EP1639128A1

EP1639128A1 - Method for detecting nucleic acids with internal control of the amplification

Info

Publication number: EP1639128A1
Application number: EP04720616A
Authority: EP
Inventors: Siegfried Burggraf
Original assignee: Labor Becker Olgemoeller & Kollegen GbR; Becker Olgemoeller & Kollegen
Current assignee: F Hoffmann La Roche AG; Roche Diagnostics GmbH
Priority date: 2003-07-02
Filing date: 2004-03-15
Publication date: 2006-03-29
Also published as: EP1493822A1; WO2005003385A1

Abstract

The invention relates to a method for the qualitative or quantitative detection of a nucleic acid in a sample by amplifying said nucleic acid and using at least one detection probe that can be reversibly bound to the amplifiable/amplified nucleic acid, enabling the nucleic acid to be detected. Said method is carried out in the sample in the presence of a control nucleic acid which is also to be amplified, and binds to the same detection probe(s) as the nucleic acid to be detected, but has differences in the nucleotide sequence in relation to the nucleic acid to be detected in the binding region of the probe(s). The differences are such that the products of the nucleic acid to be detected and the probe(s), and the control nucleic acid and the probe(s), have a different melting point, the temperature difference between the melting points being sufficiently large to be able to analytically differentiate between the two products. The invention also relates to control nucleic acids that can be used for said method, and kits consisting of such nucleic acids with at least one corresponding probe.

Description

Detection method for nucleic acids with internal amplification control

The present invention relates to a method for the qualitative or quantitative detection of a nucleic acid in a sample by means of amplification of this nucleic acid and using one or more reversibly binding detection probe (s), in which an internal nucleic acid is used which serves as a control of false negative results should serve.

The qualitative or quantitative detection of nucleic acid molecules, be it DNA or RNA, has been an important factor especially since PCR-suitable polymerases have been found

Process of laboratory medical chemistry. For this purpose, the target molecules, which are often present in only a few or even only one copy, are amplified and detected with the aid of probes which can indicate the presence of these molecules.

Such methods must be subject to certain controls which ensure that both the amplification system used would have enabled the amplification and detection of the molecule to be detected if it had been present in the sample (checking of false negative results, i.e. proof of the sample processing efficiency and exclusion of a PCR inhibition, e.g. by inhibiting the polymerase), as well as verifying that the chemicals used were functional (positive control). In many areas, especially in laboratory medicine, such controls are now also prescribed by standards (see also the quality standards in microbiological-bacteriological diagnostics MiQ 1/201: nucleic acid amplification techniques).

In the case of the controls, a distinction must be made between external controls (which take place in a separate reaction chamber) and internal controls (carried out in the sample to be examined). In the past, external control systems were mainly used to determine whether the detection test was working properly (positive and negative control). However, it is particularly advantageous to use an internal control to prove whether the amplification is inhibited. Internal controls can also be used as a quantification standard. For both qualitative and quantitative detection, the internal control system is preferably added at a very early stage in order to check all the steps involved in the detection of the nucleic acid sought.

The internal control is usually carried out by adding an artificial nucleic acid molecule to the sample in which the target nucleic acid (the target molecule) is suspected. The base sequence of this artificial molecule corresponds as far as possible to the nucleic acid region to be amplified and can therefore be amplified with the same efficiency as the actual target molecule. It is usually detected under

Use of at least one oligonucleotide detection probe that can hybridize to the target molecule and that carries a reporter group with observable properties that change depending on whether the probe is attached to or detached from the target molecule. In order to distinguish it from the target molecule, that region of the control nucleic acid molecule which binds to the detection probe (s) is modified compared to the corresponding region of the former; a probe system complementary to this modified region is used to detect the amplified control nucleic acid molecule. It is necessary that the second probe system contains a different reporter group than the first, e.g. a dye absorbing at a different wavelength so that it has a property of this

Reporter group can be detected, which differs from the property to be detected of the first reporter group.

