CN1771329A - The use of PDE4D in the screening for medicaments against atherosclerosis - Google Patents

The use of PDE4D in the screening for medicaments against atherosclerosis Download PDF

Info

Publication number
CN1771329A
CN1771329A CNA2004800096278A CN200480009627A CN1771329A CN 1771329 A CN1771329 A CN 1771329A CN A2004800096278 A CNA2004800096278 A CN A2004800096278A CN 200480009627 A CN200480009627 A CN 200480009627A CN 1771329 A CN1771329 A CN 1771329A
Authority
CN
China
Prior art keywords
leu
ser
glu
asp
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2004800096278A
Other languages
Chinese (zh)
Other versions
CN100372944C (en
Inventor
S·埃弗斯
J·芬格勒
J·海姆伯
S·格雷塔斯多蒂尔
J·R·古尔切尔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Decode Genetics ehf
Original Assignee
F Hoffmann La Roche AG
Decode Genetics ehf
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche AG, Decode Genetics ehf filed Critical F Hoffmann La Roche AG
Publication of CN1771329A publication Critical patent/CN1771329A/en
Application granted granted Critical
Publication of CN100372944C publication Critical patent/CN100372944C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/32—Cardiovascular disorders
    • G01N2800/323—Arteriosclerosis, Stenosis

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Urology & Nephrology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cardiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Vascular Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides the use of PDE4, preferably PDE4D, more preferably PDE4D5 or PDE4D7, as a novel target for the identification of compounds that can be used for the treatment of atherosclerosis, preferably of Peripheral Arterial Occlusive Disease (PAOD), or for the treatment of restenosis.

