WO1997021832A1 - Process for determination of low concentration of nucleic acid molecules - Google Patents

Process for determination of low concentration of nucleic acid molecules Download PDF

Info

Publication number
WO1997021832A1
WO1997021832A1 PCT/EP1996/005472 EP9605472W WO9721832A1 WO 1997021832 A1 WO1997021832 A1 WO 1997021832A1 EP 9605472 W EP9605472 W EP 9605472W WO 9721832 A1 WO9721832 A1 WO 9721832A1
Authority
WO
WIPO (PCT)
Prior art keywords
amplification
concentration
primers
primer
nucleic acid
Prior art date
Application number
PCT/EP1996/005472
Other languages
German (de)
French (fr)
Inventor
Manfred Eigen
Nils Walter
Petra Schwille
Frank OEHLENSCHLÄGER
Original Assignee
Evotec Biosystems Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE19545965A external-priority patent/DE19545965A1/en
Priority claimed from DE19634226A external-priority patent/DE19634226A1/en
Application filed by Evotec Biosystems Gmbh filed Critical Evotec Biosystems Gmbh
Publication of WO1997021832A1 publication Critical patent/WO1997021832A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Definitions

  • the present invention relates to a method for determining nucleic acid molecules in low concentration in samples to be examined by means of amplification reactions, in particular using polymerases and / or ligases, and unlabeled and detectable primers.
  • the 5'-nuclease assay (the so-called TaqMan polymerase chain reaction; Livak et al. In PCR Methods and Applications 4 (1995), 357-361) is similar to the method according to the invention.
  • the basis of this method is an oligonucleotide marked at the 5 ' end with a reporter molecule (fluorescein) and at the 3' end with a quencher molecule (rhodamine), which is also protected at the 3 'end by a phosphate residue against an enzymatic chain extension .
  • the probe In the course of the PCR reaction, the probe
  • Serious disadvantages of this method are the very complex and cost-intensive preparation of the double-labeled and end-group protected oligonucleotides, the involvement of enzymatic hydrolysis and the influence of media effects on the fluorescence yield, ie the quantifiability
  • the problem on which the invention is based is to provide a universally usable, easy-to-use and inexpensive method for the qualitative and quantitative detection of very small amounts of nucleic acid.
  • diagnosis of infectious pathogens it is desirable that the entire process can be carried out in compartments which are closed after the addition of the sample and do not have to be opened again in the course of the process
  • the method according to the invention is used for the determination of nuclear acid molecules in low concentrations in samples to be examined.
  • Amplification reactions are used. These use in particular polymerases and / or ligases. Unlabeled amplification primers are used. Detectable, in particular labeled primers, so-called detection primers, are also used. The detectable primers hybridize to the nucleic acid and / or are incorporated into the amplified nucleic acid by the amplification reaction, the concentration of the free detection primers decreasing. The decrease in this concentration and / or the increase in the concentration of the amplification products is measured and used as a measure of the presence of the nucleic acid molecule to be determined.
  • the detectable primers are preferably labeled with fluorescent groups.
  • primer-dependent reactions such as the polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), isothermal 3SR (soap-sustained sequence replication), strand displacement amplification (SDA) and / or nucleic acid sequence-based amplification come as amplification reactions (NASBA) in consideration.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase PCR
  • SDA strand displacement amplification
  • LCR ligase chain reaction
  • the so-called gap LCR U. Landegren, Current Opinion in Biotechnology 1996, 7: 95-97
  • gap LCR U. Landegren, Current Opinion in Biotechnology 1996, 7: 95-97
  • fluorescence correlation spectroscopy FCS
  • FCS fluorescence correlation spectroscopy
  • Decrease in the concentration of the detection primer can no longer be determined or has reached a previously definable, expedient value.
  • differently labeled detection primers can be used.
  • the detection and evaluation can preferably be carried out using the FCS in the form of the cross correlation disclosed in WO 94/16313.
  • fluorescence-labeled primers it can be preferred in further embodiments of the method according to the invention to use a variant of fluorescence correlation spectroscopy using principles of near-field microscopy (WO 96/13744) or on analysis methods according to European patent application 96 116 373.0 to fall back on.
  • the latter application describes a method for analyzing samples by repeatedly measuring the number of photons per defined time interval of light which is emitted, scattered and / or reflected by the particles in the sample, and determining the distribution of the number of photons in the respective Time intervals.
  • the method is characterized in that the distribution of the specific brightness of the particles is determined from the distribution of the number of photons.
  • a polymerase without 5'-3'-exonuclease activity is preferably used. Otherwise, as in the Livak et al. reduced.
  • the polymerases are commercially available.
  • the detection primer it is also possible to dispense with an expansion of the detection primer during the method. This can be done, for example, by using a dideoxynucleotide at the 3 'end of the detection primer or by using labeled PNA as detection primers.
  • the increase in diffusion times is also in accordance with the invention of the detection primer by hybridization to the amplified nucleic acid sufficient for reproducible FCS detection.
  • the measure according to the invention to measure the decrease in the concentration of the detectable, in particular labeled, primers and to use it as a measure of the presence of the nucleic acid molecule to be determined, is based on the fact that at the beginning of the reaction the detection primer is in a state of high mobility while at the end of the reaction, the hybridization or the amplification reaction (incorporation into an amplification product) largely or completely converts it to a state of low mobility.
  • This change in mobility can be measured in a particularly suitable manner by the method of fluorescence correlation spectroscopy, it being possible for the sample to remain in the closed compartment.
  • the concentration of the amplification primer can be 5 to 200 times the concentration of the detection primer.
  • the number of fluorescent molecules, the relative ratio of fluorescence-labeled molecules of different sizes and their diffusion mobilities can be determined quickly and reliably from the correlation curve, which is preferably determined using fluorescence correlation spectroscopy.
  • the method according to the invention in the form of an end point titration and / or hybridization detects, by appropriate choice and concentration of the fluorescence-labeled primers, only the presence of the sought sequence, which has a sequence complementary to the detection primer.
  • the method is insensitive to unspecific amplifications.
  • a high concentration of amplification primer is desirable in order to ensure reliable amplification even of small amounts of nucleic acids to be detected.
  • the concentration of the amplification primer can be 0.5 ⁇ M
  • the detection primer is preferably present in a concentration of 1 to 10 nM.
  • sample carriers such as e.g. Polycarbonate films, which are characterized by the following advantages. they are
  • Foils with 96 or 384 compartments are preferred use.
  • the foils are filled with test liquid and sample liquid in approximately 5 to 20 ⁇ l portions and sealed.
  • the solutions are fixed as small drops by capillary forces in the upper part of the film, in which the compartment has a wall thickness of 10 to 20 ⁇ m required for the FCS method.
  • the foils can be fitted into a thermostatted frame. They are wetted with a thin layer of immersion liquid for the objective to be used in the FCS detection method.
  • the compartments can be used in particular for series of dilutions, screenings or also for different types of tests.
  • the typical measuring time for a film with 96 compartments is in the range of a few minutes up to a maximum of half an hour.
  • the quantitative determination of the nucleic acid to be detected can be carried out by using at least two amplification batches of the sample.
  • a dilution series of the first amplification batch is preferably produced.
  • the relative concentrations of the second and possibly further amplification batches result from the dilution ratio.
  • the detection concentration is known, ie the detection threshold of the detection system used, or another suitable threshold value, it is possible to quantify the nucleic acid to be detected by determining the reaction times or the number of amplification cycles until the threshold value is reached in the respective amplification approaches.
  • the threshold value should preferably be within the logarithmic amplification phase can be achieved in order to achieve a high level of quantification accuracy.
  • differences m in the amplification efficiency for example in the special structure of the nucleic acid to be detected, have an effect can be based, not on the measurement result
  • the method according to the invention is also suitable for the detection of point mutations, translocations, deletions or haplotype differentiation. It can also be used in the sense of a multiplex PCR.
  • inherited metabolic diseases such as, for example, the autosomal recessive cystic fibrosis
  • heterozygous patients can be distinguished from homozygous patients by using two detection primers with different dye markers.
  • detection of DNA and RNA genomes the latter e.g. by using an RT-PCR or 3SR reaction
  • FIG. 1 relates to a schematic representation of the method according to the invention using PCR.
  • FIG. 2 describes the shift in the correlation curve G (t) in the presence of the specified initial template quantities.
  • FIG. 4a shows the autocorrelation functions G (t) obtained in exemplary embodiment 1 by FCS analysis.
  • FIG. 4b shows the application of this data in a linearized form.
  • FIG. 5 illustrates the change in the relative diffusion times of the detection primer in the course of the amplification reaction according to exemplary embodiment 1.
  • FIGS. 6a and b illustrate the detection limit of the method according to the invention when applied to exemplary embodiment 1
  • FIG. 7 shows the use of a detection primer according to the invention during NASBA in exemplary embodiment 2.
  • FIG. 8 shows the location of the primers used within the gag region of the HIV-1 genome.