It is desirable for the control system to be as similar as possible to the system to be detected in order to obtain the best possible comparability, in particular in the case of quantitative determinations. However, this can have the disadvantage that, owing to the high homology between the control nucleic acid and the nucleic acid to be detected, these two and their amplificates cross-hybridize with one another and thus give incorrect results. EP 1 236 805 A1 describes a method in which a control nucleic acid is used which has structures complementary to the nucleic acid to be detected. The properties of these controls, including, for example, the secondary structures, are particularly similar to those of the nucleic acids to be detected; however, the controls cannot hybridize with the molecules to be detected, so that wrong ones Results are avoided. However, the controls must be detected using specially designed probes. US Pat. No. 5,952,202 describes another detection system with internal control which is based on the detection with reporter quencher probes which are digested by the polymerase used during the amplification. The quenching group of the

Reporter group separated, and the reporter group, for example a fluorescent group, is activated. An internal control polynucleotide is simultaneously amplified with internal control primers and detected with the aid of a reporter quencher probe which differs in spectrometric properties from that of the reporter quencher probe used for the detection of the nucleic acid sought. In this system, the control nucleotide has to be amplified with specially tailored primers. One disadvantage of both systems is that the production of the additional components (in particular the probes) causes costs. Secondly, detection of a different physical property of the reporter group of this probe (s) forces the use of a second detection system, e.g. a separate channel for measuring absorption / fluorescence at a second wavelength.

The object of the present invention is to provide a simplified internal control for a nucleic acid detection method in which the nucleic acid is amplified.

The object is achieved in that the method is carried out in the presence of a likewise amplifiable control nucleic acid which binds the same detection probe (s) as the nucleic acid to be detected, but in the binding region of the

Probe (s) in comparison to the nucleic acid to be detected has deviations in the nucleotide sequence, such that the product of the control nucleic acid and probe (s) has a different melting point than the product of the nucleic acid and probe (s) to be detected. The difference between the two melting points must be so large that the two products can be identified by a melt analysis or another

Let the detection method be differentiated analytically. A value of not less than approx. 5 ° C is favorable for this. This latter value makes it possible, for example, to clearly differentiate the melting temperature of the pairing of nucleic acid and probe (s) to be detected in a melting diagram or the like Differentiate melting temperature of the pairing of control nucleic acid and probe (s). A clear detection enables the use of the control nucleic acid as an internal control. If the temperature differences are lower than those specified, however, in a number of cases it must be expected that the signals from the bound probes no longer differ so clearly that the control can be rated as reliable.

In a preferred embodiment of the invention, the melting point of the product from the control nucleic acid and probe (s) is lower, and according to the above statements is particularly preferably at least 5 ° C. lower than that of the product from the nucleic acid and probe (s) to be detected.

According to the invention, the same probe system (one or more probes) is used for the detection of the nucleic acid to be detected and the control nucleic acid. On the one hand, this saves costs; on the other hand, the probe (s) for the control nucleic acid need not be detected via a second detection system. In addition, the use of the present invention eliminates the need to use a positive control which, in turn, controls the efficiency of the controlling probe system. Because, as stated above, the internal amplification control according to the invention does not require a second probe system; and with that, its independent control is also eliminated.

The present invention is suitable for all probe systems that are not consumed during amplification, e.g. be digested.

The person skilled in the art is familiar with the measures for achieving a suitable melting temperature between control nucleic acid and probe (s); The following binding rule applies roughly for a well binding probe (approx. 20 bases): The nucleotide building blocks G and C (with three hydrogen bonds each) carry at approx. 4 ° C, the nucleotide building blocks A and T (with two hydrogen

Bridge bonds) each contribute approx. 2 ° C to the annealing temperature, provided that they are involved in the binding (Wallace / Ikutana rule Tm (° C) = 2x (# A + # T) + 4x (# G + # C), cited in Wetmur JG, 1991, Crit. Rev. Biochem. Mol. Biol. 26: 227-259)). More precise predictions are possible with the so-called "Nearest Neighbor" method based on thermodynamic calculations (Borer PN et. al., 1974, J. Mol. Biol. 86: 843-853, modified by Allawi, HT et al., 1997, Biochemistry 36: 10581-594). The introduction of a mismatch usually lowers the melting point roughly by 5 to 9 ° C. The type of mismatch has a strong influence on the change in melting point. So a GT mismatch causes only a very small one

