EP1616024A1 - The use of pde4d in the screening for medicaments against atherosclerosis - Google Patents
The use of pde4d in the screening for medicaments against atherosclerosisInfo
- Publication number
- EP1616024A1 EP1616024A1 EP04726162A EP04726162A EP1616024A1 EP 1616024 A1 EP1616024 A1 EP 1616024A1 EP 04726162 A EP04726162 A EP 04726162A EP 04726162 A EP04726162 A EP 04726162A EP 1616024 A1 EP1616024 A1 EP 1616024A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- pde4d
- pde4d7
- pde4
- compound
- atherosclerosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
- G01N2800/323—Arteriosclerosis, Stenosis
Definitions
- the PDE4 phosphodiesterases exist as a family of four enzymes, PDE4A, PDE4B, PDE4C and PDE4D.
- the PDE4 isoenzymes specifically degrade cAMP and are a common target for such pharmacological agents as antidepressants (for example, rolipram).
- antidepressants for example, rolipram.
- the PDE4D isoform several splice forms are known. Among them are the long isoforms, of which 6 are known, namely PDE4D3, PDE4D4, PDE4D5, PDE4D6, PDE4D7 and PDE4D8.
- Isoform PDE4D5 was disclosed by Bolger et al. (Characterization of five different proteins produced by alternatively spliced mRNAs from the human cAMP- specific phosphodiesterase PDE4D gene, Biochem. J.(1997), 328, 539-548). Isoform PDE4D7 was recently disclosed in WO02/074992. The PDE4D gene locus has been linked to stroke (WO02/074992). However, there has been no indication so far for an involvement of PDE4D in atherosclerosis or restenosis.
- PDE4 preferably PDE4D, more preferably PDE4D5 or
- PDE4D7 was identified as a novel target for the identification of compounds that can be used for the treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or for the treatment of restenosis.
- PAOD Peripheral Arterial Occlusive Disease
- PDE4 was identified as a novel target for identifying compounds for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or of restenosis.
- PAOD Peripheral Arterial Occlusive Disease
- the PDE4 inhibitor cilomilast improved walking capacity in a rat model for PAOD.
- the novel target is PDE4D
- the novel target is PDE4D5 (Seq ID No. 4 and the homologues from other species) or PDE4D7 (Seq ID No. 1 to 3 and homologues from other species).
- the novel target is PDE4D7.
- PDE4D5 and especially PDE4D7 are up-regulated in the media and intima of balloon-injured rat carotid arteries.
- the present invention provides a novel use of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, for identifying a compound which inhibits atherosclerosis, preferably Peripheral Arterial Occlusive Disease (PAOD), or restenosis. Most preferably, PDE4D7 is used.
- PDE4D preferably PDE4D, more preferably of PDE4D5 or PDE4D7, for identifying a compound which inhibits atherosclerosis, preferably Peripheral Arterial Occlusive Disease (PAOD), or restenosis.
- PAOD Peripheral Arterial Occlusive Disease
- Most preferably, PDE4D7 is used.
- the present invention also provides a novel process for identifying and obtaining a compound for therapy of atherosclerosis, said process comprising measuring the activation or inhibition of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably PDE4D7, and a compound identified by said process.
- said compound is an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7.
- said compound is an inhibitor of PDE4D7.
- Procedures to measure phosphodiesterase activity are well known in the art. One non-limiting example for such an assay is described in the examples.
- the identification of compounds for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or of restenosis may also involve administration of compounds suspected to inhibit PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7, most preferably PDE4D7, to an animal in which atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis is induced, such as in the rat balloon- injury model, or, as another non-limiting example, in ApoE knockout mice which are fed a Western Type diet or a normal Chow diet as a control (eg described by Nakashima et al., ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree, Arterioscler.
- said animal is a non-human animal.
- the present invention also provides a process for identifying and obtaining a compound for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or restenosis, said process comprising administering a compound suspected to be an activator or inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, to an animal in which atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis is induced, and measuring the extent of atherosclerosis, preferably of Peripheral Occlusive Disease, or restenosis as compared to placebo or carrier-treated animals.
- said compound is an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7.
- a process for identifying activators or inhibitors for PDE4D may comprise using a core PDE4D construct (Seq ID No. 5) which is a PDE4D with an amino acid sequence common to all PDE4D long form isoforms.
- Figure 5 shows an inhibition of core PDE4D activity by Rolipram.
- the terms as shown herein, the terms as opposedactivator or inhibitor of PDE4", proportionactivator or inhibitor of PDE4D", conjunctionactivator or inhibitor of PDE4D5 or PDE4D7” refer to compounds that activate or inhibit PDE4, PDE4D, PDE4D5 and/or PDE4D7 cellular function, either by acting directly on the phosphodiesterase of PDE4, PDE4D, PDE4D5 and/or PDE4D7, or by modulating indirectly the function of PDE4, PDE4D, PDE4D5 and/or PDE4D7, eg. by altering its subcellular targeting.
- the present invention also pertains to a compound identified by any of the processes hereinbefore described.
- the present invention pertains to a pharmaceutical composition
- a pharmaceutical composition comprising an activator or inhibitor of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, identified by the process herein before described, and a pharmaceutically acceptable carrier.
- said pharmaceutical composition comprises an inhibitor of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7.
- phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/ or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable salts refer to derivatives of the identified agents wherein the parent agent is modified by making acid or base salts thereof.
- pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
- the pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
- such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, benzenesulfonic, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
- inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like
- organic acids such as acetic, propionic, succinic, glycolic
- the pharmaceutically acceptable salts of the present invention can be synthesized from the parent agent which contains a basic or acidic moiety by conventional chemical methods.
- such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
- Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
- the agents identified by the method of the invention may be modified to achieve (i) modified site of action, spectrum of activity, and/or (ii) improved potency, and/or (iii) decreased toxicity (improved therapeutic index), and/or (iv) decreased side effects, and/or (v) modified onset of action, duration of effect, and/or (vi) modified kinetic parameters (resorption, distribution, metabolism and excretion), and/or (vii) modified physico-chemical parameters (solubility, hygroscopicity, color, taste, odor, stability, state), and/or (viii) improved general specificity, organ/tissue specificity, and/or (ix) optimized application form and route by (i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbon acids, or (iii) esterification of hydroxyl groups to, e.g.
- the carrier material can be an organic or inorganic one suitable for eteral, percutaneous or parenteral administration.
- Suitable carriers include water, gelatin, gum arabic, lactose, starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, petroleum jelly and the like.
- the pharmaceutical preparations may contain other pharmaceutically active agents. Additional additives such as flavoring agents, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding.
- a method of the present invention involves the administration of a therapeutically effective amount of an antisense oligonucleotide having a sequence capable of binding specifically with any sequences of genomic DNA or an mRNA molecule which encodes a PDE4, preferably PDE4D, or more preferably PDE4D5 or PDE4D7, so as to prevent transcription or translation of PDE4 mRNA, preferably PDE4D, more preferably PDE4D5 or PDE4D7 mRNA, most preferably PDE4D7 mRNA.
- antisense is meant a composition containing a nucleic acid sequence which is complementary to the "sense" strand of a specific nucleic acid sequence.
