EP1606618A2 - Testsystem zur auffindung von substanzen zur förderung des neuritenwachstums - Google Patents

Testsystem zur auffindung von substanzen zur förderung des neuritenwachstums

Info

Publication number
EP1606618A2
EP1606618A2 EP04720847A EP04720847A EP1606618A2 EP 1606618 A2 EP1606618 A2 EP 1606618A2 EP 04720847 A EP04720847 A EP 04720847A EP 04720847 A EP04720847 A EP 04720847A EP 1606618 A2 EP1606618 A2 EP 1606618A2
Authority
EP
European Patent Office
Prior art keywords
hnrnp
cell
actin
growth
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04720847A
Other languages
English (en)
French (fr)
Inventor
Michael Sendtner
Wilfried Rossoll
Sibylle Jablonka
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Julius Maximilians Universitaet Wuerzburg
Original Assignee
Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH,
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH, filed Critical Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH,
Publication of EP1606618A2 publication Critical patent/EP1606618A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6875—Nucleoproteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4712—Muscle proteins, e.g. myosin, actin, protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475—Assays involving growth factors

Definitions

  • the invention relates to a method and a test system for searching for or testing active substances which influence, in particular promote, the growth and / or survival of nerve cells, and thus obtainable ones
  • nerve cells The function of nerve cells depends on the formation and maintenance of functional neurites. Since a considerable number of neurodegenerative diseases (for example Alzheimer's disease, diabetic neuropathy, multiple sclerosis and the damage after cerebral ischemia) are associated with degeneration of neurites, there is a considerable need for substances which promote neurite growth and inhibit the degeneration of neurites.
  • neurodegenerative diseases for example Alzheimer's disease, diabetic neuropathy, multiple sclerosis and the damage after cerebral ischemia
  • Ribonucleoproteins are RNA-binding proteins that are involved in the biogenesis, transport and function of mRNA and rRNA.
  • the RNP includes the "small nuclear” ribonucleoproteins (snRNP) and the “heterogeneous nuclear” ribonucleoproteins (hnRNP).
  • snRNP small nuclear ribonucleoproteins
  • hnRNP heterogeneous nuclear ribonucleoproteins
  • hnRNPs play an important role in various aspects of the RNA metabolism such as splicing, transport, poly-adenylation, Stabilization and translation (Review: Krecic and Swanson, 1999; list of literature with complete bibliography see end of description).
  • snRNPs are known to be binding partners for the "survival motor neuron” (SMN) protein (Liu and Dreyfuss, 1996; Meister et al 2000).
  • SSN survival motor neuron
  • SMN is found in complex with some other proteins such as Gemin 2, Gemin 3, and Gemin 4, binds to U snRNAs (Fischer et al 1997, Bühler et al 1999; Selenko et al 2001) and is involved in the biogenesis and function of snRNPs , the "splicing" process of pre-mRNA and the processing and modification of rRNA (Pellizzoni et al Gurr Biol 11: 1074-1088, 2001; Friesen et al Mol Cell 7: 1111-1117,2001).
  • the SMN protein does not appear to be a survival factor for motor neurons, since an overexpression of the normal SMN protein motor neurons
  • SMN is also localized in the cytoplasm of motor neurons, including the dendrites and axons (Pagliardini et al., 2000).
  • SMA is one of the neurodegenerative diseases that are characterized by degeneration of nerve cells. These include Alzheimer's, diabetic neuropathy, multiple sclerosis and the complications of cerebral diseases Ischemia. Prophylaxis or therapy of these diseases is currently, if at all, only possible to a limited extent. New methods for the search for active substances as well as active substances for the prophylaxis or therapy of these diseases are urgently needed.
  • the invention is therefore based on the technical problem of specifying a test system with which active substances can be identified which are suitable for the prophylaxis and / or treatment of neurodegenerative diseases and / or nerve damage from injuries, and also such active substances.
  • the basis of the invention is the surprising finding that the heterogeneous nuclear ribonucleoproteins R and Q (hnRNP-R and hnRNP-Q), which are known to be Promote the growth of neurites significantly, bind specifically to the mRNA of ß-actin together with the product of the S n gene and that this complex translocates into the axons and growth zones of motor neurons.
  • the invention thus relates to substances which lead to an increase in the formation of complexes from the following components in nerve cells (1) hnRNP, in particular hnRNP-R and hnRNP-Q, and all of their splicing isoforms, (2) SMN protein and (3) ß-actin mRNA, test systems for the detection of such substances as well as for determining the functional state of nerve cells, with ß-actin alone (mRNA or protein) or in combination with at least one further component of this complex being detected and its use these substances for the prophylaxis and / or therapy of neurodegenerative diseases or nerve damage from injuries.
  • these substances promote the complex formation of hnRNP-R and / or of hnRNP-Q including all splicing isoforms (hereinafter referred to as hnRNP-R and -Q) with the SMN protein and with the mRNA for ß-actin.
  • These substances include nucleic acid sequences which code for ribonucleoproteins hnRNP-R and -Q and which enter the nerve cell using the methods known to the person skilled in the art, for example with the aid of the person skilled in the art known viral vectors or non-viral vectors.
  • these substances also include active substances which act on the nerve cell in such a way that the nerve cell increasingly forms ribonucleoproteins, in particular hnRNP-R and / or hnRNP -Q proteins.
  • the invention furthermore relates to methods for searching for active substances which increase the complex formation of ribonucleoproteins, in particular hnRNP-R and / or hnRNP-Q, in nerve cells, a cell being brought into contact with the substance to be tested and in the cell the amount of ⁇ -actin is determined alone or with at least one other component of the complex.
  • the invention furthermore relates to the use of an active ingredient according to the invention for the diagnosis, prophylaxis and / or therapy of a neurodegenerative disease or nerve damage due to injury or poisoning.
  • the invention furthermore relates to the detection of ⁇ -actin alone or with at least one further component of the complex for the diagnosis and / or monitoring of a neurogenerative disease.
  • detection is carried out either in molecular biology with the aid of nucleotide sequences which hybridize specifically with all or part of the nucleotide sequence of ⁇ -actin, for example using the in situ hybridization or reverse transcriptase polymerase chain reaction (RT-PCR) known to the person skilled in the art. or the detection is carried out with the help of antibodies or Antibody fragments which bind to actin or specifically ⁇ -actin or by other substances which specifically bind actin, such as, for example, fluorescence-labeled palloidin or phallacidin.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • ribonucleoproteins includes in particular all snRNP, including all splice variants or isoforms, of human and non-human origin. This does not include non-functional mutations. The same applies to SMN proteins and ß-actin.
  • non-functional denotes mutations which show no RNP / SMN / ⁇ -actin mRNA complex formation in an otherwise test system according to the invention.
  • the sequence of human hnRNP-R is known under the accession number AF000364.1. A newer version is known under the accession number NM_005826.
  • sequences of human hnRNP-Q (3 splicing isoforms Q1, Q2 and Q3) are known under accession numbers AY034483, AY034482 and AY034481, respectively.
  • the sequence of mouse hnRNP-R is known under accession number AF441128.
  • the sequence of mouse hnRNP-Q is known under the accession number AF093821.