Reduction of the melting point, a CA mismatch the strongest. The effect of the remaining pairings lies between these two, in the following order: GT <GA <TT <GG <AA <CC <CT <CA. In addition, the depression is strongly influenced by the position of the mismatch in the binding area and by the base composition in the vicinity of the mismatch. The application of the "Nearest Neighbor"

The method of probes that can be used in so-called LightCycler methods (real time method from Röche) and the influence of mismatches is described in detail in Von Ahsen, N., Schütz E. (2001), Using the nearest neighbor model for the estimation of matched and mismatched hybridization probe melting points and selection of optimal probes on the LightCycler. In: Rapid cycle real-time PCR, methods and applications,

Meuer, S., Wittwer, C, Nakagawara, K. (eds), pp. 433-56, Springer Verlag Berlin, Heidelberg, New York.

The above explanations show that in many cases it will be sufficient in the nucleotide sequence of the control nucleic acid within the binding region of the detection probe (s) to replace only one nucleotide which is present in the nucleic acid to be detected for another. However, there are preferably at least two deviations. In order to make the binding of the probe to the control nucleic acid as comparable as possible to the binding of the probe to the nucleic acid to be detected, it is advantageous if the "mismatches" are arranged as evenly as possible over the binding region.

The method can be used equally for the detection of different types of nucleic acids such as DNA or RNA. For example, it can be used for the detection of pathogen-specific nucleic acid, for example for the detection of viruses, bacteria, fungi etc. Specific examples are the detection of various hepatitis viruses, herpes, papilloma viruses, parts of the board, HIV, corona viruses (triggers of SARS ). The control nucleic acid is advantageously added to the sample to be examined as early as possible. For example, it is expedient to add them to the sample freshly taken from the patient (blood, urine or the like).

The control nucleic acid is preferably a single stranded nucleic acid, e.g. an oligonucleotide which is amplified in the presence of the substances required for the amplification of the nucleic acid to be detected, just like these. For example, and preferably, the invention can be applied to evidence that uses the common PCR amplification technique. In these cases, it is advantageous if the control nucleic acid has such a nucleotide sequence at the 3 'and at the 5' end that the amplification of the nucleic acid strand takes place in exactly the same way as that of the counter strand in the presence of the same primers which are used for the amplification of those to be detected Nucleic acid can be used. However, it should be clear that this preferred embodiment is favorable because there is no additional effort for the development of the detection conditions, including these additional components, and because the complexity of the sample is not increased thereby (additional components increase the probability of an unwanted primer, among other things) / primer pairing). However, this configuration is not a necessary criterion for the invention.

The number and choice of bases for those regions of the control nucleic acid which are neither required for primer binding nor for probe binding are of minor importance. This is particularly surprising because the prior art has repeatedly emphasized that control nucleic acids should be as similar as possible to the nucleic acids to be detected. And it's beneficial because of that

Production of shorter control nucleic acids is much cheaper. Contrary to previous assumptions, it has been found according to the invention that the named ranges of the control nucleic acid often differ greatly and in a number of cases very particularly preferably even significantly shorter, i.e. also in large parts or even up to a few (e.g. 1 to approx. 10, to approx. 20 or to approx. 30)

Nucleotides can be deleted. It is even possible that the control nucleic acid comprises only or almost exclusively the sequence regions which hybridize with and cover the probes and the primers. As a rule, it is not necessary for the control nucleic acid to be amplified in an identical number of copies, as long as on the one hand an amplification is ensured which allows the reliable detection of the control nucleic acid in the test liquid (sample) and on the other hand its amplification compared to the amplification of the nucleic acid to be detected is not preferred in such a way that the latter gives a significantly deteriorated result. The shortening or deviation described above surprisingly does not result in one or the other of the above-mentioned boundary conditions being exceeded. These conditions can also be maintained if necessary by controlling the ratio of the number of copies of the nucleic acid to be detected and the control nucleic acid.