  • FIG. 9 shows a typical time course of the shift of the correlation curves due to the hybridization and extension of the detection primer in exemplary embodiment 2.
  • FIG. 10 illustrates the kinetics of the hybridization / extension reaction of the detection primer in exemplary embodiment 2.
  • FIG. 1 schematically describes the method according to the invention using PCR.
  • the amplification primers p1 and p2 used in the PCR are shown as arrows, the detection primer p3 is coupled to a fluorescent dye (circle).
  • the left part of the figure shows amplified artifacts in the absence of the template. This can e.g. are primer dimers of the highly concentrated primers pl and p2.
  • the right side of the figure shows p2 in the presence of the template. Only when the amplificates are present in a sufficiently high concentration does the amplificate act as a template for the low-concentration, fluorescence-labeled detection primer. The change in mobility of the primer can be clearly recognized by shifting the correlation curve.
  • FIGS. 2 and 3 Results obtained with the method according to the invention on Mycobacterium tuberculosis are shown in FIGS. 2 and 3.
  • the detection of this pathogenic pathogen previously took about 3 to 4 weeks due to the complex cell culture procedures. With the aid of the method according to the invention, this detection time can be greatly reduced.
  • FIG. 2 shows the shift in the correlation curve G (t) in the presence of the specified initial template quantities.
  • the number of template molecules specified in each case was initially presented at the start of the reaction with 50 .mu.l of reaction mixture, by the method according to the invention PCR cycles amplified and analyzed using the FCS method.
  • a template characteristic of the tuberculosis pathogen Mycobacterium tuberculosis was used.
  • the detection limit here was 100 template molecules per batch. The method is therefore sensitive enough to be used in any molecular diagnostic application.
  • FIG. 4a shows the auto-correlation functions G (t) obtained by FCS analysis with increasing number of PCR cycles of the target sequence IS6110 specific for Mycobacterium tuberculosis and M. bovis (exemplary embodiment 1).
  • the PCR amplification of a 106 bp segment starting from IO 5 strands of the genomic Mycobacterium tuberculosis DNA against a background of 2.5 ⁇ g unspecific human placenta DNA in 50 ⁇ l reaction volume, was carried out using the primer pair S1 / S2 as amplification primer and 10 nM TMR -labelled probe PRI as a detection primer (Table 1).
  • the detection primer binds between the amplification primers with the same orientation as the amplification primer.
  • FIG. 5 illustrates the change in the relative diffusion times of the detection primer in the course of the amplification reaction.
  • the diffusion times of the detection primer clearly reflect the PCR amplification chemistry with an initial lag phase before reaching the detection limit value, rapid exponential enrichment of the amplification products and a plateau phase. This plateau shows a saturation which is comparable to the end point of a titration.
  • the decreasing number of the molecules of the detection primer, which are in the laser focus on average, with increasing number of temperature cycles is presumably due to adsorption effects on the walls of the reaction vessels (secondary image in FIG. 5).
  • an apparent increase in emitted photons per molecule and second can be observed (secondary image in FIG. 5).
  • FIGS. 6a and 6b illustrate the detection limit of the method according to the invention when applied to exemplary embodiment 1.
  • the PCR amplification reactions were carried out using different amplification and detection primers (Table 1). Against a background of 2.5 ⁇ g unspecific human placenta DNA in a 50 ⁇ l reaction volume, a constant number of PCR cycles (either 36 or 40 cycles) were carried out, each with different starting concentrations on target genomes.
  • the detection limit is below 100 Mycobacterium tuberculosis genomes.
  • FIG. 7 shows the use of a detection primer according to the invention during the amplification reaction according to exemplary embodiment 2.
  • the method described by van Genem et al. (PCR Methods and applications 4, 177-184, 1995) NASBA method described was varied according to the invention as follows:
  • a detection primer (gagl) was added to the reaction mixture. This hybridized to a specific sequence of the 145 b RNA strand. Reverse transcription using AMV-RT produced a ds DNA molecule with 130 bp, while the amplification product produced using primers 1 and 2 had 167 bp.
  • the amplified RNA is detected and quantified using hybridization techniques such as ELGA (enzyme-imbed gel assay) and ECL (electrochemical luminescence). These techniques require the opening of the sample carrier with the risk of carryover contamination
  • FCS electrochemical luminescence
  • FIG. 8 shows the location of the primers used within the gag region of the HIV-1 genome.
  • FIG. 9 shows a typical time course of the shift in the correlation curves ( ⁇ 10 mm, 20 mm,
  • Example 1 the hybridized (gagl-145 b RNA) detection primer and the 130 bp components produced by extension were treated as one component due to their approximately equal diffusion times.
  • the correlation curves were filled using the equation known to the person skilled in the art to describe the autocorrelation function of a two-component system.
  • FIG. 10 illustrates the kinetics of the hybridization / extension reaction of the detection primer.
  • the meaning of the symbols used is as follows:
  • the value of the initial concentration of HIV-1 RNA molecules allows a distinction to be made between positive and false positive samples.
  • the direct quantitative analysis of the initial concentration of RNA molecules in a sample can be determined as follows.
  • the logarithm of the molecules contained in the sample represents a linear function of the incubation time necessary to achieve a certain degree of primer binding (secondary picture in FIG. 10).
  • the initial concentration of RNA molecules can thus be determined using a dilution series.
  • the combined approach of hybridization and extension of the detection primer was shown.
  • the data obtained using the FCS were confirmed by sequencing.
  • no non-specific binding of the detection primer could be determined, so that this makes it possible to dispense with an extension of the detection primer during the analyzes.
  • This can be done, for example, by using a dideoxynucleotide at the 3 'end of the detection primer or by using PNA primers.
  • the increase in the diffusion times of the detection primer by hybridization to the amplified RNA is also sufficient for reproducible FCS detection.
  • the polymerase chain reaction is used as the amplification method with a detection technique based on the fluorescence correlation spectroscopy (FCS) method using a detection primer labeled with fluorescent groups, e.g. an N, N, N ', N' -tetramethyl-5-carboxyrhodamm (TMR) -labeled detection primer.
  • FCS fluorescence correlation spectroscopy
  • the detection primers are incorporated into the amplified nucleic acid by the amplification reaction, the installation being accompanied by an increase in the diffusion time of the detection primer, which can be observed by means of FCS.
  • the oligodeoxynucleotides (Table 1) were purchased in HPLC-rem quality from NAPS (D-Göttingen).
  • the probes PRI, PR3, HS1 and HS3 were labeled with the 5-isomer of TMR at their 5 'end via an aminohexyl linker.
  • DOS [(10 x N / 86) x A 554 )] / [A 260 - (0.49 x A 554 )], where N is the number of bases m of the sample.
  • dNTPs 2'-Deoxynucleos ⁇ d-5'-triphosphates
  • Pharmacia the 5 ' -3 ' exonuclease-free fragment of the Thermus aquaticus DNA polymerase from Perkm-Elmer.
  • the human placenta DNA was purchased from Sigma. Genomic DNA from Mycobacterium tuberculosis was also used.
  • the amplification reaction was carried out either with 50 ⁇ l or 25 ⁇ l samples 10 mM Tris-HCl (pH 8.3), 50 mM KCI, 2.5 mM MgCl 2 , 0.1 mg / ml gelatin, in each case 0 5 ⁇ M of the two amplification primers, in each case 200 ⁇ M of the four dNTPs, 50 ng / ⁇ l human placenta DNA as excess unspecific DNA, 1 to 20 nM of the TMR-labeled detection primer, and 0 05 U / ⁇ l of the 5'-3'-exonuclease-free fragment of the Thermus aquaticus DNA polymerase.
  • the amount of genomic Mycobacterium tuber cul osi s DNA (in the range from 0 to IO 6 molecules each 50 ⁇ l of the reaction mixture) is as indicated.
  • the PCR reaction took place in reaction tubes (multiple safecap tubes) from Sarstedt.
  • the following temperature program was used in a TRIO thermoblock cycler from Biometra (Gottingen): denaturation at 94 ° C for 30 s, polymer detection at 56 ° C (primer pair S1 / S2) or 60 ° C (primer pair B1B / B2B) for 20 s, and elongation at 72 ° C for 30 s, each for the specified number of cycles.
  • FCS measurement and determination of relative diffusion times Following the PCR, 10 ⁇ l of the reaction mixture were examined by means of FCS using a 63x1.2 water immersion objective. A detailed description of the FCS can be found in the article by Eigen and Rigler (Proc. Natl. Acad Sei USA 91.5740-5747). The autocorrelation function for a mixture of particles with fast and slow translation diffusion times is described by Thompson (Topics in Fluorescence Spectroscopy, Vol. I, Lakowicsz, JR (ed), Plenum 1991).
  • the isothermal amplification method NASBA nucleic acid sequence-based amplification
  • FCS detection method
  • the method according to the invention is used in this exemplary embodiment to detect a simulated HIV infection.
  • the TMR-labeled detection primer gagl was synthesized by NAPS (Göttingen).
  • the sample carriers with 96 reaction compartments were made in the precision engineering workshop of the Max Planck Institute for Biophysical Chemistry; each compartment has a volume of 40 ⁇ l and a wall thickness of 40 ⁇ m.
  • the plasma used was hepatitis B and C, CMV and HIV-1 negative.
  • nucleic acids Isolation of nucleic acids from the plasma: The nucleic acids were bound to activated silica (50 ⁇ l suspension, 1 mg / ml), which was added to the lysis mixture. After a washing and drying step, the nucleic acids were eluted with 50 ⁇ l elution buffer (1 mM Tris pH 8.5) and stored at -70 ° C.
  • NASBA amplification of the isolated HIV-1 RNA Typical reactions were carried out in a 20 ⁇ l reaction volume containing 40 mM Tris pH 8.5, 12 mM MgCl 2 , 42 mM KCI, 5 mM DTT, 15% v / v DMSO, in each case ImM dNTP, each 2mM NTP, 0.1 U RNase H, 0.1 ⁇ g / ⁇ l BSA, 40 U T7 RNA polymerase, 8 U AMV reverse transcriptase, 0.2 ⁇ M primer 1,2 and 5 ⁇ l isolated nucleic acid (containing 100, 200, 500, 2000 HIV-1 RNA molecules).
  • Primer 2 5'- AGT GGG GGG ACA TCA AGC AGC CAT GCA AA - 3 '(sense NT 1358-1386 from HXB2).
  • gagl 5'- TMR-GAG ACC ATC AAT GAG GAA GCT GCA GAA TGG GAT - 3 '(sense NT 1395-1427 from HXB2)
  • Oligodeoxynucleotide sequence (5 ' ⁇ 3') "Localis. T, m on (° C) c IS6110 h