  • the sequence of human SMN is known under the accession number AH006635.
  • sequence of human ⁇ -actin is known under the accession number NM_001101 (mRNA).
  • functional partial sequences and binding regions of the components can also be used.
  • the pharmaceutical preparation of a pharmaceutical composition according to the invention can be carried out in a manner customary in the art.
  • Counter ions for ionic compounds are, for example, Na + , K + , Li + or cyclohexylammonium.
  • Suitable solid or liquid pharmaceutical preparation forms are, for example, granules, powders, dragees, tablets, (micro) capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions ( " i.., Ip, im) and preparations with protracted Active ingredient release, usual in their manufacture
  • Auxiliaries such as carriers, explosives, binders, coating agents, swelling agents, lubricants or lubricants, flavorings, sweeteners and solubilizers are used.
  • a pharmaceutical composition according to the invention can be produced by mixing at least one substance used according to the invention in a defined dose with a pharmaceutically suitable and physiologically compatible carrier and, if appropriate, other suitable active ingredients, additives or auxiliaries and preparing the desired dosage form.
  • Example 1 Measurement of axon growth of motor neurons from a mouse model for spinal muscle atrophy (SMA)
  • the embryos were genotyped according to a described method (Monani et al., 2000). CNTF and BDNF were added to a final concentration of 10 ng / ml. Half of the medium was replaced on the first day and every other day. To measure the neurite length, the motor neurons, after they had been cultured for 5 days, were fixed with 4% parafor aldehyde in buffered saline (PBS) and then fixed with acetone. After blocking non-specific binding sites with 10% albumin from bovine serum (BSA), the cells were incubated overnight at 4 ° C. with the following antibodies: Rabbit antibody against phospho-tau (from Sigma, St.
  • the stained cells were scanned in on the confocal laser scanning microscope (Leica, Sol s, Germany). Staining with anti-phospho-tau identifies axonal processes. The length of the extensions was measured using the "Scion Image” software program (Scion Corp. Frederick, Maryland, USA).
  • the Smn - / -; SMN2 mouse embryos obtained motor neurons a specific reduction in the length of the phospho-tau positive axons (-27%) compared to S_nn + / +; SMN2 controls (224.7 ⁇ 20.5 ⁇ vs. 307.6 ⁇ 23.1 ⁇ m). The result suggests a reduced axon growth due to a reduced amount of Smn protein.
  • Example 2 Measurement of neurite growth in PC12 cells transiently transfected with Smn or hnRNP-R and -Q
  • Rat phaeochromocytoma cells were cultivated in DMEM (Invitrogen, Carlsbad, California, USA) + 10% horse serum and 5% fetal calf serum + antibiotics. Before transfection, the cells were high Density plated in 24-well culture dishes and transfected with 1 ⁇ g plasmid DNA (Lipofectamine 2000, Fa: Invitrogen, Carlsbad, California, USA). For this purpose, expression plasmids were used, into which wild-type forms labeled with epitope tags (HA tag or FLAG tag) or mutated versions of Smn, hnRNP R or hnRNP Q had been cloned. The day after the transfection, the cells were plated out in 35 mm culture dishes on poly-DL-ornithine-coated glass plates at a density of 1000 cells / cm 2. DMEM + 2% was used as the differentiation medium
  • Transiently transfected PC12 cells which overexpressed the wild-type form of Smn, hnRNP R or Q, showed an approximately 25-30% increase compared to the controls of neurite growth.
  • Smn with a point mutation which showed no interaction with hnRNP R (Rossoll et al .. 2002) and which was also found in SMA patients (SmnY272C) had no stimulating effect.
  • Co-expression of the wild-type form of Smn with mutated hnRNP R suppressed the growth-promoting effect. Conversely, co-expression of the wild-type form of hnRNP R with the mutated Smn also nullified the growth-promoting effect.
  • Example 3 Measurement of neurite growth in Smn or hnRNP-R or -Q overexpressing stable PC12 cell lines
  • PC12 cells were cultivated as described above and transfected with expression vectors for the wild-type form or mutated Smn, hnRNP-R or hnRNP-Q. The cells were then selected in low cell density with the antibiotic G418 for their neomycin resistance. Individual clones were tested for their stable expression of the constructs to be expressed by Western blot analysis. To measure the length of the neurite, the cells were opened as described above coated coated glass plates, differentiated by adding differentiation medium and fixed after seven days, stained and the neurite growth quantified as described above.
  • PC12 cell lines that overexpress the wild-type form of hnRNP R and Q showed neurites about three times longer than the untransfected or empty plasmid-controlled control cell lines.
  • Cell lines that overexpress hnRNP R without RNA interaction domains or Smn interaction domains (see above) showed no increased neurite growth. The effect was stronger than in the transiently transfected cell lines, since the stable cell lines could be differentiated over a longer period (seven instead of three days).
  • Example 4 Detection of Smn and hnRNP R and the ⁇ -actin content in axons and growth cones of motor neurons
  • Immunocytochemistry with anti-hnRNP R antibodies showed staining along the neurites with accumulation in the growth cones. In the Smn - / -; SMN2 motor neurons were weaker in color compared to the control motor neurons. This finding correlates with the observed localization of the hnRNP R mutant without Smn interaction domain in the cell nucleus. The interaction of hnRNP R with Smn appears to be necessary for the distal localization of hnRNP R. hnRNP R and Smn show co-localization in the axons of the cultivated motor neurons.
  • the staining showed a strong concentration of ⁇ -actin in the growth zones of the neurites in the PC12 cell lines overexpressing the wild-type form of hnRNP R and in the control cell lines transfected with the empty plasmid. In cell lines which overexpress the deletion mutant without RNA binding domains, only a weak staining was measurable in the growth zones. This dominant negative effect suggests that functional hnRNP R is required for the correct localization of ß-actin.
  • the wild-type forms of Smn and hnRNP R showed co-localization in the neurites of the cell lines.
  • RNA was purified by centrifugation using G-25 columns (Amersham, Piscataway, New Jersey, USA).
  • a cell line from human embryonic kidney cells (HEK 293) was transfected with expression constructs for the wild-type forms or mutated versions of Smn or hnRNP R, which had been epitope-amplified.
  • HA-labeled proteins by immunoprecipitation with anti-HA agarose (HA.11, from Covance, Denver, Pennsylvania; USA).
  • the pellets were resuspended in 20 ul RBB buffer and applied from a nitrocellulose filter (Protran, Schleicher & Schuell BioScience GmbH, Dassel / Relliehausen, Germany). These filters were exposed to phospho-imager plates (BAS-2500, from Photo Film Europe GmbH, Dusseldorf, Germany) and the bound radioactivity was measured as photo-stimulated luminescence [PSL] using the AIDA software package (from Raytest, Straubenhardt, Germany).
  • Kislauskis E.H. et al., 1994, J. Cell Biol. , 127, 441-451.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Die Erfindung betrifft ein Verfahren zur Suche oder Prüfung von Wirksubstanzen, welche das Wachstum und das Überleben von Nervenzellen beeinflussen, wobei eine Zelle in Kontakt gebracht wird mit mindestens einer Substanz und nachfolgend in dieser Zelle die mRNA des ß-Aktin oder das ß-Aktin Protein allein oder gemeinsam mit dem SMN Protein und/oder einem Ribonukleinprotein hnRNP, insbesondere dem Ribonukleoprotein hnRNP-R und/oder hnRNP-Q, bestimmt wer­den und die ermittelten Mengen dieser Komponenten vergli­chen werden mit den Mengen an diesen Komponenten in einer Zelle, welche nicht mit der prospektiven Wirksubstanz in Kontakt gebracht wurde, ein Testsystem zur Durchführung dieses Verfahrens sowie Verwendungen solcher Testsysteme.