According to the invention, the use of the control nucleic acid is suitable for both quantitative and qualitative detection of nucleic acid (s). For a qualitative detection, the amplification of the nucleic acid to be detected and that of the control nucleic acid, optionally with the same primers, can be carried out in the desired number of cycles. The detection of the nucleic acid to be detected and that of the internal control take place in a melting step after the amplification. The single-stranded or single-stranded (denatured) amplificate is cooled to a temperature at which the probe (s) bind / bind to both nucleic acids. This is followed by an increase in temperature with detection of the observable properties of the probe system, which change due to the detachment of the probe (s) from the nucleic acid strand. Due to the mismatches, the amplified product of the internal control hybridized with the probe (s) has a different, preferably lower melting point than the amplified product hybridized with the probe (s) of the nucleic acid to be detected.

In the qualitative as well as the quantitative determination, the amplification of the control nucleic acid can run "silently" in the background; it is therefore not critical that it works with the same efficiency as with the nucleic acid to be detected.

The presence of a nucleic acid to be detected in quantitative methods is usually detected at a temperature slightly below its Melting temperature with the existing probe (s). For quantitative determinations, the melting point of the product of control nucleic acid and probe (s) should be chosen so that the two components essentially do not hybridize at this temperature. Due to this measure, the control system does not interfere with the observation of the nucleic acid to be detected. If necessary, the detection temperature in the method can be chosen to be relatively close to the melting temperature of the product of the nucleic acid and probe (s) to be detected, so that the distance from the melting temperature of the probe (s) and control nucleic acid is sufficient.

This applies in particular to the so-called "real time" or real-time methods, in which the growth of the nucleic acid to be detected can be observed during the PCR, for example using the "LightCycler" system from Röche. The probe system consists of two probes, one of which emits a fluorescent dye, the other one which emits in the visible spectrum

Has dye. One of the dyes is at or near the 3 'end of the first probe, the other is at or near the 5' end of the second probe, the probes each being tailored to be bound to the nucleic acid Come to rest next to each other in such a way that the dyes are spatially close to each other. This leads to a transfer of the

Fluorescence resonance energy from the fluorescent dye to the light-absorbing dye (the reporter group), which is thereby stimulated to glow. The wavelength of this emission is detected. The annealing and melting temperature of the nucleic acid and primers or probe system to be detected are both below the working temperature of the polymerase. The nucleic acid sought is therefore amplified in work cycles which involve denaturing the double-stranded nucleic acid at a correspondingly high temperature, cooling to the annealing temperature at which the primer binds the probe system and the nucleic acid is detected, and raising the temperature to the working temperature the polymerase, in which a new counter strand is synthesized to the nucleic acid.

This principle of detection has hitherto usually been in the presence of a control system with a synthetic nucleic acid for its amplification required primers and a complementary probe system consisting of two probes, which has a dye emitting at a different wavelength and is additionally detected at this second wavelength. The present invention can be applied to this principle by instead tailoring a control nucleic acid that binds the same probes as the nucleic acid to be detected, but in which one or a few bases are exchanged such that the melting temperature of the pairing of control nucleic acid and Probes satisfies the conditions described above, according to the invention. Otherwise, however, the probe binds sterically unchanged to the control nucleic acid, so that its reporter group (s) in combination with the control nucleic acid give the same signal as is given by the combination of the probe with the nucleic acid to be detected.

The principle described above can of course also be applied to alternative probe systems in a correspondingly modified form. An example of this is that

System of the "molecular beacons". This system works with only one probe that contains a dye, e.g. contains a fluorescent dye and a quencher group. In the free state, the probe unfolds so that the quencher group is close to the dye group and suppresses its emission. In the state bound to the nucleic acid, the dye and quencher groups are located on spatially separated parts of the probe, which fluoresce accordingly. An internal control nucleic acid can also be used in this detection system, which binds the probe in the same way as the nucleic acid to be detected, but whose pairing with the probe has a lower melting point, as described above, due to "mismatches". However, the invention can also be used with all other known or still to be developed probe systems which are not used during the amplification.