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a process for determination of a low concentration of nucleic acid molecules in samples to be examined, by amplification reactions using unmarked primers as amplification primers and detectable, in particular marked primers, as detection primers and in particular using polymerases and/or ligases. The detectable primers hybridise to the amplification products. The drop in the concentration of detectable, in particular, marked primers, and/or the rise in the concentration of amplification products is measured and is used to measure the presence of the nucleic acid molecules to be determined.

Description

Verfahren zur Bestimmung von Nukleinsäure- mαlekülen in niedriger Konzentration Method for the determination of nucleic acid molecules in low concentration
Gegenstand der vorliegenden Erfindung ist ein Verfahren zur Bestimmung von Nukleinsäuremolekülen in niedriger Kon¬ zentration in zu untersuchenden Proben mittels Amplifi- kationsreaktionen, insbesondere unter Verwendung von Poly- merasen und/oder Ligasen, sowie unmarkierten und detektier¬ baren Primern.The present invention relates to a method for determining nucleic acid molecules in low concentration in samples to be examined by means of amplification reactions, in particular using polymerases and / or ligases, and unlabeled and detectable primers.
Ein derartiges Amplifikationsverfahren ist für die molekulare Diagnostik, insbesondere für die Pathogendiagnostik, von großer Bedeutung. Eine Vielzahl von Techniken ist beschrieben worden, die geringe Mengen an spezifischer Nukleinsäure nachzuweisen vermögen. Dem erfindungsgemäßen Verfahren ähnlich ist der 5'-Nuklease-Assay (die sogenannte TaqMan- Polymerase-Chain-Reaction; Livak et al . in PCR Methods and Applications 4 (1995) , 357 - 361) . Die Basis dieser Methode ist ein am 5'-Ende mit einem Reportermolekül (Fluorescein) und am 3 '-Ende mit einem Quenchermolekül (Rhodamin) mar¬ kiertes Oligonukleotid, welches am 3 '-Ende zudem über einen Phosphatrest gegen eine enzymatische Kettenverlängerung geschützt ist. Im Verlauf der PCR-Reaktion wird die SondeSuch an amplification method is of great importance for molecular diagnostics, in particular for pathogen diagnostics. A variety of techniques have been described that can detect small amounts of specific nucleic acid. The 5'-nuclease assay (the so-called TaqMan polymerase chain reaction; Livak et al. In PCR Methods and Applications 4 (1995), 357-361) is similar to the method according to the invention. The basis of this method is an oligonucleotide marked at the 5 ' end with a reporter molecule (fluorescein) and at the 3' end with a quencher molecule (rhodamine), which is also protected at the 3 'end by a phosphate residue against an enzymatic chain extension . In the course of the PCR reaction, the probe
ORIGINALUNTERLAGEN von der 5 '-3 '-Exonukleaseaktivitat der verwendeten Taq- Polymerase erkannt, wenn sie downstream zu einer pπmer- gestarteten Polymerase-Reaktion an die zu ampliflzierende Matrize hybridisiert hat. In der Folge sorgt die 5'-3'- Exonukleaseaktivitat für die Hydrolyse deε 5'-Endes der Sonde, wodurch die Fluoreszenz-Emission des Fluorescem- Reporters ansteigt, da sie nicht langer durch die Nachbar¬ schaft des Rhodamins geloscht wird. Gravierende Nachteile dieses Verfahrens sind die sehr aufwendige und kosten¬ intensive Praparation der doppeltmarkierten und endgruppen- geschutzten Oligonukleotide, die Beteiligung der enzymatischen Hydrolyse und der Einfluß von Medieneffekten auf die Fluoreszenzausbeute, d.h die QuantiflzierbarkeitORIGINAL DOCUMENTS recognized by the 5 '-3' exonuclease activity of the Taq polymerase used if it has hybridized downstream to a polymer-started polymerase reaction to the template to be amplified. As a result, the 5'-3'-exonuclease activity ensures the hydrolysis of the 5 'end of the probe, as a result of which the fluorescence emission of the fluorescent reporter increases since it is no longer deleted by the neighborhood of the rhodamine. Serious disadvantages of this method are the very complex and cost-intensive preparation of the double-labeled and end-group protected oligonucleotides, the involvement of enzymatic hydrolysis and the influence of media effects on the fluorescence yield, ie the quantifiability
Das der Erfindung zugrundeliegende Problem besteht darin, em universell einsetzbares, leicht handhabbares und preis¬ wertes Verfahren zur qualitativen und quantitativen Detektion von kleinsten Mengen an Nukleinsäure bereitzustellen. Es ist hierbei insbesondere im Hinblick auf die Diagnostik in¬ fektiöser Pathogene wünschenswert, daß das gesamte Verfahren in Kompartimenten ablaufen kann, die nach der Zugabe der Probe verschlossen werden und im Laufe des Verfahrens nicht wieder geöffnet werden müssenThe problem on which the invention is based is to provide a universally usable, easy-to-use and inexpensive method for the qualitative and quantitative detection of very small amounts of nucleic acid. With regard to the diagnosis of infectious pathogens in particular, it is desirable that the entire process can be carried out in compartments which are closed after the addition of the sample and do not have to be opened again in the course of the process
Die der Erfindung zugrundeliegende Aufgabe wird gelost durch em Verfahren mit den Merkmalen des Patentanspruchs 1 Die Unteranspruche 2 bis 10 betreffen bevorzugte Ausführungs¬ formen des erfindungsgemaßen Verfahrens.The object on which the invention is based is achieved by a method having the features of patent claim 1. Subclaims 2 to 10 relate to preferred embodiments of the method according to the invention.
Das erfindungsgemäße Verfahren dient zur Bestimmung von Nuklemsauremolekύlen m niedrigen Konzentrationen m zu untersuchenden Proben. Dabei werden Amplifikationsreaktionen eingesetzt . Diese verwenden insbesondere Polymerasen und/oder Ligasen Es werden unmarkierte Amplifikationsprimer einge¬ setzt Zudem werden detektierbare, insbesondere markierte Primer, sogenannte Detektionspπmer, verwendet Die detektierbaren Primer hybridisieren an die Nukleinsäure und/oder werden durch die Amplifikationsreaktion in die amplifizierte Nukleinsäure eingebaut, wobei die Konzentration der freien Detektionsprimer abnimmt. Die Abnahme dieser Konzentration und/oder die Zunahme der Konzentration der Amplifikationsprodukte wird gemessen und als Maß für das Vorhandensein des zu bestimmenden Nukleinsäuremoleküls herangezogen.The method according to the invention is used for the determination of nuclear acid molecules in low concentrations in samples to be examined. Amplification reactions are used. These use in particular polymerases and / or ligases. Unlabeled amplification primers are used. Detectable, in particular labeled primers, so-called detection primers, are also used. The detectable primers hybridize to the nucleic acid and / or are incorporated into the amplified nucleic acid by the amplification reaction, the concentration of the free detection primers decreasing. The decrease in this concentration and / or the increase in the concentration of the amplification products is measured and used as a measure of the presence of the nucleic acid molecule to be determined.
Vorzugsweise sind die detektierbaren Primer mit fluores¬ zierenden Gruppen markiert. Als Amplifikationsreaktionen kommen insbesondere Primer abhängige Reaktionen wie die Polymerasekettenreaktion (PCR) , Reverse Transkriptase PCR (RT-PCR) , isothermale 3SR (seif-sustained sequence repli¬ cation) , Strand Displacement Amplification (SDA) und/oder Nucleic Acid Sequence-based Amplification (NASBA) in Be¬ tracht. Desweiteren kann es bevorzugt sein, die Methode der Ligase Chain Reaction (LCR) einzusetzen. Ebenso kann die sogenannte gap-LCR (U. Landegren, Current Opinion in Biotechnology 1996, 7: 95 - 97) Verwendung finden.The detectable primers are preferably labeled with fluorescent groups. In particular, primer-dependent reactions such as the polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), isothermal 3SR (soap-sustained sequence replication), strand displacement amplification (SDA) and / or nucleic acid sequence-based amplification come as amplification reactions (NASBA) in consideration. Furthermore, it may be preferred to use the ligase chain reaction (LCR) method. The so-called gap LCR (U. Landegren, Current Opinion in Biotechnology 1996, 7: 95-97) can also be used.
Wird die Abnahme der Konzentration der detektierbaren, insbesondere markierten Primer, und/oder die Zunahme der Konzentration der Amplifikationsprodukte, wie erfindungsgemäß bevorzugt wird, mittels fluoreszenzmarkierter Primer ge¬ messen, ist die Fluoreszenzkorrelationsspektroskopie (FCS) einsetzbar, um ein Maß für das Vorhandensein des zu be¬ stimmenden Nukleinsäuremoleküls zu ermitteln. Bei dieser Ausführungsform des erfindungsgemäßen Verfahrens werden Amplifikationstechniken mit der Detektionsmethode Fluoreszenzkorrelationsspektroskopie gekoppelt. Das er¬ findungsgemäße Verfahren erlaubt somit die Realisierung einer Endpunkttitration, wobei die nachzuweisende Sequenz während der Reaktion stufenweise oder kontinuierlich amplifiziert wird. Der Endpunkt dieser als Endpunkttitration auffaßbaren Reaktion ist erreicht, wenn der erfindungsgemäß zu ver¬ wendende Detektionsprimer durch Inkorporation in die neue synthetisierte Nukleinsäure verbraucht ist, bzw. eine weitere 97/21832 PO7EP96/05472If the decrease in the concentration of the detectable, in particular labeled primers and / or the increase in the concentration of the amplification products, as is preferred according to the invention, is measured by means of fluorescence-labeled primers, fluorescence correlation spectroscopy (FCS) can be used to measure the presence of the to determine the determining nucleic acid molecule. In this embodiment of the method according to the invention, amplification techniques are coupled with the detection method fluorescence correlation spectroscopy. The method according to the invention thus allows an end point titration to be carried out, the sequence to be detected being amplified stepwise or continuously during the reaction. The end point of this reaction, which can be regarded as an end point titration, is reached when the detection primer to be used according to the invention has been used up by incorporation into the new synthesized nucleic acid, or another one 97/21832 PO7EP96 / 05472
- 4 -- 4 -
Abnahme der Konzentration des Detektionsprimers nicht mehr feststellbar ist oder einen vorher festlegbaren, zweckmäßigen Wert erreicht hat.Decrease in the concentration of the detection primer can no longer be determined or has reached a previously definable, expedient value.
In einer weiteren Ausführungsform des erfindungsgemäßen Verfahrens können unterschiedlich markierte Detektionsprimer verwendet werden. Die Detektion und Auswertung kann vorzugs¬ weise mittels der FCS m Form der m der WO 94/16313 offen¬ barten Kreuzkorrelation durchgeführt werden.In a further embodiment of the method according to the invention, differently labeled detection primers can be used. The detection and evaluation can preferably be carried out using the FCS in the form of the cross correlation disclosed in WO 94/16313.
Bei der Verwendung fluoreszenzmarkierter Primer kann es in weiteren Ausführungsformen des erfindungsgemäßen Verfahrens bevorzugt sein, eine Variante der Fluoreszenzkorrelations- spektroskopie unter Ausnutzung von Prinzipien der Nahfeld- mikroskopie (WO 96/13744) zu verwenden oder auf Analyse¬ methoden gemäß der europäischen Patentanmeldung 96 116 373.0 zurückzugreifen. Die letztgenannte Anmeldung beschreibt eine Methode zur Analyse von Proben durch wiederholte Messung der Anzahl von Photonen pro definiertem Zeitintervall von Licht, welches von den Partikeln in der Probe emittiert, gestreut und/oder reflektiert wird, und Bestimmung der Verteilung der Anzahl von Photonen in den jeweiligen Zeitintervallen. Die Methode ist dadurch gekennzeichnet, daß die Verteilung der spezifischen Helligkeiten der Partikel aus der Verteilung der Anzahl von Photonen bestimmt wird.When using fluorescence-labeled primers, it can be preferred in further embodiments of the method according to the invention to use a variant of fluorescence correlation spectroscopy using principles of near-field microscopy (WO 96/13744) or on analysis methods according to European patent application 96 116 373.0 to fall back on. The latter application describes a method for analyzing samples by repeatedly measuring the number of photons per defined time interval of light which is emitted, scattered and / or reflected by the particles in the sample, and determining the distribution of the number of photons in the respective Time intervals. The method is characterized in that the distribution of the specific brightness of the particles is determined from the distribution of the number of photons.