Description

Testsystem zur Auffindung von Substanzen zur Förderung des
Neuritenwachsturαs .
Gebiet der Erfindung.
Die Erfindung betrifft ein Verfahren sowie ein Testsystem zur Suche oder Prüfung von Wirksubstanzen, welche das Wachstum und/oder das Überleben von Nervenzellen beein- flussen, insbesondere fördern, damit erhältliche
Wirkstoffe, Verwendungen des Testsystems sowie Verwendungen der Wirkstoffe.
Hintergrund der Erfindung und Stand der Technik.
Die Funktion von Nervenzellen ist abhängig von der Ausbildung und dem Erhalt funktionsfähiger Neuriten. Da eine beträchtliche Anzahl neurodegenerativer Erkrankungen, (beispielsweise Alzheimer Erkrankung, diabetische Neuropathie, multiple Sklerose und die Schädigungen nach cere- braler Ischämie) einhergehen mit Degenerationen von Neuriten, besteht ein erheblicher Bedarf an Substanzen, welche das Neuritenwachstum fördern und die Degeneration von Neuriten hemmen.
Ribonukleoproteine (RNP) sind RNA bindende Proteine, beteiligt an der Biogenese, dem Transport und der Funktion von mRNA und rRNA. Zu den RNP gehören die "small nuclear" Ribonukleoproteine (snRNP) und die "heterogeneous nuclear" Ribonukleoproteine (hnRNP) . hnRNPs spielen eine wichtige Rolle bei verschiedenen Aspekten des RNA-Stoffwechsels wie z.B. Splicing, Transport, Poly-Adenylierung, Stabilisierung und Translation (Review: Krecic and Swan- son, 1999; Literaturliste mit vollständiger Bibliographie siehe Ende der Beschreibung) .
Von einigen snRNP ist bekannt, dass sie Bindungspartner darstellen für das "Survival motor neuron" (SMN) Protein (Liu und Dreyfuss, 1996; Meister et al 2000) . SMN ist im Komplex mit einigen anderen Proteinen wie Gemin 2, Gemin 3, -und Gemin 4 anzutreffen, bindet an U snRNAs (Fischer et al 1997, Bühler et al 1999; Selenko et al 2001) und ist an der Biogenese und Funktion von snRNPs, dem "splicing" Pro- zess der pre-mRNA und der Prozessierung und Modifikation von rRNA beteiligt (Pellizzoni et al Gurr Biol 11: 1074-1088, 2001; Friesen et al Mol Cell 7:1111-1117,2001).
Neuere Befunde zeigen, dass auch spezielle hnRNPs (hnRNP-R und hnRNPQs) mit normalem SMN Proteinen interagieren, während mutiertes SMN von Patienten mit spinaler muskulärer Atrophie (SMA) nicht an hnRNPs bindet (Mourela- tos et al. EMBO J 20:5443-5452,2001). Für diese speziellen hnRNPs wurde wiederum ihre Beteiligung an dem Splicing- Prozess der m-RNA belegt (Mourelatos et al EMBO J 20:5443-5452,2001) .
Mutationen oder Deletionen des Genes für SMN führen zur Reduktion von funktionellem SMN-Protein und somit zum Auftreten der spinalen muskulären Atrophie (SMA) , einer autosomalen rezessiven Muskelerkrankung, bei welcher durch eine progressive Degeneration der Motorneuronen eine fort- schreitende Muskelschwäche und Muskelatrophie entsteht. (Korinthenberg et al 1997 ; Melki, 1997) . Die Kausalität ist in soweit belegt, als eine verminderte Expression von SMN zur Apoptose von Motoneuronen des Vor- derhorns des Rückenmarkes und zur SMA (Crawford und Pardo 1996) führt, und bei Mäusen zur Degeneration von Motoneu- 5 ronen führt (Jablonka et al . , 2000).
Jedoch scheint trotz dieser Kausalität das SMN Protein kein Überlebensfaktor für Motoneurone zu sein, da eine Überexpression des normalen SMN Proteins Motoneuronen
10 nicht vor Zelltod, beispielsweise verursacht durch Entzug von trophischen Faktoren, schützt (Cisterni et al Neuro- biol Dis 8:240-251, 2001). Desweiteren ist es fraglich, ob bei der SMA der Splicing Prozess der mRNA in Motoneuronen beeinträchtigt ist (Jablonka et al 2000; Tucker et al
15 2001) .
Trotz des Fortschritts im Verständnis der Funktion von SMN beim pre-mRNA-Splicing ist nur wenig über den Pathorαecha- nismus in der SMA bekannt. Es bleibt eine offene Frage,
20 warum verringerte Mengen an funktionellem SMN-Protein in allen Geweben zu einem spezifischen Absterben von Motorneuronen führen kann. Eine mögliche Erklärung könnte darin liegen, dass SMN zusätzliche Motorneuronen- spezifische Aufgaben erfüllt. Diese Funktion könnte auf
25 der Interaktion mit Motorneuronen-spezifischen Proteinen basieren. SMN ist außer in nuklearen Strukturen auch im Zytoplasma von Motorneuronen, einschließlich der Dendriten und Axonen lokalisiert (Pagliardini et al . , 2000).
30 Die SMA gehört zu den neurodegenerativen Erkrankungen, die sich durch Degeneration von Nervenzellen auszeichnen. Hierzu zählen Alzheimer, diabetische Neuropathie, Multiple Sklerose und die Folgeerkrankungen der cerebralen Ischämie. Eine Prophylaxe oder Therapie dieser Erkrankungen ist derzeit, wenn überhaupt, nur eingeschränkt möglich. Neue Verfahren zur Suche nach Wirksubstanzen wie auch Wirksubstanzen zur Prophylaxe oder Therapie dieser Erkrankungen werden somit dringend benötigt.
Neuere Befunde zeigen (Rossoll et al . , 2002), dass i) spezielle hnRNPs, genannt hnRNP-R und hnRNP-Q , obwohl sie im" O ganismus ubiquitär in Zellen anzutreffen sind, während der Embryogenese im Rückenmark am stärksten ex- primiert werden, ii) dass hnRNP-R im wesentlichen im Zyto- plas a von Motoneuronen exprimiert wird, und zwar besonders in deren Axonen, geringer in Axonen von sensori- schen Neuronen und iii) dass die Überexpression von hnRNP- R oder von hnRNP-Q in Nervenzellen zu einem erheblich verstärktem Wachstum von Neuriten führt.
Technisches Problem.