The present invention can also be used very well for so-called multiplex analyzes, in which several nucleic acids are detected next to one another, for example when searching for specific pathogen variants. Since the control system according to the invention does not require a second detection system, two nucleic acids, for example, can be detected with the aid of two primer pairs and two probe systems, the two probe systems using two different reporter groups can be detected, for example by observing two different wavelengths at which these reporter groups emit light. According to the invention, two internal control nucleic acids are added to such a system, each of which is tailored with regard to one of the nucleic acids to be detected, as described above. Such a duplex analysis can be carried out with common two-channel

Measuring apparatuses are carried out since no more than the two dyes of the probe systems for the nucleic acids to be detected have to be detected. Accordingly, higher multiplex analyzes are possible with multi-channel devices.

The invention will be explained in more detail below with the aid of an example

Use of the control according to the invention based on the detection of hepatitis B virus shows.

Hepatitis B DNA is detected by amplifying a 188 base pair section from GenX. The section consists of the following base sequence

(SEQ ID NO: 1):

5'GACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCTGCCGACGACCCTTCTCG

GGGCCGCTTGGGGCTCTACGCCCTCTTTGCCGTCTGCCGTTCCAGCCAACCACG

GGGCGCACCTCTCTTTACGCGGTCTCCCCGTCTGTGCCTTCTCATCTGCCGGTCC GTGTGCACTTCGCTTCACCTCTGCA3 '

This sequence is divided into the following areas:

5'GACGTCCTTTGTTTACGTCCCGTC 3 '(1)

5'GGCGCTGAATCCTGCCGAC 3 '(2)

5'GACCCTTCTCGGGGCCGCTTGGGGCTCTACGCCCTCTTTGCCGTCTGCCGTTCC AGCCAACC3 '(2a)

5'ACGGGGCGCACCTCTCTTTACGCGG 3 '(3)

5'T 3 '(4)

5'CTCCCCGTCTGTGCCTTCTCATCTGC 3 '(5)

5'C 3 ^* (6) 5'GGTCCG 3 '(6a)

5 GTGCACTTCGCTTCACCTCTGCA 3 '(7)

1 and 7 are the primer bond areas. The area numbered 3 which hybridizes with the 3'-fluorescein-labeled probe; the area with the 5'Red640-labeled probe hybridizes with the number 5. The remaining numbers represent the remaining sequence area.

The test is carried out according to Jursch et al., Med. Microbiol. Immunol (Berl), 2002 Mar, 190 (4): 189-197, carried out:

F primer: 5 'GAC GTC CTT TGT YTA CGT CCC GTC 3' R primer: 5 'TGC AGA GGT GAA GCG AAG TGC ACA 3' anchor probe: 5 'ACG GGG CGC ACC TCT CTT TAG GCG G Fluorescein 3' detection probe: 5 'LC-Red640 CTC CCC GTC TGT GCC TTC TCA TCT GC Phosphat 3'

The nucleic acid preparation is carried out on silica membrane columns (Qiagen) from 200 μl plasma or serum. Elution of the DNA from the column in 50 μl. PCR approaches in glass capillaries from Röche (total volume 10 μl): 5 pmol from each primer and 2 pmol from each probe 1 μl LightCycler-FastStart DNA Master Hybridization Probes (contains polymerase and nucleotides) Sample DNA: 2.5 μl