Description

The purposes of PDE4D in the atherosclerotic medicine of screening treatment
Technical field
The PDE4D phosphodiesterase exists with the form of a family, and this family comprises four kinds of enzymes, i.e. PDE4A, PDE4B, PDE4C and PDE4D.The PDE4 isozyme cAMP that degrades specifically is the common target such as this class medicament of thymoleptic (for example rolipram).In the PDE4D isotype, known several splicing forms.Its medium length type isotype is known to have 6 kinds, called after PDE4D3, PDE4D4, PDE4D5, PDE4D6, PDE4D7 and PDE4D8.The structural domain that they all have LR1 and UCR1 site and are positioned these site C-terminal, but different N-terminal structural domains is arranged.Isotype PDE4D5 is by open (Characterization of five differentproteins produced by alternatively spliced mRNAs from the humancAMP-specific phosphodiesterase PDE4D gene such as Bolger, Biochem.J. (1997), 328,539-548).Isotype PDE4D7 is open at W002/074992 recently.The PDE4D locus once connected (W002/074992) with apoplexy.Yet, there is no indication also that up to the present PDE4D relates to atherosclerosis or restenosis.
The present invention identifies PDE4, preferred PDE4D, and more preferably PDE4D5 or PDE4D7 are for identifying a kind of new target drone of the compound for the treatment of atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis.
The present invention identifies that PDE4 is a kind of new target drone of identifying the compound can be used for treating atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis.Shown in Fig. 7,8, PDE4 inhibitor cilomilast has improved the locomotor activity of PAOD rat model.In a preferred embodiment, new target drone is PDE4D, in an embodiment that is more preferably, new target drone is PDE4D5 (homologues of Seq ID No.4 and other species) or PDE4D7 (homologues of Seq ID No.1-3 and other species).In extremely excellent embodiment, new target drone is PDE4D7.As shown in figs. 1 and 4, PDE4D5, especially PDE4D7 raise in film and the inner membrance in the air bag injury rats is carotid.
Therefore, the invention provides PDE4, preferred PDE4D, more preferably the new purposes of PDE4D5 or PDE4D7 is used for identifying the compound that suppresses atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis.Most preferably use PDE4D7.
The present invention also provides the novel method of identifying and obtain the atherosclerotic compound of treatment, described method comprises measures PDE4, preferred PDE4D, more preferably PDE4D5 or PDE4D7, the most preferably activation of the phosphodiesterase activity of PDE4D7 or inhibition, and by this method compounds identified.Most preferably, described compound is PDE4, preferred PDE4D, the more preferably inhibitor of PDE4D5 or PDE4D7, especially PDE4D7.The method of measuring phosphodiesterase activity is that this area institute is well-known.A limiting examples that is used for this mensuration has been described among the embodiment.Be used for the treatment of the evaluation of the compound of atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis, can comprise that using expection suppresses PDE4, preferred PDE4D, more preferably in PDE4D5 or PDE4D7, most preferably in the compound of PDE4D7 in the animal of having induced atherosclerosis (preferred peripheral arterial is inaccessible sick) or restenosis, as rat air bag damage model, perhaps, as another unrestricted embodiment, with the mouse that knocks out ApoE of feeding the solid type food of Western Type food or standard (Nakashima etc. for example in contrast, ApoE-deficient mice developlesions of all phases of atherosclerosis throughout the arterial tree, Arterioscler.Thromb. (1994) Jan; 14 (1): describe among the 133-40) or in contrast with lauric acid model (Kawamura etc., 1985, Arzneimittelforschung 35/7A:1154-1156).The preferred non-human animal of described animal.Therefore, the present invention also provides the method for identifying and obtaining the compound of treatment atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis, this method comprises the animal of inducing atherosclerosis (preferred peripheral arterial inaccessible sick) or restenosis used and is contemplated to PDE4, preferred PDE4D, the more preferably compound of the activator of PDE4D5 or PDE4D7 or inhibitor, and measure and compare, the degree of their atherosclerosis (preferred peripheral arterial is inaccessible sick) or restenosis with the animal of using placebo or carrier.Most preferably, described compound is PDE4, preferred PDE4D, the more preferably inhibitor of PDE4D5 or PDE4D7, especially PDE4D7.
Be used to identify that the activator of PDE4D or the method for inhibitor can comprise use core PDE4D construct (Seq ID No.5), this core construct is the PDE4D with long isotype consensus amino acid sequences of all PDE4D.Fig. 5 shows that rolipram is to the active inhibition of core PDE4D.
As used in this article, term " activator of PDE4 or inhibitor ", " activator of PDE4D or inhibitor ", " activator of PDE4D5 or PDE4D7 or inhibitor " are meant the compound that activates or suppress the cell function of PDE4, PDE4D, PDE4D5 and/or PDE4D7, PDE4, PDE4D, PDE4D5 and/or PDE4D7 phosphodiesterase both can have been directly acted on, also can indirect regulation PDE4, PDE4D, the function of PDE4D5 and/or PDE4D7, for example by changing its ubcellular target.
The invention still further relates to any method institute compounds identified by above describing.
In addition, the present invention relates to comprise the PDE4 that identifies by the method for this description, preferred PDE4D, more preferably pharmaceutical composition and pharmaceutically acceptable carrier of the phosphodiesterase activity activator of PDE4D5 or PDE4D7 or inhibitor.Most preferably, this pharmaceutical composition comprises PDE4, preferred PDE4D, more preferably PDE4D5 or PDE4D7 phosphodiesterase activity inhibitor.
Phrase " pharmaceutically acceptable " is meant herein in sound medical judgment scope, be fit to contact with human and animal's tissue, and do not have too much toxicity, stimulation, transformation reactions or other problem or complication, have those compounds, material, composition and/or the formulation of rational interests/risk ratio.
As used in this article, " pharmacologically acceptable salt " is meant the derivative of indentifying substance, and wherein parent's reagent is modified by making its acid or alkali salt.The example of the acceptable salt of medicine includes, but is not limited to the inorganic or organic acid salt (as amine) of alkaline residue, the alkalescence or the organic salt of acidic residues (as carboxylic acid).Pharmacologically acceptable salt comprises, for example from conventional non-toxic salt or the quaternary ammonium salt inorganic or parent compound that organic acid forms.For example, the non-toxic salt of this routine comprises that those stem from mineral acid (example hydrochloric acid, Hydrogen bromide, sulfuric acid, thionamic acid, phosphoric acid, nitric acid etc.) salt, and by organic acid (as acetate, propionic acid, succsinic acid, oxyacetic acid, stearic acid, lactic acid, oxysuccinic acid, tartrate, citric acid, xitix, palmitinic acid, toxilic acid, hydroxymaleic acid, toluylic acid, L-glutamic acid, phenylformic acid, Whitfield's ointment, Sulphanilic Acid, the 2-acetamido benzoate, FUMARIC ACID TECH GRADE, Phenylsulfonic acid, toluenesulphonic acids, methylsulfonic acid, ethionic acid, oxalic acid, hydroxyethylsulfonic acid etc.) Zhi Bei salt.
Pharmacologically acceptable salt can be synthetic from the parent's reagent that contains alkali or acid moieties by the conventional chemical method among the present invention.These salt usually can be by the free acid or the alkali form of these compounds, by stoichiometric amount and suitable alkali that is arranged in water or organic solvent or both mixtures or acid-respons preparation; Usually preferred non-aqueous media is as ether, ethyl acetate, ethanol, Virahol, acetonitrile.The tabulation of appropriate salt is found in Remington ' s Pharmaceutical Sciences, and the 17th edition, Mack PublishingCompany, Easton, PA, 1985, p.1418, quote its disclosure as a reference at this.
Can modify the reagent that the inventive method is identified, to reach following purpose: (i) change reaction site and activity profile, and/or (ii) improve usefulness, and/or (iii) reduce toxicity (raising therapeutic index), and/or (iv) reduce side effect, and/or (v) change the initial and duration of efficacy of reaction, and/or (vi) changing kinetic parameter (absorbs, distribute, metabolism and drainage), and/or (vii) change the physical-chemical parameters (solubleness, water absorbability, color, taste, smell, stability, state), and/or (viii) improve the general specificity, the organ-/ tissue specificity, and/or (ix) optimize application form and path, achieve the above object by the following method: (i) esterification of carboxyl, or the (ii) esterification of hydroxyl and carbonic acid, or (iii) hydroxyl with as phosphoric acid, tetra-sodium, sulfuric acid, the esterification of hemisuccinic acid, or (iv) form pharmacologically acceptable salt, or (v) form pharmaceutically acceptable mixture, or (the vi) living polymerization body on the synthetic drug Neo-Confucianism, or (vii) introduce hydrophilic segment, or (viii) introducing/exchange substituting group on aromatic base (aromates) or side chain, change substitute mode, or (ix) partly modify by structures such as structures such as introducing or biologies, or (x) synthetic homologous compound, or (xi) introduce branched building block, or (xii) alkyl substituent to the transformation of cyclic analogs, or (xiii) hydroxyl to ketal, deriving of acetal, or (xiv) acid amides, the N-acetylize of phenylcarbamic acid salt, or (xv) synthetic Mannich alkali, imines, or (xvi) ketone or aldehyde to Schiff ' s alkali, oxime, acetal, ketal, enol ester, azoles alkane, the conversion of thiozolidines or their composition; (b) prepare composition or product with fragrance or taste with the product of pharmaceutically acceptable carrier or carriers/diluents and described modification.
Can utilize any conventional carrier material.This solid support material can be fit in the intestines, through the organic or inorganic material of skin or parenteral admistration.Suitable carriers comprises water, gelatin, Sudan Gum-arabic, lactose, starch, Magnesium Stearate, talcum powder, vegetables oil, polyalkylene glycol, Vaseline etc.In addition, pharmaceutical preparation may comprise other pharmaceutically active agents.Can add as extra additives such as seasonings, stablizer, emulsifying agent, damping fluids according to the pharmaceutical formulation of generally acknowledging in the practice.
In one embodiment, method of the present invention comprises the antisense oligonucleotide of significant quantity on the administering therapeutic, its sequence can be specific in conjunction with coding PDE4, preferred PDE4D, more preferably any sequence of the genomic dna of PDE4D5 or PDE4D7 or mRNA molecule is to stop PDE4mRNA, preferred PDE4D mRNA, more preferably PDE4D5 or PDE4D7mRNA, most preferably PDE4D7mRNA's transcribing or translating." antisense " meaning is " justice is arranged " chain complementary nucleotide sequence that comprises in the composition with a certain specific nucleic acid sequence.In case be incorporated in the cell, this complementary nucleotide will combine with the endogenous sequence that cell produces and form two strands, and blocking-up is transcribed or translated.For example, see Agrawal, S. collects (1996) " Antisense Therapeutics ", HumanaPress Inc., Totawa NJ; Alama etc. (1997) Pharmacol.Res.36:171-178; Crooke, S.T. (1997) Adv.Pharmacol.40:1-49; And (1997) Biochem.Mol.Med.62 (1): 11-22 such as Lavrosky.Antisense sequences can be any nucleic acid material or any nucleic acid mimics or the analogue that comprises DNA, RNA.For example, see (1991) Antisense Res.Dev.1:285-288 such as Rossi; Pardridge etc. (1995) Proc.Nat.Acad.Sci.92:5592-5596; Nielsen and Haaima (1997) Chem.Soc.Rev.96:73-78; And (1998) Biochemistry 37:900-1010 such as Lee.Can realize sending of antisense sequences by number of ways, as by carrying out sending in the cell with recombinant vector.
The common antisense oligonucleotide that preferably has about 15-25 base is because they are easy to synthetic and can produce required retarding effect.The molecule analogue of antisense oligonucleotide also can be used for this purpose, and has extra advantage, as have the advantage aspect stability, distribution or the limited toxicity in medicine.In addition, the chemical reaction group as iron link coupled ethylenediamine tetraacetic acid (EDTA) (EDTA-Fe), can be attached on the antisense oligonucleotide, thereby causes the cracking of RNA at the hybridization site place.The antisense method is well known in the art in above-mentioned these and other purposes aspect the external translation of suppressor gene.For example, see Marcus-Sakura (1988) Anal.Biochem.172:289.
To PDE4, preferred PDE4D, more preferably PDE4D5 or PDE4D7, the most preferably inhibition of PDE4D7 also can be disturbed by RNA and realize.As a limiting examples, can obtain RNA by GB 2372995 disclosed methods disturbs, be used for suppressing the cell or tissue target gene expression, this method comprises with following two kinds of virions and infects described cell or tissue: (a) comprise the virion that representative has the singlestranded RNA (ss RNA) of adopted RNA chain, (b) comprise the virion of the singlestranded RNA (ss RNA) of representing the sense-rna chain, wherein, there are justice and sense-rna chain to comprise homeologous nucleotide sequence with described target gene.
The damage of rat carotid artery air bag is a technology of fully being accepted in the research of artery hyperplasia incident.It is used to analyze atherosclerotic smooth muscle cell proliferation component at first, but also is used as the model of postangioplasty restenosis recently.SMC reaction to damage in femoral artery and carotid artery is similar.Because be more prone to technically, repeatability is better in test, and this model is applied to carotid artery.It is bound to become the atherosclerosis in the femoral artery---peripheral arterial inaccessible sick (PAOD) sign model.As shown in table 1, the inhibitor rolipram of PDE4 suppresses the formation of neovascularity inner membrance in this model.
Therefore, the present invention also provides the method for treatment atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or restenosis, comprise and use PDE4 suffering from the atherosclerosis (preferred peripheral arterial inaccessible sick (PAOD)) or the curee of restenosis, preferred PDE4D, the more preferably activator of PDE4D5 or PDE4D7 or inhibitor.In utmost point embodiment preferred, used PDE4, preferred PDE4D, more preferably PDE4D5 or PDE4D7, the most preferably inhibitor of PDE4D7.Therefore, the present invention relates to PDE4, preferred PDE4D, the more preferably activator of PDE4D5 or PDE4D7 or the inhibitor purposes in the sick medicine of preparation treatment atherosclerosis, restenosis or preferred peripheral arterial obturation.In utmost point embodiment preferred, used PDE4, preferred PDE4D, more preferably PDE4D5 or PDE4D7, the most preferably inhibitor of PDE4D7.
The invention provides substantially as previously mentioned, especially with reference to compound, method, purposes and the composition of previous embodiment.
The accompanying drawing summary:
Fig. 1:
(a) top shows conduit damage carotid artery sample.Clearly detect the protein of about 80kDa with anti--rabbit polyclonal antibody of PDE4D7 through affinity purification.At unmarred right carotid ((a) below) with take from the contrast carotid artery (b) of unprocessed animal and all do not detect PDE4D7, show that the balloon catheter damage is listed as the expression of inducing PDE4D7 by force.
Fig. 2:
A: the cross reaction of people and mouse PDE4D5N-end: people and mouse PDE4D5 have 98.85% identity.
UCR1, the UCR2 between B:PDE4 subfamily A, B, C and the D and the comparison of catalyst structure domain show the almost same high conservative of UCRs and catalyst structure domain.
Fig. 3:
The cross reaction of people-rat-mouse PDE4D7:
Q8CG05: mouse PDE4D7 (Seq ID No.1); Q8CH04: P of Rats DE4D7 (Seq ID No.2); Q8IVD2: people PDE4D7 (Seq ID No.3)
People-rat: 96.8%
Rat-mouse: 98.8%
Fig. 4:
The expression of PDE4D5 and PDE4D7 in the air bag injury rats carotid artery
Swimming lane 1,2,3: air bag damaged back 3 days, the middle film of air bag damage and inner membrance, left neck artery
Behind the swimming lane 4,5,6:3 days, middle film, right carotid (unmarred, contrast)
Swimming lane 7: air bag damaged back 14 days, the middle film of air bag damage and inner membrance, left neck artery
After swimming lane 8:14 days, unmarred contrast right carotid
Swimming lane 9,10: air bag damaged back 7 days, the middle film of air bag damage and inner membrance, left neck artery
Behind the swimming lane 11,12:14 days, unmarred right neck is moving
Fig. 5:
The restraining effect of rolipram.The phosphodiesterase activity of PDE4D core construct (DC) can be suppressed by rolipram.The IC50 (drug level of inhibitory enzyme activity 50%) that rolipram suppresses the DC phosphodiesterase activity is 0.34+/-0.06 μ M.
Fig. 6:
PDE4 inhibitor C ilomilast is to the influence of locomotor activity in the lauric acid model: select animal and is 4 groups with their couplings according to the locomotor activity on treadmill.With PDE3 inhibitor C ilostazol as positive control.
Fig. 7:
The PDE4 inhibitor is to the influence of locomotor activity in the lauric acid model: measure once maximum travel distance week about.
Fig. 8:
The PDE4 inhibitor is to the individual results of locomotor activity influence in the lauric acid rat model.
Fig. 9:
The PDE4 inhibitor is to the influence of body weight in the lauric acid rat model.
Figure 10:
The side effect of PDE4 inhibitor in the lauric acid rat model: unusual ight soil/diarrhoea.
Figure 11:
The PK of lauric acid experiment analyzes: the blood plasma level of PDE4 inhibitor behind the oral administration.
Embodiment
PDE4D5 and the PDE4D7 expression in the rat carotid artery of damage
Animal surgery
Obtain female (300-400g) Wistar Kyoto rat (RoRo) from BRLCH-Fullinsdorf.(FRG) (Ketasol 100, Graeub, CH) peritoneal injection anesthetized rat with the 50mg/kg vetatar for Rhompun, Bayer with 5mg/kg methylbenzyl thiazine.Expose left neck artery at carotid bifurcation, and insertion 2F embolectomy conduit (Edwards laboratories, USA).By three tractive expansible of arteria carotis communis air bag.The permanent ligation rear enclosed of external carotid artery wound is can freely obtain solid type feed of commodity and water pair fed rat.
The tissue results
After damaging for six weeks, again anesthesia and by the excessive narcotic kill animals of intravenous injection.After opening body cavity, by the conduit that is placed on aortic arch rat is carried out perfusion with cold PBS, to wash away blood.Remove adventitial tissue with clock and watchmaker's tweezers from artery.Vertically open carotid artery, remove the endothelium of any remnants by the slip tweezers.This moment, carotid artery only was made up of the smooth muscle cell tissue.Merging after be stored in-80 ℃ with the rapid freezing carotid artery of liquid nitrogen this moment.
Experimental group
Merge into four experimental group:
1. the air bag damage carotid artery of 11 inflations after 6 weeks
2. 11 int carotid artery of offside
3. the left neck artery of 12 unprocessed rats
4. the right carotid of 12 unprocessed rat offsides
Antibody
Distinguished sequence (H based on people PDE4D7 2N-CADLKSESENIQRPTS-CONH 2) preparation antibody.With synthesizing peptide by this antibody of affinitive layer purification with the pillar bonded.The reorganization goods thing of personnel selection PDE4D3, PDE4D5, PDE4D6, PDE4D7, PDE4D8 detects the specificity of this antibody by immunoblotting as sample.The detection hPDE4D7 of antibodies specific in these experiments.The high conservative (as shown in Figure 3) of people, rat or mouse PDE4D7 is hinting that this antibody has the ability with rat or mouse cross reaction.
By similar approach based on distinguished sequence H 2N-CEKSKTARKSVSPKLSP-CONH 2Preparation and characterize anti-PDE4D5 peptide antibody.The height consistence (as shown in Figure 2) of the N-terminal portions of people and P of Rats DE4D5 is hinting the cross reaction ability of this antibody again.
The preparation of dielectrophoresis sample
Frozen carotid artery with cooled with liquid nitrogen and in mortar grind into powder.Place sample solution (7M urea, 2M thiocarbamide, 50mM Tris, 2% (mass/volume then, w/v) CHAPS (2-[(3-courage amidopropyl) dimethylamino]-the 1-propane sulfonate, Roche Diagnostics, Mannheim, Germany, 0.4% (w/v) dithioerythritol, 0.5% (v/v) amphotericeledrolyte (Resolytes 3.5-10, BDH, Poole, England)) carry out homogenate in, room temperature was placed 15 minutes.Homogenate is in 100,000 * g, 4 ℃ centrifugal 1 hour, collect supernatant.Estimate protein concn with the BioRad protein determination.
Two-dimensional polyacrylamide gel electrophoresis
Solid phase pH gradient adhesive tape (11cm, pH4-7, Amersham Biosciences, LittleChalfont, England) again at 7M urea, the 2M thiocarbamide, CHAPS, 0.4% (w/v) dithioerythritol, 0.5% (v/v) amphotericeledrolyte bubble rose 6 hours, put into then Protean IEF unit sample adding cup (BioRad, Hercules, CA) in.The sample that contains equal protein matter is added in the sample adding cup, carries out isoelectrofocusing according to following program: 250 volts, and 2 hours; Rise to 2500 volts gradually, totally 8 hours; 2500 volts 8 hours.Adhesive tape is hatched by following continuous two steps and is carried out balance: at first at 6M urea, 50mMTris-HCl, hatched 15 minutes in pH7.5,30% (v/v) glycerine, 2% (w/v) SDS, the 30mM dithioerythritol, then at 6M urea, 50mM Tris-HCl, pH7.5,30% (v/v) glycerine, 2% (w/v) SDS were hatched in the 136mM thioacetamide 15 minutes.The adhesive tape that balance is crossed joins in the IEF groove of standard 4-15% gel.Carry out SDS-polyacrylamide gel electrophoresis and nitrocellulose filter trace (BioRad) according to the method for gel manufacturer recommendation.(Magic Marker Invitrogen) is used to estimate molecular weight to add the molecular weight marker thing.
Immunoblotting
Trace seals with 5% skim-milk that is dissolved in TBS, and 4 ℃ of shaking tables spend the night.After the washing, add the anti-PDE4D7 antibody through affinity purification that 100ng/ml is dissolved in TBS+0.1% (v/v) Tween 20, trace was hatched 90 minutes by vibration in room temperature.After the washing trace, (1/50000 dilution, BioRad), room temperature was hatched trace 90 minutes to the anti-rabbit antibody of adding horseradish peroxidase-labeled once more.After the washing, (PIERCE, Rockford IL) develop, and are exposed to film 5-10 minute to use Super Signal West Femto substrate.
PDE4 inhibitor rolipram is to the inhibition of the rat carotid artery neointima formation of balloon catheter damage
Medicament administration
The rolipram for preparing proper concn (25mg or 2.5mg/ml) in PEG400 adds in the miniature osmotic pump (2002 Alzet), to every rat use constant dosage with 0.8 or the constant dosage of 8mg/kg/d send to every rat respectively.Micropump places the neck of anesthetized rat subcutaneous when the balloon catheter trauma surgery.Micropump connects jugular vein by the sylastic conduit, to guarantee constant intravenously perfusion in whole 14 days experiment periods.
Measure blood plasma level with LCMSMS latter stage in experiment.
Result after the balloon catheter damage (referring to animal surgery part above)
As shown in Table 1, intravenously use 0.8 or the rolipram of 8mg/kg/day significantly suppress balloon catheter injury rats carotid artery neointima and form.In order to prove conclusively this result, in experiment independently to the new rat repetitive administration of a cover medicine of high dosage (experiment 2) more.Because what use is PEG 400 but not water, flow rate pump makes slowly still has the drug residue of original volume 20% in pump after experiment finishes.Therefore, the blood plasma level of experiment mensuration in latter stage has reflected that stable state exposes (exposure) to the open air.It should be noted that good being in the inhibitor constant K i desired extent of rolipram to the PDE4 enzyme of blood plasma level.
Experiment (quantity) Rolipram dosage (mg/kg/d) The inhibition of neovascularity endothelium (% placebo result) Blood plasma level (nM) p n
2002-33 2002-33 2003-2 8 0.8 8 48 33 37 570±70 70±24 420±150 ＞0.05 ＞0.05 ＞0.05 10 10 9
Table 1 has shown that the inhibition neovascularity inner membrance of rolipram mediation forms the outline data of rendeing a service, and these data are to embed (two of each carotid artery) that cross section is measured on the square section of embedding plastics by tissue morphology measurement's art at plastics.
The expression of recombinant chou PDE4D5 and PDE4D7 isotype
PDE4D isotype 5 and 7 and the clone of core construct
The core construct:
Carry out PCR by 5 ' oligonucleotide with 1 HindIII cloning site (gatgaattcaagctttttgatgtggacaatggcaca) of before the FDV sequence, introducing 2 additional amino acids (K and L), generate coding to all PDE4D isotype 3-8 shared FDV aminoacid sequence from C-terminal to the pulsating cDNA of the core of LF1 splicing site.3 ' and terminal sequence (gtgatatctcattatcaatgggatggtgatggtgcgtgtcaggagaacgatcatct atgac) with the one group of primer generation native sequences (gtgatatctcattatcacgtgtcaggagaacgatcatctatgaca) or 6 histidine residues of additionally encoding, so that purification of recombinant proteins rapidly.The cDNA of this coding core construct is cloned into expression vector pENTR with the EcoRI-EcoRV segment TMLa (GIBCO/BRL).
Isotype (except the core construct):
The synthetic oligonucleotide that is useful on the EcoRI of directed cloning and HindIII end limit enzyme site by apparatus produces the dna segment of coding isotype specificity N-end.These isotype specific DNA segments merge by HindIII site and core construct sequence, introduce 2 extra amino-acid residues (K and L).Before expression, prove conclusively this clone's integrity by dna sequencing.
PDE4D isotype and the expression of core construct in insect cell
CDNA is cloned into and is used at the pFASTBAC1 of expressed in insect cells carrier (LifeTechnologies.Inc), and this clone's product is by the order-checking conclusive evidence.Behind the baculovirus genome of recombinating, the viral DNA of purifying is transformed into insect cell.The Sf9 cell has in the TC100 substratum (Bio Whittaker) of 5% (v/v) foetal calf serum in 27 ℃ of cultivations.Generate viral stock, measure concentration and have 1.5 * 10 for producing 9The viral bank of pfu/ml titre.For the scale operation isotype, the infection multiplicity with 1 (MOI) infects the fermented liquid that 1-24 rises the Sf9 cell.
In one embodiment, 6 * His label PDE4D polypeptide DC, D5 and D7 generate in being incubated at 1 liter of Sf9 cell that shakes in the bottle, and cell is cultivated in the SF1 of serum-free substratum.Gather in the crops the cell that infects after 3 days at recombinate shape virus infection.
In another embodiment, PDE4D core construct DC produces in 24 liters gaslift formula (Airlifter) fermentation is irritated, and adds 15 liters of substratum (the not SF1 of increase serum), 0.15 liter of lipid and 9 liters of Sf9 cells during fermentation is irritated.In whole fermentation process, cell cultures is in pH6.2,27.0+/-0.2 ℃ and 30.0+/-0.5%pO 2Condition under.Cell growth 3 days.The cell quantity that infects is 2.3 * 10 6Cells/ml.Cell is with 450 milliliters of recombinate shape virus infections.Infect harvested cell after 68 hours, cell precipitation and spissated supernatant are stored in-80 ℃, up to further processing.
The purifying of 6 * His label PDE4D isotype
The Sf9 cell from 1 liter of nutrient solution of each isotype of overexpression, be suspended in 50ml50mM HEPES pH7.8,300mM NaCl, 10mM imidazoles, 1mM DTT on ice, add a proteinase inhibitor (protease inhibitor cocktail tablet " complete, as not contain EDTA "; Roche).With 50ml Dounce homogenizer ruptured cell, the homogenate mixture is in 70,000g, 4 ℃ centrifugal 1 hour (Kontron TFT 45.94 rotary heads, 30,000rpm).Supernatant is by the filter (Minisart of aperture 1.2pm; Sartorius Germany) filters, and goes up then on sample to the 6 milliliter Ni-NTA agarose column, and flow velocity is 2ml/min.Use 50mM HEPES, after pH7.8,300mM NaCl, the 10mM imidazoles balance, with the imidazoles elute protein of the 30ml10-230mM linear gradient that is contained in same damping fluid.Merge the fraction that contains the PDE4D isotype that coomassie brilliant blue staining SDS-PAGE analyzes, frozen in-80 ℃.To use new Ni-NTA agarose material for every kind of different PDE4D isotype goods, prevent crossed contamination between the isotype.
The specific activity of 6 * His label PDE4D isotype
Estimate the relative concentration of the isotype goods of Ni-NTA agarose purifying by SDS-PAGE.The isopyknic isotype goods of last sample are in gradient gel (4-12% NuPage; Invitrogen) on.Behind the electrophoresis, the polyacrylamide gel of coomassie brilliant blue staining is by the imaging of video image system.With (macintosh computer) be not subjected to the software " NIH Image " of copyright restrictions, version 1.61 (American National Instrument Institutes of Health exploitation can be obtained http://rsb.info.nih.gov/nih-image/ by following network address) is integrated the optical density(OD) of PDE4D band.The integration random cells of each PDE4D band that software returns has reflected the relative concentration of PDE4D in the original storehouse.The identity of PDE4D and tubulin band by SDS-PAGE independently, cut respective strap, trypsinase cracking, identify that with MALDI-MS the peptide section of tryptic digestion confirms.
With commercial radiophosphorus acid diesters enzyme assay (phosphoric acid diacid enzyme [3H] assay method that cAMP-relies on; Amersham Pharmacia Biotech) measures isopyknic dilution 10 6The activity of purifying isotype doubly is by the description operation of manufacturers.The activity unit at random that obtains has reflected the relative reactivity of PDE4D in the original storehouse.
Remove the relative specific activity that the relative reactivity value calculates the PDE4D isotype with the relative concentration value.Assemble by size exclusion chromatography (SEC) qualitative examination
The isotype goods of 50 μ l Ni-NTA agarose purifying are injected Superose 12 size-exclusion column (PC3.2/30 type; Amersham Pharmacia Biotech), uses 50mM Tris-HCl, pH7.7,100mM NaCl, 0.5mM MgCl 2Carry out balance at 4 ℃, flow velocity is 0.1ml/min.Record 278nm tomographic map.From elution volume, collect elutriant with the fraction of 50 μ l.
The mensuration of phosphodiesterase activity and inhibition
Measure phosphodiesterase activity with IMAP FP-assay method.Measure the phosphodiesterase activity of core construct and PDE4D 3,5 or 7 with HEFPPhosphodiesterase Assay Kit (Molec μ lar Devices).2 μ l PDE4D 5 or 7 or PDE4D core construct, 2 μ l cAMP (final concentration 40nM) and 1 μ l detect substrate or carrier was hatched on shaking table 45 minutes.Add the BindingSolution that 12 μ l test kits (pearl with dilution in 1: 320) provide, reaction mixture was hatched on shaking table 2 hours.By Packard BioScience Fusiona-FP HT, make the emission optical filter with Polarizer 535, Fluorescein 485/20 makes exciter filter, the measure sample fluorescence polarization.Measure the inhibition of PDE4D core construct phosphodiesterase activity with rolipram as inhibitor, the working concentration of PDE4D core construct is 30ng/ml.The rat lauric acid model of PAOD (Kawamura etc., 1985, Arzneimittelforschung35/7A:1154-1156)
Rat artery is injected the lauric acid that 75 μ g are dissolved in 10 μ l straight alcohols.Injection site with the contiguous femoral artery of tissue adhesive's sealing.Wound healing allows the animal recovery from illness.As shown in Figure 6, trained rat is walked in treadmill before the injection lauric acid.By shown in the gavage drug administration.This processing causes the polyangitis disease that causes PAOD.Force rat on treadmill, to practise, up to they fatigue with the speed of 25m/min and 4.5% the gradient.Fatigue is defined as to add up up to 5 little electricity irritation and is applied to rat and just can makes it to run on treadmill the needed time again.
The inhibitor C ilomilast of PDE4 and PDE3 inhibitor C ilostazol compare.Cilostazol is used for the treatment of PAOD, therefore as positive control.Cilomilast demonstrates and Cilostazol equally valid (Fig. 7).
This tests demonstration, and the inhibitor of PDE4 can improve the travel distance of PAOD rat model.
Sequence table
＜110〉Flax Huffmun-Laroqie Co., Ltd
＜120〉PDE4D is in atherosclerosis or restenosis
<130>Case 21729
<160>4
＜170〉PatentIn version 3 .1
<210>1
<211>747
<212>PET
＜213〉mouse
<220>
＜221〉mouse PDE4D7
<222>(1)..(747)
<223>
<400>1
Met Glu Arg Asn Thr Cys Asp Val Leu Ser Arg Ser Lys Ser Ala Ser
1 5 10 15
Glu Glu Thr Leu His Ser Cys Asn Asp Glu Glu Asp Pro Phe Arg Gly
20 25 30
Met Glu Pro Tyr Leu Val Arg Arg Leu Ser Ser Arg Ser Ile Gln Leu
35 40 45
Pro Pro Leu Ala Phe Arg Gln Leu Glu Gln Thr Asp Leu Arg Ser Glu
50 55 60
Ser Glu Asn Ile Pro Arg Pro Thr Ser Leu Pro Leu Lys Ile Leu Pro
65 70 75 80
Leu Ile Ala Val Thr Ser Ala Asp Ser Thr Gly Phe Asp Val Asp Asn
85 90 95
Gly Thr Ser Ala Gly Arg Ser Pro Leu Asp Pro Met Thr Ser Pro Gly
100 105 110
Ser Gly Leu Ile Leu Gln Ala Asn Phe Val His Ser Gln Arg Arg Glu
115 120 125
Ser Phe Leu Tyr Arg Ser Asp Ser Asp Tyr Asp Leu Ser Pro Lys Ser
130 135 140
Met Ser Arg Asn Ser Ser Ile Ala Ser Asp Ile His Gly Asp Asp Leu
145 150 155 160
Ile Val Thr Pro Phe Ala Gln Val Leu Ala Ser Leu Arg Thr Val Arg
165 170 175
Asn Asn Phe Ala Ala Leu Thr Asn Leu Gln Asp Arg Ala Pro Ser Lys
180 l85 190
Arg Ser Pro Met Cys Asn Gln Pro Ser Ile Asn Lys Ala Thr Ile Thr
195 200 205
Glu Glu Ala Tyr Gln Lys Leu Ala Ser Glu Thr Leu Glu Glu Leu Asp
210 215 220
Trp Cys Leu Asp Gln Leu Glu Thr Leu Gln Thr Arg His Ser Val Ser
225 230 235 240
Glu Met Ala Ser Asn Lys Phe Lys Arg Met Leu Asn Arg Glu Leu Thr
245 250 255
His Leu Ser Glu Met Ser Arg Ser Gly Asn Gln Val Ser Glu Tyr Ile
260 265 270
Ser Asn Thr Phe Leu Asp Lys Gln His Glu Val Glu Ile Pro Ser Pro
275 280 285
Thr Gln Lys Glu Lys Glu Lys Lys Lys Arg Pro Met Ser Gln Ile Ser
290 295 300
Gly Val Lys Lys Leu Met His Ser Ser Ser Leu Thr Asn Ser Cys Ile
305 310 315 320
Pro Arg Phe Gly Val Lys Thr Glu Gln Glu Asp Val Leu Ala Lys Glu
325 330 335
Leu Glu Asp Val Asn Lys Trp Gly Leu His Val Phe Arg Ile Ala Glu
340 345 350
Leu Ser Gly Asn Arg Pro Leu Thr Val Ile Met His Thr Ile Phe Gln
355 360 365
Glu Arg Asp Leu Leu Lys Thr Phe Lys Ile Pro Val Asp Thr Leu Ile
370 375 380
Thr Tyr Leu Met Thr Leu Glu Asp His Tyr His Ala Asp Val Ala Tyr
385 390 395 400
His Asn Asn Ile His Ala Ala Asp Val Val Gln Ser Thr His Val Leu
405 410 415
Leu Ser Thr Pro Ala Leu Glu Ala Val Phe Thr Asp Leu Glu Ile Leu
420 425 430
Ala Ala Ile Phe Ala Ser Ala Ile His Asp Val Asp His Pro Gly Val
435 440 445
Ser Asn Gln Phe Leu Ile Asn Thr Asn Ser Glu Leu Ala Leu Met Tyr
450 455 460
Asn Asp Ser Ser Val Leu Glu Asn His His Leu Ala Val Gly Phe Lys
465 470 475 480
Leu Leu Gln Glu Glu Asn Cys Asp Ile Phe Gln Asn Leu Thr Lys Lys
485 490 495
Gln Arg Gln Ser Leu Arg Lys Met Ala Ile Asp Ile Val Leu Ala Thr
500 505 510
Asp Met Ser Lys His Met Asn Leu Leu Ala Asp Leu Lys Thr Met Val
515 520 525
Glu Thr Lys Lys Val Thr Ser Ser Gly Val Leu Leu Leu Asp Asn Tyr
530 535 540
Ser Asp Arg Ile Gln Val Leu Gln Asn Met Val His Cys Ala Asp Leu
545 550 555 560
Ser Asn Pro Thr Lys Pro Leu Gln Leu Tyr Arg Gln Trp Thr Asp Arg
565 570 575
Ile Met Glu Glu Phe Phe Arg Gln Gly Asp Arg Glu Arg Glu Arg Gly
580 585 590
Met Glu Ile Ser Pro Met Cys Asp Lys His Asn Ala Ser Val Glu Lys
595 600 605
Ser Gln Val Gly Phe Ile Asp Tyr Ile Val His Pro Leu Trp Glu Thr
610 615 620
Trp Ala Asp Leu Val His Pro Asp Ala Gln Asp Ile Leu Asp Thr Leu
625 630 635 640
Glu Asp Asn Arg Glu Trp Tyr Gln Ser Thr Ile Pro Gln Ser Pro Ser
645 650 655
Pro Ala Pro Asp Asp Gln Glu Asp Gly Arg Gln Gly Gln Thr Glu Lys
660 665 670
Phe Gln Phe Glu Leu Thr Leu Glu Glu Asp Gly Glu Ser Asp Thr Glu
675 680 685
Lys Asp Ser Gly Ser Gln Val Glu Glu Asp Thr Ser Cys Ser Asp Ser
690 695 700
Lys Thr Leu Cys Thr Gln Asp Ser Glu Ser Thr Glu Ile Pro Leu Asp
705 710 715 720
Glu Gln Val Glu Glu Glu Ala Val Ala Glu Glu Glu Ser Gln Pro Gln
725 730 735
Thr Gly Val Ala Asp Asp Cys Cys Pro Asp Thr
740 745
<210>2
<211>747
<212>PRT
＜213〉rat
<220>
＜221〉P of Rats DE4D7
<222>(1)..(747)
<223>
<400>2
Met Glu Arg Asp Thr Cys Asp Val Leu Ser Arg Ser Lys Ser Ala Ser
1 5 10 15
Glu Glu Thr Leu His Ser Cys Asn Glu Glu Glu Asp Pro Phe Arg Gly
20 25 30
Met Glu Pro Tyr Leu Val Arg Arg Leu Ser Ser Arg Ser Ile Gln Leu
35 40 45
Pro Pro Leu Ala Phe Arg Gln Leu Glu Gln Ala Asp Leu Arg Ser Glu
50 55 60
Ser Glu Asn Ile Pro Arg Pro Thr Ser Leu Pro Leu Lys Ile Leu Pro
65 70 75 80
Leu Ile Ala Val Thr Ser Ala Asp Ser Ser Gly Phe Asp Val Asp Asn
85 90 95
Gly Thr Ser Ala Gly Arg Ser Pro Leu Asp Pro Met Thr Ser Pro Gly
100 105 110
Ser Gly Leu Ile Leu Gln Ala Asn Phe Val His Ser Gln Arg Arg Glu
115 120 125
Ser Phe Leu Tyr Arg Ser Asp Ser Asp Tyr Asp Leu Ser Pro Lys Ser
130 135 140
Met Ser Arg Asn Ser Ser Ile Ala Ser Asp Ile His Gly Asp Asp Leu
145 150 155 160
Ile Val Thr Pro Phe Ala Gln Val Leu Ala Ser Leu Arg Thr Val Arg
165 170 175
Asn Asn Phe Ala Ala Leu Thr Asn Leu Gln Asp Arg Ala Pro Ser Lys
180 185 190
Arg Ser Pro Met Cys Asn Gln Pro Ser Ile Asn Lys Ala Thr Ile Thr
195 200 205
Glu Glu Ala Tyr Gln Lys Leu Ala Ser Glu Thr Leu Glu Glu Leu Asp
210 215 220
Trp Cys Leu Asp Gln Leu Glu Thr Leu Gln Thr Arg His Ser Val Ser
225 230 235 240
Glu Met Ala Ser Asn Lys Phe Lys Arg Met Leu Asn Arg Glu Leu Thr
245 250 255
His Leu Ser Glu Met Ser Arg Ser Gly Asn Gln Val Ser Glu Tyr Ile
260 265 270
Ser Asn Thr Phe Leu Asp Lys Gln His Glu Val Glu Ile Pro Ser Pro
275 280 285
Thr Gln Lys Glu Lys Glu Lys Lys Lys Arg Pro Met Ser Gln Ile Ser
290 295 300
Gly Val Lys Lys Leu Met His Ser Ser Ser Leu Thr Asn Ser Cys Ile
305 310 315 320
Pro Arg Phe Gly Val Lys Thr Glu Gln Glu Asp Val Leu Ala Lys Glu
325 330 335
Leu Glu Asp Val Asn Lys Trp Gly Leu His Val Phe Arg Ile Ala Glu
340 345 350
Leu Ser Gly Asn Arg Pro Leu Thr Val Ile Met His Thr Ile Phe Gln
355 360 365
Glu Arg Asp Leu Leu Lys Thr Phe Lys Ile Pro Val Asp Thr Leu Ile
370 375 380
Thr Tyr Leu Met Thr Leu Glu Asp His Tyr His Ala Asp Val Ala Tyr
385 390 395 400
His Asn Asn Ile His Ala Ala Asp Val Val Gln Ser Thr His Val Leu
405 410 415
Leu Ser Thr Pro Ala Leu Glu Ala Val Phe Thr Asp Leu Glu Ile Leu
420 425 430
Ala Ala Ile Phe Ala Ser Ala Ile His Asp Val Asp His Pro Gly Val
435 440 445
Ser Asn Gln Phe Leu Ile Asn Thr Asn Ser Glu Leu Ala Leu Met Tyr
450 455 460
Asn Asp Ser Ser Val Leu Glu Asn His His Leu Ala Val Gly Phe Lys
465 470 475 480
Leu Leu Gln Glu Glu Asn Cys Asp Ile Phe Gln Asn Leu Thr Lys Lys
485 490 495
Gln Arg Gln Ser Leu Arg Lys Met Val Ile Asp Ile Val Leu Ala Thr
500 505 510
Asp Met Ser Lys His Met Asn Leu Leu Ala Asp Leu Lys Thr Met Val
515 520 525
Glu Thr Lys Lys Val Thr Ser Ser Gly Val Leu Leu Leu Asp Asn Tyr
530 535 540
Ser Asp Arg Ile Gln Val Leu Gln Asn Met Val His Cys Ala Asp Leu
545 550 555 560
Ser Asn Pro Thr Lys Pro Leu Gln Leu Tyr Arg Gln Trp Thr Asp Arg
565 570 575
Ile Met Glu Glu Phe Phe Arg Gln Gly Asp Arg Glu Arg Glu Arg Gly
580 585 590
Met Glu Ile Ser Pro Met Cys Asp Lys His Asn Ala Ser Val Glu Lys
595 600 605
Ser Gln Val Gly Phe Ile Asp Tyr Ile Val His Pro Leu Trp Glu Thr
610 615 620
Trp Ala Asp Leu Val His Pro Asp Ala Gln Asp Ile Leu Asp Thr Leu
625 630 635 640
Glu Asp Asn Arg Glu Trp Tyr Gln Ser Thr Ile Pro Gln Ser Pro Ser
645 650 655
Pro Ala Pro Asp Asp Gln Glu Glu Gly Arg Gln Gly Gln Thr Glu Lys
660 665 670
Phe Gln Phe Glu Leu Thr Leu Glu Glu Asp Cys Glu Ser Asp Thr Glu
675 680 685
Lys Asp Ser Gly Ser Gln Val Glu Glu Asp Thr Ser Cys Ser Asp Ser
690 695 700
Lys Thr Leu Cys Thr Gln Asp Ser Glu Ser Thr Glu Ile Pro Leu Asp
705 710 715 720
Glu Gln Val Glu Glu Glu Ala Val Ala Glu Glu Glu Ser Gln Pro Glu
725 730 735
Thr Cys Val Pro Asp Asp Cys Cys Pro Asp Thr
740 745
<210>3
<211>748
<212>PRT
＜213〉people
<220>
＜221〉people PDE4D7
<222>(1)..(748)
<223>
<400>3
Met Lys Arg Asn Thr Cys Asp Leu Leu Ser Arg Ser Lys Ser Ala Ser
1 5 10 15
Glu Glu Thr Leu His Ser Ser Asn Glu Glu Glu Asp Pro Phe Arg Gly
20 25 30
Met Glu Pro Tyr Leu Val Arg Arg Leu Ser Cys Arg Asn Ile Gln Leu
35 40 45
Pro Pro Leu Ala Phe Arg Gln Leu Glu Gln Ala Asp Leu Lys Ser Glu
50 55 60
Ser Glu Asn Ile Gln Arg Pro Thr Ser Leu Pro Leu Lys Ile Leu Pro
65 70 75 80
Leu Ile Ala Ile Thr Ser Ala Glu Ser Ser Gly Phe Asp Val Asp Asn
85 90 95
Gly Thr Ser Ala Gly Arg Ser Pro Leu Asp Pro Met Thr Ser Pro Gly
100 105 110
Ser Gly Leu Ile Leu Gln Ala Asn Phe Val His Ser Gln Arg Arg Glu
115 120 125
Ser Phe Leu Tyr Arg Ser Asp Ser Asp Tyr Asp Leu Ser Pro Lys Ser
130 135 140
Met Ser Arg Asn Ser Ser Ile Ala Ser Asp Ile His Gly Asp Asp Leu
145 150 155 160
Ile Val Thr Pro Phe Ala Gln Val Leu Ala Ser Leu Arg Thr Val Arg
165 170 175
Asn Asn Phe Ala Ala Leu Thr Asn Leu Gln Asp Arg Ala Pro Ser Lys
180 185 190
Arg Ser Pro Met Cys Asn Gln Pro Ser Ile Asn Lys Ala Thr Ile Thr
195 200 205
Glu Glu Ala Tyr Gln Lys Leu Ala Ser Glu Thr Leu Glu Glu Leu Asp
210 215 220
Trp Cys Leu Asp Gln Leu Glu Thr Leu Gln Thr Arg His Ser Val Ser
225 230 235 240
Glu Met Ala Ser Asn Lys Phe Lys Arg Met Leu Asn Arg Glu Leu Thr
245 250 255
His Leu Ser Glu Met Ser Arg Ser Gly Asn Gln Val Ser Glu Phe Ile
260 265 270
Ser Asn Thr Phe Leu Asp Lys Gln His Glu Val Glu Ile Pro Ser Pro
275 280 285
Thr Gln Lys Glu Lys Glu Lys Lys Lys Arg Pro Met Ser Gln Ile Ser
290 295 300
Gly Val Lys Lys Leu Met His Ser Ser Ser Leu Thr Asn Ser Ser Ile
305 310 315 320
Pro Arg Phe Gly Val Lys Thr Glu Gln Glu Asp Val Leu Ala Lys Glu
325 330 335
Leu Glu Asp Val Asn Lys Trp Gly Leu His Val Phe Arg Ile Ala Glu
340 345 350
Leu Ser Gly Asn Arg Pro Leu Thr Val Ile Met His Thr Ile Phe Gln
355 360 365
Glu Arg Asp Leu Leu Lys Thr Phe Lys Ile Pro Val Asp Thr Leu Ile
370 375 380
Thr Tyr Leu Met Thr Leu Glu Asp His Tyr His Ala Asp Val Ala Tyr
385 390 395 400
His Asn Asn Ile His Ala Ala Asp Val Val Gln Ser Thr His Val Leu
405 410 415
Leu Ser Thr Pro Ala Leu Glu Ala Val Phe Thr Asp Leu Glu Ile Leu
420 425 430
Ala Ala Ile Phe Ala Ser Ala Ile His Asp Val Asp His Pro Gly Val
435 440 445
Ser Asn Gln Phe Leu Ile Asn Thr Asn Ser Glu Leu Ala Leu Met Tyr
450 455 460
Asn Asp Ser Ser Val Leu Glu Asn His His Leu Ala Val Gly Phe Lys
465 470 475 480
Leu Leu Gln Glu Glu Asn Cys Asp Ile Phe Gln Asn Leu Thr Lys Lys
485 490 495
Gln Arg Gln Ser Leu Arg Lys Met Val Ile Asp Ile Val Leu Ala Thr
500 505 510
Asp Met Ser Lys His Met Asn Leu Leu Ala Asp Leu Lys Thr Met Val
515 520 525
Glu Thr Lys Lys Val Thr Ser Ser Gly Val Leu Leu Leu Asp Asn Tyr
530 535 540
Ser Asp Arg Ile Gln Val Leu Gln Asn Met Val His Cys Ala Asp Leu
545 550 555 560
Ser Asn Pro Thr Lys Pro Leu Gln Leu Tyr Arg Gln Trp Thr Asp Arg
565 570 575
Ile Met Glu Glu Phe Phe Arg Gln Gly Asp Arg Glu Arg Glu Arg Gly
580 585 590
Met Glu Ile Ser Pro Met Cys Asp Lys His Asn Ala Ser Val Glu Lys
595 600 605
Ser Gln Val Gly Phe Ile Asp Tyr Ile Val His Pro Leu Trp Glu Thr
610 615 620
Trp Ala Asp Leu Val His Pro Asp Ala Gln Asp Ile Leu Asp Thr Leu
625 630 635 640
Glu Asp Asn Arg Glu Trp Tyr Gln Ser Thr Ile Pro Gln Ser Pro Ser
645 650 655
Pro Ala Pro Asp Asp Pro Glu Glu Gly Arg Gln Gly Gln Thr Glu Lys
660 665 670
Phe Gln Phe Glu Leu Thr Leu Glu Glu Asp Gly Glu Ser Asp Thr Glu
675 680 685
Lys Asp Ser Gly Ser Gln Val Glu Glu Asp Thr Ser Cys Ser Asp Ser
690 695 700
Lys Thr Leu Cys Thr Gln Asp Ser Glu Ser Thr Glu Ile Pro Leu Asp
705 710 715 720
Glu Gln Val Glu Glu Glu Ala Val Gly Glu Glu Glu Glu Ser Gln Pro
725 730 735
Glu Ala Cys Val Ile Asp Asp Arg Ser Pro Asp Thr
740 745
<210>4
<211>747
<212>PRT
＜213〉people
<220>
＜221〉people PDE4D5
<222>(1)..(747)
<223>
<400>4
Met Ala Gln Gln Thr Ser Pro Asp Thr Leu Thr Val Pro Glu Val Asp
1 5 10 15
Asn Pro His Cys Pro Asn Pro Trp Leu Asn Glu Asp Leu Val Lys Ser
20 25 30
Leu Arg Glu Asn Leu Leu Gln His Glu Lys Ser Lys Thr Ala Arg Lys
35 40 45
Ser Val Ser Pro Lys Leu Ser Pro Val Ile Ser Pro Arg Asn Ser Pro
50 55 60
Arg Leu Leu Arg Arg Met Leu Leu Ser Ser Asn Ile Pro Lys Gln Arg
65 70 75 80
Arg Phe Thr Val Ala His Thr Cys Lys Leu Phe Asp Val Asp Asn Gly
85 90 95
Thr Ser Ala Gly Arg Ser Pro Leu Asp Pro Met Thr Ser Pro Gly Ser
100 105 110
Gly Leu Ile Leu Gln Ala Asn Phe Val His Ser Gln Arg Arg Glu Ser
115 120 125
Phe Leu Tyr Arg Ser Asp Ser Asp Tyr Asp Leu Ser Pro Lys Ser Met
130 135 140
Ser Arg Asn Ser Ser Ile Ala Ser Asp Ile His Gly Asp Asp Leu Ile
145 150 155 160
Val Thr Pro Phe Ala Gln Val Leu Ala Ser Leu Arg Thr Val Arg Asn
165 170 175
Asn Phe Ala Ala Leu Thr Asn Leu Gln Asp Arg Ala Pro Ser Lys Arg
180 185 190
Ser Pro Met Cys Asn Gln Pro Ser Ile Asn Lys Ala Thr Ile Thr Glu
195 200 205
Glu Ala Tyr Gln Lys Leu Ala Ser Glu Thr Leu Glu Glu Leu Asp Trp
210 215 220
Cys Leu Asp Gln Leu Glu Thr Leu Gln Thr Arg His Ser Val Ser Glu
225 230 235 240
Met Ala Ser Asn Lys Phe Lys Arg Met Leu Asn Arg Glu Leu Thr His
245 250 255
Leu Ser Glu Met Ser Arg Ser Gly Asn Gln Val Ser Glu Phe Ile Ser
260 265 270
Asn Thr Phe Leu Asp Lys Gln His Glu Val Glu Ile Pro Ser Pro Thr
275 280 285
Gln Lys Glu Lys Glu Lys Lys Lys Arg Pro Met Ser Gln Ile Ser Gly
290 295 300
Val Lys Lys Leu Met His Ser Ser Ser Leu Thr Asn Ser Ser Ile Pro
305 310 315 320
Arg Phe Gly Val Lys Thr Glu Gln Glu Asp Val Leu Ala Lys Glu Leu
325 330 335
Glu Asp Val Asn Lys Trp Gly Leu His Val Phe Arg Ile Ala Glu Leu
340 345 350
Ser Gly Asn Arg Pro Leu Thr Val Ile Met His Thr Ile Phe Gln Glu
355 360 365
Arg Asp Leu Leu Lys Thr Phe Lys Ile Pro Val Asp Thr Leu Ile Thr
370 375 380
Tyr Leu Met Thr Leu Glu Asp His Tyr His Ala Asp Val Ala Tyr His
385 390 395 400
Asn Asn Ile His Ala Ala Asp Val Val Gln Ser Thr His Val Leu Leu
405 410 415
Ser Thr Pro Ala Leu Glu Ala Val Phe Thr Asp Leu Glu Ile Leu Ala
420 425 430
Ala Ile Phe Ala Ser Ala Ile His Asp Val Asp His Pro Gly Val Ser
435 440 445
Asn Gln Phe Leu Ile Asn Thr Asn Ser Glu Leu Ala Leu Met Tyr Asn
450 455 460
Asp Ser Ser Val Leu Glu Asn His His Leu Ala Val Gly Phe Lys Leu
465 470 475 480
Leu Gln Glu Glu Asn Cys Asp Ile Phe Gln Asn Leu Thr Lys Lys Gln
485 490 495
Arg Gln Ser Leu Arg Lys Met Val Ile Asp Ile Val Leu Ala Thr Asp
500 505 510
Met Ser Lys His Met Asn Leu Leu Ala Asp Leu Lys Thr Met Val Glu
515 520 525
Thr Lys Lys Val Thr Ser Ser Gly Val Leu Leu Leu Asp Asn Tyr Ser
530 535 540
Asp Arg Ile Gln Val Leu Gln Asn Met Val His Cys Ala Asp Leu Ser
545 550 555 560
Asn Pro Thr Lys Pro Leu Gln Leu Tyr Arg Gln Trp Thr Asp Arg Ile
565 570 575
Met Glu Glu Phe Phe Ara Gln Gly Asp Arg Glu Arg Glu Arg Gly Met
580 585 590
Glu Ile Ser Pro Met Cys Asp Lys His Asn Ala Ser Val Glu Lys Ser
595 600 605
Gln Val Gly Phe Ile Asp Tyr Ile Val His Pro Leu Trp Glu Thr Trp
610 615 620
Ala Asp Leu Val His Pro Asp Ala Gln Asp Ile Leu Asp Thr Leu Glu
625 630 635 640
Asp Asn Arg Glu Trp Tyr Gln Ser Thr Ile Pro Gln Ser Pro Ser Pro
645 650 655
Ala Pro Asp Asp Pro Glu Glu Gly Arg Gln Gly Gln Thr Glu Lys Phe
660 665 670
Gln Phe Glu Leu Thr Leu Glu Glu Asp Gly Glu Ser Asp Thr Glu Lys
675 680 685
Asp Ser Gly Ser Gln Val Glu Glu Asp Thr Ser Cys Ser Asp Ser Lys
690 695 700
Thr Leu Cys Thr Gln Asp Ser Glu Ser Thr Glu Ile Pro Leu Asp Glu
705 710 715 720
Gln Val Glu Glu Glu Ala Val Gly Glu Glu Glu Glu Ser Gln Pro Glu
725 730 735
Ala Cys Val Ile Asp Asp Arg Ser Pro Asp Thr
740 745
<210>5
<211>664
<212>PRT
＜213〉people
<220>
＜221〉core PDE4D
<222>(1)..(664)
<223>
<400>5
Met Phe Asp Val Asp Asn Gly Thr Ser Ala Gly Arg Ser Pro Leu Asp
1 5 10 15
Pro Met Thr Ser Pro Gly Ser Gly Leu Ile Leu Gln Ala Asn Phe Val
20 25 30
His Ser Gln Arg Arg Glu Ser Phe Leu Tyr Arg Ser Asp Ser Asp Tyr
35 40 45
Asp Leu Ser Pro Lys Ser Met Ser Arg Asn Ser Ser Ile Ala Ser Asp
50 55 60
Ile His Gly Asp Asp Leu Ile Val Thr Pro Phe Ala Gln Val Leu Ala
65 70 75 80
Ser Leu Arg Thr Val Arg Asn Asn Phe Ala Ala Leu Thr Asn Leu Gln
85 90 95
Asp Arg Ala Pro Ser Lys Arg Ser Pro Met Cys Asn Gln Pro Ser Ile
100 105 110
Asn Lys Ala Thr Ile Thr Glu Glu Ala Tyr Gln Lys Leu Ala Ser Glu
115 120 125
Thr Leu Glu Glu Leu Asp Trp Cys Leu Asp Gln Leu Glu Thr Leu Gln
130 135 140
Thr Arg His Ser Val Ser Glu Met Ala Ser Asn Lys Phe Lys Arg Met
145 150 155 160
Leu Asn Arg Glu Leu Thr His Leu Ser Glu Met Ser Arg Ser Gly Asn
165 170 175
Gln Val Ser Glu Phe Ile Ser Asn Thr Phe Leu Asp Lys Gln His Glu
180 185 190
Val Glu Ile Pro Ser Pro Thr Gln Lys Glu Lys Glu Lys Lys Lys Arg
195 200 205
Pro Met Ser Gln Ile Ser Gly Val Lys Lys Leu Met His Ser Ser Ser
210 215 220
Leu Thr Asn Ser Ser Ile Pro Arg Phe Gly Val Lys Thr Glu Gln Glu
225 230 235 240
Asp Val Leu Ala Lys Glu Leu Glu Asp Val Asn Lys Trp Gly Leu His
245 250 255
Val Phe Arg Ile Ala Glu Leu Ser Gly Asn Arg Pro Leu Thr Val Ile
260 265 270
Met His Thr Ile Phe Gln Glu Arg Asp Leu Leu Lys Thr Phe Lys Ile
275 280 285
Pro Val Asp Thr Leu Ile Thr Tyr Leu Met Thr Leu Glu Asp His Tyr
290 295 300
His Ala Asp Val Ala Tyr His Asn Asn Ile His Ala Ala Asp Val Val
305 310 315 320
Gln Ser Thr His Val Leu Leu Ser Thr Pro Ala Leu Glu Ala Val Phe
325 330 335
Thr Asp Leu Glu Ile Leu Ala Ala Ile Phe Ala Ser Ala Ile His Asp
340 345 350
Val Asp His Pro Gly Val Ser Asn Gln Phe Leu Ile Asn Thr Asn Ser
355 360 365
Glu Leu Ala Leu Met Tyr Asn Asp Ser Ser Val Leu Glu Asn His His
370 375 380
Leu Ala Val Gly Phe Lys Leu Leu Gln Glu Glu Asn Cys Asp Ile Phe
385 390 395 400
Gln Asn Leu Thr Lys Lys Gln Arg Gln Ser Leu Arg Lys Met Val Ile
405 410 415
Asp Ile Val Leu Ala Thr Asp Met Ser Lys His Met Asn Leu Leu Ala
420 425 430
Asp Leu Lys Thr Met Val Glu Thr Lys Lys Val Thr Ser Ser Gly Val
435 440 445
Leu Leu Leu Asp Asn Tyr Ser Asp Arg Ile Gln Val Leu Gln Asn Met
450 455 460
Val His Cys Ala Asp Leu Ser Asn Pro Thr Lys Pro Leu Gln Leu Tyr
465 470 475 480
Arg Gln Trp Thr Asp Arg Ile Met Glu Glu Phe Phe Arg Gln Gly Asp
485 490 495
Arg Glu Arg Glu Arg Gly Met Glu Ile Ser Pro Met Cys Asp Lys His
500 505 510
Asn Ala Ser Val Glu Lys Ser Gln Val Gly Phe Ile Asp Tyr Ile Val
515 520 525
His Pro Leu Trp Glu Thr Trp Ala Asp Leu Val His Pro Asp Ala Gln
530 535 540
Asp Ile Leu Asp Thr Leu Glu Asp Asn Arg Glu Trp Tyr Gln Ser Thr
545 550 555 560
Ile Pro Gln Ser Pro Ser Pro Ala Pro Asp Asp Pro Glu Glu Gly Arg
565 570 575
Gln Gly Gln Thr Glu Lys Phe Gln Phe Glu Leu Thr Leu Glu Glu Asp
580 585 590
Gly Glu Ser Asp Thr Glu Lys Asp Ser Gly Ser Gln Val Glu Glu Asp
595 600 605
Thr Ser Cys Ser Asp Ser Lys Thr Leu Cys Thr Gln Asp Ser Glu Ser
610 615 620
Thr Glu Ile Pro Leu Asp Glu Gln Val Glu Glu Glu Ala Val Gly Glu
625 630 635 640
Glu Glu Glu Ser Gln Pro Glu Ala Cys Val Ile Asp Asp Arg Ser Pro
645 650 655
Asp Thr His His His His His His
660
<210>6
<211>87
<212>PRT
＜213〉people
<220>
＜221〉people PDE4D5N-end structure territory
<222>(1)..(87)
<223>
<400>6
Met Ala Gln Gln Thr Ser Pro Asp Thr Leu Thr Val Pro Glu Val Asp
1 5 10 15
Asn Pro His Cys Pro Asn Pro Trp Leu Asn Glu Asp Leu Val Lys Ser
20 25 30
Leu Arg Glu Asn Leu Leu Gln His Glu Lys Ser Lys Thr Ala Arg Lys
35 40 45
Ser Val Ser Pro Lys Leu Ser Pro Val Ile Ser Pro Arg Asn Ser Pro
50 55 60
Arg Leu Leu Arg Arg Met Leu Leu Ser Ser Asn Ile Pro Lys Gln Arg
65 70 75 80
Arg Phe Thr Val Ala His Thr
85
<210>7
<211>88
<212>PRT
＜213〉rat
<220>
＜221〉P of Rats DE4D5N-end structure territory
<222>(1)..(88)
<223>
<400>7
Met Ala Gln Gln Thr Thr Ser Pro Asp Thr Leu Thr Val Pro Glu Val
1 5 10 15
Asp Asn Pro His Val Pro Asn Pro Trp Leu Asn Glu Asp Leu Val Lys
20 25 30
Ser Leu Arg Glu Asn Leu Leu Gln His Glu Lys Ser Lys Thr Ala Arg
35 40 45
Lys Ser Val Ser Pro Lys Leu Ser Pro Val Ile Ser Pro Arg Asn Ser
50 55 60
Pro Arg Leu Leu Arg Arg Met Leu Leu Ser Ser Asn Ile Pro Lys Gln
65 70 75 80
Arg Arg Phe Thr Val Ala His Thr
85

Claims (20)

1.PDE4 the purposes in identifying the compound that suppresses atherosclerosis or restenosis.
2. the purposes of claim 1, wherein PDE4 is PDE4D.
3. the purposes of claim 2, wherein PDE4D is PDE4D5 or PDE4D7.
4. the purposes of claim 2, wherein PDE4D is PDE4D7.
5. it is inaccessible sick that each purposes among the claim 1-4, wherein said compound suppress peripheral arterial.
6. be used to identify and obtain to treat the method for the compound of atherosclerosis or restenosis, this method comprises the activation or the inhibition of measuring the PDE4 phosphodiesterase activity.
7. the method for claim 6, wherein said PDE4 is PDE4D.
8. the method for claim 7, wherein PDE4D is PDE4D5 or PDE4D7.
9. the method for claim 7, wherein PDE4D is PDE4D7.
10. each method among the claim 6-9 has wherein obtained to be used for the treatment of the inaccessible sick compound of peripheral arterial.
11. be used to identify and obtain the method for the compound of treatment atherosclerosis or restenosis, this method comprises uses the compound that is contemplated to PDE4 activator or inhibitor to the animal of inducing atherosclerosis or restenosis, and the atherosclerosis of these animals or the degree of restenosis are compared in measurement with the animal of control treatment.
12. the method for claim 11, wherein said PDE4 is PDE4D.
13. the method for claim 12, wherein PDE4D is PDE4D5 or PDE4D7.
14. the method for claim 12, wherein PDE4D is PDE4D7.
15. each method among the claim 11-14, wherein compound is used for the treatment of the inaccessible disease of peripheral arterial.
16. by each method compounds identified among the claim 6-15.
17. comprise the compound of claim 16 and the pharmaceutical composition of pharmaceutically acceptable carrier.
18. the purposes of the compound in the claim 16 in the medicine of preparation treatment atherosclerosis, restenosis.
19. the purposes of claim 18, wherein said compound are used to prepare the inaccessible sick medicine of treatment peripheral arterial.
20. substantially as previously mentioned, especially with reference to compound, method, purposes and the composition of previous embodiment.
CNB2004800096278A 2003-04-10 2004-04-07 The use of PDE4D in the screening for medicaments against atherosclerosis Expired - Fee Related CN100372944C (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP03007993.3 2003-04-10
EP03007993 2003-04-10

Publications (2)

Publication Number Publication Date
CN1771329A true CN1771329A (en) 2006-05-10
CN100372944C CN100372944C (en) 2008-03-05

Family

ID=33155123

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2004800096278A Expired - Fee Related CN100372944C (en) 2003-04-10 2004-04-07 The use of PDE4D in the screening for medicaments against atherosclerosis

Country Status (6)

Country Link
EP (1) EP1616024A1 (en)
JP (1) JP2006522594A (en)
CN (1) CN100372944C (en)
AU (1) AU2004227089A1 (en)
CA (1) CA2521303A1 (en)
WO (1) WO2004090157A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107267482A (en) * 2009-05-12 2017-10-20 皇家飞利浦电子股份有限公司 It is used as the phosphodiesterase 4 D7 of prostate cancer marker

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1743904A3 (en) * 2005-07-13 2007-02-14 F. Hoffmann-La Roche Ag Guinea pig chymase
WO2016193110A1 (en) 2015-05-29 2016-12-08 Koninklijke Philips N.V. Methods of prostate cancer prognosis
EP3548631B1 (en) 2016-12-01 2021-08-25 Koninklijke Philips N.V. Risk scores based on human phosphodiesterase 4d variant 7 expression

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6348602B1 (en) * 1999-12-23 2002-02-19 Icos Corporation Cyclic AMP-specific phosphodiesterase inhibitors
US7354941B2 (en) * 2000-01-31 2008-04-08 Pfizer Products Inc. Nicotinamide benzofused-heterocyclyl derivatives useful as selective inhibitors of PDE4 isozymes
US20030054531A1 (en) * 2001-03-19 2003-03-20 Decode Genetics Ehf, Human stroke gene
WO2004042389A2 (en) * 2002-11-08 2004-05-21 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with human phosphodiesterase 4d (pde4d)
EP1439221B1 (en) * 2002-12-17 2007-01-24 F. Hoffmann-La Roche Ag PDE core construct

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107267482A (en) * 2009-05-12 2017-10-20 皇家飞利浦电子股份有限公司 It is used as the phosphodiesterase 4 D7 of prostate cancer marker

Also Published As

Publication number Publication date
EP1616024A1 (en) 2006-01-18
JP2006522594A (en) 2006-10-05
CN100372944C (en) 2008-03-05
WO2004090157A1 (en) 2004-10-21
AU2004227089A1 (en) 2004-10-21
CA2521303A1 (en) 2004-10-21

Similar Documents

Publication Publication Date Title
CN1916167A (en) Modulation of peroxisome proliferation-activated receptors
CN1636058A (en) Novel alanine transaminase enzyme and methods of use
CN1703229A (en) Compositions and methods for treatment of prostate and other cancers
CN1518595A (en) Modified arginine deiminase
CN1091139A (en) The PTP-D subfamily of Protein Tyrosine Phosphatases
CN1203173C (en) Process for producing transglutaminase
CN1193997A (en) Methodology to produce, purify and assay polypeptides with proteolytic activity of HCV NS3 protease
CN1285381C (en) Chemokine mutants in treatment of multiple sclerosis
CN101062954A (en) Fusion protein having blood vessel formation against function and its coding gene and application
CN1216900C (en) Cytomodulating lipophilic peptides for modulating immune system activity and inhibiting inflammation
CN1771329A (en) The use of PDE4D in the screening for medicaments against atherosclerosis
CN1170931C (en) Vasculogenesis correlation molecule
CN1778930A (en) Fusion gene of provocative organ anti-Coccidium tenellum infection and its coding protein and use thereof
CN1934250A (en) Novel alcohol dehydrogenase
CN1286973C (en) Histone methyl transferase and its preparing method
CN1170850C (en) Human angiogenin-like protein and coding sequence and application thereof
CN1526017A (en) Gene associated with leishmania parasite virulence
CN101050237A (en) Compound for blocking out interaction between uPA and uPAR, and application
CN1954882A (en) Use of long active human recombination solubility tumor necrosin alpha receptor in preparation of medicine for treating hepatic failure
CN1932016A (en) Polynucleotide affecting SRE activity and its coding polypeptides and use
CN1891718A (en) Fusion immunotoxin ML-L-SEC2 and gene and its preparation
CN1214817C (en) Coupling factor 6 inhibitor and potentiator and use thereof
CN1769436A (en) Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence
CN1303218C (en) Method of screening peroxisome proliferator-activated receptor antagon and agonist
CN1760363A (en) Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080305