Vorzugsweise wird erfindungsgemäß eine Polymerase ohne 5'-3'- Exonukleaseaktivität verwendet. Anderenfalls würde die Sonde wie im Ansatz gemäß Livak et al . abgebaut. Die Polymerasen sind kommerziell erhältlich.According to the invention, a polymerase without 5'-3'-exonuclease activity is preferably used. Otherwise, as in the Livak et al. reduced. The polymerases are commercially available.
Erfindungsgemäß ist es jedoch auch möglich, auf eine Ex¬ tension des Detektionsprimers während des Verfahrens zu verzichten. Dies kann z.B. durch Verwendung eines Didesoxy- nukleotides am 3 ' -Ende des Detektionsprimers oder durch die Verwendung von markierten PNA als Detektionsprimern erfolgen. Erfindungsgemaß ist auch der Anstieg der Diffusionszeiten des Detektionsprimers durch Hybridisierung an die amplifi- zierte Nukleinsäure ausreichend für eine reproduzierbare FCS- Detektion.According to the invention, however, it is also possible to dispense with an expansion of the detection primer during the method. This can be done, for example, by using a dideoxynucleotide at the 3 'end of the detection primer or by using labeled PNA as detection primers. The increase in diffusion times is also in accordance with the invention of the detection primer by hybridization to the amplified nucleic acid sufficient for reproducible FCS detection.
Die erfindungsgemäße Maßnahme, die Abnahme der Konzentration der detektierbaren, insbesondere markierten Primer, zu messen und als Maß für das Vorhandensein des zu bestimmenden Nukleinsäuremoleküls heranzuziehen, beruht auf der Tatsache, daß zu Beginn der Reaktion der Detektionsprimer sich in einem Zustand hoher Mobilität befindet, während er am Ende der Reaktion durch die Hybridisierung bzw. durch die Amplifika- tionsreaktion (Einbau in ein Amplifikationsprodukt) weit¬ gehend bis vollständig in einen Zustand niedriger Mobilität überführt wird. Diese Mobilitätsänderung läßt sich in be¬ sonders geeigneter Weise durch die Methode der Fluoreszenz- korrelationsspektroskopie messen, wobei die Probe im ge¬ schlossenen Kompartiment verbleiben kann. Es kann erfindungs- gemäß bevorzugt sein, die Konzentration des Detektionsprimers als gering im Verhältnis zur Konzentration des Amplifi- kationsprimers zu wählen. Insbesondere kann die Konzentration des Amplifikationsprimers das 5- bis 200-fache der Kon¬ zentration des Detektionsprimers betragen.The measure according to the invention, to measure the decrease in the concentration of the detectable, in particular labeled, primers and to use it as a measure of the presence of the nucleic acid molecule to be determined, is based on the fact that at the beginning of the reaction the detection primer is in a state of high mobility while at the end of the reaction, the hybridization or the amplification reaction (incorporation into an amplification product) largely or completely converts it to a state of low mobility. This change in mobility can be measured in a particularly suitable manner by the method of fluorescence correlation spectroscopy, it being possible for the sample to remain in the closed compartment. It can be preferred according to the invention to choose the concentration of the detection primer as low in relation to the concentration of the amplification primer. In particular, the concentration of the amplification primer can be 5 to 200 times the concentration of the detection primer.
Aus der vorzugsweise mit der Fluoreszenzkorrelations- spektroskopie ermittelten Korrelationskurve lassen sich sowohl die Anzahl der fluoreszierenden Moleküle, das relative Verhältnis fluoreszenzmarkierter Moleküle unterschiedlicher Größe als auch ihre Diffusionsmobilitäten schnell und zuver¬ lässig ermitteln. Das erfindungsgemäße Verfahren in Form einer Endpunkttitration und/oder Hybridisierung weist durch entsprechende Wahl und Konzentration der fluoreszenz¬ markierten Primer nur die Anwesenheit der gesuchten Sequenz, welche eine zum Detektionsprimer komplementäre Sequenz aufweist, nach.The number of fluorescent molecules, the relative ratio of fluorescence-labeled molecules of different sizes and their diffusion mobilities can be determined quickly and reliably from the correlation curve, which is preferably determined using fluorescence correlation spectroscopy. The method according to the invention in the form of an end point titration and / or hybridization detects, by appropriate choice and concentration of the fluorescence-labeled primers, only the presence of the sought sequence, which has a sequence complementary to the detection primer.
Das Verfahren ist unempfindlich gegenüber unspezifischen Amplifikationen. Eine hohe Konzentration an Amplifikations- primer ist wünschenswert, um eine sichere Amplifikation auch geringer Mengen an nachzuweisenden Nukleinsäuren zu gewähr¬ leisten. So kann zum Beispiel die Konzentration des Amplifi- kationsprimers 0, 5 μM betragen, während der Detektionsprimer vorzugsweise in einer Konzentration von 1 bis 10 nM vorliegt. Aus der entsprechenden Wahl unterschiedlicher Konzentrationen für Amplifikationsprimer und Detektionsprimer ergeben sich insbesondere die folgenden Vorteile. Bei der Amplifikations- reaktion wie der PCR muß es zu Assoziationsreaktionen zwischen Primer und Template kommen, um die Primer-Elongation zu starten. Diese Reaktionen haben normalerweise Geschwindig- keitskonstanten von kR = 104 - IO6 M^s"1. Im Zeitbereich von Sekunden bis Minuten kommt es gemäß der Beziehung l/t = kR (Cprime,r + Cter-place) nennenswert zu Komplexbildungen, wenn einer der Partner im Bereich von 0,1 bis 1 μM vorliegt. Dies gilt nur für bereits hohe Templatekonzentrationen bzw. für die Reaktion mit den Amplifikationsprimern. Erst wenn die Kon¬ zentration entsprechend hoch ist, kommt es zur gewünschten und spezifischen Hybridisierung mit dem Detektionsprimer, der sich dann in einer der erfindungsgemäßen Ausfuhrungs¬ formen in wenigen Amplifikationsschritten in gewünschter Weise verbraucht und nahezu vollständig durch Kettenver¬ längerung in Amplifikate überführt wird.The method is insensitive to unspecific amplifications. A high concentration of amplification primer is desirable in order to ensure reliable amplification even of small amounts of nucleic acids to be detected. For example, the concentration of the amplification primer can be 0.5 μM, while the detection primer is preferably present in a concentration of 1 to 10 nM. The following advantages result in particular from the corresponding choice of different concentrations for amplification primers and detection primers. In the amplification reaction such as the PCR, there must be association reactions between the primer and template in order to start the primer elongation. These reactions normally have rate constants of k R = 10 4 - IO 6 M ^ s "1. In the time range from seconds to minutes, according to the relationship l / t = k R (C prime , r + C ter-place ) Noteworthy about complex formation if one of the partners is in the range from 0.1 to 1 μM This only applies to already high template concentrations or for the reaction with the amplification primers. Only when the concentration is correspondingly high does the desired and specific hybridization with the detection primer, which in one of the embodiments according to the invention is then consumed in the desired manner in a few amplification steps and is almost completely converted into amplificates by chain extension.
Das erfindungsgemäße Verfahren eignet sich insbesondere in Kombination mit Probenträgern wie z.B. Polycarbonat-Folien, welche sich durch folgende Vorzüge auszeichnen. Sie sindThe method according to the invention is particularly suitable in combination with sample carriers such as e.g. Polycarbonate films, which are characterized by the following advantages. they are
a) chemisch inert b) fest verschließbar (keine Kontaminationseffekte, keine Verdampfung) c) nicht fluoreszierend d) von relativ geringer Dicke (10 bis 20 μm im Bereich der Probenflussigkeit) e) von relativ hoher Wärmeleitung.a) chemically inert b) tightly sealable (no contamination effects, no evaporation) c) not fluorescent d) of relatively small thickness (10 to 20 μm in the area of the sample liquid) e) of relatively high heat conduction.
Bevorzugt lassen sich Folien mit 96 oder 384 Kompartimenten verwenden. Die Folien werden mit Testflussigkeit und Proben- flussigkeit m ca 5 bis 20 μl Portionen befullt und ver¬ schlossen. Die Losungen werden als kleine Tropfen durch Kapillarkrafte im oberen Teil der Folie fixiert, in der das Kompartiment eine für die FCS-Methode erforderliche Wand¬ starke von 10 bis 20 μm besitzt. Die Folien lassen sich m einen thermostatisierbaren Rahmen einpassen. Sie werden mit einer dünnen Schicht Immersionsflussigkeit für das im FCS- Detektionsverfahren zu verwendende Objektiv benetzt Die Kompartimente lassen sich insbesondere für Verdunnungsreihen, Screenings oder auch für unterschiedliche Testtypen ein¬ setzen Die typische Meßzeit für eine Folie mit 96 Kom- partimenten liegt im Bereich weniger Minuten bis maximal einer halben Stunde. Durch Mitfuhrung geeigneter Standard- verdunnungen des Templates in der gleichen Folie ist die Quantifizierung der zu detektierenden Nukleinsäure in den Testkompartimenten möglich.Foils with 96 or 384 compartments are preferred use. The foils are filled with test liquid and sample liquid in approximately 5 to 20 μl portions and sealed. The solutions are fixed as small drops by capillary forces in the upper part of the film, in which the compartment has a wall thickness of 10 to 20 μm required for the FCS method. The foils can be fitted into a thermostatted frame. They are wetted with a thin layer of immersion liquid for the objective to be used in the FCS detection method. The compartments can be used in particular for series of dilutions, screenings or also for different types of tests. The typical measuring time for a film with 96 compartments is in the range of a few minutes up to a maximum of half an hour. By carrying suitable standard dilutions of the template in the same film, it is possible to quantify the nucleic acid to be detected in the test compartments.
Die quantitative Bestimmung der zu detektierenden Nuklein¬ säure kann erfindungsgemaß durch Verwendung von mindestens zwei Amplifikationsansatzen der Probe erfolgen Hierzu wird bevorzugt eine Verdunnungsreihe des ersten Ampliflkations- ansatzes hergestellt. Aus dem Verdunnungsverhaltnis ergeben sich die relativen Konzentrationen des zweiten und ggf weiterer Amplifikationsansätze. Bei Kenntnis der Nachweiskon¬ zentration, d. h. der Detektionsschwelle des verwendeten Detektionssystems, oder eines sonstigen zweckmäßigen Schwellenwertes ist durch Bestimmung der Reaktionszeiten bzw. der Anzahl der Ampliflkationszyklen bis zum Erreichen des Schwellenwertes in den jeweiligen Amplifikationsansatzen eine Quantifizierung der nachzuweisenden Nukleinsäure möglich Der Schwellenwert sollte bevorzugt innerhalb der loga¬ rithmischen Amplifikationsphase erreicht werden, um eine hohe Quantifizierungsgenauigkeit zu erzielen In vorteilhafter Weise wirken sich bei der erfindungsgemaßen Quantifizierung Unterschiede m der Ampflifikationsefflzienz, die z B in der besonderen Struktur der nachzuweisenden Nukleinsäure begründet sein können, nicht auf das Meßergebnis ausAccording to the invention, the quantitative determination of the nucleic acid to be detected can be carried out by using at least two amplification batches of the sample. For this purpose, a dilution series of the first amplification batch is preferably produced. The relative concentrations of the second and possibly further amplification batches result from the dilution ratio. If the detection concentration is known, ie the detection threshold of the detection system used, or another suitable threshold value, it is possible to quantify the nucleic acid to be detected by determining the reaction times or the number of amplification cycles until the threshold value is reached in the respective amplification approaches. The threshold value should preferably be within the logarithmic amplification phase can be achieved in order to achieve a high level of quantification accuracy. In the quantification according to the invention, differences m in the amplification efficiency, for example in the special structure of the nucleic acid to be detected, have an effect can be based, not on the measurement result