Running conditions in the LightCycler (Röche): 1. DNA denaturation and activation of the polymerase: Cycles "1"; Analysis Mode "None" Segment 1: Target Temperature "95"; Incubation Time "10:00"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" 2. Precycling program: Cycles "10"; Analysis Mode "None" Segment 1: Target Temperature "95"; Incubation Time "10"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "NONE" segment 2: target temperature "64"; incubation time "8"; Temperature Transition Rate "20.0"; Secondary Target Temperature "54"; Step Size "1.0"; Step Delay "0"; Acquisition mode "NONE" Segment 3: Target Temperature "72"; Incubation Time "13"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" 3rd main cycling program: Cycles "35"; Analysis Mode "Quantification" Segment 1: Target Temperature "95"; Incubation Time "10"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "NONE" segment 2: target temperature "54"; incubation time "8"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" segment 3: Target temperature "72"; Incubation Time "13"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "SINGLE"

In the main cycling program, the so-called annealing step (segment 2: "TargetTemperature" 54 ° C) binds the two primers and internally the two probes. The green fluorescent dye of the anchor probe (fluorescein) is excited and transfers the energy to the red dye (LightCycler Red 640 ) of the detection probe (fluorescence resonance energy transfer technology) The red fluorescence emitted by the detection probe is measured at each annealing step and corresponds to the increase in the PCR product formed.

Internal control: To check the efficiency of the nucleic acid preparation and to exclude false negative results by inhibiting the PCR reaction, the following oligonucleotide with 120 bases is used as an internal control (SEQ ID NO: 2)

This sequence is divided into the following areas: 5'GACGTCCTTTGTTTACGTCCCGTC 3 '(1 ") 5'GGCGCTGAATCCTGCCGAC 3'(2")5'ACGGGGCGCACCTCTCTTTACGCGG 3 '(3 ") 5T 3 '(4 ")

5'CTACCAGTCTATGCCTTATCATCTGC 3 '(5 ") 5'C 3' (6") 5 GTGCACTTCGCTTCACCTCTGCA 3 '(7 ") The primer binding sites are labeled 1" and 7 "; they are those of

Hepatitis DNA identical. The area labeled 3 "that hybridizes with the 3'-fluorescein-labeled probe is also identical. The area that hybridizes with the 5'Red640-labeled probe (5") shows a total of four deviations from the native hepatitis DNA (four times A instead of C; G; G; C); these deviations affect the third, 6th, 11th and 18th nucleotides of this region. The regions 2 ", 4" and 6 "represent the remaining sequence region. It corresponds to regions 2, 4 and 6 in the native hepatitis DNA shown above; the region designated there by 2a and 6a is deleted in the control DNA ,

2.5 μl of the oligonucleotide (concentration 1000 copies / μl) are added to 200 μl plasma or serum. The nucleic acid preparation is then carried out as described above.

The PCR runs are carried out as described above. Only a slight modification of the LightCycler running conditions is necessary: 1. DNA denaturation and activation of the polymerase: Cycles "1"; Analysis Mode "None" Segment 1: Target Temperature "95"; Incubation Time "10:00"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" 2. Precycling program: Cycles "10"; Analysis Mode "None" Segment 1: Target Temperature "95"; Incubation Time "10"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "NONE" segment 2: target temperature "64"; incubation time "8"; Temperature Transition Rate "20.0"; Secondary Target Temperature "54"; Step Size "1.0"; Step Delay "0"; Acquisition mode "NONE" Segment 3: Target Temperature "72"; Incubation Time "13"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" 3 .. Main cycling program: Cycles "35"; Analysis Mode "Quantification" Segment 1: Target Temperature "95"; Incubation Time "10"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "NONE" segment 2: target temperature "54"; incubation time "8"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" segment 3: Target temperature "60"; Incubation Time "0"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "SINGLE" segment 4: target temperature "72"; incubation time "13"; Temperature transition rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" 4th melting program: Cycles "1"; Analysis Mode "Melting Curves" Segment 1: Target Temperature "95"; Incubation Time "5"; Temperature Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "NONE" segment 2: target temperature "40"; incubation time "20"; Temperature <Transition Rate "20.0"; Secondary Target Temperature "0"; Step Size "0.0"; Step Delay "0"; Acquisition mode "NONE" segment 3: Target temperature "85"; Incubation Time "0"; Temperature Transition Rate "0.20"; Secondary Target Temperature "0"; Step Size "0.0"; Step delay "0"; acquisition mode "CONT"

Modification: Increase of the fluorescence measurement temperature to 60 ° C. Additional melting program after the PCR amplification has been completed. The internal control is amplified in the same way as hepatitis B DNA in the PCR, but is not detected during the PCR, since the detection probe is not bound to the internal control at the measurement temperature of 60 ° C.