- the complementary nucleotides combine with endogenous sequences produced by the cell to form duplexes and to block either transcription or translation. See, e.g., Agrawal, S., ed. (1996) Antisense Therapeutics, Humana Press Inc., Totawa NJ; Alama et al. (1997) Pharmacol. Res. 36:171-178; Crooke, S.T. (1997) Adv. Pharmacol. 40:1-49; and Lavroskv et al. (1997) Biochem. Mol. Med.
- Antisense sequences can be any nucleic acid material, including DNA, RNA, or any nucleic acid mimics or analogs. See, e.g., Rossi et al. (1991) Antisense Res. Dev. 1:285-288; Pardridge et al. (1995) Proc. Nat. Acad. Sci. 92:5592-5596; Nielsen and Haaima (1997) Chem. Soc. Rev. 96:73-78; and Lee et al. (1998) Biochemistry 37:900- 1010. Delivery of antisense sequences can be accomplished in a variety of ways, such as through intracellular delivery using a recombinant vector.
- Antisense oligonucleotides of about 15 to 25 nucleic acid bases are typically preferred as such are easily synthesized and are capable of producing the desired inhibitory effect.
- Molecular analogs of antisense oligonucleotides may also be used for this purpose and can have added advantages such as stability, distribution, or limited toxicity advantageous in a pharmaceutical product.
- chemically reactive groups such as iron-linked ethylenediamine-tetraacetic acid (EDTA-Fe), can be attached to antisense oligonucleotides, causing cleavage of the RNA at the site of hybridization.
- RNA interference may be obtained, as a non-limiting example, by the process disclosed in GB 2372995 for inhibiting the expression of a target gene in cells or tissue comprises infection of said cells or tissue with (a) viral particles containing single stranded ribonucleic acid (ss RNA) expressing a sense RNA strand and (b) viral particles containing single stranded ribonucleic acid (ss RNA) expressing an anti-sense RNA strand, wherein the sense and anti-sense RNA strands comprise homologous nucleotide sequences to a portion of said target gene.
- ss RNA single stranded ribonucleic acid
- ss RNA single stranded ribonucleic acid
- Rat carotid artery balloon injury is a well accepted technology to study the proliferative events in arteries. It was originally used to help the analysis of the smooth muscle cell proliferative component of atherosclerosis, but recently was also used as a model of restenosis after angioplasty.
- the SMC response to injury is similar in femoral and carotid arteries. Since it is technically much easier and experimentally much more reproducible the model was applied to the carotid artery. By all means it is intended to serve as model of a hall mark of Peripheral Arterial Occlusive Disease PAOD which is atherosclerosis in femoral arteries.
- the PDE4 inhibitor Rolipram inhibits neointima formation in this model.
- the present invention also provides a method of treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or of restenosis comprising administering an activator or inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7 to a subject suffering of atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis.
- an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7 is administered.
- the present invention pertains to the use of an activator or inhibitor of PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7 for the preparation of a medicament for the treatment of atherosclerosis, restenosis or, preferably, Peripheral Arterial Occlusive Disease.
- an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7 is used.
- the present invention also provides the compounds, processes, uses and compositions substantially as hereinbefore described, especially with reference to the foregoing examples.
- Q8CG05 mouse PDE4D7 (Seq ID No. 1); Q8CH04: rat PDE4D7 (Seq ID No. 2); Q8IVD2: human PDE4D7 (Seq ID No. 3)
- Lanes 1,2,3 Media and intima, balloon-injured, left carotid, 3 days post balloon inury
- Lanes 4,5,6 Media, right carotis (uninjured, control), 3 days
- Lane 7 media and intima, balloon-injured, left carotid, 14 d post injury
- Lane 8 right carotid, non-injured, control, 14 days
- Lanes 9,10 media and intima, balloon-injured, left carotid, 7 days post injury
- Lanes 11,12 right carotid, non-injured, 7 days
- PK analysis of lauric acid experiment Plasmalevels of PDE4 inhibitor after oral dosing.
- An anti-peptide antibody was generated based on the specific sequence in human PDE4D7 (H 2 N-CADLKSESENIQRPTS-CONH 2 ). This antibody was purified using the column-bound synthetic peptide for affinity chromatography. The specificity of this antibody was tested by Western blotting using recombinant preparations of human PDE 4D3, PDE4D5, PDE4D6, PDE4D7, PDE4D8 as samples. The antibody exclusively detected hPDE4D7 in these experiments. The ability of the antibody to cross-react with rat or mouse is suggested by the high degree of conservation between human, rat or mouse PDE4D7, as shown in Figure 3.
- the frozen carotid arteries were powdered in a mortar with liquid nitrogen cooling.
- the homogenate was taken up in sample solution (7 M urea, 2 M thiourea, 50 mM Tris, 2% (w/v) CHAPS (2-[(3-Cholamidopropyl)dimethyl-ammonio] l-propane sulfonate, Roche Diagnostics, Mannheim, Germany), 0.4% (w/v), Dithioerythritol, 0.5% (v/v) ampholytes (Resolytes 3.5 - 10, BDH, Poole, England)) and left at room temperature for 15 min.
- the homogenate was centrifuged at 100,000 x g for 1 h at 4°C and the supernatant was collected.
- the protein concentration was estimated using the BioRad protein assay.
- the strips were equilibrated by two consecutive incubations in 6 M urea, 50 mM Tris-HCl, pH 7.5, 30% (v/v) glycerol, 2% (w/v) SDS, 30 mM Dithioerythritol, and in 6 M urea, 50 mM Tris- HCl, pH 7.5, 30% (v/v) glycerol, 2% (w/v) SDS, 136 mM Thioacetamide for 15 min each.
- the equilibrated strips were placed into the IEF well of a Criterion 4-15% gels.
- the blots were blocked with 5% non-fat dry milk in TBS with shaking overnight at 4°C. After washing, 100 ng/ml of the affinity-purified anti-PDE4D7 antibody in TBS + 0.1% (v/v) Tween 20 was added and the blots were incubated with shaking for 90 min at room temperature. The blots were washed and peroxidase-conjugated anti-rabbit antibody was added (dilution 1/50000, BioRad) and incubated with the blots for another 90 min. After washing, the blots were developed with Super Signal West Femto substrate (PIERCE, Rockford, IL) and exposed to film for 5 - 10 min.
- PIERCE Super Signal West Femto substrate
- Rolipram at appropriate concentration was prepared in PEG400 (25mg or 2.5mg/ml) and loaded into osmotic minipumps (2002 Alzet) to deliver a constant dose of 0.8 or 8mg/kg/d respectively per rat.
- the minipump was placed sc. in the neck position of the rat under anesthesia during surgery for the balloon catheter injury.
- the minipump was connected to the jugular vein via a sylastic catheter to ensure constant i.v. infusion over the entire experimental period of 14d.
- Plasmalevels were determined at the end of the experiment using LCMSMS.
- rolipram inhibited neointima formation in balloon catheter injured rat carotid arteries significantly at 0.8 and 8mg/kg/day iv.
- the higher dose was repeated in an independent experiment with a new set of rats (exp 2).
- the plasma levels determined at the end of the experiment reflect steady state exposure. It is interesting to note that plasma levels are well within the expected range of Ki of Rolipram for PDE4 enzymes.
- Table 1 shows the summary of the efficacy data of rolipram mediated inhibition of neointima formation as measured by histomorphometry on plastic embedded cross sections (2 per carotid).