Das erfindungsgemäße Verfahren eignet sich bei Verwendung geeigneter Detektionsprimer auch zum Nachweis von Punkt- mutationen, Translokationen, Deletionen oder Haplotyp- Differenzierung. Es ist zudem im Sinne einer Multiplex-PCR einsetzbar. Bei erblichen Stoffwechselkrankheiten, wie z.B der autosomal rezessiven zystischen Fibröse, lassen sich durch Verwendung zweier Detektionsprimer mit unterschied¬ lichen Farbstoffmarkern heterozygote Patienten von homo- zygoten Patienten unterscheiden. Es ist zudem sowohl zum Nachweis von DNA- als auch RNA-Genomen geeignet (letzteres z.B. durch Einsatz m einer RT-PCR oder 3SR-Reaktιon)When using suitable detection primers, the method according to the invention is also suitable for the detection of point mutations, translocations, deletions or haplotype differentiation. It can also be used in the sense of a multiplex PCR. In the case of inherited metabolic diseases, such as, for example, the autosomal recessive cystic fibrosis, heterozygous patients can be distinguished from homozygous patients by using two detection primers with different dye markers. It is also suitable for the detection of DNA and RNA genomes (the latter e.g. by using an RT-PCR or 3SR reaction)
Die Figur 1 betrifft eine schematische Darstellung des er¬ findungsgemaßen Verfahrens unter Verwendung der PCR.FIG. 1 relates to a schematic representation of the method according to the invention using PCR.
Die Figur 2 beschreibt die Verschiebung der Korrelatlonskurve G(t) bei Anwesenheit der angegebenen initialen Template- Mengen.FIG. 2 describes the shift in the correlation curve G (t) in the presence of the specified initial template quantities.
Die Figur 3 betrifft die Darstellung der invertierten Korrelationsfunktion in der Form (G (t=0) -1) / (G (t) -1)FIG. 3 relates to the representation of the inverted correlation function in the form (G (t = 0) -1) / (G (t) -1)
Die Figur 4a zeigt die im Ausfuhrungsbeispiel 1 durch FCS- Analyse erhaltenen Autokorrelationsfunktionen G(t) .FIG. 4a shows the autocorrelation functions G (t) obtained in exemplary embodiment 1 by FCS analysis.
Die Figur 4b zeigt die Auftragung dieser Daten in linean- sierter Form.FIG. 4b shows the application of this data in a linearized form.
Die Figur 5 verdeutlicht die Änderung der relativen Diffusionszeiten des Detektionsprimers im Verlauf der Ampli- fikationsreaktion gemäß Ausfuhrungsbeispiel 1.FIG. 5 illustrates the change in the relative diffusion times of the detection primer in the course of the amplification reaction according to exemplary embodiment 1.
Die Figuren 6a und b verdeutlichen das Detektionslim.it des erfindungsgemaßen Verfahrens bei Anwendung auf das Aus¬ fuhrungsbeispiel 1 Die Figur 7 zeigt den erfindungsgemäßen Einsatz eines Detektionsprimers während der NASBA im Ausführungsbeispiel 2.FIGS. 6a and b illustrate the detection limit of the method according to the invention when applied to exemplary embodiment 1 FIG. 7 shows the use of a detection primer according to the invention during NASBA in exemplary embodiment 2.
Die Figur 8 zeigt die Lokalisation der verwendeten Priirrer innerhalb der gag Region des HIV-1 Genomes.FIG. 8 shows the location of the primers used within the gag region of the HIV-1 genome.
Die Figur 9 zeigt einen typischen Zeitverlauf der Ver¬ schiebung der Korrelationskurven aufgrund der Hybridisierung und Extension des Detektionsprimers im Ausführungsbeispiel 2.FIG. 9 shows a typical time course of the shift of the correlation curves due to the hybridization and extension of the detection primer in exemplary embodiment 2.
Die Figur 10 verdeutlicht die Kinetik der Hybridisierungs/ Extensionsreaktion des Detektionsprimers im Ausführungsbei¬ spiel 2.FIG. 10 illustrates the kinetics of the hybridization / extension reaction of the detection primer in exemplary embodiment 2.
Die Figur 1 beschreibt schematisch das erfindungsgemäße Verfahren unter Verwendung der PCR. Die in der PCR ver¬ wendeten Amplifikationsprimer pl und p2 sind als Pfeile dargestellt, der Detektionsprimer p3 ist mit einem Fluoreszenzfarbstoff (Kreis) gekoppelt. Der linke Teil der Figur zeigt amplifizierte Artefakte bei Abwesenheit des Templates. Hierbei kann es sich z.B. um Primerdimere der hochkonzentrierten Primer pl und p2 handeln. Die rechte Seite der Figur zeigt p2 in Anwesenheit des Templates . Erst wenn die Amplifikate in genügend hoher Konzentration vorliegen, wirkt das Amplifikat als Template für den niedrigkonzen¬ trierten, fluoreszenzmarkierten Detektionsprimer. Die Mobili¬ tätsänderung des Primers läßt sich deutlich durch eine Verschiebung der Korrelationskurve erkennen.FIG. 1 schematically describes the method according to the invention using PCR. The amplification primers p1 and p2 used in the PCR are shown as arrows, the detection primer p3 is coupled to a fluorescent dye (circle). The left part of the figure shows amplified artifacts in the absence of the template. This can e.g. are primer dimers of the highly concentrated primers pl and p2. The right side of the figure shows p2 in the presence of the template. Only when the amplificates are present in a sufficiently high concentration does the amplificate act as a template for the low-concentration, fluorescence-labeled detection primer. The change in mobility of the primer can be clearly recognized by shifting the correlation curve.
Mit dem erfindungsgemäßen Verfahren erzielte Ergebnisse an Mycobacterium tuberculosis sind in den Figuren 2 und 3 dargestellt. Der Nachweis dieses pathogenen Erregers dauerte bislang aufgrund der aufwendigen Zellkulturverfahren ca. 3 bis 4 Wochen. Mit Hilfe des erfindungsgemäßen Verfahrens läßt sich diese Nachweiszeit stark verkürzen. In der Figur 2 wird die Verschiebung der Korrelationskurve G(t) bei Anwesenheit der angegebenen initialen Template- Mengen gezeigt Die jeweils angegebene Anzahl von Template- molekulen wurde zu Beginn der Reaktion m jeweils 50 μl Reaktionsansatz vorgelegt, durch das erfindungsgemäße Ver¬ fahren m 32 PCR-Zyklen ampliflziert und mittels der FCS- Methode analysiert . Es wurde em für den Tuberkuloseerreger Mycobacterium tuberculosis charakteristisches Template verwendet. Die Detektionsgrenze lag hier bei 100 Template- molekulen pro Ansatz. Das Verfahren ist damit empfindlich genug, um m jeder molekulardiagnostischen Anwendung einge¬ setzt zu werden.Results obtained with the method according to the invention on Mycobacterium tuberculosis are shown in FIGS. 2 and 3. The detection of this pathogenic pathogen previously took about 3 to 4 weeks due to the complex cell culture procedures. With the aid of the method according to the invention, this detection time can be greatly reduced. FIG. 2 shows the shift in the correlation curve G (t) in the presence of the specified initial template quantities. The number of template molecules specified in each case was initially presented at the start of the reaction with 50 .mu.l of reaction mixture, by the method according to the invention PCR cycles amplified and analyzed using the FCS method. A template characteristic of the tuberculosis pathogen Mycobacterium tuberculosis was used. The detection limit here was 100 template molecules per batch. The method is therefore sensitive enough to be used in any molecular diagnostic application.
Die Figur 3 zeigt die Auftragung der invertierten Korre- lationsfunktion in der Form (G (t=0) -1) / ( (G(t) -1) . In dieser Darstellung wurden die gleichen Daten wie m Figur 2 ver¬ wendet . Durch die invertierte Auftragung sind die Kurven im betrachteten Zeitbereich lmearisiert, wodurch ihre Inter¬ pretation erleichtert wird. Eine Verschiebung von G(t) entlang der t-Achse zeigt sich m dieser Darstellung als Abflachung der Steigung, die durch lineare Regression m einfacher Weise erhalten werden kann. Die Detektionsgrenze laßt sich deutlich als 100 Templatemolekule pro Reaktions¬ ansatz erkennen.3 shows the application of the inverted correlation function in the form (G (t = 0) -1) / ((G (t) -1). In this representation, the same data as in FIG. 2 were used. Inverted plotting means that the curves are imearized in the time range under consideration, which makes their interpretation easier.A shift in G (t) along the t-axis is shown in this representation as a flattening of the slope, which is easily obtained by linear regression The detection limit can be clearly recognized as 100 template molecules per reaction batch.
Die Figur 4a zeigt die durch FCS-Analyse erhaltenen Auto¬ korrelatlonsfunktionen G(t) mit zunehmender Anzahl an PCR- Zyklen der für Mycobacterium tuberculosis und M. bovis spezifischen Targetsequenz IS6110 (Ausfuhrungsbeispiel 1) . Die PCR-Amplifikation eines 106 bp-Segmentes, ausgehend von IO5 Strängen der genomischen Mycobacterium tuberculosis DNA vor einem Hintergrund von 2.5 μg unspezifischer humaner Placenta-DNA in 50 μl Reaktionsvolumen, erfolgte unter Verwendung des Primerpaares S1/S2 als Amplifikationsprimer und 10 nM TMR-markierter Sonde PRI als Detektionsprimer (Tabelle 1) . Der Detektionsprimer bindet zwischen den Ampli- flkationsprimern mit derselben Orientierung wie der Amplifl- kationsprimer S2 und überlappt mit dem 3 '-Ende von S2 um fünf Nukleotide. Die Amplifikationsreaktionen wurden nach einer unterschiedlichen Zahl an Zyklen gestoppt. Die Inkorporation des Detektionsprimers m die Amplifikate ist an der Ver¬ schiebung der Autokorrelationskurve zu längeren Korre- lationszeiten, welche einer Zunahme der Diffusionszeit des Detektionsprimers entspricht, deutlich erkennbar.FIG. 4a shows the auto-correlation functions G (t) obtained by FCS analysis with increasing number of PCR cycles of the target sequence IS6110 specific for Mycobacterium tuberculosis and M. bovis (exemplary embodiment 1). The PCR amplification of a 106 bp segment, starting from IO 5 strands of the genomic Mycobacterium tuberculosis DNA against a background of 2.5 μg unspecific human placenta DNA in 50 μl reaction volume, was carried out using the primer pair S1 / S2 as amplification primer and 10 nM TMR -labelled probe PRI as a detection primer (Table 1). The detection primer binds between the amplification primers with the same orientation as the amplification primer. cation primer S2 and overlaps the 3 ' end of S2 by five nucleotides. The amplification reactions were stopped after a different number of cycles. The incorporation of the detection primer in the amplificates can be clearly recognized by the shift in the autocorrelation curve to longer correlation times, which corresponds to an increase in the diffusion time of the detection primer.
Die Figur 4b zeigt die Auftragung der Daten m der lmeari- sierten Form [G(t=0)] / [G(t)j . Mit zunehmender Amplifikation ist eine Abnahme der Geradensteigung zu beobachten.FIG. 4b shows the plotting of the data m in the amorphized form [G (t = 0)] / [G (t) j. A decrease in the slope of the straight line can be observed with increasing amplification.
Die Figur 5 verdeutlicht die Änderung der relativen Diffusionszeiten des Detektionsprimers im Verlauf der Ampli- fikationsreaktion. Die Diffusionszeiten des Detektionsprimers spiegeln eindeutig die PCR-Ampliflkationskmetik mit einer vor Erreichen des Detektionsgrenzwertes initialen lag-Phase, schneller exponentieller Anreicherung der Amplifikations¬ produkte sowie einer Plateauphase wider. Dieses Plateau zeigt eine Sättigung an, welche dem Endpunkt einer Titration vergleichbar ist. Die abnehmende Anzahl der durchschnittlich sich im Laserfokus befindlichen Moleküle des Detektions¬ primers mit zunehmender Zahl der Temperaturzyklen ist vermut¬ lich auf Adsorptionseffekte an den Wanden der Reaktionsgefaße zurückzuführen (Nebenbild der Figur 5) . Zudem ist eine scheinbare Zunahme emittierter Photonen pro Molekül und Sekunde zu beobachten (Nebenbild der Figur 5) .FIG. 5 illustrates the change in the relative diffusion times of the detection primer in the course of the amplification reaction. The diffusion times of the detection primer clearly reflect the PCR amplification chemistry with an initial lag phase before reaching the detection limit value, rapid exponential enrichment of the amplification products and a plateau phase. This plateau shows a saturation which is comparable to the end point of a titration. The decreasing number of the molecules of the detection primer, which are in the laser focus on average, with increasing number of temperature cycles is presumably due to adsorption effects on the walls of the reaction vessels (secondary image in FIG. 5). In addition, an apparent increase in emitted photons per molecule and second can be observed (secondary image in FIG. 5).