FIG. 1 shows the detection of the pathogen-specific amplificate during the annealing step of the PCR. At 60 ° C, both detection probes bind to the pathogen-specific target sequence. Fluorescence resonance energy is transferred from fluorescein to Red640. The red signal is detected. The figure shows the increase in the fluorescence signal in the course of the PCR amplification. Line 1 shows the amplification of 10,000 copies of HBV DNA without internal control; Line 2 shows the amplification of these copies with control. Lines 3 and 4 are negative controls (without DNA) with (line 4) and without (line 3) internal control. As line 4 shows, the probes with the internal control do not give a signal under the selected conditions (measuring temperature 60 ° C), since binding of the Red640-labeled probe is not possible due to the mismatches. The figure shows that the addition of the internal control has no influence on the result of the PCR. The approaches with and without internal control show identical results. The internal control is not detected during the PCR amplification.

The internal control can be detected by a melt analysis after the completion of the PCR. The amplificate is first denatured at 95 ° C. As a result of the final cooling to 40 ° C. (“annealing step”), the probes bind to both the pathogen-specific amplificate and to the amplificate of the internal control, even though there are four mismatches. Then there is a slow increase in temperature with continuous measurement of the fluorescence. When the detection probe melts The result of the melt analysis results in a rapid drop in the fluorescence signal .. The bond pairing of the detection probe to the internal control shows a significantly lower melting temperature than the bond to a hepatitis B PCR amplificate due to the mismatches was about 51 ° C, the melting temperature with

Hepatitis B - PCR amplificate was approximately 73 ° C. The figure shows a diagram with the first derivative of the dye detection. The curve for HBV alone (line 1) slowly increases from 45 ° C and shows only a peak at approx. 73 ° C. The curve for the HBV test together with the internal control (line 2) shows two peaks, one of which comes from the control DNA at about 51 ° C. from the melting of the probe, while the other is the result of the melting of the probe from the pathogen DNA. As expected, the negative control with internal control (line 4) shows only a single peak at approx. 51 ° C (dashed curve), and a negative control alone (line 3) remains without fluorescence.

* * * * *

Claims

Expectations:

1. A method for the qualitative or quantitative detection of a nucleic acid in a sample by means of amplification of this nucleic acid and using one or more detection probe (s) which can / can bind reversibly to the amplifiable / amplified nucleic acid and, on the basis of this property, a detection of those to be detected Nucleic acid enable, characterized in that the method is carried out in the presence of a control nucleic acid to be amplified in this sample, which binds the same detection probe (s) as the nucleic acid to be detected, but in the binding region of the probe (s) in the Comparison to the nucleic acid to be detected has at least one deviation in the nucleotide sequence, such that the products of the nucleic acid and probe (s) to be detected on the one hand and control nucleic acid and probe (s) on the other hand have a different melting point, the temperature difference between the melting points being sufficiently large is to be able to distinguish the two products from each other analytically.

2. The method according to claim 1, characterized in that the melting point of the product of the control nucleic acid and probe (s) is lower than that of the product of the nucleic acid and probe (s) to be detected.

3. The method according to claim 1 or 2, characterized in that the temperature difference of the melting points is at least 5 ° C, preferably at least 10 ° C and more preferably at least 15 ° C.

4. The method according to any one of claims 1 to 3, characterized in that the control nucleic acid is amplified with the same primers as the nucleic acid to be detected.

Method according to one of the preceding claims, characterized in that the amplification of the nucleic acid is carried out with the aid of PCR.

6. The method according to any one of the preceding claims, characterized in that two or more nucleic acids are detected in one and the same sample, the method being carried out in the presence of a control nucleic acid for each nucleic acid to be detected

7. The method according to any one of the preceding claims, characterized in that the nucleic acid to be detected is a DNA or an RNA, which in particular comes from a pathogen.