- a cDNA encoding the core fragment that is common for all the PDE4D isoforms 3- 8 starting with the amino acid sequence FDV carboxyterminal to the LFl splice site was generated by PCR using a 5' oligonucleotide with a Hindlll cloning site (gatgaattcaagctttttgatgtggacaatggca) introducing two additional amino acid (K and L) in front of the FDV sequence.
- a set of primers was used that either generated the native sequence (gtgatatctcattatcacgtgtcaggagaacgatcatctatgaca) or added a sequence encoding 6xHis residues (gtgatatctcattatcaa tgggatggtgatggtgcgtgtcaggagaacgatcatctatgac) to enable rapid purification of the recombinant proteins.
- the cDNA encoding the core construct was cloned as a EcoRI- EcoRV fragment into the expression vector pENTRTMla (GIBCO/BRL) Isoforms (except core construct):
- the DNA fragments encoding the isoform specific N-termini were generated by using synthetic oligonucleotides with terminal restriction enzyme sites for EcoRI and Hindlll incorporated for directional cloning. These isoform specific DNA fragments were fused to the core construct sequence via the Hindlll site introducing two additional amino acid residues (K and L). The integrity of the clones was confirmed by DNA sequencing prior to expression.
- the cDNAs were cloned into the pFASTBACl vector (Life Technologies. Inc) for expression in insect cells and the products were confirmed by sequencing. After recombination into the baculovirus genome the purified viral DNAs were transformed into the insect cells. Sf9 cells were cultured at 27°C in TC100 medium (BioWhittaker) with 5% (v/v) fetal calf serum. Virus stocks were generated with a titer of 1.5x 10 pfu/ml. For large scale production of the isoforms 1-24 L fermentations of Sf9 cells were infected with a MOI of l.
- the 6xHis tagged PDE4D polypeptides DC, D5 and D7 were produced in Sf9 cells in IL spinner flasks using SF1 medium in the absence of serum. Infected cells were harvested 3 days after infection with the recombinant baculoviruses.
- the PDE4D core construct DC was produced in a 24 L Airlifter Fermenter with 15 L medium (SF1 with 0% serum), 0.15 L lipids and 9 L Sf9 cells. During the entire fermentation procedure the cells were cultured at pH 6.2, 27.0+/- 0.2°C and a pO 2 of 30.0+/- 0.5 %. Cells were grown for 3 days. The cell number at infection was 2.3x10° cells/ml. Cells were infected with 450 ml recombinant baculovirus. Cells were harvested at 68h post infection and the cell pellet as well as the cconcentrated supernatant stored at -80°C until further processing.
- the supernate was filtrated through a filter with a pore size of 1.2 ⁇ M (Minisart; Sartorius, Germany) and then applied to a 6 ml Ni-NTA agarose column at 2 ml/min. After equilibration with 50 mM HEPES pH 7.8, 300 mM NaCl, 10 mM imidazole, protein was eluted with a linear 30 ml gradient from 10 to 230 mM imidazole in the same buffer. Fractions containing the PDE4D isoform as analyzed by Coomassie stained SDS-PAGE were pooled and stored frozen at -80°C. Fresh Ni-NTA agarose material was used for every different PDE4D isoform preparation in order to prevent cross contamination of isoforms.
- Relative concentrations of Ni-NTA agarose purified isoform preparations were estimated by SDS-PAGE. Equal volume amounts of isoform preparations were applied to a gradient gel (4-12% NuPage; Invitrogen). After electrophoresis the Coomassie stained polyacrylamide gel was imaged by a video imaging system. Optical densities of PDE4D bands were integrated using a Macintosh computer and the public domain software "NIH Image", version 1.61 (developed at the U.S. National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih-image/). The integrated arbitrary units per PDE4D band as returned by the software reflect the relative PDE4D concentrations within the original pools. Identities of PDE4D and tubulin bands had been verified by independent SDS-PAGE, excision of corresponding bands, trypsin cleavage and identification of tryptic peptides by MALDI-MS.
- Ni-NTA agarose purified isoform preparation 50 ⁇ l of Ni-NTA agarose purified isoform preparation was injected into a Superose 12 size exclusion column (type PC3.2/30; Amersham Pharmacia Biotech), equilibrated with 50 mM TrisHCl pH 7.7, 100 mM NaCl, 0.5 mM MgCl2 at a flow rate of 0.1 ml/ in at 4°C. Chromatograms were recorded at 278 nm. Starting from the elution volume, the column eluate was collected as 50 ⁇ l fractions.
- the phosphodiesterase activity of the core contruct and PDE4D3, 5 or 7 was measured using the HEFP Phosphodiesterase Assay Kit (Molecular Devices). 2 ⁇ l of PDE4D5 or 7 or PDE4D core construct, 2 ⁇ l of cAMP (to a final concentration of 40 nM) and 1 ⁇ l of test substance or carrier were incubated for 45 min on a shaker. 12 ⁇ l of Binding Solution provided by the kit (with beads diluted 1:320) were added, and the reaction mixture incubated on a shaker for 2 hours.
- Fluorescence polarisation of the samples was measured in a Packard BioScience Fusion a-FP HT using as an emission filter a Polarizer 535, and as an excitation filter, Fluorescein 485/20.
- Inhibition of the phosphodiesterase activity of the PDE4D core construct was determined using Rolipram as inhibitor, and using PDE4D core construct at 30 ng/ml.
- Rats were injected intra-arterially with 75ug of Lauric acid in lOul of pure ethanol.
- the injection site at the proximal femoral artery was closed with histo-acryl.
- the wound was closed and the animal allowed to recover.
- Rats had been trained to walk on a treadmill prior to LA injection as indicated in Fig 6.
- Drugs were applied by gavage as indicated.
- the treatment causes inflammation in small vessels, which can lead to PAOD.
- Rats were forced to exercise on the treadmill at 25m/min and 4.5% slope until they fatigued. Fatigue was defined as the time needed until a total of 5 small electric stimuli have been cumulatively applied as re-enforcement for the rat to run on the freadmill.
- the PDE4 inhibitor cilomilast was compared to the PDE3 inhibitor Cilostazol.
- Cilostazol is used in the treatment for PAOD and thus serves as a positive control.
- Cilomilast showed equipotent efficacy as compared to Cilostazol (Fig. 7).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Heart & Thoracic Surgery (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Cardiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Vascular Medicine (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the use of PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7, as a novel target for the identification of compounds that can be used for the treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or for the treatment of restenosis.
Description
THE USE OF PDE4D IN THE SCREENING FOR MEDICAMENTS AGAINST ATHEROSCLEROSIS
PDE4D in atherosclerosis
The PDE4 phosphodiesterases exist as a family of four enzymes, PDE4A, PDE4B, PDE4C and PDE4D. The PDE4 isoenzymes specifically degrade cAMP and are a common target for such pharmacological agents as antidepressants (for example, rolipram). Of the PDE4D isoform, several splice forms are known. Among them are the long isoforms, of which 6 are known, namely PDE4D3, PDE4D4, PDE4D5, PDE4D6, PDE4D7 and PDE4D8. All of these have in common the LR1 and UCR1 sites and the domains located at the C-terminus of these sites, but they have different N-terminal domains. Isoform PDE4D5 was disclosed by Bolger et al. (Characterization of five different proteins produced by alternatively spliced mRNAs from the human cAMP- specific phosphodiesterase PDE4D gene, Biochem. J.(1997), 328, 539-548). Isoform PDE4D7 was recently disclosed in WO02/074992. The PDE4D gene locus has been linked to stroke (WO02/074992). However, there has been no indication so far for an involvement of PDE4D in atherosclerosis or restenosis.