Die Figuren 6a und 6b verdeutlichen das Detektionslimit des erfindungsgemaßen Verfahrens bei Anwendung auf das Aus¬ fuhrungsbeispiel 1. Die PCR-Amplifikationsreaktionen wurden unter Verwendung unterschiedlicher Amplifikations- und Detektionsprimer durchgeführt (Tabelle 1) . Vor einem Hinter¬ grund von 2.5 μg unspezifischer humaner Plazenta-DNA m 50 μl Reaktionsvolumen wurde eine konstante Anzahl an PCR-Zyklen (entweder 36 oder 40 Zyklen) mit jeweils unterschiedlichen Ausgangskonzentrationen an Targetgenomen durchgeführt. Bei Verwendung der Amplifikationsprimer S1/S2 mit 1 nM Detektionsprimer PRI (Figur 6a) oder der Amplifikationsprimer B1B/B2B mit 5 nM Detektionsprimer PR3 (Figur 6b) liegt das Detektionslimit unterhalb von 100 Mycobacterium tuberculosis Genomen. Eine Quantifizierung von bis zu lediglich 10 Target¬ genomen kann durch Vergleich mit einem Verdunnungsstandard erfolgen. Die mittels FCS bestimmten Diffusionszeiten des Detektionsprimers stimmen gut mit den Ergebnissen der dem Fachmann m bekannter Weise durchgeführten Sequenzanalyse uberein (Figur 6a) . Nichtbindende Sonden, wie z.B. der Primer HS3, zeigen bei Amplifikation der Targetsequenz keine Ver¬ änderung der Autokorrelatlonsfunktion bzw. ihrer Diffusionzeiten (Figur 6b) .FIGS. 6a and 6b illustrate the detection limit of the method according to the invention when applied to exemplary embodiment 1. The PCR amplification reactions were carried out using different amplification and detection primers (Table 1). Against a background of 2.5 μg unspecific human placenta DNA in a 50 μl reaction volume, a constant number of PCR cycles (either 36 or 40 cycles) were carried out, each with different starting concentrations on target genomes. at Using the amplification primer S1 / S2 with 1 nM detection primer PRI (FIG. 6a) or the amplification primer B1B / B2B with 5 nM detection primer PR3 (FIG. 6b) the detection limit is below 100 Mycobacterium tuberculosis genomes. Up to only 10 target genomes can be quantified by comparison with a dilution standard. The diffusion times of the detection primer determined by means of FCS agree well with the results of the sequence analysis carried out in a manner known to the person skilled in the art (FIG. 6a). Non-binding probes, such as, for example, the primer HS3, show no change in the autocorrelation function or its diffusion times when the target sequence is amplified (FIG. 6b).
Die Figur 7 zeigt den erfindungsgemaßen Einsatz eines De¬ tektionsprimers wahrend der Amplifιkatιonsreaκtιon gemäß Ausfuhrungsbeispiel 2. Die von van Genem et al . (PCR Methods and applications 4, 177-184, 1995) beschriebene NASBA-Methode wurde erfindungsgemaß folgendermaßen variiert:FIG. 7 shows the use of a detection primer according to the invention during the amplification reaction according to exemplary embodiment 2. The method described by van Genem et al. (PCR Methods and applications 4, 177-184, 1995) NASBA method described was varied according to the invention as follows:
1. Em Detektionsprimer (gagl) wurde dem Reaktionsansatz zugesetzt. Dieser hybridisierte an einer spezifischen Sequenz des 145 b RNA-Stranges Durch Reverse Transkription mittels AMV-RT entstand ein ds DNA-Molekul mit 130 bp, wahrend das unter Verwendung der Primer 1 und 2 entstandene AmplifI- kationsprodukt 167 bp aufwies.1. A detection primer (gagl) was added to the reaction mixture. This hybridized to a specific sequence of the 145 b RNA strand. Reverse transcription using AMV-RT produced a ds DNA molecule with 130 bp, while the amplification product produced using primers 1 and 2 had 167 bp.
2. Alle Komponenten der NASBA-Reaktion einschließlich des Detektionsprimers und der Enzyme wurden auf Eis gemischt; der m der Literatur beschriebene Denaturierungsschritt konnte ohne Einfluß auf Reaktionsspezifitat entfallen.2. All components of the NASBA reaction including the detection primer and the enzymes were mixed on ice; the denaturation step described in the literature could be omitted without affecting reaction specificity.
3. In Standard-NASBA-Verfahren wird die ampliflzierte RNA mittels Hybπdisierungstechniken wie ELGA (enzyme-lmked gel assay) und ECL (Elektrochemilummeszenz) detektiert und quantifiziert. Diese Techniken erfordern die Öffnung der Probentrager mit der Gefahr von carryover-Kontammationen Durch die Verwendung von FCS als Detektionsmethode ist es erfindungsgemaß in vorteilhafter Weise möglich, die Proben- losung ohne Öffnung der Probentrager zu analysieren.3. In standard NASBA methods, the amplified RNA is detected and quantified using hybridization techniques such as ELGA (enzyme-imbed gel assay) and ECL (electrochemical luminescence). These techniques require the opening of the sample carrier with the risk of carryover contamination By using FCS as a detection method, it is advantageously possible according to the invention to analyze the sample solution without opening the sample holder.
Die Figur 8 zeigt die Lokalisation der verwendeten Primer innerhalb der gag Region des HIV-1-Genomes .FIG. 8 shows the location of the primers used within the gag region of the HIV-1 genome.
Die Figur 9 zeigt emen typischen Zeitverlauf der Vers¬ chiebung der Korrelationskurven (— 10 mm, 20 mm,FIG. 9 shows a typical time course of the shift in the correlation curves (−10 mm, 20 mm,
-.- - 35 mm, 50 mm, 60 mm nach Beginn der-.- - 35 mm, 50 mm, 60 mm after the start of
Amplifikation) aufgrund der Hybridisierung sowie Extension des Detektionsprimers Die Anfangskonzentration der HIV-1 RNA-Molekule betrug 5000 pro ml Plasma Hinsichtlich der theoretischen Beschreibung der Autokorrelationskurven eines Zweikomponentensystems wird auf das Ausfuhrungsbeispiel 1 verwiesen. Im vorliegenden Beispiel wurden der hybridisierte (gagl-145 b RNA) Detektionsprimer und die durch Extension entstandene 130 bp-Komponenten aufgrund ihrer annähernd gleichen Diffusionszeiten als eine Komponente behandelt. Zur Bestimmung der Kinetik der hybridisierten/extendierten Detektionsprimers wurden die Korrelationskurven unter Ver¬ wendung der dem Fachmann bekannten Gleichung zur Beschreibung der Autokorrelationsfunktion eines Zweikomponentensystems geflttet .Amplification) due to the hybridization and extension of the detection primer. The initial concentration of the HIV-1 RNA molecules was 5000 per ml of plasma. With regard to the theoretical description of the autocorrelation curves of a two-component system, reference is made to Example 1. In the present example, the hybridized (gagl-145 b RNA) detection primer and the 130 bp components produced by extension were treated as one component due to their approximately equal diffusion times. To determine the kinetics of the hybridized / extended detection primers, the correlation curves were filled using the equation known to the person skilled in the art to describe the autocorrelation function of a two-component system.
Die Figur 10 verdeutlicht die Kinetik der Hybridisierungs- /Extensionsreaktion des Detektionsprimers. Die Bedeutung der verwendeten Symbole ist wie folgt :FIG. 10 illustrates the kinetics of the hybridization / extension reaction of the detection primer. The meaning of the symbols used is as follows:
D negative Kontrolle; O falsch-positive Probe; ■ Anfangs¬ konzentration von 1000 HIV 1 RNA-Molekülen pro ml Plasma; • Anfangskonzentration von 2000 HIV-1 RNA-Molekulen pro ml Plasma; ▼ Anfangskonzentration von 5000 HIV-1 RNA-Molekulen pro ml Plasma, A Anfangskonzentration von 20000 HIV-1 RNA- Molekulen pro ml Plasma. Bei geringer Anfangskonzentration ist die Kurve zu längeren Inkubationszeiten verschoben Bei einer mit wenigen Molekülen kontaminierten falsch-positiven Probe ist diese Verschiebung besonders auffällig, so daß eine klare Unterscheidung zwischen falsch-positiven und positiven Proben möglich ist.D negative control; O false positive sample; ■ initial concentration of 1000 HIV 1 RNA molecules per ml of plasma; • Initial concentration of 2000 HIV-1 RNA molecules per ml of plasma; ▼ Initial concentration of 5000 HIV-1 RNA molecules per ml plasma, A Initial concentration of 20,000 HIV-1 RNA molecules per ml plasma. If the initial concentration is low, the curve is shifted to longer incubation times In a false positive sample contaminated with a few molecules, this shift is particularly noticeable, so that a clear distinction between false positive and positive samples is possible.
Der Wert der initialen Konzentration an HIV-1 RNA Molekülen erlaubt eine Unterscheidung zwischen positiven und falsch¬ positiven Proben. Die direkte quantitative Analyse der Anfangskonzentration an RNA-Molekülen in einer Probe kann erfindungsgemaß wie folgt ermittelt werden. Die Zeitabhängig¬ keit der Konzentration der Amplifikationsprodukte in einer NASBA-Reaktion ist annähernd durch folgende Exponential¬ funktion beschreibbar: P(t)= Pn exp(kt) , wobei k eine für den Amplifikationsmechanismus repräsentative Konstante darstellt. Der Logarithmus der in der Probe enthaltenen Moleküle stellt eine lineare Funktion der zur Erzielung eines bestimmten Primerbindungsgrades notwendigen Inkubationszeit dar (Neben¬ bild der Figur 10) . Mittels einer Verdünnungsserie läßt sich somit die Anfangskonzentration an RNA-Molekülen ermitteln.The value of the initial concentration of HIV-1 RNA molecules allows a distinction to be made between positive and false positive samples. According to the invention, the direct quantitative analysis of the initial concentration of RNA molecules in a sample can be determined as follows. The time dependence of the concentration of the amplification products in a NASBA reaction can be described approximately by the following exponential function: P (t) = P n exp (kt), where k represents a constant representative of the amplification mechanism. The logarithm of the molecules contained in the sample represents a linear function of the incubation time necessary to achieve a certain degree of primer binding (secondary picture in FIG. 10). The initial concentration of RNA molecules can thus be determined using a dilution series.
Im vorliegenden Ausführungsbeispiel wurde der kombinierte Ansatz aus Hybridisierung und Extension des Detektionsprimer dargestellt. Die mittels der FCS erhaltenen Daten wurden durch Sequenzierung konfirmiert. Es konnte bei mehr als 50 durchgeführten Analysen keine unspezifische Bindung des Detektionsprimers festgestellt werden, so daß sich hiermit die Möglichkeit ergibt, auf eine Extension des Detektions¬ primers während der Analysen zu verzichten. Dies kann z.B. durch Verwendung eines Didesoxynucleotides am 3 '-Ende des Detektionsprimers oder durch Verwendung von PNA-Primern erfolgen. Erfindungsgemaß ist auch der Anstieg der Diffusionszeiten des Detektionsprimers durch Hybridisierung an die amplifizierte RNA ausreichend für eine reproduzierbare FCS-Detektion. Ausführuncrsbeispiel 1In the present exemplary embodiment, the combined approach of hybridization and extension of the detection primer was shown. The data obtained using the FCS were confirmed by sequencing. In the case of more than 50 analyzes carried out, no non-specific binding of the detection primer could be determined, so that this makes it possible to dispense with an extension of the detection primer during the analyzes. This can be done, for example, by using a dideoxynucleotide at the 3 'end of the detection primer or by using PNA primers. According to the invention, the increase in the diffusion times of the detection primer by hybridization to the amplified RNA is also sufficient for reproducible FCS detection. Example 1
In einer bevorzugten Ausführungsform des erfindungsgemaßen Verfahrens wird als Amplifikationsmethode die Polymerase- kettenreaktion (PCR) mit einer auf der Methode der Fluoreszenzkorrelationsspektroskopie (FCS) beruhenden Detektionstechnik unter Verwendung eines mit fluoreszierenden Gruppen markierten Detektionsprimers, wie z.B. einem N, N, N' , N' -tetramethyl-5-carboxyrhodamm (TMR) -markierten Detektionsprimer, kombiniert. Die Detektionsprimer werden durch die Ampliflkationsreaktion in die amplifizierte Nu¬ kleinsäure eingebaut, wobei der Einbau mit einer Zunahme der Diffusionszeit des Detektionsprimers einhergeht, welche mittels FCS beobachtet werden kann.In a preferred embodiment of the method according to the invention, the polymerase chain reaction (PCR) is used as the amplification method with a detection technique based on the fluorescence correlation spectroscopy (FCS) method using a detection primer labeled with fluorescent groups, e.g. an N, N, N ', N' -tetramethyl-5-carboxyrhodamm (TMR) -labeled detection primer. The detection primers are incorporated into the amplified nucleic acid by the amplification reaction, the installation being accompanied by an increase in the diffusion time of the detection primer, which can be observed by means of FCS.