8. The method according to any one of the preceding claims, characterized in that the presence of the nucleic acid in the sample is observed using "real time" methods.

9. The method according to claim 8, characterized in that the detection of the nucleic acid is carried out at a temperature which is 2-10 ° C below the melting temperature of the product of the nucleic acid and probe (s) to be detected.

10. The method according to claim 9, characterized in that the product of control nucleic acid and probe (s) has such a low melting point that it is essentially nonexistent or nonexistent in the detection of the nucleic acid to be detected.

11. The method according to any one of the preceding claims, characterized in that only one probe is used and the detection of the nucleic acid is carried out on the basis of the melting curve of this nucleic acid in the presence of the probe, the melting point of the control nucleic acid in the presence of this probe as an internal control serves for the correct course of the amplification.

12. The method according to any one of claims 1 to 10, characterized in that two detection probes are used to detect the nucleic acid, one of which carries a reporter group and the other one changes the observable properties of the reporter group when it comes close to the reporter group.

13. The method according to claim 12, characterized in that a detection probe for detecting the nucleic acid is used which carries a reporter group and a second group which changes the observable properties of the reporter group when it comes close to the reporter group, the reporter group and the second group is only so close to one another either during the binding of the detection probe to the nucleic acid or only in the unbound state of the detection probe that the observable properties of the reporter group are changed.

14. The method according to any one of the preceding claims, characterized in that the nucleotide sequence of the control nucleic acid in the binding region of the detection probe (s) has at least 2 changes compared to the nucleic acid to be detected, of which at least one is an exchange of a G or a C. ,

15. The method according to any one of the preceding claims, characterized in that the sequence region of the control nucleic acid, which can neither hybridize with a detection probe nor possibly with a primer, is shortened.

16. The method according to any one of the preceding claims, characterized in that the sequence of the control nucleic acid in the region that can hybridize neither with a detection probe or possibly with a primer, has significant deviations from the nucleic acid to be detected.

17. Use of a control nucleic acid in one of the methods according to claim 1 to 16, characterized in that its nucleotide sequence in the binding region of the detection probe (s) has at least one change compared to the nucleic acid to be detected.

18. Use of a control nucleic acid in one of the methods according to claim 1 to 16, characterized in that its nucleotide sequence in the binding region of the detection probe (s) has at least two, preferably three to five changes compared to the nucleic acid to be detected.

19. Use of a control nucleic acid in one of the methods according to claims 1 to 16, characterized in that its sequence region, which can neither hybridize with a detection probe nor possibly with a primer, is shortened.

20. Use of a control nucleic acid in one of the methods according to claims 1 to 16, characterized in that its sequence in the region which cannot hybridize either with a detection probe or possibly with a primer has significant deviations from the nucleic acid to be detected ,

21. Use of a control nucleic acid according to claim 18, characterized in that the changes are distributed approximately uniformly over the binding region of the detection probe (s).

22. Kit comprising a nucleic acid, which is particularly suitable as a control nucleic acid for the negative control in a method for detecting a nucleic acid sought, and a probe system with one or more oligonucleotide-containing probes, the probe (s) of which can bind to the control nucleic acid / and and which has a reporter group with an observable property which changes depending on whether the probe (s) of the system is / are bound to this nucleic acid or not, characterized in that the nucleic acid particularly suitable as a control nucleic acid in at least one of those regions in which the oligonucleotide (s) of the probe (s) of the probe system can bind has at least one misbinding site with respect to the oligonucleotide of the probe (s) binding in this region.

23. Kit according to claim 22, wherein the nucleic acid particularly suitable as a control nucleic acid has at least 2, preferably three to five, misbinding sites.

4. Kit according to one of claims 22 or 23, wherein the defects of the nucleic acid, which is particularly suitable as a control nucleic acid, are arranged substantially uniformly distributed over the binding region of the oligonucleotide of the probe (s).