In the present invention PDE4, preferably PDE4D, more preferably PDE4D5 or
PDE4D7, was identified as a novel target for the identification of compounds that can be used for the treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or for the treatment of restenosis.
In the present invention, PDE4 was identified as a novel target for identifying compounds for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or of restenosis. As shown in Figures 7 and 8, the PDE4 inhibitor cilomilast improved walking capacity in a rat model for PAOD. In a preferred embodiment, the novel target is PDE4D, in an even more preferred embodiment, the novel target is PDE4D5 (Seq ID No. 4 and the homologues from other species) or PDE4D7 (Seq ID No. 1 to 3 and homologues from other species). In a most preferred embodiment, the novel target is PDE4D7. As shown in Figures 1 and 4, PDE4D5 and
especially PDE4D7 are up-regulated in the media and intima of balloon-injured rat carotid arteries.
Thus, the present invention provides a novel use of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, for identifying a compound which inhibits atherosclerosis, preferably Peripheral Arterial Occlusive Disease (PAOD), or restenosis. Most preferably, PDE4D7 is used.
The present invention also provides a novel process for identifying and obtaining a compound for therapy of atherosclerosis, said process comprising measuring the activation or inhibition of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably PDE4D7, and a compound identified by said process. Most preferably, said compound is an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7. Most preferably, said compound is an inhibitor of PDE4D7. Procedures to measure phosphodiesterase activity are well known in the art. One non-limiting example for such an assay is described in the examples. The identification of compounds for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or of restenosis may also involve administration of compounds suspected to inhibit PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7, most preferably PDE4D7, to an animal in which atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis is induced, such as in the rat balloon- injury model, or, as another non-limiting example, in ApoE knockout mice which are fed a Western Type diet or a normal Chow diet as a control (eg described by Nakashima et al., ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree, Arterioscler. Thromb. (1994) Jan;14(l):133-40) or in the lauric acid model (Kawamura et al., 1985, Arzneimittelforschung 35/7A):1154-1156). Preferably, said animal is a non-human animal. Thus, the present invention also provides a process for identifying and obtaining a compound for therapy of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or restenosis, said process comprising administering a compound suspected to be an activator or inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, to an animal in which atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis is induced, and measuring the extent of atherosclerosis, preferably of Peripheral Occlusive Disease, or restenosis as compared to placebo or carrier-treated animals. Most preferably, said compound is an
inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7.
A process for identifying activators or inhibitors for PDE4D may comprise using a core PDE4D construct (Seq ID No. 5) which is a PDE4D with an amino acid sequence common to all PDE4D long form isoforms. Figure 5 shows an inhibition of core PDE4D activity by Rolipram.
As used herein, the terms „activator or inhibitor of PDE4",„activator or inhibitor of PDE4D",„activator or inhibitor of PDE4D5 or PDE4D7" refer to compounds that activate or inhibit PDE4, PDE4D, PDE4D5 and/or PDE4D7 cellular function, either by acting directly on the phosphodiesterase of PDE4, PDE4D, PDE4D5 and/or PDE4D7, or by modulating indirectly the function of PDE4, PDE4D, PDE4D5 and/or PDE4D7, eg. by altering its subcellular targeting.
The present invention also pertains to a compound identified by any of the processes hereinbefore described.
Further to this, the present invention pertains to a pharmaceutical composition comprising an activator or inhibitor of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, identified by the process herein before described, and a pharmaceutically acceptable carrier. Most preferably, said pharmaceutical composition comprises an inhibitor of the phosphodiesterase activity of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7.
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/ or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
As used herein, "pharmaceutically acceptable salts" refer to derivatives of the identified agents wherein the parent agent is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable
salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, benzenesulfonic, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
The pharmaceutically acceptable salts of the present invention can be synthesized from the parent agent which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
The agents identified by the method of the invention may be modified to achieve (i) modified site of action, spectrum of activity, and/or (ii) improved potency, and/or (iii) decreased toxicity (improved therapeutic index), and/or (iv) decreased side effects, and/or (v) modified onset of action, duration of effect, and/or (vi) modified kinetic parameters (resorption, distribution, metabolism and excretion), and/or (vii) modified physico-chemical parameters (solubility, hygroscopicity, color, taste, odor, stability, state), and/or (viii) improved general specificity, organ/tissue specificity, and/or (ix) optimized application form and route by (i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbon acids, or (iii) esterification of hydroxyl groups to, e.g. phosphates, pyrophosphates or sulfates or hemi succinates, or (iv) formation of pharmaceutically acceptable salts, or (v) formation of pharmaceutically acceptable complexes, or (vi) synthesis of pharmacologically active polymers, or (vii) introduction of hydrophilic moieties, or (viii) introduction/exchange of substituents on aromates or side chains, change of substituent pattern, or (ix) modification by introduction of isosteric or bioisosteric moieties, or (x) synthesis of homologous compounds, or (xi) introduction of branched side chains, or (xii) conversion of alkyl substituents to cyclic analogues, or (xiii) derivatisation of hydroxyl group to ketales, acetales, or (xiv) N-acetylation to amides, phenylcarbamates, or (xv) synthesis of Mannich bases, imines, or (xvi) transformation of ketones or aldehydes to Schiff s bases,
oximes, acetales, ketales, enolesters, oxazolidines, thiozolidines or combinations thereof; and (b) formulating the product of said modification with a pharmaceutically acceptable carrier or a carrier/ diluent acceptable for fragrance or flavor compositions or products.
Any conventional carrier material can be utilized. The carrier material can be an organic or inorganic one suitable for eteral, percutaneous or parenteral administration. Suitable carriers include water, gelatin, gum arabic, lactose, starch, magnesium stearate, talc, vegetable oils, polyalkylene-glycols, petroleum jelly and the like. Furthermore, the pharmaceutical preparations may contain other pharmaceutically active agents. Additional additives such as flavoring agents, stabilizers, emulsifying agents, buffers and the like may be added in accordance with accepted practices of pharmaceutical compounding.
In one embodiment, a method of the present invention involves the administration of a therapeutically effective amount of an antisense oligonucleotide having a sequence capable of binding specifically with any sequences of genomic DNA or an mRNA molecule which encodes a PDE4, preferably PDE4D, or more preferably PDE4D5 or PDE4D7, so as to prevent transcription or translation of PDE4 mRNA, preferably PDE4D, more preferably PDE4D5 or PDE4D7 mRNA, most preferably PDE4D7 mRNA. By "antisense" is meant a composition containing a nucleic acid sequence which is complementary to the "sense" strand of a specific nucleic acid sequence. Once introduced into a cell, the complementary nucleotides combine with endogenous sequences produced by the cell to form duplexes and to block either transcription or translation. See, e.g., Agrawal, S., ed. (1996) Antisense Therapeutics, Humana Press Inc., Totawa NJ; Alama et al. (1997) Pharmacol. Res. 36:171-178; Crooke, S.T. (1997) Adv. Pharmacol. 40:1-49; and Lavroskv et al. (1997) Biochem. Mol. Med.
62(l):ll-22. Antisense sequences can be any nucleic acid material, including DNA, RNA, or any nucleic acid mimics or analogs. See, e.g., Rossi et al. (1991) Antisense Res. Dev. 1:285-288; Pardridge et al. (1995) Proc. Nat. Acad. Sci. 92:5592-5596; Nielsen and Haaima (1997) Chem. Soc. Rev. 96:73-78; and Lee et al. (1998) Biochemistry 37:900- 1010. Delivery of antisense sequences can be accomplished in a variety of ways, such as through intracellular delivery using a recombinant vector.
Antisense oligonucleotides of about 15 to 25 nucleic acid bases are typically preferred as such are easily synthesized and are capable of producing the desired inhibitory effect. Molecular analogs of antisense oligonucleotides may also be used for this purpose and can have added advantages such as stability, distribution, or limited
toxicity advantageous in a pharmaceutical product. In addition, chemically reactive groups, such as iron-linked ethylenediamine-tetraacetic acid (EDTA-Fe), can be attached to antisense oligonucleotides, causing cleavage of the RNA at the site of hybridization. These and other uses of antisense methods to inhibit the in vitro translation of genes are well known in the art. See, e.g., Marcus-Sakura (1988) Anal. Biochem. 172:289.
Inhibition of PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7, most preferably PDE4D7 may also be achieved by using RNA interference. RNA interference may be obtained, as a non-limiting example, by the process disclosed in GB 2372995 for inhibiting the expression of a target gene in cells or tissue comprises infection of said cells or tissue with (a) viral particles containing single stranded ribonucleic acid (ss RNA) expressing a sense RNA strand and (b) viral particles containing single stranded ribonucleic acid (ss RNA) expressing an anti-sense RNA strand, wherein the sense and anti-sense RNA strands comprise homologous nucleotide sequences to a portion of said target gene.
Rat carotid artery balloon injury is a well accepted technology to study the proliferative events in arteries. It was originally used to help the analysis of the smooth muscle cell proliferative component of atherosclerosis, but recently was also used as a model of restenosis after angioplasty. The SMC response to injury is similar in femoral and carotid arteries. Since it is technically much easier and experimentally much more reproducible the model was applied to the carotid artery. By all means it is intended to serve as model of a hall mark of Peripheral Arterial Occlusive Disease PAOD which is atherosclerosis in femoral arteries. As shown in Table 1, the PDE4 inhibitor Rolipram inhibits neointima formation in this model.
Thus, the present invention also provides a method of treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease, or of restenosis comprising administering an activator or inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7 to a subject suffering of atherosclerosis, preferably Peripheral Arterial Occlusive Disease, or restenosis. In a most preferred embodiment, an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7 is administered. Thus, the present invention pertains to the use of an activator or inhibitor of PDE4, preferably PDE4D, more preferably PDE4D5 or
PDE4D7 for the preparation of a medicament for the treatment of atherosclerosis, restenosis or, preferably, Peripheral Arterial Occlusive Disease. In a most preferred embodiment, an inhibitor of PDE4, preferably PDE4D, more preferably of PDE4D5 or PDE4D7, most preferably of PDE4D7, is used.
The present invention also provides the compounds, processes, uses and compositions substantially as hereinbefore described, especially with reference to the foregoing examples.
Brief description of the figures:
Figure 1:
(a) The catheter injured carotid samples are shown on top. Clearly, a ca. 80 kDa protein is detected with the affinity-purified anti-PDE4D7 rabbit polyclonal antibody. PDE4D7 was neither detected in the non-injured right carotid ((a) bottom) nor in the control carotids from untreated animals (b), indicating a strong induction of PDE4D7 expression as a consequence of balloon catheter injury.
Figure 2:
A: Cross-reactivity human and rat PDE4D5 N-terminus: human and rat PDE4D5 are 98.85% identical.
B: The comparisons between UCR1, UCR2 and the catalytic domains of the PDE4 subfamilies A, B, C and D show that the UCRs are about as well-conserved as the catalytic domain.
Figure 3:
Cross reactivity human-rat-mouse PDE4D7:
Q8CG05: mouse PDE4D7 (Seq ID No. 1); Q8CH04: rat PDE4D7 (Seq ID No. 2); Q8IVD2: human PDE4D7 (Seq ID No. 3)
human-rat: 96.8 %
rat-mouse": 98.8 %
Figure 4:
PDE4D5 and PDE4D7 expression in balloon-injured rat carotids
Lanes 1,2,3: Media and intima, balloon-injured, left carotid, 3 days post balloon inury
Lanes 4,5,6: Media, right carotis (uninjured, control), 3 days
Lane 7: media and intima, balloon-injured, left carotid, 14 d post injury
Lane 8: right carotid, non-injured, control, 14 days
Lanes 9,10: media and intima, balloon-injured, left carotid, 7 days post injury
Lanes 11,12: right carotid, non-injured, 7 days
Figure 5:
Rolipram inhibition. Phosphodiesterase activity of the PDE4D core construct (DC) can be inhibited by Rolipram. The IC50 of DC phosphodiesterase activity by Rolipram inhibition was 0.34+/- 0.06 μM.
Figure 6:
Effect of PDE4 inhibitor Cilomilast on Walking Capacity in the Lauric Acid model: Animals were selected according to their ability to walk on the treadmill and matched in 4 groups. The PDE3 inhibitor Cilostazol was used as a positive control.
Figure 7:
Effect of PDE4 inhibitors on Walking Capacity in the Lauric Acid model: Maximal walking distance was measured in weekly intervals.
Figure 8:
Individual results of the effects of PDE4 inhibitor on Walking Capacity in the Lauric Acid rat model.
Figure 9:
Effect of PDE4 inhibitors on Body Weight in the Lauric Acid rat model.
Figure 10:
Side effects of PDE4 inhibitor in the lauric acid rat model: Abnormal Stool/Diarrhea.
Figure 11:
PK analysis of lauric acid experiment: Plasmalevels of PDE4 inhibitor after oral dosing.
Examples
PDE4D5 and PDE4D7 expression in injured rat carotid arteries
Animal surgery
Male (300 - 400g) Wistar Kyoto Rats (RoRo) were obtained from BRL CH-Fϋllinsdorf. The animals were anaesthetized with 5mg/kg Xylazine (Rhompun, Bayer, FRG) and 50mg/kg Ketamin (Ketasol 100, Graeub, CH) i.p. The left carotid was
exposed at the bifurcation and a 2F embolectomy catheter (Edwards laboratories, USA) was inserted. The inflated balloon was pulled through the common carotid artery three times. After permanent ligation of the external carotid artery the wound was closed and the animals kept in pairs with commercial chow and water ad libidum.
Tissue harvest
6 weeks post injury the animals were reanesthesized and killed with an i.v. overdose of anesthetics. After opening the body cavity, rats are perfused with cold PBS via a catheter placed in the aortic arch to flush out the blood, and the carotid arteries harvested. The adventitial issues were removed from the arteries with watchmaker forceps. The carotids were opened longitudinally and any remaining endothelium was removed by sliding movements of the forceps. The carotids consist now only of smooth muscle cell tissue. At this stage the carotids were shock frozen in liquid nitrogen, pooled and stored at -80 degrees Celsius.
Experimental groups
4 experimental groups were pooled:
1. 11 balloon injured carotids 6 weeks post ballooning
2. 11 contralateral uninjured carotid arteries
3. 12 left carotids of unmanipulated rats
4. 12 contralateral right carotids form unmanipulated rats
Antibodies
An anti-peptide antibody was generated based on the specific sequence in human PDE4D7 (H2N-CADLKSESENIQRPTS-CONH2). This antibody was purified using the column-bound synthetic peptide for affinity chromatography. The specificity of this antibody was tested by Western blotting using recombinant preparations of human PDE 4D3, PDE4D5, PDE4D6, PDE4D7, PDE4D8 as samples. The antibody exclusively
detected hPDE4D7 in these experiments. The ability of the antibody to cross-react with rat or mouse is suggested by the high degree of conservation between human, rat or mouse PDE4D7, as shown in Figure 3.
An anti-PDE4D5 peptide antibody was prepared and characterized in a similar way based on the specific sequence H2N -CEKSKTARKSVSPKLSP- CONH2. Again, the ability to cross-react is suggested by the high degree of identity in the N-terminal portion of human and rat PDE4D5, as shown in Figure 2.
Preparation of samples for Two-Dimensional Electrophoresis
The frozen carotid arteries were powdered in a mortar with liquid nitrogen cooling. The homogenate was taken up in sample solution (7 M urea, 2 M thiourea, 50 mM Tris, 2% (w/v) CHAPS (2-[(3-Cholamidopropyl)dimethyl-ammonio] l-propane sulfonate, Roche Diagnostics, Mannheim, Germany), 0.4% (w/v), Dithioerythritol, 0.5% (v/v) ampholytes (Resolytes 3.5 - 10, BDH, Poole, England)) and left at room temperature for 15 min. The homogenate was centrifuged at 100,000 x g for 1 h at 4°C and the supernatant was collected. The protein concentration was estimated using the BioRad protein assay.
Two-Dimensional Polyacrylamide Gel Electrophoresis
Immobilized pH gradient strips ( 11cm, pH 4 - 7, Amersham Biosciences, Little
Chalfont, England) were re-swollen in 7 M urea, 2 M thiourea, CHAPS, 0.4% (w/v), Dithioerythritol, 0.5% (v/v) ampholytes for 6 h, and placed into a Protean IEF cell cup loading tray (BioRad, Hercules, CA). Equal protein amounts (0.5 mg) of the samples were loaded into the cups and isoelectric focusing was performed using the following protocol: 250 V, 2h; gradual increase to 2500 V over 8 h; 2500 V for 8 h. The strips were equilibrated by two consecutive incubations in 6 M urea, 50 mM Tris-HCl, pH 7.5, 30% (v/v) glycerol, 2% (w/v) SDS, 30 mM Dithioerythritol, and in 6 M urea, 50 mM Tris- HCl, pH 7.5, 30% (v/v) glycerol, 2% (w/v) SDS, 136 mM Thioacetamide for 15 min each. The equilibrated strips were placed into the IEF well of a Criterion 4-15% gels. SDS- polyacrylamide electrophoresis and blotting to nitrocellulose membranes (BioRad) was performed according to the gel manufacturer's recommendations. A molecular weight marker (Magic Marker, Invitrogen) was included for molecular weight estimation.
Western Blotting
The blots were blocked with 5% non-fat dry milk in TBS with shaking overnight at 4°C. After washing, 100 ng/ml of the affinity-purified anti-PDE4D7 antibody in TBS + 0.1% (v/v) Tween 20 was added and the blots were incubated with shaking for 90 min at room temperature. The blots were washed and peroxidase-conjugated anti-rabbit antibody was added (dilution 1/50000, BioRad) and incubated with the blots for another 90 min. After washing, the blots were developed with Super Signal West Femto substrate (PIERCE, Rockford, IL) and exposed to film for 5 - 10 min.
Inhibition of neointima formation in balloon catheter injured rat carotid arteries by the PDE4 inhibitor rolipram
Drug application
Rolipram at appropriate concentration was prepared in PEG400 (25mg or 2.5mg/ml) and loaded into osmotic minipumps (2002 Alzet) to deliver a constant dose of 0.8 or 8mg/kg/d respectively per rat. The minipump was placed sc. in the neck position of the rat under anesthesia during surgery for the balloon catheter injury. The minipump was connected to the jugular vein via a sylastic catheter to ensure constant i.v. infusion over the entire experimental period of 14d.
Plasmalevels were determined at the end of the experiment using LCMSMS.
Results following balloon catheter injury (see under animal surgery above):
As shown in Table 1, rolipram inhibited neointima formation in balloon catheter injured rat carotid arteries significantly at 0.8 and 8mg/kg/day iv. To confirm the results, the higher dose was repeated in an independent experiment with a new set of rats (exp 2). At the end of the experiment still 20% of the original volume is present in the pumps due to the slower pumprate of a PEG 400 solution rather than water. Thus, the plasma levels determined at the end of the experiment reflect steady state exposure. It is interesting to
note that plasma levels are well within the expected range of Ki of Rolipram for PDE4 enzymes.
Experiment Rolipram dose Inhibition of neointima plasma level n
(number) (mg/kg/d) (% from placebo) (nM)
2002-33 48 570±70 >0.05 10
2002-33 0.8 33 70±24 >0.05 10
2003-2 37 420±150 >0.05
Table 1 shows the summary of the efficacy data of rolipram mediated inhibition of neointima formation as measured by histomorphometry on plastic embedded cross sections (2 per carotid).
Expression of recombinant PDE4D5 and PDE4D7 isoforms
Cloning of the PDE4D isoforms 5 and 7 and the core construct
Core construct:
A cDNA encoding the core fragment that is common for all the PDE4D isoforms 3- 8 starting with the amino acid sequence FDV carboxyterminal to the LFl splice site was generated by PCR using a 5' oligonucleotide with a Hindlll cloning site (gatgaattcaagctttttgatgtggacaatggcaca) introducing two additional amino acid (K and L) in front of the FDV sequence. At the 3' end a set of primers was used that either generated the native sequence (gtgatatctcattatcacgtgtcaggagaacgatcatctatgaca) or added a sequence encoding 6xHis residues (gtgatatctcattatcaa tgggatggtgatggtgcgtgtcaggagaacgatcatctatgac) to enable rapid purification of the recombinant proteins. The cDNA encoding the core construct was cloned as a EcoRI- EcoRV fragment into the expression vector pENTR™la (GIBCO/BRL)
Isoforms (except core construct):
The DNA fragments encoding the isoform specific N-termini were generated by using synthetic oligonucleotides with terminal restriction enzyme sites for EcoRI and Hindlll incorporated for directional cloning. These isoform specific DNA fragments were fused to the core construct sequence via the Hindlll site introducing two additional amino acid residues (K and L). The integrity of the clones was confirmed by DNA sequencing prior to expression.
Expression of the PDE4D isoforms and the core construct in insect cells
The cDNAs were cloned into the pFASTBACl vector (Life Technologies. Inc) for expression in insect cells and the products were confirmed by sequencing. After recombination into the baculovirus genome the purified viral DNAs were transformed into the insect cells. Sf9 cells were cultured at 27°C in TC100 medium (BioWhittaker) with 5% (v/v) fetal calf serum. Virus stocks were generated with a titer of 1.5x 10 pfu/ml. For large scale production of the isoforms 1-24 L fermentations of Sf9 cells were infected with a MOI of l.
In one example, the 6xHis tagged PDE4D polypeptides DC, D5 and D7 were produced in Sf9 cells in IL spinner flasks using SF1 medium in the absence of serum. Infected cells were harvested 3 days after infection with the recombinant baculoviruses.
In another example, the PDE4D core construct DC was produced in a 24 L Airlifter Fermenter with 15 L medium (SF1 with 0% serum), 0.15 L lipids and 9 L Sf9 cells. During the entire fermentation procedure the cells were cultured at pH 6.2, 27.0+/- 0.2°C and a pO2 of 30.0+/- 0.5 %. Cells were grown for 3 days. The cell number at infection was 2.3x10° cells/ml. Cells were infected with 450 ml recombinant baculovirus. Cells were harvested at 68h post infection and the cell pellet as well as the cconcentrated supernatant stored at -80°C until further processing.
Purification of 6xHis tagged PDE4D isoforms
Sf9 cells from 1 liter culture broth, overexpressing the respective isoform, were resuspended on ice in 50 ml 50 mM HEPES pH 7.8, 300 mM NaCl 10 mM imidazole, 1 mM DTT, supplemented with protease inhibitors (one protease inhibitor cocktail tablet "complete, EDTA-free"; Roche). Opening of cells was performed by use of a 50 ml Dounce homogenizator and the homogeneous mixture was centrifuged for 1 hour at 70O0O g and 4°C (Kontron TFT 45.94 rotor at 30O00 rpm). The supernate was filtrated through a filter with a pore size of 1.2 μM (Minisart; Sartorius, Germany) and then applied to a 6 ml Ni-NTA agarose column at 2 ml/min. After equilibration with 50 mM HEPES pH 7.8, 300 mM NaCl, 10 mM imidazole, protein was eluted with a linear 30 ml gradient from 10 to 230 mM imidazole in the same buffer. Fractions containing the PDE4D isoform as analyzed by Coomassie stained SDS-PAGE were pooled and stored frozen at -80°C. Fresh Ni-NTA agarose material was used for every different PDE4D isoform preparation in order to prevent cross contamination of isoforms.
Specific activities of 6xHis tagged PDE4D isoforms
Relative concentrations of Ni-NTA agarose purified isoform preparations were estimated by SDS-PAGE. Equal volume amounts of isoform preparations were applied to a gradient gel (4-12% NuPage; Invitrogen). After electrophoresis the Coomassie stained polyacrylamide gel was imaged by a video imaging system. Optical densities of PDE4D bands were integrated using a Macintosh computer and the public domain software "NIH Image", version 1.61 (developed at the U.S. National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih-image/). The integrated arbitrary units per PDE4D band as returned by the software reflect the relative PDE4D concentrations within the original pools. Identities of PDE4D and tubulin bands had been verified by independent SDS-PAGE, excision of corresponding bands, trypsin cleavage and identification of tryptic peptides by MALDI-MS.
Activities of equal volume amounts of 106-fold diluted purified isoforms were determined by use of a commercial radioactive phosphodiesterase assay (cAMP- dependent phosphodiesterase [3H] assay; Amersham Pharmacia Biotech), following the instructions of the manufacturer. The obtained arbitrary activity units reflect the relative PDE4D activities within the original pools.
Relative specific activities of PDE4D isoforms were calculated by dividing relative activity values by relative concentration values.
Qualitative investigation of aggregation by size exclusion chromatography (SEC)
50 μl of Ni-NTA agarose purified isoform preparation was injected into a Superose 12 size exclusion column (type PC3.2/30; Amersham Pharmacia Biotech), equilibrated with 50 mM TrisHCl pH 7.7, 100 mM NaCl, 0.5 mM MgCl2 at a flow rate of 0.1 ml/ in at 4°C. Chromatograms were recorded at 278 nm. Starting from the elution volume, the column eluate was collected as 50 μl fractions.
Activity assay and inhibition of phosphodiesterase activity
An IMAP FP-Assay was used for the determination of phosphodiesterase activity.
The phosphodiesterase activity of the core contruct and PDE4D3, 5 or 7 was measured using the HEFP Phosphodiesterase Assay Kit (Molecular Devices). 2 μl of PDE4D5 or 7 or PDE4D core construct, 2 μl of cAMP (to a final concentration of 40 nM) and 1 μl of test substance or carrier were incubated for 45 min on a shaker. 12 μl of Binding Solution provided by the kit (with beads diluted 1:320) were added, and the reaction mixture incubated on a shaker for 2 hours. Fluorescence polarisation of the samples was measured in a Packard BioScience Fusion a-FP HT using as an emission filter a Polarizer 535, and as an excitation filter, Fluorescein 485/20. Inhibition of the phosphodiesterase activity of the PDE4D core construct was determined using Rolipram as inhibitor, and using PDE4D core construct at 30 ng/ml.
Rat Lauric Acid model for PAOD (Kawamura et al., 1985, Arzneimittelforschung 35/7A):1154-1156)
Rats were injected intra-arterially with 75ug of Lauric acid in lOul of pure ethanol. The injection site at the proximal femoral artery was closed with histo-acryl. The wound was closed and the animal allowed to recover. Rats had been trained to walk on a treadmill prior to LA injection as indicated in Fig 6. Drugs were applied by gavage as indicated. The treatment causes inflammation in small vessels, which can lead to PAOD. Rats were forced to exercise on the treadmill at 25m/min and 4.5% slope until they fatigued. Fatigue was defined as the time needed until a total of 5 small electric stimuli have been cumulatively applied as re-enforcement for the rat to run on the freadmill.
The PDE4 inhibitor cilomilast was compared to the PDE3 inhibitor Cilostazol. Cilostazol is used in the treatment for PAOD and thus serves as a positive control. Cilomilast showed equipotent efficacy as compared to Cilostazol (Fig. 7).
This experiment indicates that a PDE4 inhibitor can improve walking distance in a rat model for PAOD.
Claims
1. Use of PDE4 for identifying a compound which inhibits atherosclerosis or restenosis.
2. The use of claim 1, wherein the PDE4 is PDE4D.
3. The use of claim 2 wherein the PDE4D is PDE4D5 or PDE4D7.
4. The use of claim 2 wherein the PDE4D is PDE4D7.
5. The use of any of claims 1 to 4, wherein said compound inhibits Peripheral Arterial Occlusive Disease.
6. A process for identifying and obtaining a compound for therapy of atherosclerosis or restenosis, said process comprising measuring the activation or inhibition of the phosphodiesterase activity of PDE4.
7. The process of claim 6, wherein said PDE4 is PDE4D.
8. The process of claim 7 wherein the PDE4D is PDE4D5 or PDE4D7.
9. The process of claim 7 wherein the PDE4D is PDE4D7.
10. The process of any one of claims 6 to 9, wherein a compound is obtained for the treatment of Peripheral Arterial Occlusive Disease.
11. A process for identifying and obtaining a compound for therapy of atherosclerosis, or restenosis, said process comprising administering a compound suspected to be an activator or inhibitor of PDE4 to an animal in which atherosclerosis or restenosis is induced, and measuring the extent of atherosclerosis or restenosis as compared to control-treated animals.
12. The process of claim 11, wherein said PDE4 is PDE4D.
13. The process of claim 12 wherein the PDE4D is PDE4D5 or PDE4D7.
14. The process of claim 12 wherein the PDE4D is PDE4D7.
15. The process of any one of claims 11 to 14, wherein the compound is for the therapy of Peripheral Arterial Occlusive Disease.
16. A compound identified by the process of any one of claims 6 to 15.
17. A pharmaceutical composition comprising a compound of claim 16 and a pharmaceutically acceptable carrier.
18. Use of a compound of claim 16 for the preparation of a medicament for the treatment of atherosclerosis, restenosis.
19. The use of claim 18, wherein said compound is used for the preparation of a medicament for the treatment of Peripheral Arterial Occlusive Disease.
0. The compounds, processes, uses and composition substantially as hereinbefore described, especially with reference to the foregoing examples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04726162A EP1616024A1 (en) | 2003-04-10 | 2004-04-07 | The use of pde4d in the screening for medicaments against atherosclerosis |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03007993 | 2003-04-10 | ||
| PCT/EP2004/003739 WO2004090157A1 (en) | 2003-04-10 | 2004-04-07 | The use of pde4d in the screening for medicaments against atherosclerosis |
| EP04726162A EP1616024A1 (en) | 2003-04-10 | 2004-04-07 | The use of pde4d in the screening for medicaments against atherosclerosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1616024A1 true EP1616024A1 (en) | 2006-01-18 |
Family
ID=33155123
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP04726162A Withdrawn EP1616024A1 (en) | 2003-04-10 | 2004-04-07 | The use of pde4d in the screening for medicaments against atherosclerosis |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1616024A1 (en) |
| JP (1) | JP2006522594A (en) |
| CN (1) | CN100372944C (en) |
| AU (1) | AU2004227089A1 (en) |
| CA (1) | CA2521303A1 (en) |
| WO (1) | WO2004090157A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1743904A3 (en) * | 2005-07-13 | 2007-02-14 | F. Hoffmann-La Roche Ag | Guinea pig chymase |
| ES2700877T3 (en) * | 2009-05-12 | 2019-02-19 | Koninklijke Philips Nv | Phosphodiesterase 4D7 as a marker of prostate cancer |
| JP6745820B2 (en) | 2015-05-29 | 2020-08-26 | コーニンクレッカ フィリップス エヌ ヴェKoninklijke Philips N.V. | Prostate Cancer Prognosis Judgment Method |
| KR102546357B1 (en) | 2016-12-01 | 2023-06-22 | 코닌클리케 필립스 엔.브이. | Risk score based on human phosphodiesterase 4D variant 7 expression |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1439221A1 (en) * | 2002-12-17 | 2004-07-21 | F. Hoffmann-La Roche Ag | PDE core construct |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6348602B1 (en) * | 1999-12-23 | 2002-02-19 | Icos Corporation | Cyclic AMP-specific phosphodiesterase inhibitors |
| CZ20022410A3 (en) * | 2000-01-31 | 2003-08-13 | Pfizer Products Inc. | Nicotinamide benzofused-heterocyclyl derivatives useful as selective inhibitors of PDE4 isozymes |
| US20030054531A1 (en) * | 2001-03-19 | 2003-03-20 | Decode Genetics Ehf, | Human stroke gene |
| WO2004042389A2 (en) * | 2002-11-08 | 2004-05-21 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with human phosphodiesterase 4d (pde4d) |
-
2004
- 2004-04-07 EP EP04726162A patent/EP1616024A1/en not_active Withdrawn
- 2004-04-07 AU AU2004227089A patent/AU2004227089A1/en not_active Abandoned
- 2004-04-07 CA CA002521303A patent/CA2521303A1/en not_active Abandoned
- 2004-04-07 JP JP2006505054A patent/JP2006522594A/en active Pending
- 2004-04-07 WO PCT/EP2004/003739 patent/WO2004090157A1/en not_active Ceased
- 2004-04-07 CN CNB2004800096278A patent/CN100372944C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1439221A1 (en) * | 2002-12-17 | 2004-07-21 | F. Hoffmann-La Roche Ag | PDE core construct |
Non-Patent Citations (3)
| Title |
|---|
| DE FABRITIIS A.; CONTI E.; COCCHERI S.: "Management of patients with carotid stenosis", PATHOPHYSIOLOGY OF HAEMOSTASIS AND THROMBOSIS, vol. 32, no. 5-6, September 2002 (2002-09-01), pages 381 - 385, XP008091547 * |
| RIVARD A.; ANDRES V., HISTOLOGY AND HISTOPATHOLOGY, vol. 15, no. 2, April 2000 (2000-04-01), pages 557 - 571, XP008091548 * |
| See also references of WO2004090157A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2521303A1 (en) | 2004-10-21 |
| AU2004227089A1 (en) | 2004-10-21 |
| WO2004090157A1 (en) | 2004-10-21 |
| CN1771329A (en) | 2006-05-10 |
| CN100372944C (en) | 2008-03-05 |
| JP2006522594A (en) | 2006-10-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Little et al. | Nuclear calcium/calmodulin-dependent protein kinase IIδ preferentially transmits signals to histone deacetylase 4 in cardiac cells | |
| JPH08502885A (en) | PTP 1D: a novel protein tyrosine phosphatase | |
| ES2287927T3 (en) | PEPTIDES THAT HAVE A GDP EXCHANGE FACTOR ACTIVITY, NUCLEIC ACID SEQUENCES THAT CODIFY THESE PEPTIDES, PREPARATION AND USE. | |
| KR20010041418A (en) | Protease-activated receptor 4 and uses thereof | |
| US10253069B2 (en) | Compositions and methods for regulating arterial tone | |
| Gomez et al. | Identification of rab7 as a melanosome-associated protein involved in the intracellular transport of tyrosinase-related protein 1 | |
| WO2017155277A1 (en) | Method for screening anticancer agent inhibiting binding of aimp2-dx2 and hsp70 | |
| WO2004090157A1 (en) | The use of pde4d in the screening for medicaments against atherosclerosis | |
| JP2010239971A (en) | Promotion of peroxisomal catalase function in cells | |
| US20070117138A1 (en) | Splice variant cannabinoid receptor (cb1b) | |
| US6602707B2 (en) | Mammalian cell surface DNA receptor-encoding nucleic acid | |
| US5872231A (en) | Nucleic acids encoding merosin | |
| WO2006135783A2 (en) | Compositions and methods for modulating angiogenesis | |
| JP2016520570A (en) | PAR-4 antagonist for use in the treatment or prevention of influenza A virus infection | |
| JPH09511236A (en) | DNA encoding CAI resistance protein and use thereof | |
| EP1108068A1 (en) | T-type calcium channel | |
| JP2005510460A (en) | molecule | |
| JP4975444B2 (en) | Drug discovery target protein and target gene, and screening method | |
| JP2003533217A (en) | Novel double oxidases as mitogens and endocrine regulators | |
| JP4512273B2 (en) | New peptides | |
| JP2009508812A (en) | Methods and compositions for inhibition of vascular permeability | |
| JP4232423B2 (en) | Novel ubiquitin-specific protease | |
| KR102194536B1 (en) | A Composition for Predicting Response to Tamoxifen | |
| JP3629759B2 (en) | Proteasome activator | |
| EP1369478A1 (en) | Novel scavenger receptor class a protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20051110 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL HR LT LV MK |
|
| DAX | Request for extension of the european patent (deleted) | ||
| 17Q | First examination report despatched |
Effective date: 20070808 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20081206 |