Der Erfindung liegt daher das technische Problem zu Grunde, ein Testsystem, mit welchem sich Wirkstoffe identifizieren lassen, die sich zur Prophylaxe und/oder Behandlung von neurodegenerativen Erkrankungen und/oder Nervenschäden durch Verletzungen eignen, sowie solche Wirkstoffe anzugeben.
Der Erfindung zu Grunde liegende Erkenntnisse.
Grundlage der Erfindung ist der überraschende Befund, dass die heterogenen nuklearen Ribonukleoproteine R und Q (hnRNP-R und hnRNP-Q) , von denen bekannt ist, dass sie das Wachstum von Neuriten erheblich fördern, gemeinsam mit dem Produkt des S n-Genes an die mRNA von ß-Aktin spezifisch binden und dass dieser Komplex in die Axone und Wachstumszonen von Motoneuronen transloziert .
Grundzüge der Erfindung und bevorzugte Ausführungsbeispiele .
Gegenstand der Erfindung sind somit Substanzen, welche zur Steigerung der Bildung von Komplexen aus folgenden Komponenten in Nervenzellen führen (1) hnRNP, in besonderem von hnRNP-R und hnRNP-Q, sowie aller ihrer Splicing-Isoformen, (2) SMN-Protein und (3) ß-Aktin mRNA, Testsysteme zur Auf- findung von solchen Substanzen wie auch zur Ermittlung des Funktionszustandes von Nervenzellen, wobei ß-Aktin allein (mRNA oder Protein) oder in Kombination mit mindestens einer weiteren Komponente dieses Komplexes nachgewiesen wird und die Verwendung dieser Substanzen für die Prophy- laxe und/oder Therapie von neurodegenerativen Erkrankungen oder Nervenschäden durch Verletzungen.
In einer besonderen Ausführungsform dieser Erfindung fördern diese Substanzen die Komplexbildung von hnRNP-R und/oder von hnRNP-Q inklusive aller Splicing-Isoformen (in weiterer Folge nur noch hnRNP-R und -Q genannt) mit dem SMN Protein und mit der mRNA für ß-Aktin.
Zu diesen Substanzen zählen Nukleinsäuresequenzen, welche für Ribonukleoproteine hnRNP-R und -Q kodieren und welche in die Nervenzelle mit den dem Fachmann bekannten Verfahren wie beispielsweise mit Hilfe von dem Fachmann bekannten viralen Vektoren oder nicht viralen Vektoren eingeführt werden.
Zu diesen Substanzen zählen jedoch auch Wirkstoffe, welche auf die Nervenzelle derart einwirken, dass die Nervenzelle verstärkt Ribonukleoproteine, im Besonderen hnRNP-R und/oder hnRNP -Q Proteine bildet.
Gegenstand der Erfindung sind des weiteren Verfahren zur Suche nach Wirkstoffen, welche die Komplexbildung von Ri- bonukleoproteinen, im Besonderen von hnRNP-R und/oder hnRNP-Q in Nervenzellen verstärken, wobei eine Zelle in Kontakt gebracht wird mit der zu prüfenden Substanz und in der Zelle die Menge an ß-Aktin allein oder mit mindestens einer weiteren Komponente des Komplexes bestimmt wird.
Gegenstand der Erfindung ist des weiteren die Verwendung eines erfindungsgemäßen Wirkstoffes für die Diagnose, die Prophylaxe und /oder Therapie einer neurodegenerativen Erkrankung oder einer Nervenschädigung durch Verletzung oder Vergiftung.
Gegenstand der Erfindung ist des weiteren der Nachweis von ß-Aktin allein oder mit mindestens einer weiteren Kompo- nente des Komplexes zur Diagnose und/oder Verlaufskontrolle einer neurogenerativen Erkrankung. Ein derartiger Nachweis erfolgt entweder molekularbiologisch mit Hilfe von Nukleotidsequenzen, welche mit der gesamten oder mit Teilen der Nukleotidsequenz von ß-Aktin spezifisch hybrid- isieren beispielsweise unter Anwendung der dem Fachmann bekannten in situ Hybridisierung oder Reverse- Transcriptase Polymerase Chain Reaction (RT-PCR) oder der Nachweis erfolgt mit Hilfe von Antikörpern oder Antikörperfragmenten, welche an Aktin oder spezifisch ß- Aktin binden oder durch andere Substanzen, welche spezifisch Aktin binden wie z.B. Fluoreszenz-markiertes Phal- loidin oder Phallacidin.
Bezüglich Methoden zum Nachweis bzw. zur Bestimmung einer oder mehrerer Komponenten eines erfindungsgemäßen Testsystems wird ausdrücklich auf die Beispiele verwiesen.
Unter den Begriff der Ribonukleoproteine (RNP) fallen insbesondere alle snRNP, einschließlich aller Splicevarianten bzw. Isoformen, humaner sowie nicht humaner Herkunft. Nicht hierunter fallen nicht-funktionale Mutationen. Entsprechendes gilt für SMN Proteine und ß-Actin. Der Begriff nicht-funktional bezeichnet dabei Mutationen, die in einem ansonsten erfindungsgemäßen Testsystem keine Komplexbildung RNP/SMN/ß-Actin mRNA zeigen. Die Sequenz von human hnRNP-R ist unter der Accessionnummer AF000364.1 bekannt. Eine neuere Version ist unter der Accessionnummer NM_005826 bekannt. Sequenzen von human hnRNP-Q (3 Splicing Isoformen Ql, Q2 und Q3) sind unter den Accessionnummern AY034483, AY034482 und AY034481, respektive, bekannt. Die Sequenz von Maus hnRNP-R ist unter der Accessionnummer AF441128 bekannt. Die Sequenz von Maus hnRNP-Q ist unter der Accessionnummer AF093821 bekannt. Die Sequenz von human SMN ist unter der Accessionnummer AH006635 bekannt. Die Sequenz von human ß-Actin ist unter der Accessionnummer NM_001101 (mRNA) bekannt. Im Rahmen der Erfindung sind auch funktionale Teilsequenzen sowie Bindungsregionen der Komponenten einsetzbar. Hierunter fallen beispielsweise der 3' untranslatierte Bereich der ß-Aktin mRNA sowie die "zipcode" Region. Die galenische Herrichtung einer erfindungsgemäßen pharmazeutischen Zusammensetzung kann in fachüblicher Weise erfolgen. Als Gegenionen für ionische Verbindungen kommen beispielsweise Na+, K+, Li+ oder Cyclohexylammonium infrage . Geeigente feste oder flüssige galenische Zubereitungsformen sind beispielsweise Granulate, Pulver, Dragees, Tabletten, (Mikro-) Kapseln, Suppositorien, Sirupe, Säfte, Suspensionen, Emulsionen, Tropfen oder injizierbare Lösungen ("i. ., i.p., i.m.) sowie Präparate mit protrahierter Wirkstoff-Freigabe, bei deren Herstellung übliche
Hilfsmittel wie Trägerstoffe, Spreng-, Binde-, Überzugs-, Quellungs-, Gleit- oder Schmiermittel, Geschmacksstoffe, Süßungsmittel und Lösungsvermittler, Verwendung finden. Als Hilfsstoffe sei Magnesiumcarbonat, Titandioxyd, Lac- tose, Mannit und andere Zucker, Talcum, Milcheiweiß, Gelatine, Stärke, Zellulose und ihre Derivate, tierische und pflanzliche Öle wie Lebertran, Sonnenblumen-, Erdnuss- oder Sesamöl, Polyethylenglycole und Lösungsmittel, wie etwa steriles Wasser und ein- oder mehrwertige Alkohole, beispielsweise Glycerin, genannt. Eine erfindungsgemäße pharmazeutische Zusammensetzung ist dadurch herstellbar, dass mindestens eine erfindungsgemäß verwendete Substanz in definierter Dosis mit einem pharmazeutisch geeigneten und physiologisch verträglichen Träger und ggf. weiteren geeigneten Wirk-, Zusatz- oder Hilfsstoffen gemischt und zu der gewünschten Darreichungsform hergerichtet ist.
Im Folgenden wird die Erfindung anhand von lediglich Aus- führungsformen darstellenden Beispielen näher erläutert. Beispiel 1: Messung des Axon-Wachstums von Motoneuronen aus einem Mausmodell für Spinale Muskelatrophie (SMA)
Primäre Motoneurone wurden aus dem lumbalen Rückenmark von Smn-/-; SMN2 Mäusen und Smn+/+; SMN2 Kontrollen isoliert. In diesem Modell für Spinale Muskelatrophie (SMA) wird humanes SMN2 als Transgen in Mäusen mit deletiertem Smn (Sehrank et al . , 1997) exprimiert (Monani et al . , 2000). Die Motoneurone wurden nach bereits beschriebenen Methoden kultiviert (Wiese et al . , 1999). Spinale Motoneurone wurden am Embryonaltag 14 aufgrund ihrer Bindung an mit Anti-p75 Neurotrophin-Rezeptor Antikörper beschichtete Kulturschalen isoliert und in einer Dichte von 3000 Zellen /cm2 in 6-Well Kulturschalen (Fa. Greiner Bio-One GmbH, Frickenhausen, Deutschland) auf Glasplättchen ausplattiert, welche mit Poly-Ornithin und Laminin beschichtet worden waren (Wiese et al., 1999; Wiese et al., 2001). Die Zellen wurden in Neurobasal-Medium (Fa. Invitrogen, Carls- bad, Kalifornien, USA) mit Pferdeserum, 500 uM Glutamax und 50 μg/ml Apotransferrin bei 37 °C und 5 % C02 kultiviert. Die Genotypisierung der Embryonen erfolgte nach einer beschriebenen Methode (Monani et al . , 2000). CNTF und BDNF wurden zu einer Endkonzentration von 10 ng/ml zugegeben. Die Hälfte des Mediums wurde am ersten Tag und jeden zweiten Tag ersetzt. Zur Messung der Neuritenlänge wurden die Motoneurone, nachdem sie 5 Tage lang kultiviert worden waren, mit 4% Parafor aldehyd in gepufferter Kochsalzlösung (PBS) fixiert und mit Aceton nachfixiert. Nach dem Blockieren unspezifischer Bindungsstellen mit 10 % Albumin aus Rinderserum (BSA) wurden die Zellen über Nacht bei 4°C mit den folgenden Antikörpern inkubiert: Kaninchen Antikörper gegen Phospho-Tau (Fa. Sigma, St. Louis, Missouri, USA; 1 μg/ml) und ein monoklonaler Maus- Antikörper gegen MAP-2 (Fa. Chemicon, Pittsburg, Pennsylvania, USA; 1:1000) . Die Zellen wurden dreimal mit Tris- gepufferter Kochsalzlösung mit Triton X-100 (TBS-T) ge- waschen, eine Stunde mit Cy2 und Cy3-konjugierten Sekundärantikörpern inkubiert (Fa. Dianova, Hamburg, Deutschland; 1:200) und nach neuerlichem Waschen mit TBS-T wurden die Zellen in Mowiol (Fa. Sigma, St. Louis, Missouri") eingebettet.
Die gefärbten Zellen wurden am Konfokalen Laser-Scanning- Mikroskop eingescanned (Leica, Sol s, Deutschland) . Die Färbung mit Anti-Phospho-Tau identifiziert axonale Fortsätze. Die Länge der Fortsätze wurde mittels des „Scion Image" Software-Programms gemessen (Fa. Scion Corp. Frederick, Maryland, USA) .
Dabei zeigten die von Smn-/-; SMN2 Mausembryos gewonnenen Motoneurone eine spezifische Reduktion der Länge der Phospho-Tau positiven Axone (-27%) im Vergleich zu S_nn+/+; SMN2 Kontrollen (224.7±20.5 μ vs . 307.6±23.1 μm) . Das Ergebnis lässt auf ein reduziertes Axon-Wachstum infolge verringerter Menge an Smn-Protein schließen.
Beispiel 2: Messung des Neuritenwachstums in transient mit Smn oder hnRNP-R und -Q transfizierten PC12 Zellen
Phaeochromozytom-Zellen aus der Ratte (PC12) wurden in DMEM (Fa. Invitrogen, Carlsbad, Kalifornien, USA) + 10% Pferdeserum und 5% fötalem Kälberserum + Antibiotika kultiviert. Vor der Transfektion wurden die Zellen in hoher Dichte in 24-Well Kulturschalen ausplattiert und mit 1 μg Plasmid-DNA transfiziert (Lipofectamine 2000, Fa : Invitro- gen, Carlsbad, Kalifornien, USA) . Dazu wurden Expressionsplasmide verwendet, in welche mit Epitop-Tags (HA-Tag oder FLAG-Tag) markierte Wildtyp-Formen oder mutierte Versionen von Smn, hnRNP R oder hnRNP Q kloniert worden waren. Am Tag nach der Transfektion wurden die Zellen in 35mm Kulturschalen auf Poly-DL-Ornithin beschichteten Glasplättchen in einer Dichte von 1000 Zellen / cm2 aus- plattiert. Als Differenzierungsmedium wurde DMEM + 2%
Pferdeseru und 1% fötalem Kälberserum + 50 ng/ml NGF +An- tibiotika verwendet. Nach drei Tagen wurden die Zellen fixiert und gefärbt. Die PC12 Zellen wurden mit 4% Paraformaldehyd (PFA) in gepufferter Kochsalzlösung (PBS) fixiert. Nach dem Blockieren unspezifischer Bindungsstellen mit 15 % Ziegenserum + 0,3 % Triton X-100 wurden die Zellen über Nacht bei 4°C mit den folgenden Antikörpern inkubiert: Kaninchen Antikörper gegen hnRNP R (Rossoll et al., 2002; 1/1000), Anti-Neurofilament H (Fa. Sig a, St. Louis, Missouri, USA; 1:400), Anti-HA (HA.11, Fa. Covance, Denver, Pennsylvania, USA; 1:250) und Anti-FLAG M2 (Fa. Sigma, St. Louis, Missouri, USA, 1:500). Die Zellen wurden dreimal mit Tris-gepuf erter Kochsalzlösung mit Triton X-100 (TBS-T) gewaschen, 1 Stunde mit Cy2 und Cy3-konjugierten Sekundärantikörpern inkubiert (Fa. Dianova, Hamburg, Deutschland, 1:200). Nach neuerlichem Waschen mit TBS-T wurden die Zellen in Mowiol eingebettet und am Fluoreszenzmikroskop oder Konfokalmikroskop wie oben angegeben ausgewertet.
Transient transfizierte PC12 Zellen welche die Wildtyp- Form von Smn, hnRNP R oder Q überexprimierten, wiesen im Vergleich zu den Kontrollen einen etwa 25-30%igen Zuwachs an Neuritenwachstum auf. Smn mit einer Punktmutation welche keine Interaktion mit hnRNP R zeigt (Rossoll et al .. 2002) und welche auch in SMA-Patienten gefunden wurde (SmnY272C) hatten keinen stimulierenden Effekt. Auch mu- tiertes hnRNP R mit einer Deletion der ersten beiden RNA- Bindungsdomänen (von Aminosäure 166-331) oder der Deletion der Smn-Interaktionsdomäne (von Aminosäure 522-556) förderte nicht das Neuritenwachstum. Eine Co-Expression von der Wildtyp-Form von Smn mit utierte hnRNP R unter- drückte den Wachstums-fordernden Effekt. Umgekehrt machte, eine Co-Expression von der Wildtyp-Form von hnRNP R mit dem mutierten Smn ebenfalls den Wachstums-fördernden Effekt zunichte.
Zusammen zeigen diese Experimente, dass der
Neuritenwachstums-fördernden Effekt von Smn und hnRNP R nur bei den Wildtyp-Formen auftritt, die miteinander in- teragieren können.
Beispiel 3: Messung des Neuritenwachstums in Smn oder hnRNP-R oder -Q überexprimierenden stabilen PC12 Zelllinien
Zur Herstellung stabiler Zelllinien wurden PC12 Zellen wie oben beschrieben kultiviert und mit Expressionsvektoren für die Wildtyp-Form oder mutiertes Smn, hnRNP-R oder hnRNP-Q tranfiziert. Danach wurden die Zellen in geringer Zelldichte mit dem Antibiotikum G418 auf ihre Neomycin- Resistenz hin selektiert. Individuelle Klone wurden auf ihre stabile Expression der zu exprimierenden Konstrukte durch Westernblot-Analyse getestet. Zur Messung der Neu- ritenlänge wurden die Zellen wie oben beschrieben auf beschichtete Glasplättchen ausplattiert, durch Zugabe von Differenzierungsmedium di ferenziert und nach sieben Tagen fixiert, gefärbt und das Neuritenwachstum quantifiziert wie oben beschrieben.
PC12 Zelllinien welche die Wildtyp-Form von hnRNP R und Q überexprimieren zeigten etwa dreimal längere Neuriten als die untransfizierten oder mit dem leeren Plasmid trans- fizierten Kontroll-Zelllinien. Zelllinien welche hnRNP R ohne RNA-Interaktionsdomänen oder Smn-Interaktionsdomäne (siehe oben) überexprimieren, wiesen kein verstärktes Neuritenwachstum auf. Der Effekt war stärker als in den transient transfizierten Zelllinien, da die stabilen Zelllinien über einen längeren Zeitraum (sieben statt drei Tage) differenziert werden konnten.
Beispiel 4: Nachweis von Smn und hnRNP R sowie des ß-Aktin Gehalts in Axonen und Wachstumskegeln von Motoneuronen
Die Kultivierung der Motoneurone sowie die Fixierung, Fär¬ bung und Auswertung erfolgte wie oben beschrieben. Als Antikörper wurden monoklonaler anti-Smn Antikörper (Fa. BD Biosciences, Lexington, Kentucky, USA; 1:500), Kaninchen Anti-hnRNP R Antikörper (Rossoll et al . , 2002; 1/1000), Anti-Aktin (Fa. Röche, Basel, Schweiz; 1:200) und ß-Aktin (Fa. bcam, Cambridge, UK; 1:1000) verwendet. Da in Neuriten vorzugsweise ß-Aktin lokalisiert ist, sind die Er- gebnisse für Anti-Aktin und spezifischen Anti-ß-Aktin ähnlich. In Motoneuronen von Kontroll-Mäusen war die ß-Aktin- spezifische Färbung in den distalen Anteilen der Axone und den Wachstumskegeln konzentriert. In Motoneuronen von Smn-/-; SMN2 Mäusen war diese Färbung viel schwächer aus- geprägt. Die Färbungen mit Anti-Aktin und Anti-ß-Aktin Antikörpern zeigten ein ähnliches Ergebnis. Dieses Ergebnis legt nahe, dass Smn für die Lokalisation von ß-Aktin an den Wachstumskegeln erforderlich ist.
Immunzytochemie mit Anti-hnRNP R Antikörpern zeigte eine Färbung entlang der Neuriten mit einer Akkumulation in den Wachstumskegeln. In den Smn-/-; SMN2 Motoneuronen war die Färbung im Vergleich zu den Kontroll-Motoneuronen schwächer. Dieser Befund korreliert mit der beobachteten ausschließlichen Lokalisation von der hnRNP R Mutante ohne Smn-Interaktionsdomäne im Zellkern. Die Interaktion von hnRNP R mit Smn scheint für die distale Lokalisation von hnRNP R erforderlich zu sein. hnRNP R und Smn zeigen in den Axonen der kultivierten Motoneuronen Co-Lokalisation.
Beispiel 5: Nachweis von Smn und hnRNP R sowie des ß-
Aktin-Gehalts in Neuriten und Wachstumskegeln von kultivierten Zelllinien
Die Kultivierung der PC12 Zelllinien sowie die Fixierung, Färbung und Auswertung erfolgte wie oben beschrieben. Als Antikörper wurden monoklonaler anti-Smn Antikörper (Fa. BD Biosciences, Lexington, Kentucky, USA; 1:500), Kaninchen Anti-hnRNP R Antikörper (Rossoll et al . , 2002; 1/1000), Anti-Aktin (Fa. Röche, Basel, Schweiz; 1:200) und ß-Aktin (Fa. Abcam, Cambridge, UK; 1:1000) verwendet. Da in Neuriten vorzugsweise ß-Aktin lokalisiert ist, sind die Ergebnisse für Anti-Aktin und spezifischen Anti-ß-Aktin ähnlich.
Die Färbungen zeigten in den die Wildtyp-Form von hnRNP R überexprimierenden PC12 Zelllinien und in den mit dem leeren Plasmid transfizierten Kontroll-Zelllinien eine starke Konzentration von ß-Aktin in den Wachstumszonen der Neuriten. In Zelllinien welche die Deletionsmutante ohne RNA-Bindedomänen überexprimieren, war nur eine schwache Färbung in den WachstumsZonen messbar. Dieser dominant negative Effekt lässt darauf schließen, dass funktionelles hnRNP R für die richtige Lokalisation von ß-Aktin benötigt wird. Die Wildtyp-Formen von Smn und hnRNP R zeigten in den Neuriten der Zelllinien Co-Lokalisation.
Beispiel 6: Nachweis der Bindung von ß-Aktin mRNA an hnRNP R
Die untranslatierten 3' Region von ß-Aktin vom Stop-Codon bis zur Poly-A Sequenz oder die sogenannte „zipcode- Region" (Kislauskis et al . , 1994) wurden durch RT-PCR am- plifiziert und in ein Plasmid mit der Bindungsstelle für die T7 RNA-Poly erase kloniert (pTZ19) . Wahlweise wurde ein Poly-A-Schwanz von 30 Nukleotiden angefügt. (Verwendete Primer: actinUTRfwd ATGAAAGCTTAGGCGGACTGTTACTGAGCTGC, actinUTRpolyAfullrev
ATGAGAATTC- (30) -GTGTAAGGTAAGGTGTGCAC, actinUTRpolyAziprev ATGAGAATTC-T (30) -CTGCGCAAGTTAGGTTTTGTC, actinUTRfullrev ATGAGGATCCGTGTAAGGTAAGGTGTGCAC.) Die Plasmide wurden durch Verdau mit EcoRI am 3 ' Ende linearisiert und aufgereinigt. 0,2 μg wurden für die RNA-Synthese mittels in vitro Tran¬ skription mit dem radioaktiv markierten Nukleotid α32P-CTP verwendet (T7 Transcription Kit, Fa. MBI Fermentas, Vilnius, Litauen) . Die markierte transkribierte RNA wurde über Zentrifugation mittels G-25 Säulchen (Fa. Amersham, Piscataway, New Jersey, USA) aufgereinigt . Eine Zelllinie aus menschlichen embryonalen Nierenzellen (HEK 293) wurde mit durch HA-Epitop- arkierte Expres- sionskonstrukte für die Wildtyp-Formen oder mutierte Versionen von Smn oder hnRNP R transfiziert . Nach 48 Stunden wurden die Zellen in Lysepuffer lysiert (25 mM Tris-HCl pH=8.0, 137 mM NaCl, 2mM EGTA, 2 mM EDTA, 10 % Glycerol, 1 % Triton X-100, 0,05 % ß-Mercaptoethanol and Proteasein- hibitoren; Fa. Röche, Basel, Schweiz) und die HA- markierten Proteine durch Immun-Präzipitation mit Anti-HA- Agarose (HA.11, Fa. Covance, Denver, Pennsylvania; USA) aufgereinigt . Die Immunkomplexe wurden fünfmal mit dem Lyse-Puffer und einmal mit RBB-Puffer gewaschen (RBB: 10 mM Tris pH=7,5, 1,5 mM MgCl2, 250 mM KCl, 2 mM DTT und 0,25 % Triton X-100) und mit der markierten RNA 30 Minuten bei Raumtemperatur in RBB-Puffer inkubiert. Die RNA- Protein-Komplexe wurden mit dreimal RBB-Puffer und RBB- Puffer + 5mg/ml Heparin (Fa. Sigma, St. Louis, Missouri, USA) gewaschen. Die Pellets wurden in 20 μl RBB-Puffer resuspendiert, und aus Nitrozellulose-Filter aufgetragen (Protran, Fa. Schleicher & Schuell BioScienceGmbH, Dassel/Relliehausen, Deutschland) . Diese Filter wurden mit Phospho-Imager-Platten (BAS-2500, Fa. Photo Film Europe GmbH, Düsseldorf, Deutschland) exponiert und die gebundene Radioaktivität wurde als Photo-stimulierte Lumineszenz [PSL] mittels des AIDA Software Pakets gemessen (Fa. Raytest, Straubenhardt, Deutschland) .
Die Ergebnisse zeigten, dass die Wildtyp-Form, jedoch nicht die mutierten Versionen (siehe oben) von hnRNP R an den 3' untranslatierten Bereich von ß-Aktin mRNA binden. Diese Bindung erfolgte unabhängig von dem Poly-A-Schwanz . Auch die „zipcode"-Region allein zeigt spezifische Bindung.
Diese Ergebnisse demonstrierten nicht nur eine Bindung von hnRNP R an ß-Aktin mRNA, sondern legen auch nahe, dass die Interaktion mit Smn für diese Bindung erforderlich ist, da die mutierte Version ohne die Smn-Interaktionsdo_r.är_e keine ß-Aktin mRNA-Bindung zeigten.
Zusammengenommen lassen die Ergebnisse darauf schließen, dass ein Komplex von Smn und hnRNP R oder Q an ß-Aktin mRNA bindet und in Axone von Motoneurone aber auch andere Neuriten transloziert. Störungen dieser Komplexe führen zu reduzierten ß-Aktin Konzentrationen an den Wachstumszonen der Neuriten und damit zu vermindertem Axon-Wachstum.
Literatur : Buhler, D. et al . , 1999, Hum. Mol. Genet . , 8, 2351-2357.
Cisterni,C. et al . , 2001, Neurobiol. Dis., 8, 240-251.
Crawford,T.O. et al., 1996, Neurobiol. Dis., 3, 97-110.
Fischer, U. et al., 1997, Cell, 90, 1023-1029.
Friesen, .J. et al., 2001, Mol. Cell, 7, 1111-1117.• Jablonka, S. et al . , 2000, Hum. Mol. Genet., 9, 341-346.
Kislauskis,E.H. et al., 1994, J. Cell Biol . , 127, 441-451.
Korinthenberg, R. et al . , 1997, Ann. Neurσl., 42, 364-368.
Krecic,A.M. et al., 1999, Curr. Opin. Cell Biol., 11,
363-371. Lefebvre,S. et al., 1995, Cell, 80, 155-165.
Lefebvre,S. et al . , 1997, Nat . Genet., 16, 265-269.
Liu.Q. et al., 1996, EMBO J., 15, 3555-3565.
Meister, G. et al., 2000, Hum. Mol. Genet., 9, 1977-1986. Monani, U.R. et al . , 2000, Hum. Mol. Genet., 9, 333-339. Mourelatos,Z. et al . , 2001, EMBO J., 20, 5443-5452. Pellizzoni,L. et al., 2001, Curr. Biol., 11, 1079-1088. Rossoll, . et al., 2002, Hum. Mol. Genet., 11, 93-105. Schrank, B. et al., 1997, Proc. Natl. Acad. Sei. U. S. A, 94, 9920-9925.
Selenko, P. et al., 2001, Nat. Struct. Biol., 8, 27-31. Tucker,K.E. et al, 2001, J. Cell Biol., 154, 293-307. Wiese,S. et al., 1999, Eur. J. Neurosci., 11, 1668-1676. Wiese, S. et al . , 2001, Nat. Neurosci., 4, 137-142.

Claims

Patentansprüche
1. Verfahren zur Suche oder Prüfung von Wirksubstanzen, welche das Wachstum und das Überleben von Nervenzellen beeinflussen, wobei eine Zelle in Kontakt gebracht wird mit mindestens einer prospektiven Wirksubstanz, wobei nachfolgend in dieser Zelle die mRNA des ß-Aktin oder das ß-Aktin Protein allein oder gemeinsam mit dem SMN -Protein und/oder einem Ribonukleinprotein hnRNP, insbe- sondere dem Ribonukleoprotein hnRNP-R und/oder hnRNP-Q, bestimmt werden, beispielsweise in Wachstumszonen von Neuriten, wobei die dabei ermittelten Mengen dieser Komponenten verglichen werden mit den Mengen an diesen Komponenten in einer Zelle, welche nicht mit der prospektiven Wirksubstanz in Kontakt gebracht wurde, und wobei im Falle einer erhöhten Menge die Wirksubstanz selektiert wird.
2. Verfahren nach Anspruch 1, wobei eine, mehrere oder alle Komponenten mit Antikörpern oder Antikörperfragmenten nachgewiesen und optional quantitativ bestimmt werden.
3. Verfahren nach Anspruch 1 oder 2, wobei ß-Aktin mit Aktin-bindenden Substanzen nachgewiesen und optional quantitativ bestimmt wird.
4. Verfahren nach einem der Ansprüche 1 bis 3, wobei eine, mehrere oder alle Komponenten durch Messung ihrer mRNA nachgewiesen und optional quantitativ bestimmt werden.
5. Verfahren nach einem der Ansprüche 1 bis 4, wobei die Zelle eine Nervenzelle ist.
6. Verfahren nach einem der Ansprüche 1 bis 4, wobei die Zelle mesodermalen oder endodermalen Ursprungs ist.
7. Testsystem zur Durchf hrung eines Verfahrens nach einem der Ansprüche 1 bis 6, mit einer Zelle, Zellen einer Zelllmie, oder einer Zellen enthaltenden Gewebeprobe, mit Mitteln zur Kultivierung der Zellen, sowie mit Mit- "terln zur qualitativen oder quantitativen Bestimmung einer, mehrerer oder aller Komponenten.
8. Verwendung des Testsystems nach Anspruch 7 zur Suche nach Wirksubstanzen, welche das Wachstum und Überleben von Nervenzellen anregen und/oder welche das Wachstum von Neuriten und Axonen anregen.
9. Verwendung des Testsystems nach Anspruch 7 zur Prüfung des Wachstums und des Überlebens von Nervenzellen, insbesondere zur Diagnose und/oder Verlaufkontrolle einer neurodegenerativen Erkrankung und/oder Nervenschaden durch Verletzungen oder Vergiftungen.
10. Wirksubstanz erhaltlich mit einem Verfahren nach einem der Ansprüche 1 bis 6, wobei diese Wirksubstanz m einer Zelle die Menge an Komplexen enthaltend die Komponenten Ribonukleinproteme, insbesondere hnRNP-R und/oder hnRNP-Q, SMN und ß-Aktin mRNA erhöht.
11. Verwendung einer Wirksubstanz nach Anspruch 10 zur Herstellung einer pharmazeutischen Zusammensetzung zur Forderung des Wachstums und des Überlebens von Nervenzellen, insbesondere zur Prophylaxe oder Therapie neurodegenerativer Erkrankungen und/oder Nervenschäden durch Verletzungen oder Vergiftungen.
EP04720847A 2003-03-21 2004-03-16 Testsystem zur auffindung von substanzen zur förderung des neuritenwachstums Withdrawn EP1606618A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10312846A DE10312846A1 (de) 2003-03-21 2003-03-21 Testsystem zur Auffindung von Substanzen zur Föderung des Neuritenwachstums
DE10312846 2003-03-21
PCT/DE2004/000577 WO2004083853A2 (de) 2003-03-21 2004-03-16 Testsystem zur auffindung von substanzen zur förderung des neuritenwachstums

Publications (1)

Publication Number Publication Date
EP1606618A2 true EP1606618A2 (de) 2005-12-21

Family

ID=32946067

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04720847A Withdrawn EP1606618A2 (de) 2003-03-21 2004-03-16 Testsystem zur auffindung von substanzen zur förderung des neuritenwachstums

Country Status (4)

Country Link
US (1) US20080020964A1 (de)
EP (1) EP1606618A2 (de)
DE (1) DE10312846A1 (de)
WO (1) WO2004083853A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1898258B1 (de) * 2005-06-20 2016-08-17 Nippon Telegraph And Telephone Corporation Elektrooptisches vorrichtung

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5543509A (en) * 1992-08-14 1996-08-06 The United States Of America As Represented By The Department Of Health And Human Services Method for quantifying laminin and β-actin messenger RNA
DE4416446A1 (de) * 1993-05-12 1994-11-17 Becton Dickinson Co Für menschliche DNA spezifische Sequenzen
US6130064A (en) * 1998-02-24 2000-10-10 Incyte Pharmaceuticals, Inc. Human SMN-like protein

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004083853A2 *

Also Published As

Publication number Publication date
DE10312846A1 (de) 2004-10-07
US20080020964A1 (en) 2008-01-24
WO2004083853A3 (de) 2004-11-18
WO2004083853A2 (de) 2004-09-30

Similar Documents

Publication Publication Date Title
Zhai et al. Assembling the presynaptic active zone: a characterization of an active zone precursor vesicle
DE69622701T2 (de) Hemmung von tau-tau-verknüpfung
Blázquez et al. The CB1 cannabinoid receptor signals striatal neuroprotection via a PI3K/Akt/mTORC1/BDNF pathway
DE69836740T2 (de) Amyloid beta protein (globulärer aufbau und seine verwendung)
de Lucas-Cerrillo et al. Function of partially duplicated human α7 nicotinic receptor subunit CHRFAM7A gene: Potential implications for the cholinergic anti-inflammatory response
Weiler et al. Fragile X mental retardation protein is necessary for neurotransmitter-activated protein translation at synapses
Sonobe et al. AC. elegans model of C9orf72-associated ALS/FTD uncovers a conserved role for eIF2D in RAN translation
Wevers et al. Expression of nicotinic acetylcholine receptors in Alzheimer’s disease: postmortem investigations and experimental approaches
Dessy et al. Dynamin mediates caveolar sequestration of muscarinic cholinergic receptors and alteration in NO signaling
Chiang et al. cAMP-response element-binding protein contributes to suppression of the A2A adenosine receptor promoter by mutant Huntingtin with expanded polyglutamine residues
Lebeau et al. Staufen 2 regulates mGluR long-term depression and Map1b mRNA distribution in hippocampal neurons
Cox et al. The small heat shock proteins αB-crystallin (HSPB5) and Hsp27 (HSPB1) inhibit the intracellular aggregation of α-synuclein
DE69808743T2 (de) Netrinrezeptoren
Ross et al. Bromodeoxyuridine induces senescence in neural stem and progenitor cells
Tiruchinapalli et al. Activity-dependent expression of RNA binding protein HuD and its association with mRNAs in neurons
El-Seoudi et al. Catabolic effects of FGF-1 on chondrocytes and its possible role in osteoarthritis
Guo et al. Cellular and subcellular distributions of β1-and β2-adrenoceptors in the CA1 and CA3 regions of the rat hippocampus
Rossi et al. UsnRNP trafficking is regulated by stress granules and compromised by mutant ALS proteins
Arvanitis et al. High intracellular concentrations of amyloid‐beta block nuclear translocation of phosphorylated CREB
Mercer et al. Chemico-genetic identification of drebrin as a regulator of calcium responses
Tsampoula et al. Nuclear receptor NR5A2 promotes neuronal identity in the adult hippocampus
Malmqvist et al. Tau mRNA is present in axonal RNA granules and is associated with elongation factor 1A
Sakai et al. Up‐regulation of cyclin D1 occurs in apoptosis of immature but not mature cerebellar granule neurons in culture
Proepper et al. The Kvβ2 subunit of voltage-gated potassium channels is interacting with ProSAP2/Shank3 in the PSD
Wijegunawardana et al. Ataxin-2 polyglutamine expansions aberrantly sequester TDP-43, drive ribonucleoprotein condensate transport dysfunction and suppress local translation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050926

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: JULIUS-MAXIMILIANS-UNIVERSITAET WUERZBURG

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20070306

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070918