Verwendete Materialien: Die Oligodesoxynukleotide (Tabelle 1) wurden m HPLC-remer Qualität bei der Fa. NAPS (D- Göttingen) erworben. Die Markierung der Sonden PRI, PR3, HS1 und HS3 erfolgte mit dem 5-Isomer von TMR an ihrem 5' -Ende über einen Aminohexyllinker. Die Konzentrationen wurden unter Berücksichtigung der Absorption des TMR-Labels bei 260 nm (mit A260 / A554 = 0.49) bestimmt, und der Substitutionsgrad (DOS) , entsprechend einem Markierungslabel pro Molekül, wurde mitteis folgender Formel bestätigt:Materials used: The oligodeoxynucleotides (Table 1) were purchased in HPLC-rem quality from NAPS (D-Göttingen). The probes PRI, PR3, HS1 and HS3 were labeled with the 5-isomer of TMR at their 5 'end via an aminohexyl linker. The concentrations were determined taking into account the absorption of the TMR label at 260 nm (with A 260 / A 554 = 0.49), and the degree of substitution (DOS), corresponding to one label per molecule, was confirmed using the following formula:
DOS = [ (10 x N / 86) x A554) ] / [A260 - (0,49 x A554)] , wobei N die Anzahl der Basen m der Probe angibt .DOS = [(10 x N / 86) x A 554 )] / [A 260 - (0.49 x A 554 )], where N is the number of bases m of the sample.
2'-Desoxynucleosιd-5'-Triphosphate (dNTPs) wurden von der Fa. Pharmacia erworben; das 5'-3 '-exonukleasefreie Stoffel- fragment der Thermus aquaticus DNA-Polymerase von der Fa. Perkm-Elmer. Die humane Placenta DNA wurde bei der Fa. Sigma erworben. Zudem wurde genomische DNA von Mycobacterium tuberculosis verwendet .2'-Deoxynucleosιd-5'-triphosphates (dNTPs) were purchased from Pharmacia; the 5 ' -3 ' exonuclease-free fragment of the Thermus aquaticus DNA polymerase from Perkm-Elmer. The human placenta DNA was purchased from Sigma. Genomic DNA from Mycobacterium tuberculosis was also used.
PCR m Gegenwart von Detektionsprimer: Die Ampliflkations¬ reaktion erfolgte entweder m 50 μl oder 25 μl Proben mit 10 mM Tris-HCl (pH 8.3) , 50 mM KCI, 2.5 mM MgCl2, 0.1 mg/ml Gelatine, jeweils 0 5 μM der beiden Amplifikationsprimer, jeweils 200 μM der vier dNTPs, 50 ng/μl humaner Placenta-DNA als Überschuß unspeziflscher DNA, 1 bis 20 nM des TMR- markierten Detektionsprimers, und 0 05 U/μl des 5'-3'-exo- nukleasefreien Stoffelfragmentes der Thermus aquaticus DNA- Polymerase . Die Menge an genomischer Mycobacterium tuber¬ cul osi s DNA (im Bereich von 0 bis IO6 Moleküle je 50 μl der Reaktionsmischung) betrüg wie angegeben. Die PCR-Reaktion erfolgte in Reaktionsrohrchen (Multiple-Safecap tubes) der Fa. Sarstedt . Es wurde folgendes Temperaturprogramm in einem TRIO-Thermoblock-Cycler der Fa Biometra (Gottingen) ange¬ wendet Denaturierung bei 94°C für 30 s, Pπmerbmdung bei 56°C (Primerpaar S1/S2) oder 60°C (Primerpaar B1B/B2B) für 20 s, und Elongation bei 72°C für 30 s, jeweils für die angegebene Zahl der Zyklen.PCR in the presence of detection primer: The amplification reaction was carried out either with 50 μl or 25 μl samples 10 mM Tris-HCl (pH 8.3), 50 mM KCI, 2.5 mM MgCl 2 , 0.1 mg / ml gelatin, in each case 0 5 μM of the two amplification primers, in each case 200 μM of the four dNTPs, 50 ng / μl human placenta DNA as excess unspecific DNA, 1 to 20 nM of the TMR-labeled detection primer, and 0 05 U / μl of the 5'-3'-exonuclease-free fragment of the Thermus aquaticus DNA polymerase. The amount of genomic Mycobacterium tuber cul osi s DNA (in the range from 0 to IO 6 molecules each 50 μl of the reaction mixture) is as indicated. The PCR reaction took place in reaction tubes (multiple safecap tubes) from Sarstedt. The following temperature program was used in a TRIO thermoblock cycler from Biometra (Gottingen): denaturation at 94 ° C for 30 s, polymer detection at 56 ° C (primer pair S1 / S2) or 60 ° C (primer pair B1B / B2B) for 20 s, and elongation at 72 ° C for 30 s, each for the specified number of cycles.
FCS-Messung und Bestimmung relativer Diffusionszeiten- Im Anschluß an die PCR wurden 10 μl der Reaktionsmischung mittels FCS unter Verwendung eines 63x1.2 Wasser-Immersions¬ objektives untersucht. Eine detaillierte Beschreibung der FCS ist in dem Artikel von Eigen und Rigler (Proc. Natl. Acad Sei USA 91.5740-5747) zu finden. Die Autokorre¬ lationsfunktion für eine Mischung von Partikeln mit schnellen und langsamen Translationsdiffusionszeiten ist bei Thompson (Topics in Fluorescence Spectroscopy, Vol. I, Lakowicsz, JR (ed) , Plenum 1991) beschrieben.FCS measurement and determination of relative diffusion times. Following the PCR, 10 μl of the reaction mixture were examined by means of FCS using a 63x1.2 water immersion objective. A detailed description of the FCS can be found in the article by Eigen and Rigler (Proc. Natl. Acad Sei USA 91.5740-5747). The autocorrelation function for a mixture of particles with fast and slow translation diffusion times is described by Thompson (Topics in Fluorescence Spectroscopy, Vol. I, Lakowicsz, JR (ed), Plenum 1991).
Ausfuhrungsbeispiel 2Exemplary embodiment 2
In einer weiteren bevorzugten Ausführungsform wird die isothermale Ampliflkationsmethode NASBA (nucleic acid sequence-based amplification) mit der Detektionsmethode FCS kombiniert Das erfindungsgemäße Verfahren wird in diesem Ausfuhrungsbeispiel verwendet, um eine simulierte HIV-In¬ fektion nachzuweisen. Verwendete Materialien: Die Komponenten für die RNA-Iso¬ lierung sowie für die Amplifikationsmethode NASBA wurden bei der Fa. Organon Teknika (Eppelheim) erworben. Der mit TMR- markierte Detektionsprimer gagl wurde von der Fa. NAPS (Göttingen) synthetisiert. Die Probenträger mit 96 Reaktions- kompartimenten wurden in der Feinmechanikwerkstatt des Max- Planck-Institutes für Biophysikalische Chemie angefertigt; jedes Kompartiment besitzt ein Volumen von 40 μl und eine Wandstärke von 40 μm. Das verwendete Plasma war Hepatitis B- und C-, CMV- und HIV-1-negativ.In a further preferred embodiment, the isothermal amplification method NASBA (nucleic acid sequence-based amplification) is combined with the detection method FCS. The method according to the invention is used in this exemplary embodiment to detect a simulated HIV infection. Materials used: The components for the RNA isolation and for the NASBA amplification method were purchased from Organon Teknika (Eppelheim). The TMR-labeled detection primer gagl was synthesized by NAPS (Göttingen). The sample carriers with 96 reaction compartments were made in the precision engineering workshop of the Max Planck Institute for Biophysical Chemistry; each compartment has a volume of 40 μl and a wall thickness of 40 μm. The plasma used was hepatitis B and C, CMV and HIV-1 negative.
Simulation einer HIV-1-Infektion: Jeweils 1 ml Plasma wurde mit unterschiedlichen Mengen (1000, 2000, 5000, 20000 Mole¬ küle) an genomischer HIV-1 RNA (HXB2) versetzt. 9 ml Lyse- Puffer (5.25 M Guanidmthiocyanat, 50 mM Tris pH 6.4 , 20 mM EDTA, 1.3 % w/v Triton X-100) wurden zugesetzt.Simulation of HIV-1 infection: 1 ml of plasma was mixed with different amounts (1000, 2000, 5000, 20,000 molecules) of genomic HIV-1 RNA (HXB2). 9 ml of lysis buffer (5.25 M guanide thiocyanate, 50 mM Tris pH 6.4, 20 mM EDTA, 1.3% w / v Triton X-100) were added.
Isolierung von Nukleinsäuren aus dem Plasma: Die Nuklein¬ säuren wurden an aktivierte Kieselerde (50 μl Suspension, 1 mg/ml) , welche der Lyse-Mischung zugesetzt wurde, gebunden. Nach einem Wasch- und Trocknungsschritt wurden die Nuklein¬ säuren mit 50 μl Elutionspuffer (1 mM Tris pH 8.5) eluiert und bei -70°C gelagert.Isolation of nucleic acids from the plasma: The nucleic acids were bound to activated silica (50 μl suspension, 1 mg / ml), which was added to the lysis mixture. After a washing and drying step, the nucleic acids were eluted with 50 μl elution buffer (1 mM Tris pH 8.5) and stored at -70 ° C.
NASBA-Amplifikation der isolierten HIV-1 RNA: Typische Reaktionen wurden durchgeführt m einem 20 μl Reaktions- volumen, enthaltend 40 mM Tris pH 8.5, 12 mM MgCl2, 42 mM KCI, 5 mM DTT, 15 % v/v DMSO, jeweils ImM dNTP, jeweils 2mM NTP, 0.1 U RNase H, 0.1 μg/μl BSA, 40 U T7 RNA-Polymerase, 8 U AMV Reverse Transkriptase, 0.2 μM Primer 1,2 und 5 μl isolierte Nukleinsäure (enthaltend 100, 200, 500, 2000 HIV-1 RNA-Moleküle) . In negativen Kontrollreaktionen wurden diese 5 μl isolierter Nukleinsäure durch 5 μl bidestilliertes Wasser ersetzt. Die Sequenzen der Amplifikationsprimer smd innerhalb der gag Region des HIV-1-Genomes lokalisiert (Figur 8) . Sie weisen die folgenden Sequenzen auf: Primer 1 : 5'- AAT TCT AAT ACG ACT CAC TAT AGG GTG CTA TGT CACNASBA amplification of the isolated HIV-1 RNA: Typical reactions were carried out in a 20 μl reaction volume containing 40 mM Tris pH 8.5, 12 mM MgCl 2 , 42 mM KCI, 5 mM DTT, 15% v / v DMSO, in each case ImM dNTP, each 2mM NTP, 0.1 U RNase H, 0.1 μg / μl BSA, 40 U T7 RNA polymerase, 8 U AMV reverse transcriptase, 0.2 μM primer 1,2 and 5 μl isolated nucleic acid (containing 100, 200, 500, 2000 HIV-1 RNA molecules). In negative control reactions, these 5 μl of isolated nucleic acid were replaced by 5 μl of bidistilled water. The sequences of the amplification primers smd localized within the gag region of the HIV-1 genome (Figure 8). They have the following sequences: Primer 1: 5'- AAT TCT AAT ACG ACT CAC TAT AGG GTG CTA TGT CAC
TTC CCC TTG GTT CTC TCA -3' (antisense NT 1471-1499 von HXB2 , T7 Promotor unterstrichen)TTC CCC TTG GTT CTC TCA -3 ' (antisense NT 1471-1499 from HXB2, T7 promoter underlined)
Primer 2: 5'- AGT GGG GGG ACA TCA AGC AGC CAT GCA AA - 3' (sense NT 1358-1386 von HXB2) .Primer 2: 5'- AGT GGG GGG ACA TCA AGC AGC CAT GCA AA - 3 '(sense NT 1358-1386 from HXB2).
Zum Reaktionsansatz wurden 1 μl TMR-markierter gagl- Detektionsprimer (Endkonzentration: 4.5 nM) zugesetzt:1 μl of TMR-labeled gagl detection primer (final concentration: 4.5 nM) were added to the reaction mixture:
gagl: 5'- TMR-GAG ACC ATC AAT GAG GAA GCT GCA GAA TGG GAT - 3' (sense NT 1395-1427 von HXB2)gagl: 5'- TMR-GAG ACC ATC AAT GAG GAA GCT GCA GAA TGG GAT - 3 '(sense NT 1395-1427 from HXB2)
Diese Amplifikationsansätze von jeweils 21 μl wurden in ver¬ schließbare Probenträger, insbesondere Polycarbonatfolien mit 96 Vertiefungen, überführt und in die auf 42°C vor¬ temperierte Temperierungseinheit eines dem Fachmann bekannten FCS-Gerätes eingesetzt. In einem typischen Experiment wurden 10 Amplifikationsreaktionen einschließlich negativer Kon¬ trollen in parallelisierter Form durchgeführt. Die FCS- online-Detektion erfolgte unter Verwendung eines Wasser- Immersionsobjektives (Zeiss Plan Neofluar 40x0.9) . Das durch den Laserstrahl und ein Pinhole in einer dem Fachmann be¬ kannten Weise definierte Detektionsvolumen lag in der Größen- ordung von IO"15 1. These amplification batches of 21 μl each were transferred to closable sample carriers, in particular polycarbonate films with 96 wells, and inserted into the temperature control unit of an FCS device known to the person skilled in the art, which was preheated to 42 ° C. In a typical experiment, 10 amplification reactions including negative controls were carried out in parallel. The FCS online detection was carried out using a water immersion objective (Zeiss Plan Neofluar 40x0.9). The detection volume defined by the laser beam and a pinhole in a manner known to the person skilled in the art was in the order of 10 "15 1.
Table 1. Amplifikatioπs- und Detektionsprimer für die DNA-Amplifikation von IS6110 mittels PCR.Table 1. Amplification and detection primers for the DNA amplification of IS6110 using PCR.
Oligodeoxynukleotid Sequenz (5'→3')" Lokalis. T, m auf (°C) c IS6110h Oligodeoxynucleotide sequence (5 '→ 3') "Localis. T, m on (° C) c IS6110 h
51 accgcatcgaatgcatgtctcgggtAAGGCGTACTCGACC 970-984 41.751 accgcatcgaatgcatgtctcgggtAAGGCGTACTCGACC 970-984 41.7
52 cgattccgctccagacttctcggGTGTACTGAGATCCCCT 1025-1011 39.352 cgattccgctccagacttctcggGTGTACTGAGATCCCCT 1025-1011 39.3
B1B AGCGCCGCTTCGGAC 769-783 55.1B1B AGCGCCGCTTCGGAC 769-783 55.1
B2B TCGATGTGTACTGAGATCCCCT 1032-1011 54.7B2B TCGATGTGTACTGAGATCCCCT 1032-1011 54.7
PRI TMR-CCCCTATCCGTATGGTGG 1015-998 52.0PRI TMR-CCCCTATCCGTATGGTGG 1015-998 52.0
PR3 TMR-CCCCTATCCGTATGGTGGATAACGTCTTTC 1015-986 66.4PR3 TMR-CCCCTATCCGTATGGTGGATAACGTCTTTC 1015-986 66.4
HS1 TMR-gacattgttcgtcggccgcHS1 TMR-gacattgttcgtcggccgc
HS3 TMR-tgctagagatctctaagttataacacatcaatgtcaaHS3 TMR-tgctagagatctctaagttataacacatcaatgtcaa
* Kleinbuchstaben = Zur Targetsequenz IS6110 nicht komplementäre Basen. b Bindungsstelle auf der Targetsequenz IS6110. c Schmelzpunkt der jeweiligen Targetsequenz bei Konzentrationen von 1 nM DNA und 50 mM Salz. * Lower case = bases not complementary to the target sequence IS6110. b Binding site on the target sequence IS6110. c Melting point of the respective target sequence at concentrations of 1 nM DNA and 50 mM salt.

Claims

A n s p r ü c h e Expectations
1. Verfahren zur Bestimmung von Nuklemsauremolekülen in niedriger Konzentration in zu untersuchenden Proben mittels Amplifikationsreaktionen unter Verwendung von unmarkierten Primern als Amplifikationsprimer und detektierbaren, insbesondere markierten Primern als Detektionsprimer sowie insbesondere von Polymerasen und/oder Ligasen, wobei die detektierbaren Primer an die Amplifikationsprodukte hybridisieren und die Ab¬ nahme der Konzentration der detektierbaren, insbe¬ sondere markierten Primer, und/oder die Zunahme der Konzentration der Amplifikationsprodukte gemessen wird und als Maß für das Vorhandensein der zu bestimmenden Nuklemsäuremolekule herangezogen wird.1. A method for the determination of nucleic acid molecules in low concentration in samples to be examined by means of amplification reactions using unlabeled primers as amplification primers and detectable, in particular labeled primers as detection primers and in particular polymerases and / or ligases, the detectable primers hybridizing to the amplification products and the Decrease in the concentration of the detectable, in particular marked primers, and / or the increase in the concentration of the amplification products is measured and used as a measure of the presence of the nucleic acid molecules to be determined.
2. Verfahren nach Anspruch 1, wobei die an die Amplifi- kationsprodukte hybridisierten detektierbaren, ins¬ besondere markierten Primer, durch die Amplifikations- reaktion in die amplifizierte Nukleinsäure eingebaut werden.2. The method according to claim 1, wherein the detectable, in particular labeled primers hybridized to the amplification products are incorporated into the amplified nucleic acid by the amplification reaction.
3. Verfahren nach Anspruch 1, wobei die detektierbaren, insbesondere markierten Primer, Nukleinsäuren mit einem 3 ' -termmalen Didesoxynucleotid oder PNA smd.3. The method according to claim 1, wherein the detectable, in particular labeled primers, nucleic acids with a 3 '-terminal dideoxynucleotide or PNA smd.
4. Verfahren nach mindestens einem der Ansprüche 1 bis 3, wobei die detektierbaren, insbesondere markierten Primer, mit fluoreszierenden Gruppen markiert sind.4. The method according to at least one of claims 1 to 3, wherein the detectable, in particular labeled primers, are labeled with fluorescent groups.
5. Verfahren nach mindestens einem der Ansprüche 1 bis 4, wobei als Amplifikationsreaktion primerabhangige Reakt¬ ionen wie Polymerase-Ketten-Reaktion (PCR) , isothermale 3 SR (seif-sustained-sequence-replication) , Strand- Displacement-Amplification (SDA) , Reverse Transkriptase PCR (RT-PCR) und/oder Nucleic Acid Sequence-based Amplification (NASBA) eingesetzt werden. 5. The method according to at least one of claims 1 to 4, wherein as amplification reaction primer-dependent Reakt¬ ions such as polymerase chain reaction (PCR), isothermal 3 SR (soap-sustained-sequence-replication), beach displacement amplification (SDA) , Reverse transcriptase PCR (RT-PCR) and / or nucleic acid sequence-based amplification (NASBA) can be used.
6. Verfahren nach mindestens einem der Ansprüche 1 bis 4 , wobei als Amplifikationsreaktion die Ligase-Chain- Reaction oder gap-Ligase-Chain-Reaction eingesetzt wird.6. The method according to at least one of claims 1 to 4, wherein the amplification reaction, the ligase chain reaction or gap ligase chain reaction is used.
7. Verfahren nach mindestens einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, daß die Abnahme der Konzen¬ tration der detektierbaren, insbesondere markierten Primer, und/oder die Zunahme der Konzentration der Amplifikationsprodukte mittels Fluoreszenzspektros- kopie, insbesondere Fluoreszenzkorrelationsspektros- kopie (FCS) , gemessen wird.7. The method according to at least one of claims 1 to 6, characterized in that the decrease in the concentration of the detectable, in particular labeled primers, and / or the increase in the concentration of the amplification products by means of fluorescence spectroscopy, in particular fluorescence correlation spectroscopy (FCS) , is measured.
8. Verfahren nach mindestens einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, daß die Polymerase keine 5'-3'- Exonukleaseaktivität aufweist.8. The method according to at least one of claims 1 to 7, characterized in that the polymerase has no 5'-3'-exonuclease activity.
9. Verfahren nach mindestens einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, daß die Konzentration des Detektionsprimers gering im Verhältnis zur Konzen¬ tration des Amplifikationsprimers ist.9. The method according to at least one of claims 1 to 8, characterized in that the concentration of the detection primer is low in relation to the concentration of the amplification primer.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, daß die Konzentration des Amplifikationsprimers das 5- bis 200-fache der Konzentration des Detektionsprimers beträgt .10. The method according to claim 9, characterized in that the concentration of the amplification primer is 5 to 200 times the concentration of the detection primer.
11. Verfahren nach mindestens einem der Ansprüche 1 bis 10, dadurch gekennzeichnet, daß das Verfahren mittels Probenträgern, insbesondere Polycarbonat-Folien, durch¬ geführt wird.11. The method according to at least one of claims 1 to 10, characterized in that the method is carried out by means of sample carriers, in particular polycarbonate films.
12. Verfahren nach mindestens einem der Ansprüche 1 bis 11, dadurch gekennzeichnet, daß die Konzentration der nachzuweisenden Nukleinsäuremoleküle bestimmt wird. 12. The method according to at least one of claims 1 to 11, characterized in that the concentration of the nucleic acid molecules to be detected is determined.
13. Verfahren nach Anspruch 12, wobei die Quantifi¬ zierung der nachzuweisenden Nuklemsauremoleküle über eine Verdünnungsreihe bestehend aus mindestens zwei Amplifikationsansatzen erfolgt, indem die Reaktionszeit und/oder die Anzahl der Amplifi- kationszyklen bis zum Erreichen eines zweckmäßigen Schwellenwertes, welcher insbesondere innerhalb der logarithmischen Amplifikationsphase erreicht wird, ermittelt wird. 13. The method according to claim 12, wherein the quantification of the nuclear acid molecules to be detected is carried out via a dilution series consisting of at least two amplification batches, by the reaction time and / or the number of amplification cycles until an appropriate threshold value is reached, which is particularly within the logarithmic amplification phase is reached, is determined.
PCT/EP1996/005472 1995-12-08 1996-12-06 Process for determination of low concentration of nucleic acid molecules WO1997021832A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE19545965A DE19545965A1 (en) 1995-12-08 1995-12-08 Determination of low concentration of specific nucleic acid by amplification
DE19545965.2 1995-12-08
DE19634226.0 1996-08-24
DE19634226A DE19634226A1 (en) 1996-08-24 1996-08-24 Determining very low concentrations of nucleic acid by amplification

Publications (1)

Publication Number Publication Date
WO1997021832A1 true WO1997021832A1 (en) 1997-06-19

Family

ID=26021094

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1996/005472 WO1997021832A1 (en) 1995-12-08 1996-12-06 Process for determination of low concentration of nucleic acid molecules

Country Status (1)

Country Link
WO (1) WO1997021832A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000061720A2 (en) * 1999-04-12 2000-10-19 Nanogen/Becton Dickinson Partnership Allele-specific strand displacement amplification primers and method
WO2001068680A2 (en) * 2000-03-17 2001-09-20 Carl Zeiss Jena Gmbh System and method for analysing active ingredients designed to influence intra-cellular processes
EP1180549A1 (en) * 2000-03-27 2002-02-20 Olympus Optical Co., Ltd. Method of measuring polymorphism
US6365346B1 (en) 1998-02-18 2002-04-02 Dade Behring Inc. Quantitative determination of nucleic acid amplification products
US6778724B2 (en) 2000-11-28 2004-08-17 The Regents Of The University Of California Optical switching and sorting of biological samples and microparticles transported in a micro-fluidic device, including integrated bio-chip devices
US7745221B2 (en) 2003-08-28 2010-06-29 Celula, Inc. Methods and apparatus for sorting cells using an optical switch in a microfluidic channel network
US20130095489A1 (en) * 2010-05-04 2013-04-18 Centers For Disease Control And Prevention Process for detection of multidrug resistant tuberculosis using real-time pcr and high resolution melt analysis

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993010267A1 (en) * 1991-11-15 1993-05-27 Igen, Inc. Rapid assays for amplification products
WO1994002634A1 (en) * 1992-07-24 1994-02-03 University Of South Australia Amplification and detection process
EP0639647A2 (en) * 1993-07-08 1995-02-22 Tanabe Seiyaku Co., Ltd. Assay for detecting nucleic acid sequence
EP0678581A1 (en) * 1994-04-18 1995-10-25 Becton, Dickinson and Company Fluorescence polarization detection of nucleic acid amplification
EP0714986A1 (en) * 1994-12-01 1996-06-05 Tosoh Corporation Method of detecting specific nucleic acid sequences
EP0731173A2 (en) * 1995-03-10 1996-09-11 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Berlin Method for the direct detection of a few oligonucleotides

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993010267A1 (en) * 1991-11-15 1993-05-27 Igen, Inc. Rapid assays for amplification products
WO1994002634A1 (en) * 1992-07-24 1994-02-03 University Of South Australia Amplification and detection process
EP0639647A2 (en) * 1993-07-08 1995-02-22 Tanabe Seiyaku Co., Ltd. Assay for detecting nucleic acid sequence
EP0678581A1 (en) * 1994-04-18 1995-10-25 Becton, Dickinson and Company Fluorescence polarization detection of nucleic acid amplification
EP0714986A1 (en) * 1994-12-01 1996-06-05 Tosoh Corporation Method of detecting specific nucleic acid sequences
EP0731173A2 (en) * 1995-03-10 1996-09-11 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Berlin Method for the direct detection of a few oligonucleotides

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
EIGEN M ET AL: "Sorting single molecules: Application to diagnostics and evolutionary biotechnology", PROC. NATL. ACAD. SCI. USA, vol. 91, June 1994 (1994-06-01), pages 5740 - 47, XP002029412 *
KINJO M ET AL: "Ultrasensitive hybridization using fluorescence correlation spectroscopy", NUCLEIC ACIDS RESEARCH, vol. 23, no. 10, 25 May 1995 (1995-05-25), pages 1795 - 99, XP002029411 *
WALTER N ET AL: "Fluorescence correlation analysis of probe diffusion simplifies pathogen detection by PCR", PROC. NATL. ACAD. SCI. USA, vol. 93, November 1996 (1996-11-01), pages 12805 - 810, XP002029413 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6365346B1 (en) 1998-02-18 2002-04-02 Dade Behring Inc. Quantitative determination of nucleic acid amplification products
WO2000061720A2 (en) * 1999-04-12 2000-10-19 Nanogen/Becton Dickinson Partnership Allele-specific strand displacement amplification primers and method
WO2000061720A3 (en) * 1999-04-12 2001-01-18 Nanogen Becton Dickinson Partn Allele-specific strand displacement amplification primers and method
WO2001068680A2 (en) * 2000-03-17 2001-09-20 Carl Zeiss Jena Gmbh System and method for analysing active ingredients designed to influence intra-cellular processes
WO2001068680A3 (en) * 2000-03-17 2002-08-22 Zeiss Carl Jena Gmbh System and method for analysing active ingredients designed to influence intra-cellular processes
EP1180549A1 (en) * 2000-03-27 2002-02-20 Olympus Optical Co., Ltd. Method of measuring polymorphism
EP1180549A4 (en) * 2000-03-27 2004-03-10 Olympus Optical Co Method of measuring polymorphism
US6778724B2 (en) 2000-11-28 2004-08-17 The Regents Of The University Of California Optical switching and sorting of biological samples and microparticles transported in a micro-fluidic device, including integrated bio-chip devices
US7745221B2 (en) 2003-08-28 2010-06-29 Celula, Inc. Methods and apparatus for sorting cells using an optical switch in a microfluidic channel network
US8426209B2 (en) 2003-08-28 2013-04-23 Celula, Inc. Methods and apparatus for sorting cells using an optical switch in a microfluidic channel network
US20130095489A1 (en) * 2010-05-04 2013-04-18 Centers For Disease Control And Prevention Process for detection of multidrug resistant tuberculosis using real-time pcr and high resolution melt analysis

Similar Documents

Publication Publication Date Title
DE69838210T2 (en) Labeled primer, suitable for the detection of nucleic acids
DE69232773T3 (en) Device for the detection of nucleic acid amplification reactions
DE10150121B4 (en) Real-time detection of DNA amplification products
DE60213730T2 (en) Real-time quantification with internal standards
DE60023056T2 (en) Method for quantifying an analyte
DE69528670T2 (en) DETECTION OF NUCLEIC ACIDS BY NUCLEASE-CATALYZED PRODUCT PRODUCTION
DE69828908T2 (en) FLUORIMETRIC SYSTEM FOR THE DETECTION OF NUCLEIC ACIDS
DE69133574T2 (en) Method for distinguishing sequence variants
DE69829328T2 (en) Strand Displacement Amplification of RNA
EP0705905B1 (en) Method for the sensitive detection of nucleic acids
DE60014762T2 (en) Method for the detection of ribonucleic acids
DE60129869T2 (en) Method for the quantification of nucleic acids in real time by means of efficiency correction
DE69533660T2 (en) Homogeneous method for detection of double-stranded nucleic acids by means of fluorescent dyes and kits useful for this
EP0718408B1 (en) Sensitive method for detecting nucleic acids
DE60030145T2 (en) DETECTION PROCEDURE FOR SHORT SEQUENCE VARIANTS
DE60204874T2 (en) METHOD FOR DETECTING NUCLEIC ACIDS
DE19915141A1 (en) Detection of nucleic acid amplificates
DE60209617T2 (en) Quantitative multiplex PCR with a large dynamic range
EP0892070B1 (en) Integrated process and system for the amplification and detection of nucleic acids
DE69822685T2 (en) Method for determining nucleic acid sequences
EP3559275A1 (en) Two-part mediator probe
DE602004008740T2 (en) Method for determining the amount of template nucleic acid present in a sample
WO1997021832A1 (en) Process for determination of low concentration of nucleic acid molecules
EP0437774B1 (en) Process for the preparation of modified nucleic acids
DE60122043T2 (en) Oligonucleotides for the detection of 'Vibrio parahaemolyticus' and detection method for 'Vibrio parahaemolyticus' using the same oligonucleotides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97521718

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase