EP1578980A2 - Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und entsprechendes protein mit der bezeichnung 213p1f11 - Google Patents

Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und entsprechendes protein mit der bezeichnung 213p1f11

Info

Publication number
EP1578980A2
EP1578980A2 EP02728647A EP02728647A EP1578980A2 EP 1578980 A2 EP1578980 A2 EP 1578980A2 EP 02728647 A EP02728647 A EP 02728647A EP 02728647 A EP02728647 A EP 02728647A EP 1578980 A2 EP1578980 A2 EP 1578980A2
Authority
EP
European Patent Office
Prior art keywords
protein
amino acid
cell
cancer
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02728647A
Other languages
English (en)
French (fr)
Other versions
EP1578980A4 (de
Inventor
Pia M. Challita-Eid
Arthur B. Raitano
Mary Faris
Rene S. Hubert
Robert Kendall Morrison
Wangmao Ge
Aya Jakobovits
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agensys Inc
Original Assignee
Agensys Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agensys Inc filed Critical Agensys Inc
Publication of EP1578980A2 publication Critical patent/EP1578980A2/de
Publication of EP1578980A4 publication Critical patent/EP1578980A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3015Breast
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3038Kidney, bladder
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention described herein relates to a gene and its encoded protein, termed 213P1F11, expressed in certain cancers, and to diagnostic and therapeutic methods and compositions useful in the management of cancers that express 213P1F11.
  • Cancer is the second leading cause of human death next to coronary disease. Worldwide, millions of people die from cancer every year. In the United States alone, as reported by the American Cancer Society, cancer causes the death of well over a half-million people annually, with over 1.2 million new cases diagnosed per year. While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the rise. In the early part of the next century, cancer is predicted to become the leading cause of death.
  • carcinomas of the lung, prostate, breast, colon, pancreas, and ovary represent the primary causes of cancer death. These and virtually all other carcinomas share a common lethal feature. With very few exceptions, metastatic disease from a carcinoma is fatal. Moreover, even for those cancer patients who initially survive their primary cancers, common experience has shown that their lives are dramatically altered. Many cancer patients experience strong anxieties driven by the awareness of the potential for recurrence or treatment failure. Many cancer patients experience physical debilitations following treatment. Furthermore, many cancer patients experience a recurrence.
  • prostate cancer is the fourth most prevalent cancer in men. In North America and Northern Europe, it is by far the most common cancer in males and is the second leading cause of cancer death in men. In the United States alone, well over 30,000 men die annually of this disease - second only to lung cancer. Despite the magnitude of these figures, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modalities. Unfortunately, these treatments are ineffective for many and are often associated with undesirable consequences.
  • PSA serum prostate specific antigen
  • the LAPC Los Angeles Prostate Cancer
  • SCID severe combined immune deficient mice
  • More recently identified prostate cancer markers include PCTA-1 (Su et al, 1996, Proc. Natl. Acad. Sci.
  • PSM prostate-specific membrane
  • STEAP Human, et al, Proc Natl Acad Sci U S A. 1999 Dec 7; 96(25): 14523-8
  • PSCA prostate stem cell antigen
  • Renal cell carcinoma accounts for approximately 3 percent of adult malignancies. Once adenomas reach a diameter of 2 to 3 cm, malignant potential exists. In the adult, the two principal malignant renal tumors are renal cell adenocarcinoma and transitional cell carcinoma of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated at more than 29,000 cases in the United States, and more than 11,600 patients died of this disease in 1998. Transitional cell carcinoma is less frequent, with an incidence of approximately 500 cases per year in the United States.
  • bladder cancer represents approximately 5 percent in men (fifth most common neoplasm) and 3 percent in women (eighth most common neoplasm).
  • the incidence is increasing slowly, concurrent with an increasing older population.
  • 1998 there was an estimated 54,500 cases, including 39,500 in men and 15,000 in women.
  • the age-adjusted incidence in the United States is 32 per 100,000 for men and 8 per 100,000 in women.
  • the historic male/female ratio of 3 : 1 may be decreasing related to smoking patterns in women.
  • Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly.
  • bladder cancers recur in the bladder.
  • Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy.
  • TUR transurethral resection of the bladder
  • the multifocal and recurrent nature of bladder cancer points out the limitations of TUR.
  • Most muscle-invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion is the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function.
  • An estimated 130,200 cases of colorectal cancer occurred in 2000 in the United States, including 93,800 cases of colon cancer and 36,400 of rectal cancer.
  • Colorectal cancers are the third most common cancers in men and women.
  • Treatment options for lung and bronchial cancer are determined by the type and stage of the cancer and include surgery, radiation therapy, and chemotherapy. For many localized cancers, surgery is usually the treatment of choice. Because the disease has usually spread by the time it is discovered, radiation therapy and chemotherapy are often needed in combination with surgery. Chemotherapy alone or combined with radiation is the treatment of choice for small cell lung cancer; on this regimen, a large percentage of patients experience remission, which in some cases is long lasting. There is however, an ongoing need for effective treatment and diagnostic approaches for lung and bronchial cancers.
  • breast cancer In the U.S. alone, there were an estimated 41,200 deaths (40,800 women, 400 men) in 2000 due to breast cancer. Breast cancer ranks second among cancer deaths in women. According to the most recent data, mortality rates declined significantly during 1992-1996 with the largest decreases in younger women, both white and black. These decreases were probably the result of earlier detection and improved treatment. Taking into account the medical circumstances and the patient's preferences, treatment of breast cancer may involve lumpectomy (local removal of the tumor) and removal of the lymph nodes under the arm; mastectomy (surgical removal of the breast) and removal of the lymph nodes under the arm; radiation therapy; chemotherapy; or hormone therapy. Often, two or more methods are used in combination.
  • DCIS ductal carcinoma in situ
  • Surgery, radiation therapy, and chemotherapy are treatment options for ovarian cancer.
  • Surgery usually includes the removal of one or both ovaries, the fallopian tubes (salpingo-oophorectomy), and the uterus (hysterectomy).
  • the fallopian tubes saccharin-oophorectomy
  • the uterus hysterectomy
  • advanced disease an attempt is made to remove all inrra- abdominal disease to enhance the effect of chemotherapy.
  • pancreatic cancer There were an estimated 28,300 new cases of pancreatic cancer in the United States in 2000. Over the past 20 years, rates of pancreatic cancer have declined in men. Rates among women have remained approximately constant but may be beginning to decline. Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the United States. Over the past 20 years, there has been a slight but significant decrease in mortality rates among men (about -0.9% per year) v e rates have increased slightly among women.
  • the present invention relates to a gene, designated 213P1F11, that has now been found to be over- expressed in the cancer(s) listed in Table I.
  • Northern blot expression analysis of 213P1F11 gene expression in normal tissues shows a restricted expression pattern in adult tissues.
  • the nucleotide ( Figure 2) and amino acid ( Figure 2, and Figure 3) sequences of 213P1F11 are provided.
  • tissue-related profile of 213P IF 11 in normal adult tissues combined with the over-expression observed in the tissues listed in Table I, shows that 213P1F11 is aberrantly over-expressed in at least some cancers, and thus serves as a useful diagnostic, prophylactic, prognostic, and/or therapeutic target for cancers of the tissue(s) such as those listed in Table I.
  • the invention provides polynucleotides corresponding or complementary to all or part of the 213P1F11 genes, RNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 213PlFl l-related proteins and fragments of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 contiguous amino acids; at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100 contiguous amino acids of a 213P1F11 -related protein, as well as the peptides/proteins themselves; DNA, RNA, DNA/RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary or having at least a 90% homology to the 213P1F11 genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides that hybridize to the 213P
  • Recombinant DNA molecules containing 213P1F11 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of 213P1F11 gene products are also provided.
  • the invention further provides antibodies that bind to 213P1F11 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker or therapeutic agent.
  • the entire nucleic acid sequence of Figure 2 is not encoded and/or the entire amino acid sequence of Figure 2 is not prepared. In certain embodiments, the entire nucleic acid sequence of Figure 2 is encoded and/or the entire air ⁇ io acid sequence of Figure 2 is prepared, either of which are in respective human unit dose forms.
  • the invention further provides methods for detecting the presence and status of 213P1F11 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 213P1F11.
  • a typical embodiment of this invention provides methods for monitoring 213P1F11 gene products in a tissue or hematology sample having or suspected of having some form of growth dysregulation such as cancer.
  • the invention further provides various immunogenic or therapeutic compositions and strategies for treating cancers that express 213P1F11 such as cancers of tissues listed in Table I, including therapies aimed at inhibiting the transcription, translation, processing or function of 213P1F11 as well as cancer vaccines.
  • the invention provides compositions, and methods comprising them, for treating a cancer that expresses 213P1F11 in a human subject wherein the composition comprises a carrier suitable for human use and a human unit dose of one or more than one agent that inhibits the production or function of 213P1F11.
  • the carrier is a uniquely human carrier.
  • the agent is a moiety that is immunoreactive with 213P1F11 protein.
  • Non-limiting examples of such moieties include, but are not limited to, antibodies (such as single chain, monoclonal, polyclonal, humanized, chimeric, or human antibodies), functional equivalents thereof (whether naturally occurring or synthetic), and combinations thereof.
  • the antibodies can be conjugated to a diagnostic or therapeutic moiety.
  • the agent is a small molecule as defined herein.
  • the agent comprises one or more than one peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a human to elicit a CTL response to 213P1F11 and/or one or more than one peptide which comprises a helper T lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to elicit an HTL response.
  • CTL cytotoxic T lymphocyte
  • HTL helper T lymphocyte
  • the peptides of the invention may be on the same or on one or more separate polypeptide molecules.
  • the agent comprises one or more than one nucleic acid molecule that expresses one or more than one of the CTL or HTL response stimulating peptides as described above.
  • the one or more than one nucleic acid molecule may express a moiety that is immunologically reactive with 213P1F11 as described above.
  • the one or more than one nucleic acid molecule may also be, or encodes, a molecule that inhibits production of 213P1F11.
  • Non-limiting examples of such molecules include, but are not limited to, those complementary to a nucleotide sequence essential for production of 213P1F11 (e.g. antisense sequences or molecules that form a triple helix with a nucleotide double helix essential for 213P1F11 production) or a ribozyme effective to lyse 213P1F11 mRNA.
  • FIG. 2A The cDNA and amino acid sequence of213PlFl l variant 1 clone CASP14-BrCl (also called “213P1F11 v.l” or “213PlFll variant 1" or “213P1F11”) is shown in Figure 2A.
  • the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-1132 including the stop codon.
  • the cDNA and amino acid sequence of 213P1F11 variant 2 (also called “213P1F11 v.2") is shown in Figure 2B.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 409- 1096 including the stop codon.
  • the cDNA and amino acid sequence of 213P1F11 variant 3 (also called “213P1F11 v.3") is shown in Figure 2C.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-844 including the stop codon.
  • the cDNA and amino acid sequence of 213P1F11 variant 4 (also called “213P1F11 v.4") is shown in Figure 2D.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 1-966 including the stop codon.
  • the cDNA (SEQ ID. NO.
  • 213P1F11 variant 5 also called “213P1F11 v.5"
  • Figure 2E The codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-1132 including the stop codon.
  • the cDNA and amino acid sequence of213PlFl l variant 6 (also called “213P1F11 variant v.6") is shown in Figure 2F.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-1132 including the stop codon.
  • the cDNA and amino acid sequence of 213P1F11 variant 7 (also called “213P1F11 v.7”) is shown in Figure 2G.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-1132 including the stop codon.
  • the cDNA and amino acid sequence of 213P1F11 variant 8 (also called “213P1F11 v.8") is shown in Figure 2H.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 404-1132 including the stop codon.
  • a reference to 213P1F11 includes all variants thereof, including those shown in Figure 10.
  • Figure 3. Amino acid sequence of 213P1F11 v.l is shown in Figure 3A; it has 242 amino acids.
  • the amino acid sequence of 213P IF 11 v.2 is shown in Figure 3B; it has 230 amino acids.
  • the amino acid sequence of 213P1F11 v.3 is shown in Figure 3C; it has 146 amino acids.
  • the amino acid sequence of 213P1F11 v.4 is shown in Figure 3D; it has 321 amino acids.
  • the amino acid sequence of 213P1F11 v.5 is shown in Figure 3E; it has 242 amino acids.
  • the amino acid sequence of 213P1F11 v.6 is shown in Figure 3F; it has 242 amino acids.
  • a reference to 213P1F11 includes all variants thereof, including those shown in Figure 11.
  • FIG 4 The nucleic acid sequence alignment of 213P1F11 v.l with human Caspase-14 (gi 6912286) precursor mRNA is shown in Figure 4A.
  • the amino acid sequence alignment of 213P1F11 v.l with human Caspase-14 (gi 6912286) mRNA is shown in Figure 4B.
  • the amino acid sequence alignment of 213P1F11 v.1 with mouse Caspase-14 (gi 6753280) mRNA is shown in Figure 4C.
  • the amino acid sequence alignment of 213P1F11 v.2 with human Caspase-14 (gi 6912286) mRNA is shown in Figure 4D.
  • the amino acid sequence alignment of 213P1F11 v.3 with human Caspase-14 (gi 6912286) mRNA is shown in Figure 4E.
  • the amino acid sequence alignment of 213P1F11 v.2 with mouse caspase 14 (gi 6753280) mRNA is shown in Figure 4F.
  • the amino acid sequence alignment of 213P1F11 v.4 with human Caspase-14 (gi 6912286) mRNA is shown in Figure 4G.
  • Figure 7 Percent accessible residues amino acid profile of A) 213P1F11 variant 1, B) 213P1F11 variant 2, C) 213P1F11 variant 3 and D) 213P1F11 variant 4, determined by computer algorithm sequence analysis using the method of Janin (Janin J., 1979 Nature 277:491-492) accessed on the ProtScale website located at the World Wide Web (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 8 Average flexibility amino acid profile of A) 213P1F11 variant 1, B) 213P1F11 variant 2, C) 213P1F11 variant 3 and D) 213P1F11 variant 4, determined by computer algorithm sequence analysis using the method of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P.K., 1988. Int. I. Pept. Protein Res. 32:242-255) accessed on the ProtScale website located at the World Wide Web (.expasy.ch/cgi- bin protscale.pl) through the ExPasy molecular biology server.
  • FIG. 9 Beta-turn amino acid profile of A) 213P1F11 variant 1, B) 213P1F11 variant 2, C) 213P1F11 variant 3 and D) 213P1F11 variant 4, determined by computer algorithm sequence analysis using the method of Deleage and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294) accessed on the ProtScale website located at the World Wide Web (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 10 Schematic display of nucleotide variants of 213P1F11. Variants 213P1F11 v.2 and v.3 are splice variants.
  • Variant 213P1F11 v.4 is an alternative transcript. Others are Single Nucleotide Polymorphism (also called "SNP") variants, which could also occur in any of the transcript variants that contains the base pairs. Numbers in “( )" underneath the box correspond to those of 213P1F11 v.l. The black boxes show the same sequence as 213P1F11 v. l. SNPs are indicated above the box.
  • SNP Single Nucleotide Polymorphism
  • FIG 11. Schematic display of protein variants of 213P1F11.
  • Nucleotide variants 213P1F11 v.l though v.6 in Figure 10 code for protein variants 213P IF 11 v.l through 213P IF 11 v.6, respectively.
  • Variants 213P1F11 v.7 through v.10 code the same protein as variant 213P1F11 v.l.
  • Protein variants 213P1F11 v.5 and v.6 are variants with single amino acid variations, which may exist in transcript variants 213P1F11 v.2 through 4.
  • the black boxes show the same sequence as 213P1F11 v.l.
  • the numbers in "()" underneath the box correspond to those of 213P1F11 v.l.
  • Single amino acid differences are indicated above the box.
  • Variant 213P1F11 v.2 and v.3 are splice variants.
  • Variant 213P1F11 v.4 is an alternative transcript. Compared with 213P1F11 v.l, 213P1F11 v.2 has a longer (+74 bp at 5' end) exon 6 and variant 213P1F11 v.3 has a longer (+68 bp at 5' end) exon 5.
  • Variant 213P1F11 v.4 has three different exons. Relative locations of exons from all variants on the chromosome are shown at the bottom. Numbers in "( )" underneath the box correspond to those of 213P1F11 v.l. Black boxes show the same sequence as 213PlFll v.l. Intron lengths are not proportional.
  • Figure 14 Expression of 213P1F11 by RT-PCR.
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), LAPC xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), bladder cancer pool, breast cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 213P1F11, was performed at 26 and 30 cycles of amplification. Results show strong expression of 213P1F11 in bladder cancer pool, breast cancer pool, xenograft pool, and cancer metastasis pool.
  • Figure 15 Expression of 213P1F11 v.l compared to 213P1F11 v.2 in patient cancer samples by RT-PCR.
  • primers were designed flanking the insertion in 213P1F11 v.2. Using these primers, amplification of 213P1F11 v.l will generate a PCR fragment of 165 bp, whereas 213P1F11 v.2 will generate a PCR fragment of 249 bp as depicted in the figure.
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), bladder cancer pool, breast cancer pool, LAPC xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), and 213P1F11 v.l plasmid control. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers depicted above, was performed at 35 cycles of amplification. Results show strong expression of 213P IF 11 v.l in bladder cancer pool, breast cancer pool, LAPC xenograft pool, and the plasmid positive control. A lower expression of the 249 bp 213P1F11 v.2 product was detected in breast cancer pool, LAPC xenograft pool, and to lower extent in bladder cancer pool.
  • FIG. 16 Expression of 213P1F11 in normal tissues. Three multiple tissue northern blots (A and B, Clontech; C, OriGene) with 2 ug of mRNA/lane were probed with the 213P1F11 SSH fragment. Size standards in kilobases (kb) are indicated on the side. Results show strong expression of 213P1F11 only in skin tissue. A weak transcript is detected in normal thymus but not in the other tissues tested.
  • FIG. 1 Expression of 213P1F11 in bladder cancer patient tissues.
  • RNA was extracted from normal bladder (N), bladder cancer cell lines (UM-UC-3 and SCaBER), bladder cancer patient tumors (T) and normal tissue adjacent to bladder cancer (N A ⁇ ).
  • Northern blots with 10 ug of total RNA were probed with the 213P1F11 SSH fragment. Size standards in kilobases are indicated on the side. Results show strong expression of 213P1F11 in the bladder tumor tissues but not in normal bladder nor in the bladder cancer cell lines.
  • FIG. 18 Expression of 213P1F11 in prostate cancer xenografts.
  • RNA was extracted from normal prostate, LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI prostate cancer xenografts.
  • Northern blot with 10 ⁇ g of total RNA/lane was probed with 213P1F11 SSH sequence. Size standards in kilobases (kb) are indicated on the side.
  • the results show expression of 213P1F11 in the LAPC-9AI xenograft, but not in the other xenografts nor in normal prostate.
  • FIG. 19 Expression of 213P1F11 in breast cancer patient tissues.
  • RNA was extracted from normal breast (N), breast cancer cell lines (DU4475, MCF7 and CAMA-1), breast cancer patient tumors (T) and breast cancer metastasis to lymph node (Met).
  • Northern blots with 10 ug of total RNA were probed with the 213P IF 11 SSH fragment. Size standards in kilobases are indicated on the side. Results show strong expression of 213P1F11 in the breast tumor tissues as well as in the cancer metastasis specimen. Weak expression was also detected in the CAMA-1 cell line, but not in the other 2 breast cancer cell lines tested.
  • prostate cancer means prostate cancers that have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage Cl - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system.
  • AUA American Urological Association
  • stage Cl - C2 disease under the Whitmore-Jewett system
  • stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system.
  • TNM tumor, node, metastasis
  • surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes compared to patients having clinically localized (organ-confined) prostate cancer.
  • Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base.
  • Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invade
  • “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence 213P1F11 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence 213P1F11.
  • the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
  • analog refers to a molecule which is structurally similar or shares similar or corresponding attributes with another molecule (e.g. a 213P1F11-related protein).
  • a 213P1F11-related protein e.g. an analog of a 213P1F11 protein can be specifically bound by an antibody or T cell that specifically binds to 213P1F11.
  • Antibody is used in the broadest sense. Therefore an “antibody” can be naturally occurring or man-made such as monoclonal antibodies produced by conventional hybridoma technology.
  • Anti-213P1F11 antibodies comprise monoclonal and polyclonal antibodies as well as fragments containing the antigen-binding domain and/or one or more complementarity determining regions of these antibodies.
  • an “antibody fragment” is defined as at least a portion of the variable region of the immunoglobulin molecule that binds to its target, i.e., the antigen-binding region. In one embodiment it specifically covers single anti-213PlFl 1 antibodies and clones thereof (including agonist, antagonist and neutralizing antibodies) and anti-213PlFl 1 antibody compositions withpolyepitopic specificity.
  • codon optimized sequences refers to nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences that have been optimized for expression in a given host species by elimination of spurious polyadenylation sequences, elimination of exon/intron splicing signals, elimination of transposon-like repeats and/or optimization of GC content in addition to codon optimization are referred to herein as an "expression enhanced sequences.”
  • cytotoxic agent refers to a substance that inhibits or prevents the expression activity of cells, function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes chemotherapeutic agents, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof.
  • cytotoxic agents include, but are not limited to maytansinoids, yttrium, bismuth, ricin, ricin A-chain, doxorubicin, daunorubicin, taxql, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, mitogellin, retstrictocin, phenomycin, enomycin, curicin, crotin, calicheamicin, sapaonaria officinalis inhibitor, and glucocorticoid and other chemotherapeutic agents, as well as radioisotopes such as At 211 , 1 131 , 1 dox
  • homolog refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar>at corresponding positions.
  • HLA Human Leukocyte Antigen
  • HLA Human Leukocyte Antigen
  • MHC Major Histocompatibility Complex
  • hybridize used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing in O.lXSSC/0.1% SDS are above 55 degrees C.
  • isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
  • isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
  • a polynucleotide is said to be “isolated” when it is substantially separated from contaminant polynucleotides that correspond or are complementary to genes other than the 213P1F11 genes or that encode polypeptides other than 213P1F11 gene product or fragments thereof.
  • a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated 213P1F11 polynucleotide.
  • a protein is said to be "isolated,” for example, when physical, mechanical or chemical methods are employed to remove the 213P1F11 proteins from cellular constituents that are normally associated with the protein.
  • a skilled artisan can readily employ standard purification methods to obtain an isolated 213P IF 11 protein.
  • an isolated protein can be prepared by chemical means.
  • mammal refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.
  • metastatic prostate cancer and “metastatic disease” mean prostate cancers that have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage TxNxM+ under the TNM system.
  • surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is a preferred treatment modality.
  • Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation. Approximately half of these androgen-refractory patients die within 6 months after developing that status.
  • the most common site for prostate cancer metastasis is bone. Prostate cancer bone metastases are often osteoblastic rather than osteolytic (i.e., resulting in net bone formation).
  • Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
  • the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the antibodies comprising the population are identical except for possible naturally occurring mutations that are present in minor amounts.
  • a "motif, as in biological motif of a 213P1F11-related protein, refers to any pattern of amino acids forming part of the primary sequence of a protein, that is associated with a particular function (e.g. protein- protein interaction, protein-DNA interaction, etc) or modification (e.g. that is phosphorylated, glycosylated or amidated), or localization (e.g. secretory sequence, nuclear localization sequence, etc.) or a sequence that is correlated with being immunogenic, either humorally or cellularly.
  • a motif can be either contiguous or capable of being aligned to certain positions that are generally correlated with a certain function or property.
  • motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
  • Peptide motifs for HLA binding are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
  • a “pharmaceutical excipient” comprises a material such as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservative, and the like.
  • “Pharmaceutically acceptable” refers to a non-toxic, inert, and/or composition that is physiologically compatible with humans or other mammals.
  • polynucleotide means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA and or RNA. In the art, this term if often used interchangeably with “oligonucleotide”.
  • a polynucleotide can comprise a nucleotide sequence disclosed herein wherein thymidine (T), as shown for example in Figure 2, can also be uracil (U); this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T).
  • T thymidine
  • U uracil
  • polypeptide means a polymer of at least about 4, 5, 6, 7, or 8 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used. In the art, this term is often used interchangeably with “peptide” or "protein”.
  • HLA "primary anchor residue” is an amino acid at a specific position along a peptide sequence which is understood to provide a contact point between the immunogenic peptide and the HLA molecule.
  • One to three, usually two, primary anchor residues within a peptide of defined length generally defines a "motif for an immunogenic peptide. These residues are understood to fit in close contact with peptide binding groove of an HLA molecule, with their side chains buried in specific pockets of the binding groove.
  • the primary anchor residues for an HLA class I molecule are located at position 2 (from the amino terminal position) and at the carboxyl terminal position of a 8, 9, 10, 11, or 12 residue peptide epitope in accordance with the invention.
  • the primary anchor residues of a peptide that will bind an HLA class II molecule are spaced relative to each other, rather than to the termini of a peptide, where the peptide is generally of at least 9 amino acids in length.
  • the primary anchor positions for each motif and supermotif are set forth in Table TV.
  • analog peptides can be created by altering the presence or absence of particular residues in the primary and/or secondary anchor positions shown in Table IV. Such analogs are used to modulate the binding affinity and/or population coverage of a peptide comprising a particular HLA motif or supermotif.
  • a "recombinant" DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro.
  • Non-limiting examples of small molecules include compounds that bind or interact with 213P1F11, ligands including hormones, neuropeptides, chemokines, odorants, phospholipids, and functional equivalents thereof that bind and preferably inhibit 213P1F11 protein function.
  • Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably below about 9, about 8, about 7, about 6, about 5 or about 4 kDa.
  • small molecules physically associate with, or bind, 213P1F11 protein; are not found in naturally occurring metabolic pathways; and/or are more soluble in aqueous than non-aqueous solutions
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative.temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al, Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
  • “Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll 0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 °C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and
  • Modely stringent conditions are described by, but not limited to, those in Sambrook et al, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
  • washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
  • moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dexfran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
  • 5 x SSC 150 mM NaCI, 15 mM trisodium citrate
  • 50 mM sodium phosphate pH 7.6
  • 5 x Denhardt's solution 10% dexfran sulfate
  • 20 mg/mL denatured sheared salmon sperm DNA followed by washing the filters in 1 x SSC at about 37-50°C.
  • the skilled artisan will recognize how to adjust the temperature,, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
  • HLA “supermotif is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles.
  • to treat or “therapeutic” and grammatically related terms, refer to any improvement of any consequence of disease, such as prolonged survival, less morbidity, and/or a lessening of side effects which are the byproducts of an alternative therapeutic modality; full eradication of disease is not required.
  • transgenic animal e.g., a mouse or rat
  • transgene is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • transgene is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.
  • an HLA or cellular immune response "vaccine” is a composition that contains or encodes one or more peptides of the invention.
  • vaccines such as a cocktail of one or more individual peptides; one or more peptides of the invention comprised by a polyepitopic peptide; or nucleic acids that encode such individual peptides or polypeptides, e.g., a minigene that encodes a polyepitopic peptide.
  • the "one or more peptides” can include any whole unit integer from 1- 242 or more, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, or 242 or more peptides of the invention.
  • HLA class I peptides of the invention can be admixed with, or linked to, HLA class II peptides, to facilitate activation of both cytotoxic T lymphocytes and helper T lymphocytes.
  • HLA vaccines can also comprise peptide-pulsed antigen presenting cells, e.g., dendritic cells.
  • variant refers to a molecule that exhibits a variation from a described type or norm, such as a protein that has one or more different amino acid residues in the corresponding position(s) of a specifically described protein (e.g. the 213P1F11 protein shown in Figure 2 or Figure 3.
  • An analog is an example of a variant protein.
  • Splice isoforms and single nucleotides polymorphisms (SNPs) are further examples of variants.
  • the "213P1F11-related proteins" of the invention include those specifically identified herein, as well as allelic variants, conservative substitution variants, analogs and homologs that can be isolated/generated and characterized without undue experimentation following the methods outlined herein or readily available in the art. Fusion proteins that combine parts of different 213P1F11 proteins or fragments thereof, as well as fusion proteins of a 213PlFl l protein and a heterologous polypeptide are also included. Such 213PlFll proteins are collectively referred to as the 213P1F11-related proteins, the proteins of the invention, or 213P1F11.
  • 213P1F11-related protein refers to a polypeptide fragment or a 213P1F11 protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 amino acids; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, or 242 or more amino acids.
  • One aspect of the invention provides polynucleotides corresponding or complementary to all or part of a 213P1F11 gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a 213P IF 11-related protein and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to a 213PlFl l gene or mRNA sequence or a part thereof, and polynucleotides or oligonucleotides that hybridize to a 213P1F11 gene, mRNA, or to a 213P1F11 encoding polynucleotide (collectively, "213P1F11 polynucleotides").
  • T can also be U in Figure 2.
  • Embodiments of a 213P1F11 polynucleotide include: a 213P1F11 polynucleotide having the sequence shown in Figure 2, the nucleotide sequence of 213P1F11 as shown in Figure 2 wherein T is U; at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2; or, at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2 where T is U.
  • embodiments of 213P IF 11 nucleotides comprise, without limitation:
  • V a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2D , from nucleotide residue number 1 through nucleotide residue number 966, including the stop codon, wherein T can also be U;
  • VI a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2E , from nucleotide residue number 404 through nucleotide residue number 1132, including the stop codon, wherein T can also be U;
  • VI a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2F , from nucleotide residue number 404 through nucleotide residue number 1132, including the stop codon, wherein T can also be U;
  • VIII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2G , from nucleotide residue number 404 through nucleotide residue number 1132, including the stop codon, wherein T can also be U;
  • (LX) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2H , from nucleotide residue number 404 through nucleotide residue number 1132, including the stop codon, wherein T can also be U;
  • (XII) a polynucleotide that encodes at least one peptide set forth in Tables V-XIX;
  • (XIV) a polynucleotide that encodes a peptide region of at least 5 amino acids of a peptide of Figure 3A in any whole number increment up to 242 that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6A; or of Figure 3B in any whole number increment up to 230 that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6B; or of Figure 3C in any whole number increment up to 146 that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6C; or of Figure 3D in any whole number increment up to 321 that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6D;
  • (XV) a polynucleotide that encodes a peptide region of at least 5 amino acids of a peptide of Figure 3A in any whole number increment up to 242 that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7A; or of Figure 3B in any whole number increment up to 230 that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7B; or of Figure 3C in any whole number increment up to 146 that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7C; or of Figure 3D in any whole number increment up to 321 that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7D;
  • (XVI) a polynucleotide that encodes a peptide region of at least 5 amino acids of a peptide of Figure 3A in any whole number increment up to 242 that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile of Figure 8A; or of Figure 3B in any whole number increment up to 230 that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile of Figure 8B; or of Figure 3C in any whole number increment up to 146 that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile of Figure8C; or of Figure 3D in any whole number increment up to 321 that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile of Figure 8D;
  • (XVII) a polynucleotide that encodes a peptide region of at least 5 amino acids of a peptide of Figure 3 A in any whole number increment up to 242 that includes an amino acid position having a value greater than 0.5 in the Beta-turn profile of Figure 9A; or of Figure 3B in any whole number increment up to 230 that includes an amino acid position having a value greater than 0.5 in the Beta- turn profile of Figure 9B; or of Figure 3C in any whole number increment up to 146 that includes an amino acid position having a value greater than 0.5 in the Beta-turn profile of Figure9C; or of Figure 3D in any whole number increment up to 321 that includes an amino acid position having a value greater than 0.5 in the Beta-turn profile of Figure 9D;
  • (XXI) a polynucleotide of any of (I)-(XVTfl) or peptide of (XIX) together with a pharmaceutical excipient and/or in a human unit dose form.
  • Typical embodiments of the invention disclosed herein include 213P1F11 polynucleotides that encode specific portions of 213P1F11 mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example:
  • representative embodiments of the invention disclosed herein include: polynucleotides and their encoded peptides themselves encoding about amino acid 1 to about amino acid 10 of the 213P1F11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 10 to about amino acid 20 of the 213P1F11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 20 to about amino acid 30 of the 213P1F11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 30 to about amino acid 40 of the 213P 1 F 11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 40 to about amino acid 50 of the 213P1F11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 50 to about amino acid 60 of the 213P1F11 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 60 to about amino acid 70 of the 2
  • polynucleotides encoding portions of the amino acid sequence (of about 10 amino acids), of amino acids 100 through the carboxyl terminal amino acid of the 213P1F11 protein are embodiments of the invention. Wherein it is understood that each particular amino acid position discloses that position plus or minus five amino acid residues.
  • Polynucleotides encoding relatively long portions of a 213PlFl l protein are also within the scope of the invention.
  • polynucleotides encoding from about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the 213P1F11 protein "or variant" shown in Figure 2 or Figure 3 can be generated by a variety of techniques well known in the art.
  • These polynucleotide fragments can include any portion of the 213P1F11 sequence as shown in Figure 2.
  • Additional illustrative embodiments of the invention disclosed herein include 213P1F11 polynucleotide fragments encoding one or more of the biological motifs contained within a 213PlFl l protein "or variant" sequence, including one or more of the motif-bearing subsequences of a 213P1F11 protein "or variant” set forth in Tables V-XIX.
  • HLA Peptide Tables (collectively HLA Peptide Tables) respective to its parental protein, e.g., variant 1, variant 2, etc.
  • HLA Peptide Tables the particular variant
  • the length of the peptide in an HLA Peptide Table the Search Peptides in Table XXIX.
  • a unique Search Peptide is used to obtain HLA peptides of a particular for a particular variant.
  • the position of each Search Peptide relative to its respective parent molecule is listed in Table XXIX.
  • a Search Peptide begins at position "X"
  • a particular Search Peptide begins at position 150 of is parental molecule, one must add 150 - 1, i.e., 149 to each HLA peptide amino acid position to calculate the position of that amino acid in the parent molecule.
  • One embodiment of the invention comprises an HLA peptide, that occurs at least twice in Tables V- XIX collectively, or an oligonucleotide that encodes the HLA peptide.
  • Another embodiment of the invention comprises an HLA peptide that occurs at least once in Tables V-XVIII and at least once in table XIX, or an oligonucleotide that encodes the HLA peptide.
  • Another embodiment of the invention is antibody epitopes which comprise a peptide regions, or an oligonucleotide encoding the peptide region, that has one two, three, four, or five of the following characteristics: i) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or greater than 0.5, 0.6, 0J, 0.8, 0.9, or having a value equal to 1.0, in the Hydrophilicity profile of Figure 5; ii) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or having a value equal to 0.0, in the Hydropathicity profile of Figure 6; iii) a peptide region of at least
  • typical polynucleotide fragments of the invention encode one or more of the regions of 213P1F11 protein or variant that exhibit homology to a known molecule.
  • typical polynucleotide fragments can encode one or more of the 213P1F11 protein or variant N-glycosylation sites, cAMP and cGMP-dependent protein kinase phosphorylation sites, casein kinase II phosphorylation sites or N-myristoylation site and amidation sites.
  • the polynucleotides of the preceding paragraphs have a number of different specific uses.
  • the human 213P1F11 gene maps to the chromosomal location set forth in the Example entitled "Chromosomal Mapping of 213P1F11."
  • polynucleotides that encode different regions of the 213P1F11 proteins are used to characterize cytogenetic abnormalities of this chromosomal locale, such as abnormalities that are identified as being associated with various cancers.
  • cytogenetic abnormalities of this chromosomal locale such as abnormalities that are identified as being associated with various cancers.
  • a variety of chromosomal abnormalities including rearrangements have been identified as frequent cytogenetic abnormalities in a number of different cancers (see e.g.
  • polynucleotides encoding specific regions of the 213P1F11 proteins provide new tools that can be used to delineate, with greater precision than previously possible, cytogenetic abnormalities in the chromosomal region that encodes 213P1F11 that may contribute to the malignant phenotype.
  • these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtle and less common chromosomal abnormalities (see e.g. Evans et al, Am. J. Obstet. Gynecol 171(4): 1055-1057 (1994)).
  • 213P1F11 was shown to be highly expressed in bladder and other cancers
  • 213P1F11 polynucleotides are used in methods assessing the status of 213P1F11 gene products in normal versus cancerous tissues.
  • polynucleotides that encode specific regions of the 213P1F11 proteins are used to assess the presence of perturbations (such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.) in specific regions of the 213P1F11 gene, such as regions containing one or more motifs.
  • Exemplary assays include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Marrogi et al, J. Cutan. Pathol. 26(8): 369-378 (1999), both of which utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein.
  • SSCP single-strand conformation polymorphism
  • nucleic acid related embodiments of the invention disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules, as well as nucleic acid molecules based on an alternative backbone, or including alternative bases, whether derived from natural sources or synthesized, and include molecules capable of inhibiting the RNA or protein expression of 213P1F11.
  • antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, that specifically bind DNA or RNA in a base pair-dependent manner.
  • PNAs peptide nucleic acids
  • non-nucleic acid molecules such as phosphorothioate derivatives
  • Antisense technology entails the administration of exogenous oligonucleotides that bind to a target polynucleotide located within the cells.
  • the term "antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e.g., 213P1F11. See for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1:1-5 (1988).
  • the 213P1F11 antisense oligonucleotides of the present invention include derivatives such as S- oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action.
  • S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
  • the S-oligos of the present invention can be prepared by treatment of the corresponding O-oligos with 3H-l,2-benzodithiol-3-one- 1,1 -dioxide, which is a sulfur transfer reagent. See, e.g., Iyer, R. P. et al, J. Org. Chem. 55:4693-4698 (1990); and Iyer, R. P. et al, J. Am. Chem. Soc. 112:1253-1254 (1990).
  • Additional 213P1F11 antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see, e.g., Partridge et al, 1996, Antisense & Nucleic Acid Drug Development 6: 169-175).
  • the 213P1F11 antisense oligonucleotides of the present invention typically can be RNA or DNA that is complementary to and stably hybridizes with the first 100 5' codons or last 100 3' codons of a 213P1F1 1 genomic sequence or the corresponding mRNA. Absolute complementarity is not required, although high degrees of complementarity are preferred. Use of an oligonucleotide complementary to this region allows for the selective hybridization to 213P1F11 mRNA and not to mRNA specifying other regulatory subunits of protein kinase.
  • 213P1F11 antisense oligonucleotides of the present invention are 15 to 30-mer fragments of the antisense DNA molecule that have a sequence that hybridizes to 213P1F11 mRNA.
  • 213P1F11 antisense oligonucleotide is a 30-mer oligonucleotide that is complementary to a region in the first 10 5' codons or last 10 3' codons of 213P1F11.
  • the antisense molecules are modified to employ ribozymes in the inhibition of 213P1F11 expression, see, e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12: 510-515 (1996). II.A.3.) Primers and Primer Pairs
  • nucleotides of the invention include primers and primer pairs, which allow the specific amplification of polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
  • Probes can be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • Such probes and primers are used to detect the presence of a 213P1F11 polynucleotide in a sample and as a means for detecting a cell expressing a 213P1F11 protein.
  • probes include polypeptides comprising all or part of the human 213P1F11 cDNA sequence shown in Figure 2.
  • primer pairs capable of specifically amplifying 213P1F11 mRNAs are also described in the Examples.
  • primers and probes can be prepared based on the sequences provided herein and used effectively to amplify and/or detect a 213PlFll mRNA.
  • the 213P1F11 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the amplification and/or detection of the 213P1F11 gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers; as coding sequences capable of directing the expression of 213P1F11 polypeptides; as tools for modulating or inhibiting the expression of the 213P1F11 gene(s) and/or translation of the 213P1F11 transcript(s); and as therapeutic agents.
  • the 213P1F11 cDNA sequences described herein enable the isolation of other polynucleotides encoding 213P1F11 gene produces), as well as the isolation of polynucleotides encoding 213P1F11 gene product homologs, alternatively spliced isoforms, allelic variants, and mutant forms of a 213P1F11 gene product as well as polynucleotides that encode analogs of 213P IF 11-related proteins.
  • Various molecular cloning methods that can be employed to isolate full length cDNAs encoding a 213P1F11 gene are well known (see, for example, Sambrook, J.
  • a 213P1F11 cDNA (e.g., Figure 2) or a portion thereof can be synthesized and used as a probe to retrieve overlapping and full-length cDNAs corresponding to a 213P1F11 gene.
  • a 213P1F11 gene itself can be isolated by screening genomic DNA libraries, bacterial artificial chromosome libraries (BACs), yeast artificial chromosome libraries (YACs), and the like, with 213P1F11 DNA probes or primers.
  • the invention also provides recombinant DNA or RNA molecules containing a 213P1F11 polynucleotide, a fragment, analog or homologue thereof, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook et al, 1989, supra).
  • the invention further provides a host- vector system comprising a recombinant DNA molecule containing a 213PlFl l polynucleotide, fragment, analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell.
  • suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 or HighFive cell).
  • suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPrl, other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of 213P1F11 or a fragment, analog or homolog thereof can be used to generate 213P1F11 proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art.
  • a wide range of host-vector systems suitable for the expression of 213P1F11 proteins or fragments thereof are available, see for example, Sambrook et al, 1989, supra; Current Protocols in Molecular Biology, 1995, supra).
  • Preferred vectors for mammalian expression include but are not limited to pcDNA 3.1 myc-His- tag (Invitrogen) and the retroviral vector pSRcctkneo (Muller et al, 1991, MCB 11 : 1785).
  • 213P1F11 can be expressed in several prostate cancer and non-prostate cell lines, including for example 293, 293T, rat-1, NIH 3T3 and TsuPrl.
  • the host-vector systems of the invention are useful for the production ofa 213PlFl l protein or fragment thereof. Such host-vector systems can be employed to study the functional properties of 213P1F11 and 213P1F11 mutations or analogs.
  • Recombinant human 213P1F11 protein or an analog or homolog or fragment thereof can be produced by mammalian cells transfected with a construct encoding a 213P1F11-related nucleotide.
  • 293T cells can be transfected with an expression plasmid encoding 213P1F11 or fragment, analog or homolog thereof, a 213P1F11-related protein is expressed in the 293T cells, and the recombinant 213P1F11 protein is isolated using standard purification methods (e.g., affinity purification using anti- 213P1F11 antibodies).
  • a 213P1F11 coding sequence is subcloned into the retroviral vector pSRccMSVtkneo and used to infect various mammalian cell lines, such as NIH 3T3, TsuPrl, 293 and rat-1 in order to establish 213P1F11 expressing cell lines.
  • various mammalian cell lines such as NIH 3T3, TsuPrl, 293 and rat-1
  • Various other expression systems well known in the art can also be employed.
  • Expression constructs encoding a leader peptide joined in frame to a 213P1F11 coding sequence can be used for the generation of a secreted form of recombinant 213P1F11 protein.
  • codons having a usage frequency of less than about 20% in known sequences of the desired host typically have rare codons (i.e., codons having a usage frequency of less than about 20% in known sequences of the desired host) replaced with higher frequency codons.
  • Codon preferences for a specific species are calculated, for example, by utilizing codon usage tables available on the INTERNET such as at URL located at the World Wide Web .dna.affrc.go.jp/ ⁇ nakamura/codon.html.
  • Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression.
  • the GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
  • Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol Cell Biol, 9:5073-5080 (1989).
  • 213P1F11-related proteins Another aspect of the present invention provides 213P1F11-related proteins.
  • Specific embodiments of 213P1F11 proteins comprise a polypeptide having all or part of the amino acid sequence of human • 213P1F11 as shown in Figure 2 or Figure 3.
  • embodiments of 213P1F11 proteins comprise variant, homolog or analog polypeptides that have alterations in the amino acid sequence of 213P1F11 shown in Figure 2 or Figure 3.
  • allelic variants of human 213P1F11 share a high degree of structural identity and homology (e.g., 90% or more homology).
  • allelic variants of a 213P1F11 protein contain conservative amino acid substitutions within the 213P1F11 sequences described herein or contain a substitution of an amino acid from a corresponding position in a homologue of 213P1F11.
  • One class of 213P1F11 allelic variants are proteins that share a high degree of homology with at least a small region of a particular 213P1F11 amino acid sequence, but further contain a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift.
  • Proteins of the invention can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
  • isoleucine I
  • V valine
  • L leucine
  • Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
  • substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein.
  • G glycine
  • A alanine
  • V valine
  • M Methionine
  • L Lysine
  • K arginine
  • R arginine
  • Embodiments of the invention disclosed herein include a wide variety of art-accepted variants or analogs of 213P1F11 proteins such as polypeptides having amino acid insertions, deletions and substitutions.
  • 213P1F11 variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis.
  • Site-directed mutagenesis (Carter et al, Nucl. Acids Res., /5.4331 (1986); Zoller et al, Nucl. Acids Res., 10:6487 (1987)), cassette mutagenesis (Wells et al, Gene, 34:315 (1985)), restriction selection mutagenesis (Wells et al, Philos. Trans. R. Soc. London SerA, 317:415 (1986)) or other known techniques can be performed on the cloned DNA to produce the 213P1F11 variant DNA.
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence that is involved in a specific biological activity such as a protein-protein interaction.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • amino acids include alanine, glycine, serine, and cysteine.
  • Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main- chain conformation of the variant. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine substitution does not yield adequate amounts of variant, an isosteric amino acid can be used.
  • 213P1F11 variants, analogs or homologs have the distinguishing attribute of having at least one epitope that is "cross reactive" with a 213P1F11 protein having an amino acid sequence of Figure 3.
  • cross reactive means that an antibody or T cell that specifically binds to a 213P1F11 variant also specifically binds to a 213P1F11 protein having an amino acid sequence set forth in Figure 3.
  • a polypeptide ceases to be a variant of a protein shown in Figure 3, when it no longer contains any epitope capable of being recognized by an antibody or T cell that specifically binds to the starting 213P1F11 protein.
  • 213P1F11-related protein variants share 70%, 75%, 80%, 85% or 90% or more similarity with an amino acid sequence of Figure 3, or a fragment thereof.
  • Another specific class of 213P1F11 protein variants or analogs comprise one or more of the 213P IF 11 biological motifs described herein or presently known in the art.
  • analogs of 213P1F11 fragments that have altered functional (e.g. immunogenic) properties relative to the starting fragment. It is to be appreciated that motifs now or which become part of the art are to be applied to the nucleic or amino acid sequences of Figure 2 or Figure 3.
  • embodiments of the claimed invention include polypeptides containing less than the full amino acid sequence of a 213P1F11 protein shown in Figure 2 or Figure 3.
  • representative embodiments of the invention comprise peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids of a 213P1F11 protein shown in Figure 2 or Figure 3.
  • representative embodiments of the invention disclosed herein include polypeptides consisting of about amino acid 1 to about amino acid 10 of a 213P1F11 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 10 to about amino acid 20 of a 213P1F11 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 20 to about amino acid 30 ofa 213PlFl l protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 30 to about amino acid 40 of a 213P1F11 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 40 to about amino acid 50 of a 213P1F11 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 50 to about amino acid 60 of a 213P1F11 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 60 to about amino acid 70 of a 213PlFl l protein shown in Figure 2 or Figure 3 , polypeptides consisting of about
  • polypeptides consisting of about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 130, or 140 or 150 etc.) of a 213P1F11 protein shown in Figure 2 or Figure 3 are embodiments of the invention. It is to be appreciated that the starting and stopping positions in this paragraph refer to the specified position as well as that position plus or minus 5 residues.
  • 213P1F11-related proteins are generated using standard peptide synthesis technology or using chemical cleavage methods well known in the art. Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode a 213P1F11-related protein. In one embodiment, nucleic acid molecules provide a means to generate defined fragments of a 213P1F11 protein (or variants, homologs or analogs thereof).
  • Additional illustrative embodiments of the invention disclosed herein include 213P1F11 polypeptides comprising the amino acid residues of one or more of the biological motifs contained within a 213P1F11 polypeptide sequence set forth in Figure 2 or Figure 3.
  • motifs are known in the art, and a protein can be evaluated for the presence of such motifs by a number of publicly available Internet sites (see, e.g., URL addresses located at the World Wide Web: pfam.wustl.edu/; http.V/searcHavmcher.bcm.tmc.edu/seq-search/struc-predict.html; psort.ims.u-tokyo.ac.jp/; .cbs.dtu.dk/; .ebi.ac.uk/interpro/scan.html; .expasy.ch/tools/scnpsitl.html; EpimatrixTM and EpimerTM, Brown University,
  • Motif bearing subsequences of all 213P1F11 variant proteins are set forth and identified in Tables V- XIX.
  • Table XX sets forth several frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu ). The columns of Table XX list (1) motif name abbreviation, (2) percent identity found amongst the different member of the motif family, (3) motif name or description and (4) most common function; location information is included if the motif is relevant for location.
  • Polypeptides comprising one or more of the 213P1F11 motifs discussed above are useful in elucidating the specific characteristics of a malignant phenotype in view of the observation that the 213P1F11 motifs discussed above are associated with growth deregulation and because 213P1F11 is overexpressed in certain cancers (See, e.g., Table I).
  • Casein kinase II, cAMP and camp-dependent protein kinase, and Protein Kinase C are enzymes known to be associated with the development of the malignant phenotype (see e.g.
  • Amidation is another protein modification also associated with cancer and cancer progression (see e.g. Treston et al, J. Natl. Cancer Inst. Monogr. (13): 169-175 (1992)).
  • proteins of the invention comprise one or more of the immunoreactive epitopes identified in accordance with art-accepted methods, such as the peptides set forth in Tables V-XIX.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 213P1F11 protein that are capable of optimally binding to specified HLA alleles (e.g., Table IV; EpimatrixTM and EpimerTM, Brown University, URL located at the World Wide Web .brown.edu/Research/TB-HIV_Lab/epimatr ⁇ and BIMAS, URL bimas.dcrt.nih.gov/.)
  • processes for identifying peptides that have sufficient binding affinity for HLA molecules and which are correlated with being immunogenic epitopes are well known in the art, and are carried out without undue experimentation.
  • processes for identifying peptides that are immunogenic epitopes are well known in the art, and are carried out without undue
  • epitopes in order to modulate immunogenicity. For example, one begins with an epitope that bears a CTL or HTL motif (see, e.g., the HLA Class I and HLA Class II motifs/supermotifs of Table IV).
  • the epitope is analoged by substituting out an amino acid at one of the specified positions, and replacing it with another amino acid specified for that position. For example, one can substitute out a deleterious residue in favor of any other residue, such as a preferred residue as defined in Table IV; substitute a less-preferred residue with a preferred residue as defined in Table IV; or substitute an originally-occurring preferred residue with another preferred residue as defined in Table TV. Substitutions can occur at primary anchor positions or at other positions in a peptide; see, e.g., Table TV.
  • inventions include polypeptides comprising combinations of the different motifs set forth in Table XXI, and or, one or more of the predicted CTL epitopes of Tables V-XIX, and/or, one or more of the T cell binding motifs known in the art. Preferred embodiments contain no insertions, deletions or substitutions either within the motifs or the intervening sequences of the polypeptides.
  • embodiments which include a number of either N-terminal and or C-terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
  • the number of N-terminal and/or C-terminal amino acid residues on either side of a motif is between about 1 to about 100 amino acid residues, preferably 5 to about 50 amino acid residues.
  • 213P1F11-related proteins are embodied in many forms, preferably in isolated form.
  • a purified 213P1F11 protein molecule will be substantially free of other proteins or molecules that impair the binding of 213P1F11 to antibody, T cell or other ligand.
  • the nature and degree of isolation and purification will depend on the intended use.
  • Embodiments of a 213P1F11-related proteins include purified 213P1F11-related proteins and functional, soluble 213P1F11-related proteins.
  • a functional, soluble 213P1F11 protein or fragment thereof retains the ability to be bound by antibody, T cell or other ligand.
  • the invention also provides 213P1F11 proteins comprising biologically active fragments of a 213P1F11 amino acid sequence shown in Figure 2 or Figure 3.
  • Such proteins exhibit properties of the starting 213P1F11 protein, such as the ability to elicit the generation of antibodies that specifically bind an epitope associated with the starting 213P1F11 protein; to be bound by such antibodies; to elicit the activation of HTL or CTL; and or, to be recognized by HTL or CTL that also specifically bind to the starting protein.
  • 213P1F11-related polypeptides that contain particularly interesting structures can be predicted and/or identified using various analytical techniques well known in the art, including, for example, the methods of Chou- Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson- Wolf analysis, or on the basis of immunogenicity. Fragments that contain such structures are particularly useful in generating subunit-specific anti-213PlFl 1 antibodies, or T cells or in identifying cellular factors that bind to 213P1F11. For example, hydrophilicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Hopp, T.P. and Woods, K.R., 1981, Proc. Natl. Acad. Sci.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 213P 1 F 11 protein that are capable of optimally binding to specified HLA alleles (e.g., by using the SYFPEITHI site at World Wide Web URL syfpeithi.bmi-heidelberg.com/; the listings in Table IV(A)-(E); EpimatrixTM and EpimerTM, Brown University, located at the World Wide Web (.brown.edu/Research TB- HIV_Lab/epimatrix/epimatrix.html); and BIMAS, URL bimas.dcrt.nih.gov/).
  • peptide epitopes from 213P1F11 that are presented-in the context of human MHC Class I molecules, e.g., HLA-A1, A2, A3, Al l, A24, B7 and B35 were predicted (Tables V-XIX).
  • the complete amino acid sequence of the 213P1F11 protein and relevant portions of other variants i.e., for HLA Class I predictions 9 flanking redisues on either side of a point mutation, and for HLA Class II predictions 14 flanking residues on either side of a point mutation, were entered into the HLA Peptide Motif Search algorithm found in the Bioinformatics and Molecular Analysis Section (BIMAS) web site listed above; in addition to the site SYFPEITHI, at URL sy eithi.bmi-heidelberg.com/.
  • BIMAS Bioinformatics and Molecular Analysis Section
  • HLA peptide motif search algorithm was developed by Dr. Ken Parker based on binding of specific peptide sequences in the groove of HLA Class I molecules, in particular HLA-A2 (see, e.g., Falk et al, Nature 351: 290-6 (1991); Hunt et al, Science 255:1261-3 (1992); Parker et al, J. Immunol. 149:3580-7 (1992); Parker et al, J. Immunol. 152:163-75 (1994)).
  • HLA-A2 This algorithm allows location and ranking of 8-mer, 9-mer (also refered to as “nonamer”), and 10-mer (also refered to as “decamer”) peptides from a complete protein sequence for predicted binding to HLA-A2 as well as numerous other HLA Class I molecules.
  • Many HLA class I binding peptides are 8-, 9-, 10 or 11-mers.
  • the epitopes preferably contain a leucine (L) or methionine (M) at position 2 and a valine (V) or leucine (L) at the C- terminus (see, e.g., Parker et al, J. Immunol. 149:3580-7 (1992)).
  • Tables V-XIX Selected results of 213P1F11 predicted binding peptides are shown in Tables V-XIX herein.
  • Tables V-XIX the selected candidates, 9-mers and 10-mers, and 15-mers for each family member are shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
  • the binding score corresponds to the estimated half time of dissociation of complexes containing the peptide at 37°C at pH 6.5.
  • Peptides with the highest binding score are predicted to be the most tightly bound to HLA Class I on the cell surface for the greatest period of time and thus represent the best immunogenic targets for T-cell recognition.
  • every epitope predicted by th ⁇ BIMAS site, EpimerTM and EpimatrixTM sites, or specified by the HLA class I or class II motifs available in the art or which become part of the art such as set forth in Table IV (or determined using World Wide Web site URL syfpeithi.bmi-heidelberg.com/, or BIMAS, bimas.dcrt.nih.gov/) are to be "applied” to.
  • a 213P1F11 protein in accordance with the invention As used in this context "applied” means that a 213P1F11 protein is evaluated, e.g., visually or by computer- based patterns finding methods, as appreciated by those of skill in the relevant art.
  • Every subsequence of a 213P1F11 protein of 8, 9, 10, or 11 amino acid residues that bears an HLA Class I motif, or a subsequence of 9 or more amino acid residues that bear an HLA Class II motif are within the scope of the invention.
  • 213P1F11 can be conveniently expressed in cells (such as 293T cells) transfected with a commercially available expression vector such as a CMV- driven expression vector encoding 213P1F11 with a C-terminal 6XHis and MYC tag (pcDNA3.1 /mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville TN).
  • the Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of a secreted 213P1F11 protein in transfected cells.
  • the secreted HIS-tagged 213P1F11 in the culture media can be purified, e.g., using a nickel column using standard techniques.
  • Modifications of 213P1F11-related proteins such as covalent modifications are included within the scope of this invention.
  • One type of covalent modification includes reacting targeted amino acid residues of a 213P1F11 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of a 213PlFl l protein.
  • Another type of covalent modification of a 213P1F11 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of a protein of the invention.
  • Another type of covalent modification of 213P1F11 comprises linking a 213P1F11 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • PEG polyethylene glycol
  • polypropylene glycol polypropylene glycol
  • polyoxyalkylenes polyoxyalkylenes
  • the 213P1F11-related proteins of the present invention can also be modified to form a chimeric molecule comprising 213P1F11 fused to another, heterologous polypeptide or amino acid sequence.
  • a chimeric molecule can be synthesized chemically or recombinantly.
  • a chimeric molecule can have a protein of the invention fused to another tumor-associated antigen or fragment thereof.
  • a protein in accordance with the invention can comprise a fusion of fragments ofa 213PlFl l sequence (amino or nucleic acid) such that a molecule is created that is not, through its length, directly homologous to the amino or nucleic acid sequences shown in Figure 2 or Figure 3.
  • Such a chimeric molecule can comprise multiples of the same subsequence of213PlFl l.
  • a chimeric molecule can comprise a fusion of a 213P1F11-related protein with a polyhistidine epitope tag, which provides an epitope to which immobilized nickel can selectively bind, with cytokines or with growth factors.
  • the epitope tag is generally placed at the amino- or carboxyl- terminus of a213PlFl 1 protein.
  • the chimeric molecule can comprise a fusion of a 213P IF 11-related protein with an immunoglobulin or a particular region of an immunoglobulin.
  • the chimeric molecule also referred to as an "immunoadhesin"
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a 213PlFl l polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGI molecule.
  • the proteins of the invention have a number of different specific uses. As 213P1F11 is highly expressed in prostate and other cancers, 213P1F11-related proteins are used in methods that assess the status of 213P1F11 gene products in normal versus cancerous tissues, thereby elucidating the malignant phenotype. Typically, polypeptides from specific regions ofa 213PlFl l protein are used to assess the presence of perturbations (such as deletions, insertions, point mutations etc.) in those regions (such as regions containing one or more motifs).
  • perturbations such as deletions, insertions, point mutations etc.
  • Exemplary assays utilize antibodies or T cells targeting 213P1F11-related proteins comprising the amino acid residues of one or more of the biological motifs contained within a 213P1F11 polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues or to elicit an immune response to the epitope.
  • 213P1F11-related proteins that contain the amino acid residues of one or more of the biological motifs in a 213P1F11 protein are used to screen for factors that interact with that region of 213P1F11.
  • 213P1F11 protein fragments/subsequences are particularly useful in generating and characterizing domain-specific antibodies (e.g., antibodies recognizing an extracellular or intracellular epitope of a 213P1F1 1 protein), for identifying agents or cellular factors that bind to 213P1F11 or a particular structural domain thereof, and in various therapeutic and diagnostic contexts, including but not limited to -diagnostic assays, cancer vaccines and methods of preparing such vaccines.
  • domain-specific antibodies e.g., antibodies recognizing an extracellular or intracellular epitope of a 213P1F1 1 protein
  • Proteins encoded by the 213P1F11 genes, or by analogs, homologs or fragments thereof, have a variety of uses, including but not limited to generating antibodies and in methods for identifying ligands and other agents and cellular constituents that bind to a 213P1F11 gene product.
  • Antibodies raised against a 213P1F11 protein or fragment thereof are useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of 213P1F11 protein, such as those listed in Table I. Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers.
  • 213P1F11-related nucleic acids or proteins are also used in generating HTL or CTL responses.
  • immunological assays useful for the detection of 213P1F11 proteins are used, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
  • Antibodies can be labeled and used as immunological imaging reagents capable of detecting 213PlFll-expressing cells (e.g., in radioscintigraphic imaging methods).
  • 213P1F11 proteins are also particularly useful in generating cancer vaccines, as further described herein.
  • Another aspect of the invention provides antibodies that bind to 213P1F11-related proteins.
  • Preferred antibodies specifically bind to a 213P1F11-related protein and do not bind (or bind weakly) to peptides or proteins that are not 213P1F11-related proteins.
  • antibodies that bind 213P1F11 can bind 213P1F11-related proteins such as the homologs or analogs thereof.
  • 213P1F11 antibodies of the invention are particularly useful in cancer (see, e.g., Table I) diagnostic and prognostic assays, and imaging methodologies. Similarly, such antibodies are useful in the treatment, diagnosis, and/or prognosis of other cancers, to the extent 213P1F11 is also expressed or overexpressed in these other cancers. Moreover, intracellularly expressed antibodies (e.g., single chain antibodies) are therapeutically useful in treating cancers in which the expression of 213P1F11 is involved, such as advanced or metastatic prostate cancers.
  • the invention also provides various immunological assays useful for the detection and quantification of 213P1F11 and mutant 213P1F11-related proteins.
  • Such assays can comprise one or more 213P1F11 antibodies capable of recognizing and binding a 213P1F11-related protein, as appropriate.
  • These assays are performed within various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), and the like.
  • Immunological non-antibody assays of the invention also comprise T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.
  • MHC major histocompatibility complex
  • immunological imaging methods capable of detecting prostate cancer and other cancers expressing 213P1F11 are also provided by the invention, including but not limited to radioscintigraphic imaging methods using labeled 213P1F11 antibodies.
  • assays are clinically useful in the detection, monitoring, and prognosis of 213P1F11 expressing cancers such as prostate cancer.
  • 213P1F11 antibodies are also used in methods for purifying a 213P1F11-related protein and for isolating 213P1F11 homologues and related molecules.
  • a method of purifying a 213P1F11-related protein comprises incubating a 213P1F11 antibody, which has been coupled to a solid matrix, with a lysate or other solution containing a 213P1F11-related protein under conditions that permit the 213P1F11 antibody to bind to the 213P1F11-related protein; washing the solid matrix to eliminate impurities; and eluting the 213P1F11-related protein from the coupled antibody.
  • Other uses of 213P1F11 antibodies in accordance with the invention include generating anti-idiotypic antibodies that mimic a 213P1F11 protein.
  • antibodies can be prepared by immunizing a suitable mammalian host using a 213P1F11-related protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Hariow, and Lane (1988); Hariow, Antibodies, Cold Spring Harbor Press, NY (1989)).
  • fusion proteins of 213P1F11 can also be used, such as a 213PlFl l GST-fusion protein.
  • a GST fusion protein comprising all or most of the amino acid sequence of Figure 2 or Figure 3 is produced, then used as an immunogen to generate appropriate antibodies.
  • a 213P1F11-related protein is synthesized and used as an immunogen.
  • naked DNA immunization techniques known in the art are used (with or without purified 213P1F11-related protein or 213P1F11 expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly et al, 1997, Ann. Rev. Immunol. 15: 617-648).
  • the amino acid sequence of a 213P1F11 protein as shown in Figure 2 or Figure 3 can be analyzed to select specific regions of the 213P1F11 protein for generating antibodies.
  • hydrophobicity and hydrophilicity analyses of a 213P1F11 amino acid sequence are used to identify hydrophilic regions in the 213P1F11 structure. Regions of a 213P1F11 protem that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis. Hydrophilicity profiles can be generated using the method of Hopp, T.P.
  • Hydropathicity profiles can be generated using the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility profiles can be generated using the method of Bhaskaran R., Ponnuswamy P.K., 1988, Int. J. Pept. Protein Res. 32:242-255.
  • Beta-turn profiles can be generated using the method of Deleage, G., Roux B., 1987, Protein Engineering 1:289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. Methods for the generation of 213P1F11 antibodies are further illustrated by way of the examples provided herein. Methods for preparing a protein or polypeptide for use as an immunogen are well known in the art. Also well known in the art are methods for preparing immunogenic conjugates of a protein with a carrier, such as BSA, KLH or other carrier protein. In some circumstances, direct conjugation using, for example, carbodiimide reagents are used; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, are effective.
  • Administration of a 213P1F11 immunogen is often conducted by injection over a suitable time period and with use of a suitable adjuvant, as is understood in the art.
  • titers of antibodies can be taken to determine adequacy of antibody formation.
  • 213P1F11 monoclonal antibodies can be produced by various means well known in the art.
  • immortalized cell lines that secrete a desired monoclonal antibody are prepared using the standard hybridoma technology of Kohler and Milstein or modifications that immortalize antibody-producing B cells, as is generally known.
  • Immortalized cell lines that secrete the desired antibodies are screened by immunoassay in which the antigen is a 213P1F11-related protein.
  • the cells can be expanded and antibodies produced either from in vitro cultures or from ascites fluid.
  • the antibodies or fragments of the invention can also be produced, by recombinant means. Regions that bind specifically to the desired regions of a 213P1F11 protein can also be produced in the context of chimeric or complementarity determining region (CDR) grafted antibodies of multiple species origin. Humanized or human 213P1F11 antibodies can also be produced, and are preferred for use in therapeutic contexts.
  • CDR complementarity determining region
  • Fully human 213P1F11 monoclonal antibodies can be generated using cloning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man, Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. Id., pp 65-82).
  • Fully human 213P1F11 monoclonal antibodies can also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application W098/24893, Kucherlapati and Jakobovits et al, published December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614; U.S. patents 6,162,963 issued 19 December 2000; 6,150,584 issued 12 November 2000; and, 6,114598 issued 5 September 2000). This method avoids the in vitro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.
  • Reactivity of 213P1F11 antibodies with a 213P1F11-related protein can be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 213P1F11-related proteins, 213P1F11-expressing cells or extracts thereof.
  • a 213P1F11 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme.
  • bi-specific antibodies specific for two or more 213P1F11 epitopes are generated using methods generally known in the art.
  • Homodimeric antibodies can also be generated by cross-linking techniques known in the art (e.g., Wolff et al, Cancer Res. 53: 2560-2565).
  • compositions of the invention induce a therapeutic or prophylactic immune responses in very broad segments of the world- wide population.
  • immunology-related technology For an understanding of the value and efficacy of compositions of the invention that induce cellular immune responses, a brief review of immunology-related technology is provided.
  • a complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA- restricted T cells (Buus, S. et al, Cell 47: 1071, 1986; Babbitt, B. P. et al, Nature 317:359, 1985; Townsend, A. and Bodmer, H, Annu. Rev. Immunol. 7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403, 1993).
  • class I and class II allele-specific HLA binding motifs allows identification of regions within a protein that are correlated with binding to particular HLA antigen(s).
  • candidates for epitope-based vaccines have been identified; such candidates can be further evaluated by HLA-peptide binding assays to determine binding affinity and/or the time period of association of the epitope and its corresponding HLA molecule. Additional confirmatory work can be performed to select, amongst these vaccine candidates, epitopes with preferred characteristics in terms of population coverage, and/or immunogenicity.
  • Various strategies can be utilized to evaluate cellular immunogenicity, including: 1) Evaluation of primary T cell cultures from normal individuals (see, e.g., Wentworth, P. A. et al, Mol. Immunol 32:603, 1995; Celis, E. et al, Proc. Natl. Acad. Sci. USA 91:2105, 1994; Tsai, V. et al, J. Immunol. 158:1796, 1997; Kawashima, I. et al, Human Immunol. 59:1, 1998).
  • This procedure involves the stimulation of peripheral blood lymphocytes (PBL) from normal subjects with a test peptide in the presence of antigen presenting cells in vitro over a period of several weeks. T cells specific for the peptide become activated during this time and are detected using, e.g., a lymphokine- or ⁇ Cr-release assay involving peptide sensitized target cells.
  • PBL peripheral blood lymphocytes
  • HLA transgenic mice see, e.g., Wentworth, P. A. et al, J. Immunol. 26:97, 1996; Wentworth, P. A. et al, Int. Immunol. 8:651, 1996; Alexander, J. et al, J. Immunol 159:4753, 1997).
  • peptides in incomplete Freund's adjuvant are administered subcutaneously to HLA transgenic mice.
  • splenocytes are removed and cultured in vitro in the presence of test peptide for approximately one week.
  • Peptide-specific T cells are detected using, e.g., a
  • ⁇ Cr-release assay involving peptide sensitized target cells and target cells expressing endogenously generated antigen.
  • recall responses are detected by culturing PBL from subjects that have been exposed to the antigen due to disease and thus have generated an immune response "naturally", or from patients who were vaccinated against the antigen.
  • PBL from subjects are cultured in vitro for 1-2 weeks in the presence of test peptide plus antigen presenting cells (APC) to allow activation of "memory" T cells, as compared to "naive"
  • APC antigen presenting cells
  • T cells At the end of the culture period, T cell activity is detected using assays including " ⁇ release involving peptide-sensitized targets, T cell proliferation, or lymphokine release.
  • Nucleic acids that encode a 213P1F11-related protein can also be used to generate either transgenic animals or "knock out" animals that, in turn, are useful in the development and screening of therapeutically useful reagents.
  • cDNA encoding 213P1F11 can be used to clone genomic DNA that encodes 213P1F11. The cloned genomic sequences can then be used to generate transgenic animals containing cells that express DNA that encode 213P1F11.
  • Methods for generating transgenic animals, particularly animals such as mice or rats have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 issued 12 April 1988, and 4,870,009 issued 26 September 1989.
  • particular cells would be targeted for 213P1F11 transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding 213P1F11 can be used to examine the effect of increased expression of DNA that encodes 213P1F11. Such animals' can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
  • an animal is treated with a reagent and a reduced incidence of a pathological condition, compared to untreated animals that bear the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of 213P1F11 can be used to construct a 213P1F11 "knock out" animal that has a defective or altered gene encoding 213PlFl l as a result of homologous recombination between the endogenous gene encoding 213P1F11 and altered genomic DNA encoding 213P1F11 introduced into an embryonic cell of the animal.
  • cDNA that encodes 213P1F11 can be used to clone genomic DNA encoding 213P1F11 in accordance with established techniques. A portion of the genomic DNA encoding 213P1F11 can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector (see, e.g., Thomas and Capecchi, Cell. 5J.:503 (1987) for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see, e.g., Li et al, Cell. 69:915 (1992)).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal, and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knock out animals can be characterized, for example, for their ability to defend against certain pathological conditions or for their development of pathological conditions due to absence of a 213P1F11 polypeptide.
  • Another aspect of the present invention relates to methods for detecting 213P1F11 polynucleotides and 213P IF 11-related proteins, as well as methods for identifying a cell that expresses 213P1F11.
  • the expression profile of 213P1F11 makes it a diagnostic marker for metastasized disease. Accordingly, the status of 213P1F11 gene products provides information useful for predicting a variety of factors including susceptibility to advanced stage disease, rate of progression, and/or tumor aggressiveness.
  • the status of 213P1F11 gene products in patient samples can be analyzed by a variety protocols that are well known in the art including immunohistochemical analysis, the variety of Northern blotting techniques including in situ hybridization, RT-PCR analysis (for example on laser capture micro-dissected samples), Western blot analysis and tissue array analysis.
  • the invention provides assays for the detection of 213P1F11 polynucleotides in a biological sample, such as serum, bone, prostate, and other tissues, urine, semen, cell preparations, and the like.
  • Detectable 213P1F.11 polynucleotides include, for example, a 213P1F11 gene or fragment thereof, 213P1F11 mRNA, alternative splice variant 213P1F11 mRNAs, and recombinant DNA or RNA molecules that contain a 213P1F11 polynucleotide.
  • a number of methods for arnplifying and or detecting the presence of 213P1F11 polynucleotides are well known in the art and can be employed in the practice of this aspect of the invention.
  • a method for detecting a 213P1F11 mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using a 213P1F11 polynucleotides as sense ' and antisense primers to amplify 213P1F11 cDNAs therein; and detecting the presence of the amplified 213P1F11 cDNA.
  • the sequence of the amplified 213P1F11 cDNA can be determined.
  • a method of detecting a 213P1F11 gene in a biological sample comprises first isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 213P1F11 polynucleotides as sense and antisense primers; and detecting the presence of the amplified 213P1F11 gene.
  • Any number of appropriate sense and antisense probe combinations can be designed from a 213P1F11 nucleotide sequence (see, e.g., Figure 2) and used for this purpose.
  • the invention also provides assays for detecting the presence of a 213P1F11 protein in a tissue or other biological sample such as serum, semen, bone, prostate, urine, cell preparations, and the like.
  • Methods for detecting a 213P 1F11-related protein are also well known and include, for example, immunoprecipitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA and the like.
  • a method of detecting the presence of a 213P1F11-related protein in a biological sample comprises first contacting the sample with a 213P1F11 antibody, a 213P1F11-reactive fragment thereof, or a recombinant protein containing an antigen binding region of a 213P1F11 antibody; and then detecting the binding of 213P IF 11-related protein in the sample.
  • an assay for identifying a cell that expresses a 213P1F11 gene comprises detecting the presence of 213P1F11 mRNA in the cell.
  • Methods for the detection of particular mRNAs in cells include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled 213P1F11 riboprobes, Northern blot and related techniques) and various nucleic acid amplification assays (such as RT-PCR using complementary primers specific for 213P1F11, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
  • an assay for identifying a cell that expresses a 213P1F11 gene comprises detecting the presence of 213P1F11-related protein • in the cell or secreted by the cell.
  • Various methods for the detection of proteins are well known in the art and are employed for the detection of 213P1F11-related proteins and cells that express 213P1F11-related proteins.
  • 213P1F11 expression analysis is also useful as a tool for identifying and evaluating agents that modulate 213P1F11 gene expression.
  • 213P1F11 expression is significantly upregulated in prostate cancer, and is expressed in cancers of the tissues listed in Table I.
  • Identification of a molecule or biological agent that inhibits 213P1F11 expression or over-expression in cancer cells is of therapeutic value.
  • such an agent can be identified by using a screen that quantifies 213P1F11 expression by RT-PCR, nucleic acid hybridization or antibody binding.
  • Oncogenesis is known to be a multistep process where cellular growth becomes progressively dysregulated and cells progress from a normal physiological state to precancerous and then cancerous states (see, e.g., Alers et al, Lab Invest. 77(5): 437-438 (1997) and Isaacs et al, Cancer Surv. 23: 19-32 (1995)).
  • examining a biological sample for evidence of dysregulated cell growth allows for early detection of such aberrant physiology, before a pathologic state such as cancer has progressed to a stage that therapeutic options are more limited and or the prognosis is worse.
  • the status of 213P1F11 in a biological sample of interest can be compared, for example, to the status of 213P1F11 in a corresponding normal sample (e.g. a sample from that individual or alternatively another individual that is not affected by a pathology).
  • a corresponding normal sample e.g. a sample from that individual or alternatively another individual that is not affected by a pathology.
  • An alteration in the status of 213P1F11 in the biological sample provides evidence of dysregulated cellular growth.
  • a predetermined normative value such as a predetermined normal level of mRNA expression (see, e.g., Grever et al, J. Comp. Neural. 1996 Dec 9; 376(2): 306-14 and U.S. Patent No. 5,837,501) to compare 213P1F11 status in a sample.
  • status in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products.
  • skilled artisans use a number of parameters to evaluate the condition or state of a gene and its products. These include, but are not limited to the location of expressed gene products (including the location of 213P1F11 expressing cells) as well as the level, and biological activity of expressed gene products (such as 213P1F11 mRNA, polynucleotides and polypeptides).
  • an alteration in the status of 213P1F11 comprises a change in the location of 213P1F11 and/or 213P1F11 expressing cells and/or an increase in 213P1F11 mRNA and/or protein expression.
  • 213P1F11 status in a sample can be analyzed by a number of means well known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro- dissected samples, Western blot analysis, and tissue array analysis.
  • Typical protocols for evaluating the status of a 213P1F11 gene and gene products are found, for example in Ausubel et al. eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis).
  • the status of 213P1F11 in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in a 213P1F11 gene), Northern analysis and/or PCR analysis of 213P1F11 mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of 213P1F11 mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in polypeptide localization within a sample, alterations in expression levels of 213P1F11 proteins and/or associations of 213P1F11 proteins with polypeptide binding partners).
  • genomic Southern analysis to examine, for example perturbations in a 213P1F11 gene
  • Northern analysis and/or PCR analysis of 213P1F11 mRNA to examine, for example alterations in the polynucleotide sequences or expression levels of 213P1F11 mRNAs
  • Detectable 213P1F11 polynucleotides include, for example, a 213P1F11 gene or fragment thereof, 213P1F11 mRNA, alternative splice variants, 213P1F11 mRNAs, and recombinant DNA or RNA molecules containing a 213P1F11 polynucleotide.
  • the expression profile of 213P1F11 makes it a diagnostic marker for local and/or metastasized disease, and provides information on the growth or oncogenic potential of a biological sample.
  • the status of 213P1F11 provides information useful for predicting susceptibility to particular disease stages, progression, and or tumor aggressiveness.
  • the invention provides methods and assays for deterrnining 213P1F11 status and diagnosing cancers that express 213P1F11, such as cancers of the tissues listed in Table I.
  • assays that evaluate the levels of 213P1F11 mRNA transcripts or proteins in a biological sample can be used to diagnose a disease associated with 213P1F11 dysregulation, and can provide prognostic information useful in defining appropriate therapeutic options.
  • the expression status of 213P1F11 provides information including the presence, stage and location of dysplastic, precancerous and cancerous cells, predicting susceptibility to various stages of disease, and/or for gauging tumor aggressiveness. Moreover, the expression profile makes it useful as an imaging reagent for metastasized disease. Consequently, an aspect of the invention is directed to the various molecular prognostic and diagnostic methods for examining the status of 213P1F11 in biological samples such as those from individuals suffering from, or suspected of suffering from a pathology characterized by dysregulated cellular growth, such as cancer.
  • the status of 213P1F11 in a biological sample can be examined by a number of well-known procedures in the art.
  • the status of 213P1F11 in a biological sample taken from a specific location in the body can be examined by evaluating the sample for the presence or absence of 213P1F11 expressing cells (e.g. those that express 213P1F11 mRNAs or proteins).
  • This examination can provide evidence of dysregulated cellular growth, for example, when 213P IF 11-expressing cells are found in a biological sample that does not normally contain such cells (such as a lymph node), because such alterations in the status of 213P1F11 in a biological sample are often associated with dysregulated cellular growth.
  • one indicator of dysregulated cellular growth is the metastases of cancer cells from an organ of origin (such as the prostate) to a different area of the body (such as a lymph node).
  • evidence of dysregulated cellular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with prostate cancer, and such metastases are associated with known predictors of disease progression (see, e.g., Murphy et al, Prostate 42(4): 315-317 (2000);Su et al, Semin. Surg. Oncol. 18(1): 17-28 (2000) and Freeman et al, J Urol 1995 Aug 154(2 Pt l):474-8).
  • the invention provides methods for monitoring 213P1F11 gene products by determining the status of 213P1F11 gene products expressed by cells from an individual suspected of having a disease associated with dysregulated cell growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of 213P1F11 gene products in a corresponding normal sample.
  • the presence of aberrant 213P1F11 gene products in the test sample relative to the normal sample provides an indication of the presence of dysregulated cell growth within the cells of the individual.
  • the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in 213P1F11 mRNA or protein expression in a test cell or tissue sample relative to expression levels in the corresponding normal cell or tissue.
  • the presence of 213P1F11 mRNA can, for example, be evaluated in tissues including but not limited to those listed in Table I.
  • the presence of significant 213P1F11 expression in any of these tissues is useful to indicate the emergence, presence and/or severity of a cancer, since the corresponding normal tissues do not express 213P1F11 mRNA or express it at lower levels.
  • 213P1F11 status is determined at the protein level rather than at the nucleic acid level.
  • a method comprises determining the level of 213P1F11 protein expressed by cells in a test tissue sample and comparing the level so determined to the level of 213P1F11 expressed in a corresponding normal sample.
  • the presence of 213P1F11 protein is evaluated, for example, using immunohistochemical methods.
  • 213P1F11 antibodies or binding partners capable of detecting 213P1F11 protein expression are used in a variety of assay formats well known in the art for this purpose.
  • perturbations can include insertions, deletions, substitutions and the like.
  • Such evaluations are useful because perturbations in the nucleotide and amino acid sequences are observed in a large number of proteins associated with a growth dysregulated phenotype (see, e.g., Marrogi et al, 1999, J. Cutan. Pathol. 26(8):369-378).
  • a mutation in the sequence of 213P 1 F 11 may be indicative of the presence or promotion of a tumor.
  • Such assays therefore have diagnostic and predictive value where a mutation in 213P1F11 indicates a potential loss of function or increase in tumor growth.
  • methylation status of a 213P1F11 gene in a biological sample. Aberrant demethylation and/or hypermethylation of CpG islands in gene 5' regulatory regions frequently occurs in immortalized and transformed cells, and can result in altered expression of various genes. For example, promoter hypermethylation of the pi-class glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al, Am. J. Pathol. 155(6): 1985-1992 (1999)).
  • methylation-sensitive restriction enzymes that cannot cleave sequences that contain methylated CpG sites to assess the methylation status of CpG islands.
  • MSP methylation specific PCR
  • MSP methylation specific PCR
  • This procedure involves initial modification of DNA by sodium bisulfite (which will convert all unmethylated cytosines to uracil) followed by amplification using primers specific for methylated versus unmethylated DNA. Protocols involving methylation interference can also be found for example in Current Protocols In Molecular Biology, Unit 12, Frederick M. Ausubel et al. eds., 1995.
  • Gene amplification is an additional method for assessing the status of 213P1F11.
  • Gene amplification is measured in a sample directly, for example, by conventional Southern blotting or Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies are employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn are labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Biopsied tissue or peripheral blood can be conveniently assayed for the presence of cancer cells using for example, Northern, dot blot or RT-PCR analysis to detect 213P1F11 expression.
  • the presence of RT-PCR amplifiable 213P1F11 mRNA provides an indication of the presence of cancer.
  • RT-PCR assays are well known in the art.
  • RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these include RT- PCR assays for the detection of cells expressing PSA and PSM (Verkaik et al, 1997, Urol. Res. 25:373-384; Ghossein et ⁇ /., 1995, J. Clin. Oncol. 13:1195-2000; Heston et al, 1995, Clin. Chem. 41 :1687-1688).
  • a further aspect of the invention is an assessment of the susceptibility that an individual has for developing cancer.
  • a method for predicting susceptibility to cancer comprises detecting 213P1F11 mRNA or 213P1F11 protein in a tissue sample, its presence indicating susceptibility to cancer, wherein the degree of 213P1F11 mRNA expression correlates to the degree of susceptibility.
  • the presence of 213P1F11 in prostate or other tissue is examined, with the presence of 213P1F11 in the sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor).
  • 213P IF 11 nucleotide and amino acid sequences in a biological sample, in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like.
  • the presence of one or more perturbations in 213P1F11 gene products in the sample is an indication of cancer susceptibility (or the emergence or existence of a tumor).
  • the invention also comprises methods for gauging tumor aggressiveness.
  • a method for gauging aggressiveness of a tumor comprises determining the level of 213P1F11 mRNA or 213P1F11 protein expressed by tumor cells, comparing the level so determined to the level of 213P1F11 mRNA or 213P1F11 protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of 213P1F11 mRNA or 213P1F11 protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.
  • aggressiveness of a tumor is evaluated by determining the extent to which 213P1F11 is expressed in the tumor cells, with higher expression levels indicating more aggressive tumors.
  • Another embodiment is the evaluation of the integrity of 213P1F11 nucleotide and amino acid sequences in a biological sample, in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like. The presence of one or more perturbations indicates more aggressive tumors.
  • methods for observing the progression of a malignancy in an individual over time comprise determining the level of 213P1F11 mRNA or 213P1F11 protein expressed by cells in a sample of the tumor, comparing the level so determined to the level of 213P1F11 mRNA or 213P1F11 protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of 213P1F11 mRNA or 213P1F11 protein expression in the tumor sample over time provides information on the progression of the cancer.
  • the progression of a cancer is evaluated by determining 213P1F11 expression in the tumor cells over time, where increased expression over time indicates a progression of the cancer. Also, one can evaluate the integrity 213P1F11 nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, where the presence of one or more perturbations indicates a progression of the cancer.
  • Another embodiment of the invention is directed to methods for observing a coincidence between the expression of 213P1F11 gene and 213P1F11 gene products (or perturbations in 213P1F11 gene and 213P1F11 gene products) and a factor that is associated with malignancy, as a means for diagnosing and prognosticating the status of a tissue sample.
  • factors associated with malignancy can be utilized, such as the expression of genes associated with malignancy (e.g.
  • Methods for observing a coincidence between the expression of 213P1F11 gene and 213P1F11 gene products (or perturbations in 213P1F11 gene and 213P1F11 gene products) and another factor that is associated with malignancy are useful, for example, because the presence of a set of specific factors that coincide with disease provides information crucial for diagnosing and prognosticating the status of a tissue sample.
  • methods for observing a coincidence between the expression of 213P1F11 gene and 213P1F11 gene products (or perturbations in 213P1F11 gene and 213P1F11 gene products) and another factor associated with malignancy entails detecting the overexpression of 213P1F11 mRNA or protein in a tissue sample, detecting the overexpression of PSA mRNA or protein in a tissue sample (or PSCA or PSM expression), and observing a coincidence of 213P1F11 mRNA or protein and PSA mRNA or protein overexpression (or PSCA or PSM expression).
  • the expression of 213P1F11 and PSA mRNA in prostate tissue is examined, where the coincidence of 213P1F11 and PSA mRNA overexpression in the sample indicates the existence of prostate cancer, prostate cancer susceptibility or the emergence or status of a prostate tumor.
  • Standard methods for the detection and quantification of 213P1F11 mRNA include in situ hybridization using labeled 213P1F11 riboprobes, Northern blot and related techniques using 213P1F11 polynucleotide probes, RT- PCR analysis using primers" specific for 213P1F11, and other amplification type detection methods, such as, for • example, branched DNA, SISBA, TMA and the like.
  • semi-quantitative RT-PCR is used to detect and quantify 213P1F11 mRNA expression.
  • Any number of primers capable of arr ⁇ lifying 213P1F11 can be used for this purpose, including but not limited to the various primer sets specifically described herein.
  • polyclonal or monoclonal antibodies specifically reactive with the wild-type 213P1F11 protein can be used in an immunohistochemical assay of biopsied tissue.
  • the 213P1F11 protein and nucleic acid sequences disclosed herein allow a skilled artisan to identify proteins, small molecules and other agents that interact with 213P1F11, as well as pathways activated by 213P1F11 via any one of a variety of art accepted protocols.
  • one can utilize one of the so-called interaction trap systems also referred to as the "two-hybrid assay".
  • molecules interact and reconstitute a transcription factor which directs expression of a reporter gene, whereupon the expression of the reporter gene is assayed.
  • Other systems identify protein-protein interactions in vivo through reconstitution of a eukaryotic transcriptional activator, see, e.g., U.S. Patent Nos.
  • peptide libraries can be screen peptide libraries to identify molecules that interact with 213P1F11 protein sequences.
  • peptides that bind to 213P1F11 are identified by screening libraries that encode a random or controlled collection of amino acids.
  • Peptides encoded by the libraries are expressed as fusion proteins of bacteriophage coat proteins, the bacteriophage particles are then screened against the 213PlFl l protein(s).
  • peptides having a wide variety of uses are thus identified without any prior information on the structure of the expected ligand or receptor molecule.
  • Typical peptide libraries and screening methods that can be used to identify molecules that interact with 213P1F11 protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 issued 3 March 1998 and 5,733,731 issued 31 March 1998.
  • cell lines that express 213P1F11 are used to identify protein-protein interactions mediated by 213P1F11. Such interactions can be examined using immunoprecipitation techniques (see, e.g., Hamilton B.J., et al Biochem. Biophys. Res. Commun. 1999, 261:646-51).
  • 213P1F11 protein can be immunoprecipitated from 213P1F11-expressing celllines using anti-213PlFl l antibodies.
  • antibodies against His-tag can be used in a cell line engineered to express fusions of213PlFl l and a His-tag (vectors mentioned above).
  • the immunoprecipitated complex can be examined for protein association by procedures such as Western blotting, 35 S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.
  • Small molecules and ligands that interact with 213P1F11 can be identified through related embodiments of such screening assays. For example, small molecules can be identified that interfere with protein function, including molecules that interfere with 213PlFl l's ability to mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA molecules as an indication of regulation of cell cycles, second messenger signaling or tumorigenesis.
  • small molecules that modulate 213P1F11-related ion channel, protein pump, or cell communication functions are identified and used to treat patients that have a cancer that expresses 213P1F11 (see, e.g., Hille, B., Ionic Channels of Excitable Membranes 2 nd Ed., Sinauer Assoc, Sunderland, MA, 1992).
  • ligands that regulate 213P1F11 function can be identified based on their ability to bind 213P1F11 and activate a reporter construct. Typical methods are discussed for example in U.S. Patent No. 5,928,868 issued 27 July 1999, and include methods for forming hybrid ligands in which at least one ligand is a small molecule.
  • cells engineered to express a fusion protein of 213P1F11 and a DNA-binding protein are used to co-express a fusion protein of a hybrid ligand/small molecule and a cDNA library transcriptional activator protein.
  • the cells further contain a reporter gene, the expression of which is conditioned on the proximity of the first and second fusion proteins to each other, an event that occurs only if the hybrid ligand binds to target sites on both hybrid proteins.
  • Those cells that express the reporter gene are selected and the unknown small molecule or the unknown ligand is identified. This method provides a means of identifying modulators which activate or inhibit 213P1F11.
  • An embodiment of this invention comprises a method of screening for a molecule that interacts with a 213PlFl l amino acid sequence shown in Figure 2 or Figure 3, comprising the steps of contacting a population of molecules with a 213P1F11 amino acid sequence, allowing the population of molecules and the 213P1F11 amino acid sequence to interact under conditions that facilitate an interaction, determining the presence of a molecule that interacts with the 213P1F11 amino acid sequence, and then separating molecules that do not interact with the 213P1F11 amino acid sequence from molecules that do.
  • the method further comprises purifying, characterizing and identifying a molecule that interacts with the 213P1F11 amino acid sequence.
  • the identified molecule can be used to modulate a function performed by 213P1F11.
  • the 213P1F11 amino acid sequence is contacted with a library of peptides.
  • 213P1F11 functions as a transcription factor involved in activating tumor-promoting genes or repressing genes that block tumorigenesis.
  • therapeutic approaches that inhibit the activity of a 213P1F11 protein are useful for patients suffering from a cancer that expresses 213P1F11.
  • These therapeutic approaches generally fall into two classes.
  • One class comprises various methods for inhibiting the binding or association of a 213P1F11 protein with its binding partner or with other proteins.
  • Another class comprises a variety of methods for inhibiting the transcription of a 213P1F11 gene or translation of 213P1F11 mRNA.
  • the invention provides cancer vaccines comprising a 213P1F11-related protein or 213P1F11-related nucleic acid.
  • cancer vaccines prevent and/or treat 213P1F11-expressing cancers with minimal or no effects on non-target tissues.
  • the use of a tumor antigen in a vaccine that generates humoral and or cell-mediated immune responses as anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al, 1995, Int. J. Cancer 63:231-237; Fong t ⁇ /., 1997, J. Immunol. 159:3113-3117).
  • Such methods can be readily practiced by employing a 213P1F11-related protein, or a 213PlFl l- encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the 213P1F11 immunogen (which typically comprises a number of antibody or T cell epitopes).
  • Skilled artisans understand that a wide variety of vaccine systems for delivery of immunoreactive epitopes are known in the art (see, e.g., Heryln et al, Ann Med 1999 Feb 31(l):66-78; Maruyama et al, Cancer Immunol Immunother 2000 Jun 49(3): 123-32) Briefly, such methods of generating an immune response (e.g.
  • a mammal's immune system comprises the steps of: exposing the mammal's immune system to an immunoreactive epitope (e.g. an epitope present in a 213P1F11 protein shown in Figure 3 or analog or homolog thereof) so that the mammal generates an immune response that is specific for that epitope (e.g. generates antibodies that specifically recognize that epitope).
  • an immunoreactive epitope e.g. an epitope present in a 213P1F11 protein shown in Figure 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 213P1F11 protein shown in Figure 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 213P1F11 protein shown in Figure 3 or analog or homolog thereof
  • Such vaccine compositions can include, for example, lipopeptides (e.g.Nitiello, A. et al, J. Clin. Invest. 95:341, 1995), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG”) microspheres ⁇ see, e.g., Eldridge, et al, Molec. Immunol.
  • lipopeptides e.g.Nitiello, A. et al, J. Clin. Invest. 95:341, 1995
  • PLG poly(DL-lactide-co-glycolide)
  • Toxin-targeted delivery technologies also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
  • the vaccine compositions of the invention can also be used in conjunction with other treatments used for cancer, e.g., surgery, chemotherapy, drug therapies, radiation therapies, etc. including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, and the, like.
  • CTL epitopes can be determined using specific algorithms to identify peptides within 213P1F11 protein that bind corresponding HLA alleles (see e.g., Table IV; EpimerTM and EpimatrixTM, Brown University (located at the World Wide Web .brown.edu/Research/ITi-HIV_Lab/epimatrix/epiimtrix.htrnl); and, BIMAS, (URL bimas.dcrt.nih.gov/; SYFPEITHI at URL sy ⁇ eithi.bmi-heidelberg.com/).
  • a 213P1F11 immunogen contains one or more amino acid sequences identified using techniques well known in the art, such as the sequences shown in Tables V-XIX, or a peptide of 8, 9, 10 or 11 amino acids specified by an HLA Class I motif/supermotif (e.g., Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA Class II motif/supermotif (e.g., Table IV (B) or Table IV (C)).
  • HLA Class I motif/supermotif e.g., Table IV (A), Table IV (D), or Table IV (E)
  • HLA Class II motif/supermotif e.g., Table IV (B) or Table IV (C)
  • the HLA Class I binding groove is essentially closed ended so that peptides of only a particular size range can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11 amino acids long.
  • the HLA Class II binding groove is essentially open ended; therefore a peptide of about 9 or more amino acids can be bound by an HLA Class II molecule. Due to the binding groove differences between HLA Class I and II, HLA Class I motifs are length specific, i.e., position two of a Class I motif is the second amino acid in an amino to carboxyl direction of the peptide.
  • HLA Class II epitopes are often 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino acids.
  • Methods of generating an immune response in a mammal comprise exposing the mammal's immune system to an immunogenic epitope on a protein (e.g. a 213P1F11 protein) so that an immune response is generated.
  • a protein e.g. a 213P1F11 protein
  • a typical embodiment consists of a method for generating an immune response to 213PlFl l in a host, by contacting the host with a sufficient amount of at least one 213P1F11 B cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic interval thereafter re-contacting the host with the 213P1F11 B cell or cytotoxic T-cell epitope or analog thereof.
  • a specific embodiment consists of a method of generating an immune response against a 213P IF 11-related protein or a man-made multiepitopic peptide comprising: administering 213P1F11 immunogen (e.g.
  • a 213P1F11 protein or a peptide fragment thereof, a 213P1F11 fusion protein or analog etc. in a vaccine preparation to a human or another mammal.
  • vaccine preparations further contain a suitable adjuvant (see, e.g., U.S. Patent No. 6, 146,635) or a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see, e.g., Alexander et al, J. Immunol. 2000 164(3); 164(3): 1625-1633; Alexander et al, Immunity 1994 1(9): 751-761 and Alexander et al, Immunol. Res. 1998 18(2): 79-92).
  • a suitable adjuvant see, e.g., U.S. Patent No. 6, 146,635
  • a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see
  • An alternative method comprises generating an immune response in an individual against a 213PlFl l immunogen by: administering in vivo to muscle or skin of the individual's body a DNA molecule that comprises a DNA sequence that encodes a 213PlFl l immunogen, the DNA sequence operatively linked to regulatory sequences which control the expression of the DNA sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is expressed in the cells and an immune response is generated against the immunogen (see, e.g., U.S. Patent No. 5,962,428).
  • a genetic vaccine facilitator such as anionic lipids; saponins; lectins; estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also administered.
  • an antiidiotypic antibody can be administered that mimics 213P1F11, in order to generate a response to the target antigen.
  • Vaccine compositions of the invention include nucleic acid-mediated modalities.
  • DNA or RNA that encode ⁇ rotein(s) of the invention can be administered to a patient.
  • Genetic immunization methods can be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing 213P1F11.
  • Constructs comprising DNA encoding a 213P1F11-related protein/immunogen and appropriate regulatory sequences can be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded 213P1F11 protein/immunogen.
  • a vaccine comprises a 213P1F11-related protein.
  • 213P1F11-related protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against cells that bear a 213P1F11 protein.
  • Various prophylactic and therapeutic genetic immunization techniques known in the art can be used (for review, see information and references published at Internet address located at the World Wide Web .genweb.com). Nucleic acid-based delivery is described, for instance, in Wolff et. al, Science 247:1465 (1990) as well as U.S. Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720.
  • DNA-based delivery technologies include "naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun”) or pressure-mediated delivery (see, e.g., U.S. Patent No. 5,922,687).
  • proteins of the invention can be expressed via viral or bacterial vectors.
  • viral gene delivery systems that can be used in the practice of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno- associated virus, lentivirus, and Sindbis virus (see, e.g., Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al J. Natl. Cancer Inst. 87:982-990 (1995)).
  • Non-viral delivery systems can also be employed by introducing naked DNA encoding a 213P1F11-related protein into the patient (e.g., intramuscularly or inrradermally) to induce an anti-tumor response.
  • Vaccinia virus is used, for example, as a vector to express nucleotide sequences that encode the peptides of the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the protein immunogenic peptide, and thereby elicits a host immune response.
  • Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No. 4,722,848.
  • Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover et al, Nature 351:456-460 (1991).
  • BCG vectors are described in Stover et al, Nature 351:456-460 (1991).
  • a wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention e.g. adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax to
  • gene delivery systems are used to deliver a 213P1F11-related nucleic acid molecule.
  • the full-length human 213P1F11 cDNA is employed.
  • 213P1F11 nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) and/or antibody epitopes are employed.
  • APCs antigen presenting cells
  • DC dendritic cells
  • DRCs antigen presenting cells
  • DRCs dendritic cells
  • MHC class I and II molecules MHC class I and II molecules
  • B7 co-stimulator B7 co-stimulator
  • IL-12 IL-12
  • PSMA prostate-specific membrane antigen
  • dendritic cells can be used to present 213P1F11 peptides to T cells in the context of MHC class I or II molecules.
  • autologous dendritic cells are pulsed with 213P1F11 peptides capable of binding to MHC class I and/or class II molecules.
  • dendritic cells are pulsed with the complete 213P1F11 protein.
  • Yet another embodiment involves engineering the overexpression of a 213P1F11 gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al, 1997, Cancer Gene Ther. 4:17-25), retrovirus (Henderson et al, 1996, Cancer Res.
  • Cells that express 213P1F11 can also be engineered to express immune modulators, such as GM-CSF, and used as immunizing agents.
  • 213P1 FI 1 as a Target for Antibody-based Therapy 213P1F11 is an attractive target for antibody-based therapeutic strategies.
  • a number of antibody strategies are known in the art for targeting both extracellular and intracellular molecules (see, e.g., complement and ADCC mediated killing as well as the use of intrabodies).
  • 213P IF 11 is expressed by cancer cells of various lineages relative to corresponding normal cells, systemic adrninistration of 213P IF 11 -immunoreactive compositions are prepared that exhibit excellent sensitivity without toxic, nonspecific and/or non-target effects caused by binding of the immunoreactive composition to non-target organs and tissues.
  • Antibodies specifically reactive with domains of 213P1F11 are useful to treat 213P1F11- expressing cancers systemically, either as conjugates with a toxin or therapeutic agent, or as naked antibodies capable of inhibiting cell proliferation or function.
  • 213P1F11 antibodies can be introduced into a patient such that the antibody binds to 213P1F11 and modulates a function, such as an interaction with a binding partner, and consequently mediates destruction of the tumor cells and/or inhibits the growth of the tumor cells.
  • Mechanisms by which such antibodies exert a therapeutic effect can include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation of the physiological function of 213P1F11, inhibition of ligand binding or signal transduction pathways, modulation of tumor cell differentiation, alteration of tumor angiogenesis factor profiles, and/or apoptosis.
  • antibodies can be used to specifically target and bind immunogenic molecules such as an immunogenic region ofa 213PlFl l sequence shown in Figure 2 or Figure 3.
  • cytotoxic agents see, e.g., Slevers et al. Blood 93:11 3678-3684 (June 1, 1999)
  • cytotoxic and/or therapeutic agents When cytotoxic and/or therapeutic agents are delivered directly to cells, such as by conjugating them to antibodies specific for a molecule expressed by that cell (e.g. 213P1F11), the cytotoxic agent will exert its known biological effect (i.e. cytotoxicity) on those cells.
  • compositions and methods for using antibody-cytotoxic agent conjugates to kill cells are known in the art.
  • typical methods entail administering to an animal having a tumor a biologically effective amount of a conjugate comprising a selected cytotoxic and/or therapeutic agent linked to a targeting agent (e.g. an anti-213PlFl 1 antibody) that binds to a marker (e.g. 213P1F11) expressed, accessible to binding or localized on the cell surfaces.
  • a targeting agent e.g. an anti-213PlFl 1 antibody
  • a marker e.g. 213P1F11
  • a typical embodiment is a method of delivering a cytotoxic and/or therapeutic agent to a cell expressing 213P1F11, comprising conjugating the cytotoxic agent to an antibody that immunospecifically binds to a 213PlFl l epitope, and, exposing the cell to the antibody-agent conjugate.
  • Another illustrative embodiment is a method of treating an individual suspected of suffering from metastasized cancer, comprising a step of administering parenterally to said individual a pharmaceutical composition comprising a therapeutically effective amount of an antibody conjugated to a cytotoxic and/or therapeutic agent.
  • Cancer immunotherapy using anti-213PlFll antibodies can be done in accordance with various approaches that have been successfully employed in the treatment of other types of cancer, including but not limited to colon cancer (Arlen et al, 1998, Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki et al, 1997, Blood 90:3179-3186, Tsunenari et al, 1997, Blood 90:2437-2444), gastric cancer (Kasprzyk et al, 1992, Cancer Res. 52:2771-2776), B-cell lymphoma (Funakoshi et al, 1996, J. Immunother. Emphasis Tumor Immunol.
  • Some therapeutic approaches involve conjugation of naked antibody to a toxin or radioisotope, such as the conjugation of Y 91 or I 131 to anti-CD20 antibodies (e.g., ZevalinTM, IDEC Pharmaceuticals Corp.
  • antibodies can be conjugated to a therapeutic agent.
  • 213P1F11 antibodies can be administered in conjunction with radiation, chemotherapy or hormone ablation.
  • antibodies can be conjugated to a toxin such as calicheamicin (e.g., MylotargTM, Wyeth- Ayerst, Madison, NJ, a recombinant humanized IgG kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, MA, also see e.g., US Patent 5,416,064).
  • a toxin such as calicheamicin (e.g., MylotargTM, Wyeth- Ayerst, Madison, NJ, a recombinant humanized IgG kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, MA, also see e.g., US Patent 5,41
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers.
  • Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy.
  • antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment.
  • antibody therapy can enable .the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the • chemotherapeutic agent very well.
  • Fan et al. (Cancer Res. 53:4637-4642, 1993), Prewett et al. (International J. of Onco. 9:217-224, 1996), and Hancock et al. (Cancer Res. 51:4575-4580, 1991) describe the use of various antibodies together with chemotherapeutic agents.
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy. Alternatively, antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment. Additionally, antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well.
  • Cancer patients can be evaluated for the presence and level of213PlFll expression, preferably using immunohistochemical assessments of tumor tissue, quantitative 213P1F11 imaging, or other techniques that reliably indicate the presence and degree of 213P1F11 expression. Immunohistochemical analysis of tumor biopsies or surgical specimens is preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are well known in the art.
  • Anti-213P1F11 monoclonal antibodies that treat prostate and other cancers include those that initiate a potent immune response against the tumor or those that are directly cytotoxic.
  • anti-213PlFl 1 monoclonal antibodies mAbs
  • ADCC antibody-dependent cell cytotoxicity
  • anti-213PlFl 1 mAbs that exert a direct biological effect on tumor growth are useful to treat cancers that express 213P1F11.
  • Mechanisms by which directly cytotoxic mAbs act include: inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the induction of apoptosis.
  • the mechanism(s) by which a particular anti-213PlFl 1 mAb exerts an anti-tumor effect is evaluated using any number of in vitro assays that evaluate cell death such as ADCC, ADMMC, complement- mediated cell lysis, and so forth, as is generally known in the art.
  • preferred monoclonal antibodies used in the therapeutic methods of the invention are those that are either fully human or humanized and that bind specifically to the target 213P1F11 antigen with high affinity but exhibit low or no antigenicity in the patient.
  • Therapeutic methods of the invention contemplate the administration of single anti-213PlFl 1 mAbs as well as combinations, or cocktails, of different mAbs.
  • Such mAb cocktails can have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality. Such mAbs in combination can exhibit synergistic therapeutic effects.
  • anti-213PlFl 1 mAbs can be administered concomitantly with other therapeutic modalities, including but not limited to various chemotherapeutic agents, androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery or radiation.
  • the anti-213PlFl 1 mAbs are administered in their "naked" or unconjugated form, or can have a therapeutic agent(s) conjugated to them.
  • Anti-213P1F11 antibody formulations are administered via any route capable of delivering the antibodies to a tumor cell.
  • Routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and the like.
  • Treatment generally involves repeated administration of the anti-213PlFl 1 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1, .2, .3, .4, .5, .6, .7, .8, .9., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-1000 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti-213PlFl 1 mAb preparation represents an acceptable dosing regimen.
  • the initial loading dose is administered as a 90 minute or longer infusion.
  • the periodic maintenance dose is administered as a 30 minute or longer infusion, provided the initial dose was well tolerated.
  • various factors can influence the ideal dose regimen in a particular case.
  • Such factors include, for example, the binding affinity and half life of the Ab or mAbs used, the degree of 213P1F11 expression in the patient, the extent of circulating shed 213P1F11 antigen, the desired steady-state antibody concenfration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • patients should be evaluated for the levels of 213P1F11 in a given sample (e.g. the levels of circulating 213P1F11 antigen and or 213P1F11 expressing cells) in order to assist in the determination of the most effective dosing regimen, etc.
  • levels of 213P1F11 in a given sample e.g. the levels of circulating 213P1F11 antigen and or 213P1F11 expressing cells
  • Such evaluations are also used for monitoring purposes throughout therapy, and are useful to gauge therapeutic success in combination with the evaluation of other parameters (for example, urine cytology and/or ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in prostate cancer therapy).
  • Anti-idiotypic anti-213PlFl 1 antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a 213P1F11-related protein.
  • the generation of anti-idiotypic antibodies is well known in the art; this methodology can readily be adapted to generate antiidiotypic anti-213PlFl 1 antibodies that mimic an epitope on a 213P1F11-related protein (see, for example, Wagner et al, 1997, Hybridoma 16: 33-40; Foon et al, 1995, J. Clin. Invest. 96:334-342; Herlyn et al, 1996, Cancer Immunol. Immunother. 43:65-76).
  • Such an anti-idiotypic antibody can be used in cancer vaccine strategies.
  • Vaccines and methods of preparing vaccines that contain an immunogenically effective amount of one or more HLA-binding peptides as described herein are further embodiments of the invention.
  • vaccines in accordance with the invention encompass compositions of one or more of the claimed peptides.
  • a peptide can be present in a vaccine individually.
  • the peptide can exist as a homopolymer comprising multiple copies of the same peptide, or as a heteropolymer of various peptides.
  • Polymers have the advantage of increased immunological reaction and, where different peptide epitopes are used to make up the polymer, the additional ability to induce antibodies and/or CTLs that react with different antigenic determinants of the pathogenic organism or tumor-related peptide targeted for an immune response.
  • the composition can be a naturally occurring region of an antigen or can be prepared, e.g., recombinantly or by chemical synthesis.
  • Carriers that can be used with vaccines of the invention are well known in the art, and include, e.g., thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly L-lysine, poly L-glutamic acid, influenza, hepatitis B virus core protein, and the like.
  • the vaccines can contain a physiologically tolerable (i.e., acceptable) diluent such as water, or saline, preferably phosphate buffered saline.
  • the vaccines also typically include an adjuvant.
  • Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Additionally, as disclosed herein, CTL responses can be primed by conjugating peptides of the invention to lipids, such as tripalmitoyl-S-glycerylcysteinlyseryl- serine (P 3 CSS). Moreover, an adjuvant such as a synthetic cytosme-phosphorothiolated-guanine-containing (CpG) oligonucleotides has been found to increase CTL responses 10- to 100-fold, (see, e.g. Davila and Celis, J. Immunol. 165:539-547 (2000))
  • the immune system of the host Upon immunization with a peptide composition in accordance with the invention, via injection, aerosol, oral, transdermal, transmucosal, intrapleural, inttathecal, or other suitable routes, the immune system of the host responds to the vaccine by producing large amounts of CTLs and/or HTLs specific for the desired antigen. Consequently, the host becomes at least partially immune to later development of cells that express or overexpress 213P1F11 antigen, or derives at least some therapeutic benefit when the antigen was tumor- associated.
  • class I peptide components may be desirable to combine with components that induce or facilitate neutralizing antibody and or helper T cell responses directed to the target antigen.
  • a preferred embodiment of such a composition comprises class I and class II epitopes in accordance with the invention.
  • An alternative embodiment of such a composition comprises a class I and/or class II epitope in accordance with the invention, along with a cross reactive HTL epitope such as PADRETM (Epimmune, San Diego, CA) molecule (described e.g., in U.S. Patent Number 5,736,142).
  • a vaccine of the invention can also include antigen-presenting cells (APC), such as dendritic cells (DC), as a vehicle to present peptides of the invention.
  • APC antigen-presenting cells
  • DC dendritic cells
  • Vaccine compositions can be created in vitro, following dendritic cell mobilization and harvesting, whereby loading of dendritic cells occurs in vitro.
  • dendritic cells are fransfected, e.g., with a minigene in accordance with the invention, or are pulsed with peptides.
  • the dendritic cell can then be administered to a patient to elicit immune responses in vivo.
  • Vaccine compositions either DNA- or peptide-based, can also be administered in vivo in combination with dendritic cell mobilization whereby loading of dendritic cells occurs in vivo.
  • the following principles are utilized when selecting an array of epitopes for inclusion in a polyepitopic composition for use in a vaccine, or for selecting discrete epitopes to be included in a vaccine and/or to be encoded by nucleic acids such as a minigene. It is preferred that each of the following principles be balanced in order to make the selection.
  • the multiple epitopes to be incorporated in a given vaccine composition may be, but need not be, contiguous in sequence in the native antigen from which the epitopes are derived.
  • Epitopes are selected which, upon administration, mimic immune responses that have been observed to be correlated with tumor clearance.
  • this includes 3-4 epitopes that come from at least one tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • HLA Class II a similar rationale is employed; again 3-4 epitopes are selected from at least one TAA (see, e.g., Rosenberg et al, Science 278:1447-1450).
  • Epitopes from one TAA may be used in combination with epitopes from one or more additional TAAs to produce a vaccine that targets tumors with varying expression patterns of frequently-expressed TAAs.
  • Epitopes are selected that have the requisite binding affinity established to be correlated with immunogenicity: for HLA Class I an IC 50 of 500 nM or less, often 200 nM or less; and for Class II an ICjo of 1000 nM or less.
  • Sufficient supermotif bearing-peptides, or a sufficient array of allele-specific motif-bearing peptides, are selected to give broad population coverage. For example, it is preferable to have at least 80% population coverage.
  • a Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess the breadth, or redundancy of, population coverage.
  • nested epitopes are epitopes referred to as "nested epitopes.” Nested epitopes occur where at least two epitopes overlap in a given peptide sequence.
  • a nested peptide sequence can comprise B cell, HLA class I and/or HLA class II epitopes.
  • a general objective is to provide the greatest number of epitopes per sequence.
  • an aspect is to avoid providing a peptide that is any longer than the amino terminus of the amino terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide.
  • a polyepitopic protein is created, or when creating a minigene, an objective is to generate the smallest peptide that encompasses the epitopes of interest. This principle is similar, if not the same as that employed when selecting a peptide comprising nested epitopes. However, with an artificial polyepitopic peptide, the size minimization objective is balanced against the need to integrate any spacer sequences between epitopes in the polyepitopic protein.
  • Spacer amino acid residues can, for example, be introduced to avoid junctional epitopes (an epitope recognized by the immune system, not present in the target antigen, and only created by the man-made juxtaposition of epitopes), or to facilitate cleavage between epitopes and thereby enhance epitope presentation.
  • Junctional epitopes are generally to be avoided because the recipient may generate an immune response to that non-native epitope. Of particular concern is a junctional epitope that is a "dominant epitope.” A dominant epitope may lead to such a zealous response that immune responses to other epitopes are diminished or suppressed.
  • potential peptide epitopes can also be selected on the basis of their conservancy.
  • a criterion for conservancy may define that the entire sequence of an HLA class I binding peptide or the entire 9-mer core of a class II binding peptide be conserved in a designated percentage of the sequences evaluated for a specific protein antigen.
  • Nucleic acids encoding the peptides of the invention are a particularly useful embodiment of the invention. Epitopes for inclusion in a minigene are preferably selected according to the guidelines set forth in the previous section.
  • a preferred means of administering nucleic acids encoding the peptides of the invention uses minigene constructs encoding a peptide comprising one or multiple epitopes of the invention.
  • a multi-epitope DNA plasmid encoding supermotif- and or motif-bearing epitopes derived 213P1F11, the PADRE® universal helper T cell epitope or multiple HTL epitopes from 213P IF 11 (see e.g., Tables V-XIX), and an endoplasmic reticulum-franslocating signal sequence can be engineered.
  • a vaccine may also comprise epitopes that are derived from other TAAs.
  • the immunogenicity of a multi-epitopic minigene can be confirmed in transgenic mice to evaluate the magnitude of CTL induction responses against the epitopes tested. Further, the immunogenicity of DNA- encoded epitopes in vivo can be correlated with the in vitro responses of specific CTL lines against target cells fransfected with the DNA plasmid. Thus, these experiments can show that the minigene serves to both: 1.) generate a CTL response and 2.) that the induced CTLs recognized cells expressing the encoded epitopes.
  • the amino acid sequences of the epitopes may be reverse translated.
  • a human codon usage table can be used to guide the codon choice for each amino acid.
  • These epitope-encoding DNA sequences may be directly adjoined, so that when translated, a continuous polypeptide sequence is created.
  • additional elements can be incorporated into the minigene design. Examples of amino acid sequences that can be reverse translated and included in the minigene sequence include: HLA class I epitopes, HLA class II epitopes, ' antibody epitopes, a ubiquitination signal sequence, and/or an endoplasmic reticulum targeting signal.
  • HLA presentation of CTL and HTL epitopes may be improved by including synthetic (e.g. poly-alanine) or naturally-occurring flanking sequences adjacent to the CTL or HTL epitopes; these larger peptides comprising the epitope(s) are within the scope of the invention.
  • the minigene sequence may be converted to DNA by assembling oligonucleotides that encode the plus and minus strands of the minigene. Overlapping oligonucleotides (30-100 bases long) may be synthesized, phosphorylated, purified and annealed under appropriate conditions using well known techniques. The ends of the oligonucleotides can be joined, for example, using T4 DNA ligase. This synthetic minigene, encoding the epitope polypeptide, can then be cloned into a desired expression vector.
  • Standard regulatory sequences well known to those of skill in the art are preferably included in the vector to ensure expression in the target cells.
  • a promoter with a downstream cloning site for minigene insertion a polyadenylation signal for efficient transcription termination; an E. coli origin of replication; and an E. coli selectable marker (e.g. ampicillin or kanamycin resistance).
  • Numerous promoters can be used for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, e.g., U.S. Patent Nos. 5,580,859 and 5,589,466 for other suitable promoter sequences.
  • introns are required for efficient gene expression, and one or more synthetic or naturally-occurring introns could be incorporated into the transcribed region of the minigene.
  • mRNA stabilization sequences and sequences for replication in mammalian cells may also be considered for increasing minigene expression.
  • the minigene is cloned into the polylinker region downstream of the promoter.
  • This plasmid is transformed into an appropriate E. coli strain, and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements included in the vector, are confirmed using restriction mapping and DNA sequence analysis. Bacterial cells harboring the correct plasmid can be stored as a master cell bank and a working cell bank.
  • immunostimulatory sequences appear to play a role in the immunogenicity of DNA vaccines. These sequences may be included in the vector, outside the minigene coding sequence, if desired to enhance immunogenicity.
  • a bi-cistronic expression vector which allows production of both the minigene-encoded epitopes and a second protein (included to enhance or decrease immunogenicity) can be used.
  • proteins or polypeptides that could beneficially enhance the immune response if co- expressed include cytokines (e.g., IL-2, IL-12, GM-CSF), cytokine-inducing molecules (e.g., LeIF), costimulatory molecules, or for HTL responses, pan-DR binding proteins (PADRETM, Epimmune, San Diego, CA).
  • Helper (HTL) epitopes can be joined to intracellular targeting signals and expressed separately from expressed CTL epitopes; this allows direction of the HTL epitopes to a cell compartment different than that of the CTL epitopes. If required, this could facilitate more efficient entry of HTL epitopes into the HLA class II pathway, thereby improving HTL induction.
  • immunosuppressive molecules e.g. TGF- ⁇
  • Therapeutic quantities of plasmid DNA can be produced for example, by fermentation in E. coli, followed by purification.
  • Plasmid DNA can be purified using standard bioseparation technologies such as solid phase anion-exchange resins supplied by QIAGEN, Inc. (Valencia, California). If required, supercoiled DNA can be isolated from the open circular and linear forms using gel electrophoresis or other methods.
  • Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS). This approach, known as "naked DNA,” is currently being used for intramuscular (IM) administration in clinical trials. To maximize the immunotherapeutic effects of minigene DNA vaccines, an alternative method for formulating purified plasmid DNA may be desirable. A variety of methods have been described, and new techniques may become available.
  • Cationic lipids, glycolipids, and fusogenic liposomes can also be used in the formulation (see, e.g., as described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682 (1988); U.S. Pat No. 5,279,833; WO 91/06309; and Feigner, et al, Proc. NaflAcad. Sci. USA 84:7413 (1987).
  • peptides and compounds referred to collectively as protective, interactive, non-condensing compounds could also be complexed to purified plasmiiDNA to influence variables such as stability, intramuscular dispersion, or trafficking to specific organs or cell types.
  • Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of minigene-encoded CTL epitopes.
  • the plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays.
  • the transfection method used will be dependent on the final formulation. Electroporation can be used for "naked" DNA, whereas cationic lipids allow direct in vitro transfection.
  • a plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of transfected cells using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • HTL epitopes are then chromium-51 ( 51 Cr) labeled and used as target cells for epitope-specific CTL lines; cytolysis, detected by 51 Cr release, indicates both production of, and HLA presentation of, minigene- encoded CTL epitopes. Expression of HTL epitopes may be evaluated in an analogous manner using assays to assess HTL activity.
  • 51 Cr chromium-51
  • In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations.
  • Transgenic mice expressing appropriate human HLA proteins are immunized with the DNA product.
  • the dose and route of administration are formulation dependent (e.g., IM for DNA in PBS, intraperitoneal (i.p.) for lipid-complexed DNA).
  • Twenty-one days after immunization splenocytes are harvested and restimulated for one week in the presence of peptides encoding each epitope being tested. Thereafter, for CTL effector cells, assays are conducted for cytolysis of peptide-loaded, 51 Cr-labeled target cells using standard techniques.
  • Lysis of target cells that were sensitized by HLA loaded with peptide epitopes, corresponding to minigene- encoded epitopes, demonstrates DNA vaccine function for in vivo induction of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic mice in an analogous manner.
  • nucleic acids can be administered using ballistic delivery as described, for instance, in U.S. Patent No. 5,204,253.
  • particles comprised solely of DNA are administered.
  • DNA can be adhered to particles, such as gold particles.
  • Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art, e.g., an expression construct encoding epitopes of the invention can be incorporated into a viral vector such as vaccinia.
  • Vaccine compositions comprising CTL peptides of the invention can be modified, e.g., analoged, to provide desired attributes, such as improved serum half life, broadened population coverage or enhanced immunogenicity.
  • the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence which contains at least one epitope that is capable of inducing a T helper cell response.
  • a CTL peptide can be directly linked to a T helper peptide, often CTL epitope/HTL epitope conjugates are linked by a spacer molecule.
  • the spacer is typically comprised of relatively small, neutral molecules, such as amino acids or amino acid mimetics, which are substantially uncharged under physiological conditions.
  • the spacers are typically selected from, e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or neutral polar amino acids.
  • the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo-oligomer. When present, the spacer will usually be at least one or two residues, more usually three to six residues and sometimes 10 or more residues.
  • the CTL peptide epitope can be linked to the T helper peptide epitope either directly or via a spacer either at the amino or carboxy terminus of the CTL peptide.
  • the amino terminus of either the immunogenic peptide or the T helper peptide may be acylated.
  • the T helper peptide is one that is recognized by T helper cells present in a majority of a genetically diverse population. This can be accomplished by selecting peptides that bind to many, most, or all of the HLA class II molecules.
  • Examples of such amino acid bind many HLA Class II molecules include sequences from antigens such as tetanus toxoid at positions 830-843 (QYIKANSKFIGITE; SEQ ID NO: 38), Plasmodium falciparum circumsporozoite (CS) protein at positions 378-398 (DIEKKIAKMEKASSVFNVVNS; SEQ ID NO: 39), and Streptococcus 18kD protein at positions 116-131 (GAVDSILGGVATYGAA; SEQ ID NO: 40).
  • Other examples include peptides bearing a DR 1-4-7 supermotif, or either of the DR3 motifs.
  • An alternative of a pan-DR binding epitope comprises all "L” natural amino acids and can be provided in the form of nucleic acids that encode the epitope.
  • HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified to include D-amino acids to increase their resistance to proteases and thus extend their serum half life, or they can be conjugated to other molecules such as lipids, proteins, carbohydrates, and the like to increase their biological activity.
  • a T helper peptide can be conjugated to one or more palmitic acid chains at either the amino or carboxyl termini.
  • compositions of the invention at least one component which primes B lymphocytes or T lymphocytes.
  • Lipids have been identified as agents capable of priming CTL in vivo.
  • palmitic acid residues can be attached to the ⁇ -and ⁇ - amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide.
  • the lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant.
  • a particularly effective immunogenic composition comprises palmitic acid attached to ⁇ - and ⁇ - amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.
  • E. coli lipoproteins such as tripalmitoyl-S- glycerylcysteinlyseryl- serine (P 3 CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, et al, Nature 342:561, 1989).
  • Peptides of the invention can be coupled to P 3 CSS, for example, and the lipopeptide administered to an individual to specifically prime an immune response to the target antigen.
  • P 3 CSS-conjugated epitopes two such compositions can be combined to more effectively elicit both humoral and cell-mediated responses.
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • An embodiment of a vaccine composition in accordance with the invention comprises ex vivo administration of a cocktail of epitope-bearing peptides to PBMC, or isolated DC therefrom, from the patient's blood.
  • a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Pharmacia-Monsanto, St. Louis, MO) or GM-CSF/IL-4. After pulsing the DC with peptides and prior to reinfusion into patients, the DC are washed to remove unbound peptides.
  • a vaccine comprises peptide-pulsed DCs which present the pulsed peptide epitopes complexed with HLA molecules on their surfaces.
  • the DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate CTL responses to 213P1F11.
  • a helper T cell (HTL) peptide such as a natural or artificial loosely restricted HLA Class II peptide, can be included to facilitate the CTL response.
  • HTL helper T cell
  • a vaccine in accordance with the invention is used to treat a cancer which expresses or overexpresses 213P1F11.
  • Antigenic 213P1F11 -related peptides are used to elicit a CTL and/or HTL response ex vivo, as well.
  • the resulting CTL or HTL cells can be used to treat tumors in patients that do not respond to other conventional forms of therapy, or will not respond to a therapeutic vaccine peptide or nucleic acid in accordance with the invention.
  • Ex vivo CTL or HTL responses to a particular antigen are induced by incubating in tissue culture the patient's, or genetically compatible, CTL or HTL precursor cells together with a source of antigen-presenting cells (APC), such as dendritic cells, and the appropriate immunogenic peptide.
  • APC antigen-presenting cells
  • the cells After an appropriate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded into effector cells, the cells are infused back into the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their specific target cell (e.g., a tumor cell).
  • CTL destroy
  • HTL facilitate destruction
  • Transfected dendritic cells may also be used as antigen presenting cells.
  • compositions of the invention are typically used to treat and/or prevent a cancer that expresses or overexpresses 213P1F11.
  • peptide and/or nucleic acid compositions are administered to a patient in an amount sufficient to elicit an effective B cell, CTL and/or HTL response to the antigen and to cure or at least partially arrest or slow symptoms and/or complications.
  • An amount adequate to accomplish this is defined as "therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician.
  • the immunogenic peptides of the invention are generally administered to an individual already bearing a tumor that expresses 213P1F11.
  • the peptides or DNA encoding them can be administered individually or as fusions of one or more peptide sequences.
  • Patients can be treated with the immunogenic peptides separately or in conjunction with other treatments, such as surgery, as appropriate.
  • administration should generally begin at the first diagnosis of213PlFl l- associated cancer. This is followed by boosting doses until at least symptoms are substantially abated and for a period thereafter.
  • the embodiment of the vaccine composition i.e., including, but not limited to embodiments such as peptide cocktails, polyepitopic polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells
  • delivered to the patient may vary according to the stage of the disease or the patient's health status. For example, in a patient with a tumor that expresses 213P1F11, a vaccine comprising 213P IF 11 -specific CTL may be more efficacious in killing tumor cells in patient with advanced disease than alternative embodiments.
  • compositions which stimulate helper T cell responses can also be given in accordance with this embodiment of the invention.
  • the dosage for an initial therapeutic immunization generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1,000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient.
  • Boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide pursuant to a boosting regimen over weeks to months may be administered depending upon the patient's response and condition as determined by measuring the specific activity of CTL and HTL obtained from the patient's blood. Administration should continue until at least clinical symptoms or laboratory tests indicate that the neoplasia, has been eliminated or reduced and for a period thereafter.
  • the dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.
  • the peptides and compositions of the present invention are employed in serious disease states, that is, life-threatening or potentially life threatening situations.
  • life-threatening or potentially life threatening situations in certain embodiments, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these peptide compositions relative to these stated dosage amounts.
  • the vaccine compositions of the invention can also be used purely as prophylactic agents.
  • the dosage for an initial prophylactic immunization generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient. This is followed by boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide administered at defined intervals from about four weeks to six months after the initial administration of vaccine.
  • the immunogenicity of the vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a sample of the patient's blood.
  • compositions for therapeutic treatment are intended for parenteral, topical, oral, nasal, infrathecal, or local (e.g. as a cream or topical ointment) administration.
  • the pharmaceutical compositions are administered parentally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly.
  • compositions for parenteral adminisfration which comprise a solution of the immunogenic peptides dissolved or suspended in an acceptable carrier, preferably an aqueous carrier.
  • aqueous carriers e.g., water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid and the like. These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to adminisfration.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to , approximate physiological conditions, such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • auxiliary substances such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • the concenfration of peptides of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of a ⁇ mnistration selected.
  • a human unit dose form of a composition is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be used for administration of such compositions to humans (see, e.g., Remington's Pharmaceutical Sciences, 17 th Edition, A. Gennaro, Editor, Mack Publishing Co., Easton, Pennsylvania, 1985).
  • a peptide dose for initial immunization can be from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
  • an initial immunization may be performed using an expression vector in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
  • the nucleic acid (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
  • a booster dose is then administered.
  • the booster can be recombinant fowlpox virus administered at a dose of5-10 7 to 5xl0 9 pfu.
  • a freatment generally involves repeated administration of the anti-213PlFl 1 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-500 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- 213P1F11 mAb preparation represents an acceptable dosing regimen.
  • various factors can influence the ideal dose in a particular case.
  • Such factors include, for example, half life of a composition, the binding affinity of an Ab, the immunogenicity of a substance, the degree of 213P1F11 expression in the patient, the extent of circulating shed 213P1F11 antigen, the desired steady-state concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • Non-limiting preferred human unit doses are, for example, 500 ⁇ g - lmg, lmg - 50mg, 50mg - lOOmg, lOOmg - 200mg, 200mg - 300mg, 400mg - 500mg, 500mg - 600mg, 600mg - 700mg, 700mg - 800mg, 800mg - 900mg, 900mg - lg, or lmg - 700mg.
  • the dose is in a range of 2-5 mg/kg body weight, e.g., with follow on weekly doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, lOmg/kg body weight followed, e.g., in two, three or four weeks by weekly doses; 0.5 - lOmg/kg body -weight, e.g., followed in two, three or four weeks by weekly doses; 225, 250, 275, 300, 325, 350, 375, 400mg m 2 of body area weekly; l-600mg m 2 of body area weekly; 225-400mg m 2 of body area weekly; these does can be followed by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9, 19, 11, 12 or more weeks.
  • human unit dose forms of polynucleotides comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors, including the sequence of the polynucleotide, molecular weight of the polynucleotide and route of administration. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dosage range may be selected from, for example, an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • a dose may be about any of the following: 0.1 to 100 mg/kg, 0.1 to 50 mg/kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500 mg/kg, 100 to 400 mg/kg, 200 to 300 mg/kg, 1 to 100 mg/kg, 100 to 200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to 1000 mg/kg, 500 to 5000 mg/kg, or 500 to 10,000 mg/kg.
  • parenteral routes of administration may require higher doses of polynucleotide compared- to more direct application to the nucleotide to diseased tissue, as do polynucleotides of increasing length.
  • human unit dose forms of T-cells comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dose may be about 10 4 cells to about 10 6 cells, about 10 6 cells to about 10 8 cells, about 10 8 to about 10" cells, or about 10 8 to about 5 x 10 10 cells.
  • a dose may also about 10 6 cells/m 2 to about 10 10 cells/m 2 , or about 10 ⁇ cells/m 2 to about 10 8 cells/m 2 .
  • Proteins(s) of the invention, and or nucleic acids encoding the protein(s), can also be administered via liposomes, which may also serve to: 1) target the proteins(s) to a particular tissue, such as lymphoid tissue; 2) to target selectively to diseases cells; or, 3) to increase the half-life of the peptide composition.
  • liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like.
  • the peptide to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to a receptor prevalent among lymphoid cells, such as monoclonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogenic compositions.
  • liposomes either filled or decorated with a desired peptide of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the peptide compositions.
  • Liposomes for use in accordance with the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol.
  • lipids are generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream.
  • a variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et al, Ann. Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Patent Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
  • a ligand to be incorporated into the liposome can include, e.g., antibodies or fragments thereof specific for cell surface determinants of the desired immune system cells.
  • a liposome suspension containing a peptide may be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the peptide being delivered, and the stage of the disease being treated.
  • nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient, that is, one or more peptides of the invention, and more preferably at a concenfration of 25%-75%.
  • immunogenic peptides are preferably supplied in finely divided form along with a surfactant and propellant. Typical percentages of peptides are about 0.01%-20% by weight, preferably about 1%-10%.
  • the surfactant must, of course, be nontoxic, and preferably soluble in the propellant.
  • Representative of such agents are the esters or partial esters of fatty acids containing from about 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
  • the surfactant may constitute about 0.1%-20% by weight of the composition, preferably about 0.25-5%.
  • the balance of the composition is ordinarily propellant.
  • a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery.
  • 213P1F11 polynucleotides, polypeptides, reactive cytotoxic T cells (CTL), reactive helper T cells (HTL) and anti-polypeptide antibodies are used in well known diagnostic, prognostic and therapeutic assays that examine conditions associated with dysregulated cell growth such as cancer, in particular the cancers listed in Table I (see, e.g., both its specific pattern of tissue expression as well as its overexpression in certain cancers as described for example in the Example entitled "Expression Analysis of 213P1F11 in Normal Tissues and Patient Specimens").
  • 213P1F11 can be analogized to a prostate associated antigen PSA, the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see, e.g., Merrill et al, J. Urol. 163(2): 503-5120 (2000); Polascik et al, J. Urol. Aug; 162(2):293-306 (1999) and , Fortier et al, J. Nat. Cancer Inst. 91(19): 1635-1640(1999)).
  • PSA prostate associated antigen PSA
  • Typical embodiments of diagnostic methods which utilize the 213P1F11 polynucleotides, polypeptides, reactive T cells and antibodies are analogous to those methods from well-established diagnostic assays which employ, e.g., PSA polynucleotides, polypeptides, reactive T cells and antibodies.
  • PSA polynucleotides are used as probes (for example in Northern analysis, see, e.g., Sharief et al, Biochem. Mol. Biol. Int. 33(3):567-74(1994)) and primers (for example in PCR analysis, see, e.g., Okegawa et al, J. Urol.
  • the 213P1F11 polynucleotides described herein can be utilized in the same way to detect 213P1F11 overexpression or the metastasis of prostate and other cancers expressing this gene.
  • PSA polypeptides are used to generate antibodies specific for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods to monitor PSA protein overexpression (see, e.g., Stephan et al, Urology 55(4):560-3 (2000)) or the metastasis of prostate cells (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3):233-7 (1996)), the • 213P1F11 polypeptides described herein can be utilized to generate antibodies for use in detecting 213P1F11 overexpression or the metastasis of prostate cells and cells of other cancers expressing this gene.
  • metastases involves the movement of cancer cells from an organ of origin (such as the lung or prostate gland etc.) to a different area of the body (such as a lymph node)
  • assays which examine a biological sample for the presence of cells expressing 213P1F11 polynucleotides and/or polypeptides can be used to provide evidence of metastasis.
  • tissue that does not normally contain 213P1F11-expressing cells lymph node
  • lymph node a biological sample from tissue that does not normally contain 213P1F11-expressing cells
  • lymph node xenografts isolated from lymph node and bone metastasis, respectively, this finding is indicative of metastasis.
  • 213P1F11 polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when cells in a biological sample that do not normally express 213P1F11 or express 213P1F11 at a different level are found to express 213P1F11 or have an increased expression of 213P IF 11 (see, e.g., the 213P1F11 expression in the cancers listed in Table I and in patient samples etc. shown in the accompanying Figures).
  • artisans may further wish to generate supplementary evidence of metastasis by testing the biological sample for the presence of a second tissue restricted marker (in addition to 213P1F11) such as PSA, PSCA etc. (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)).
  • PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods- of monitoring PSA
  • 213P1F11 polynucleotide fragments and polynucleotide variants are used in an analogous manner.
  • typical PSA polynucleotides used in methods of monitoring PSA are probes or primers which consist of fragments of the PSA cDNA sequence.
  • primers used to PCR amplify a PSA polynucleotide must include less than the whole PSA sequence to function in the polymerase chain reaction.
  • PCR reactions In the context of such PCR reactions, skilled artisans generally create a variety of different polynucleotide fragments that can be used as primers in order to amplify different portions of a polynucleotide of interest or to optimize amplification reactions (see, e.g., Caetano-Anolles, G. Biotechniques 25(3): 472-476, 478-480 (1998); Robertson et al, Methods Mol. Biol. 98:121-154 (1998)).
  • Polynucleotide fragments and variants are useful in this context where they are capable of binding to a target polynucleotide sequence (e.g., a 213P1F11 polynucleotide shown in Figure 2 or variant thereof) under conditions of high stringency.
  • a target polynucleotide sequence e.g., a 213P1F11 polynucleotide shown in Figure 2 or variant thereof
  • PSA polypeptides which contain an epitope that can be recognized by an antibody or T cell that specifically binds to that epitope are used in methods of monitoring PSA.
  • 213P1F11 polypeptide fragments and polypeptide analogs or variants can also be used in an analogous manner.
  • This practice of using polypeptide fragments or polypeptide variants to generate antibodies is typical in the art with a wide variety of systems such as fusion proteins being used by practitioners (see, e.g., Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubel et al eds., 1995).
  • each epitope(s) functions to provide the architecture with which an antibody or T cell is reactive.
  • polypeptide fragments that can be used in order to generate immune responses specific for different portions of a polypeptide of interest (see, e.g., U.S. Patent No. 5,840,501 and U.S. Patent No. 5,939,533).
  • a polypeptide comprising one of the 213P1F11 biological motifs discussed herein or a motif-bearing subsequence which is readily identified by one of skill in the art based on motifs available in the art.
  • Polypeptide fragments, variants or analogs are typically useful in this context as long as they comprise an epitope capable of generating an antibody or T cell specific for a target polypeptide sequence (e.g. a 213P1F11 polypeptide shown in Figure 3).
  • the 213P1F11 polynucleotides and polypeptides exhibit specific properties that make them useful in diagnosing cancers such as those listed in Table I.
  • Diagnostic assays that measure the presence of 213P1F11 gene products in order to evaluate the presence or onset of a disease condition described herein, such as prostate cancer, are used to identify patients for preventive measures or further monitoring, as has been done so successfully with PSA.
  • these materials satisfy a need in the art for molecules having similar or complementary characteristics to PSA in situations where, for example, a definite diagnosis of metastasis of prostatic origin cannot be made on the basis of a test for PSA alone (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)), and consequently, materials such as 213P1F11 polynucleotides and polypeptides (as well as the 213P1F11 polynucleotide probes and anti-213PlFl 1 antibodies used to identify the presence of these molecules) need to be employed to confirm a metastases of prostatic origin.
  • the 213P1F11 polynucleotides disclosed herein have a number of other utilities such as their use in the identification of oncogenetic associated chromosomal abnormalities in the chromosomal region to which the 213P1F11 gene maps (see the Example entitled "Chromosomal Mapping of 213P1F11" below).
  • the 213P1F11-related proteins and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see, e.g., Takahama K Forensic Sci Int 1996 Jun 28;80(l-2): 63-9).
  • 213P1F11-related proteins or polynucleotides of the invention can be used to treat a pathologic condition characterized by the over-expression of213PlFl l.
  • the amino acid or nucleic acid sequence of Figure 2 or Figure 3, or fragments of either can be used to generate an immune response to a 213P1F11 antigen.
  • Antibodies or other molecules that react with 213P1F11 can be used to modulate the function of this molecule, and thereby provide a therapeutic benefit.
  • the invention includes various methods and compositions for inhibiting the binding of 213P1F11 to its binding partner or its association with other protein(s) as well as methods for inhibiting 213P1F11 function.
  • a recombinant vector that encodes single chain antibodies that specifically bind to 213P1F11 are introduced into 213P1F11 expressing cells via gene transfer technologies. Accordingly, the encoded single chain anti-213PlFl 1 antibody is expressed intracellularly, binds to 213P1F11 protein, and thereby inhibits its function.
  • Methods for engineering such intracellular single chain antibodies are well known.
  • intracellular antibodies also known as "infrabodies” are specifically targeted to a particular compartment within the cell, providing control over where the inhibitory activity of the treatment is focused. This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TJJBTECH vol. 13).
  • Inrrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors (see, e.g., Richardson et al, 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al, 1994, J. Biol. Chem. 289: 23931-23936; Deshane et al, 1994, Gene Ther. 1: 332-337).
  • Single chain antibodies comprise the variable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide.
  • single chain antibodies are expressed as a single chain variable region fragment joined to the light chain constant region.
  • Well-known intracellular trafficking signals are engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to precisely target the intrabody to the desired intracellular compartment.
  • infrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif.
  • Infrabodies intended to exert activity in the nucleus are engineered to include a nuclear localization signal. Lipid moieties are joined to infrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane. Infrabodies can also be targeted to exert function in the cytosol. For example, cytosolic infrabodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural cellular destination.
  • infrabodies are used to capture 213P1F11 in the nucleus, thereby preventing its activity within the nucleus.
  • Nuclear targeting signals are engineered into such 213P1F11 infrabodies in order to achieve the desired targeting.
  • Such 213P1F11 infrabodies are designed to bind specifically to a particular 213P1F11 domain.
  • cytosolic infrabodies that specifically bind to a 213PlFl l protein are used to prevent 213P1F11 from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g., preventing 213P1F11 from forming transcription complexes with other factors).
  • the transcription of the intrabody is placed under the regulatory control of an appropriate tumor-specific promoter and/or enhancer.
  • an appropriate tumor-specific promoter and/or enhancer In order to target intrabody expression specifically to prostate, for example, the PSA promoter and/or promoter/enhancer can be utilized (See, for example, U.S. Patent No. 5,919,652 issued 6 July 1999).
  • recombinant molecules bind to 213P1F11 and thereby inhibit 213P1F11 function.
  • these recombinant molecules prevent or inhibit 213P1F11 from accessing/binding to its binding partner(s) or associating with other protein(s).
  • Such recombinant molecules can, for example, contain the reactive part(s) of a 213P1F11 specific antibody molecule.
  • the 213P1F11 binding domain ofa 213PlFll binding partner is engineered into a dimeric fusion protein, whereby the fusion protein comprises two 213P1F11 ligand binding domains linked to the Fc portion of a human IgG, such as human IgGl.
  • Such IgG portion can contain, for example, the C H 2 and C H 3 domains and the hinge region, but not the C H 1 domain.
  • Such dimeric fusion proteins are administered in soluble form to patients suffering from a cancer associated with the expression of 213P1F11, whereby the dimeric fusion protein specifically binds to 213P1F11 and blocks 213P1F11 interaction with a binding partner.
  • Such dimeric fusion proteins are further combined into multimeric proteins using known antibody linking technologies.
  • the present invention also comprises various methods and compositions for inhibiting the transcription of the 213P1F11 gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of 213P1F11 mRNA into protein.
  • a method of inhibiting the transcription of the 213P1F11 gene comprises contacting the 213P1F11 gene with a 213P1F11 antisense polynucleotide.
  • a method of inhibiting 213P1F11 mRNA translation comprises contacting a 213P1F11 mRNA with an antisense polynucleotide.
  • a 213P1F11 specific ribozyme is used to cleave a 213P1F11 message, thereby inhibiting translation.
  • Such antisense and ribozyme based methods can also be directed to the regulatory regions of the 213P1F11 gene, such as 213P1F11 promoter and/or enhancer elements.
  • proteins capable of inhibiting a 213P1F11 gene transcription factor are used to inhibit 213P1F11 mRNA transcription.
  • the various polynucleotides and compositions useful in the aforementioned methods have been described above.
  • the use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.
  • Gene transfer and gene therapy technologies can be used to deliver therapeutic polynucleotide molecules to tumor cells synthesizing 213P1F11 (i.e., antisense, ribozyme, polynucleotides encoding infrabodies and other 213P1F11 inhibitory molecules).
  • 213P1F11 i.e., antisense, ribozyme, polynucleotides encoding infrabodies and other 213P1F11 inhibitory molecules.
  • Recombinant vectors encoding 213P1F11 antisense polynucleotides, ribozymes, factors capable of interfering with 213P1F11 ⁇ transcription, and so forth, can be delivered to target tumor cells using such gene therapy approaches.
  • the above therapeutic approaches can be combined with any one of a wide variety of surgical, chemotherapy or radiation therapy regimens.
  • the therapeutic approaches of the invention can enable the use of reduced dosages of chemotherapy (or other therapies) and/or less frequent administration, an advantage for- all patients and particularly for those that do not tolerate the toxicity of the chemotherapeutic agent well.
  • the anti-tumor activity of a particular composition can be evaluated using various in vitro and in vivo assay systems.
  • In vitro assays that evaluate therapeutic activity include cell growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of determining the extent to which a therapeutic composition will inhibit the binding of 213P1F11 to a binding partner, etc.
  • a 213P1F11 therapeutic composition can be evaluated in a suitable animal model.
  • xenogenic prostate cancer models can be used, wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice (Klein et al, 1997, Nature Medicine 3 : 402-408).
  • PCT Patent Application W098/16628 and U.S. Patent 6,107,540 describe various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like.
  • xenografts from tumor bearing mice treated with the therapeutic composition can be examined for the presence of apoptotic foci and compared to untreated control xenograft- bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition.
  • Suitable carriers include any material that when combined with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is generally non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generally, Remington's Pharmaceutical Sciences 16 th Edition, A. Osal., Ed., 1980).
  • Therapeutic formulations can be solubilized and administered via any route capable of delivering the therapeutic composition to the tumor site.
  • Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, infratumor, intradermal, intraorgan, orthotopic, and the like.
  • a preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
  • Therapeutic protein preparations can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water (containing for example, benzyl alcohol preservative) or in sterile water prior to injection.
  • Dosages and administration protocols for the treatment of cancers using the foregoing methods will vary with the method and the target cancer, and will generally depend on a number of other factors appreciated in the art.
  • kits are also within the scope of the invention.
  • Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method.
  • the container(s) can comprise a probe that is or can be detectably labeled.
  • probe can be an antibody or polynucleotide specific for a 213P1F11-related protein or a 213PlFl l gene or message, respectively.
  • the kit can also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
  • a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
  • the kit can include all or part of the amino acid sequence of Figure 2 or Figure 3 or analogs thereof, or a nucleic acid molecules that encodes such amino acid sequences.
  • the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • a label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, and can also indicate directions for either in vivo or in vitro use, such as those described above. Directions and or other information can also be included on an insert which is included with the kit.
  • Example 1 SSH-Generated Isolation of a cDNA Fragment of the 213P1F11 Gene
  • SSH Suppression Subtractive Hybridization
  • the patient cancer and normal tissues were purchased from different sources such as the NDRI (Philadelphia, PA).
  • mRNA for some normal tissues were purchased from Clontech, Palo Alto, CA.
  • Tissues were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue isolate total RNA. Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by specfrophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.
  • DPNCDN (cDNA synthesis primer): 5'TTTTGATCAAGCTT 30 3' (SEQ ID NO: 42)
  • Nested primer (NP)1 5 CGAGCGGCCGCCCGGGCAGGA3' (SEQ ID NO: 48)
  • SSH Suppression Subfractive Hybridization
  • the gene 213P1F11 sequence was derived from a bladder cancer pool minus normal tissue cDNA subtraction.
  • the SSH DNA sequence ( Figure 1) was identified.
  • the cDNA derived from of pool of normal tissues was used as the source of the "driver” cDNA, while the cDNA from a pool of bladder cancer tissues was used as the source of the "tester” cDNA.
  • Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 ⁇ g of poly(A) + RNA isolated from the relevant xenograft tissue, as described above, using CLONTECH 's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1, Catalog No. K1804-1). The resulting cDNA was digested with Dpn II for 3 hrs at 37°C. Digested cDNA was extracted with phenol/chloroform (1:1) and ethanol precipitated.
  • Driver cDNA was generated by combining in a 1:1 ratio Dpn II digested cDNA from the relevant tissue source (see above) with a mix of digested cDNAs derived from the nine normal tissues: stomach, skeletal muscle, lung, brain, liver, kidney, pancreas, small intestine, and heart.
  • Tester cDNA was generated by diluting 1 ⁇ l of Dpn II digested cDNA from the relevant tissue source (see above) (400 ng) in 5 ⁇ l of water. The diluted cDNA (2 ⁇ l, 160 ng) was then ligated to 2 ⁇ l of Adaptor 1 and Adaptor 2 (10 ⁇ M), in separate ligation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72°C for 5 min.
  • the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) Adaptor 1- and Adaptor 2- ligated tester cDNA. In a final volume of 4 ⁇ l, the samples were overlaid with mineral oil, denatured in an MJ Research thermal cycler at 98°C for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68°C. The two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C. The second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCI, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.
  • PCR 1 was conducted using the following conditions: 75°C for 5 min., 94°C for 25 sec, then 27 cycles of 94°C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment.
  • PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, and 72°C for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.
  • PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed E. coli were subjected to blue/white and ampicillin selection. White colonies were picked and arrayed into 96 well plates and were grown in liquid culture overnight. To identify inserts, PCR amplification was performed on 1 ml of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel elecfrophoresis.
  • Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
  • First sfrand cDNAs can be generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Preamplif ⁇ cation system. The manufacturer's protocol was used which included an incubation for 50 min at 42°C with reverse transcriptase followed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume can be increased to 200 ⁇ l with water prior to normalization. First sfrand cDNAs from 16 different normal human tissues can be obtained from Clontech.
  • Normalization of the first strand cDNAs from multiple tissues was performed by using the primers 5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 50) and 5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 51) to amplify ⁇ -actin.
  • First strand cDNA (5 ⁇ l) were amplified in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, lXPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCl 2 , 50 mM KCl, pH8.3) and IX Klentaq DNA polymerase (Clontech). Five ⁇ l of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
  • PCR was performed using an MJ Research thermal cycler under the following conditions: Initial denaturation can be at 94°C for 15 sec, followed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min. After agarose gel electrophoresis, the band intensities of the 283 b.p. ⁇ -actin bands from multiple tissues were compared by visual inspection. Dilution factors for the first strand cDNAs were calculated to result in equal ⁇ -actin band intensities in all tissues after 22 cycles of PCR. Three rounds of normalization can be required to achieve equal band intensities in all tissues after 22 cycles of PCR.
  • First strand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), LAPC xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), bladder cancer pool, breast cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semi- quantitative PCR, using primers to 213P1F11, was performed at 26 and 30 cycles of amplification. Results show sfrong expression of213PlFl l in bladder cancer pool, breast cancer pool, xenograft pool, and cancer metastasis pool, but not in the vital pools.
  • the 213P1F11 SSH cDNA sequence was derived from a bladder cancer pool minus normal tissues cDNA subtraction.
  • the SSH cDNA sequence ( Figure 1) was designated 213P1F11.
  • the SSH DNA sequence of 166 bp did not show homology to any known gene.
  • the full- length cDNA 213P1F11 was cloned from bladder cancer cDNA. Variants of 213P1F11 were identified and these are listed in Figures 2 and 3. 213PlFl l v.l reveals 100% identity to caspase-14 precursor apoptosis- related cysteine protease protein ( Figure 4).
  • Chromosomal localization can implicate genes in disease pathogenesis.
  • chromosome mapping approaches include fluorescent in situ hybridization (FISH), human/hamster radiation hybrid (RH) panels (Walter et al., 1994; Nature Genetics 7:22; Research Genetics, Huntsville Al), human-rodent somatic cell hybrid panels such as is available from the Coriell Institute (Camden, New Jersey), and genomic viewers utilizing BLAST homologies to sequenced and mapped genomic clones (NCBI, Bethesda, Maryland).
  • Second sfrand cDNA was prepared from vital pool 1 (liver, lung and kidney), vital pool 2 (pancreas, colon and stomach), LAPC-xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), bladder cancer pool, breast cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers to 213P1F11, was performed at 26 and 30 cycles of amplification. Results show strong expression of 213P1F11 in bladder cancer pool, breast cancer pool, xenograft pool, and cancer metastasis pool, but not in the vital pools.
  • First sfrand cDNA was prepared from vital pool 1 (liver, lung and kidney), bladder cancer pool, breast cancer pool, LAPC xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), and 213P1F11 v.1 plasmid control. Normalization was performed by PCR using primers to actin and GAPDH. Semi-quantitative PCR, using primers depicted above, was performed at 35 cycles of amplification. Results show strong expression of213PlFll v.l in bladder cancer pool, breast cancer pool, LAPC xenograft pool, and the plasmid positive control.
  • Figure 19 shows that 213P1F11 was expressed in breast cancer patient tissues.
  • RNA was extracted from normal breast (N), breast cancer cell lines (DU4475, MCF7 and CAMA-1), breast cancer patient tumors (T) and breast cancer metastasis to lymph node (Met).
  • Northern blots with 10 ug of total RNA were probed with the 213P1F11 SSH fragment. Results show strong expression of 213P1F11 in the breast tumor tissues as well as in the cancer metastasis specimen. Weak expression was also detected in the CAMA-1 cell line, but not in the other 2 breast cancer cell lines tested.
  • 213P1F11 is a potential therapeutic target and a diagnostic marker for human cancers.
  • Transcript variants are variants of matured mRNA from the same gene by alternative transcription or alternative splicing.
  • Alternative transcripts are transcripts from the same gene but start transcription at different points.
  • Splice variants are mRNA variants spliced differently from the same transcript.
  • a given gene can have zero to many alternative transcripts and each transcript can have zero to many splice variants.
  • Each franscript variant has a unique exon makeup, and can have different coding and/or non-coding (5' or 3' end) portions, from the original franscript.
  • Transcript variants can code for similar or different proteins with the same or a similar function or may encode proteins with different functions, and may be expressed in the same tissue at the same time, or at different tissue, or at different times, proteins encoded by transcript variants can have similar or different cellular or extracellular localizations, i.e., be secreted.
  • Transcript variants are identified by a variety of art-accepted methods. For example, alternative transcripts and splice variants are identified in a full-length cloning experiment, or by use of full-length transcript and EST sequences. First, all human ESTs were grouped into clusters which show direct or indirect identity with each other. Second, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to the consensus sequence(s) or other full-length sequences. Each consensus sequence is a potential splice variant for that gene (see, e.g., located at the World Wide Web (.doubletwist.com/products/cl l_agentsOverview.jhtml). Even when a variant is identified that is not a full-length clone, that portion of the variant is very useful for antigen generation and for further cloning of the full-length splice variant, using techniques known in the art.
  • Genomic-based franscript variant identification programs include FgenesH (A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 10(4):516-22); Grail (http://compbio.oml.gov/Grail-bin/EmptyGrailForm) and GenScan (http://genes.mit.edu/GENSCAN.html).
  • FgenesH A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA," Genome Research. 2000 April; 10(4):516-22
  • Grail http://compbio.oml.gov/Grail-bin/EmptyGrailForm
  • GenScan http://genes.mit.edu/GENSCAN.html.
  • PCR-based Validation Welhnann S, et al, Specific reverse franscription-PCR quantification of vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clin Chem. 2001 Apr;47(4):654-60; Jia, H.P., et al, Discovery of new human beta-defensins using a genomics-based approach, Gene. 2001 Jan 24; 263(1-2):211-8.
  • PCR-based and 5' RACE Validation Brigle, K.E., et al, Organization of the murine reduced folate carrier gene and identification of variant splice forms, Biochem Biophys Acta. 1997 Aug 7; 1353(2): 191-8).
  • genomic regions are modulated in cancers.
  • the genomic region, to which a gene maps is modulated in a particular cancer
  • the alternative transcripts or splice variants of the gene are modulated as well.
  • 213P1F11 has a particular expression profile related to cancer.
  • Alternative transcripts and splice variants of 213P1F11 may also be involved in cancers in the same or different tissues, thus serving as tumor-associated markers/antigens.
  • the exon composition of the original transcript, designated as 213P1F11 v.l is shown in Table XXIIIA.
  • Tables XXIV through XXVII are set forth herein on a variant-by-variant basis.
  • Table XXIV shows the nucleotide sequences of transcript variant 2 through variant 4.
  • Table XXV shows the alignment of franscript variant 2 through variant 4, each with the nucleic acid sequence of 213P1F11 variant 1.
  • Table XXVI lays out amino acid translation of franscript variant 2 through variant 4 for the identified reading frame orientation.
  • Table XXVII displays alignments of the amino acid sequences encoded by splice variant 2 through variant 4, each with that of 213P1F11 variant 1.
  • Table XXVIII displays clustal alignments of 213P1F11 protein variant 1 through variant 6.
  • Single Nucleotide Polymorphism is a single base pair variation in nucleotide sequences.
  • A/T the base pair make-up of one or more spots in the genome of an individual
  • haplotype refers to base pair make-up of more than one varied spots on the same DNA molecule (chromosome in higher organism).
  • SNPs that occur on a cDNA are called cSNPs. These cSNPs may change amino acids of the protein encoded by the gene and thus change the functions of the protein.
  • SNPs and/or combinations of alleles have many applications including diagnosis of inherited diseases, determination of drug reactions and dosage, identification of genes responsible for disearses and discovery of genetic relationship between individuals (P. Nowotny, J. M. Kwon and A. M. Goate, " SNP analysis to dissect human traits," Curr. Opin. Neurobiol. 2001 Oct; 11(5):637-641 ; M. Pirmohamed and B. K. Park, "Genetic susceptibility to adverse drug reactions," Trends Pharmacol. Sci. 2001 Jun; 22(6):298-305; J. H. Riley, C.
  • SNPs are identified by a variety of art-accepted methods (P. Bean, "The promising voyage of SNP target discovery," Am. Clin. Lab. 2001 Oct-Nov; 20(9):18-20; K. M. Weiss, "In search of human variation,” Genome Res. 1998 Jul; 8(7):691-697; M. M. She, “Enabling large-scale pharmacogenetic studies by high- throughput mutation detection and genotyping technologies," Clin. Chem. 2001 Feb; 47(2): 164- 172).
  • SNPs are identified by sequencing DNA fragments that show polymorphism by gel-based methods such as restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE).
  • RFLP restriction fragment length polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • SNPs can also be discovered by direct sequencing of DNA samples pooled from different individuals or by comparing sequences from different DNA samples. With the rapid accumulation of sequence data in public and private databases, one can discover SNPs by comparing sequences using computer programs (Z. Gu, L. Hillier and P. Y. Kwok, "Single nucleotide polymorphism hunting in cyberspace,” Hum. Mutat. 1998; 12(4):221-225). SNPs can be verified and genotype or haplotype of an individual can be determined by a variety of methods including direct sequencing and high throughput microarrays (P. Y. Kwok, "Methods for genotyping single nucleotide polymorphisms," Annu. Rev. Genomics Hum. Genet.
  • alleles of the SNPs can occur in different combinations (haplotypes) and in any one of the transcript variants that contains the sequence context of the SNPs , e.g., 213P1F11 v.2, 213P1F11 v.3 or 213Plfl l v.4.
  • 213P1F11 and 213P1F11 variants are cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 213P1F11 or 213P1F11 variants are expressed in these constructs, amino acids 1 to 242 of 213P1F11 variant 1, amino acids 1-230 of variant 2, amino acids 1-146 of variant 3, amino acids 1-321 of variant 4; or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 213P1F11, variants, or analogs thereof.
  • pCRII In vitro transcription and translation constructs: pCRII: To generate 213P1F11 sense and anti-sense RNA probes for RNA in situ investigations, pCRII constructs (Invitrogen, Carlsbad CA) are generated encoding either all or fragments of the 213P IF 11 cDNA. The pCRII vector has Sp6 and T7 promoters flanking the insert to drive the transcription of 213P1F11 RNA for use as probes in RNA in situ hybridization experiments. These probes are used to analyze, the cell and tissue expression of 213P1F11 at the RNA level.
  • Transcribed 213P1F11 RNA representing the cDNA amino acid coding region of the 213P1F11 gene is used in in vitro translation systems such as the TnTTM Coupled Reticulolysate Sytem (Promega, Corp., Madison, WI) to synthesize 213P1F11 protein.
  • TnTTM Coupled Reticulolysate Sytem Promega, Corp., Madison, WI
  • pGEX Constructs To generate recombinant 213P1F11 proteins in bacteria that are fused to the Glutathione S-fransferase (GST) protein, all or parts of the T- fusion vector of the pGEX family (Amersham Pharmacia Biotech, Piscataway, NJ). These constructs allow controlled expression of recombinant 213P1F11 protein sequences with GST fused at the amino-terminus and a six histidine epitope (6X His) at the carboxyl- terminus.
  • GST Glutathione S-fransferase
  • the GST and 6X His tags permit purification of the recombinant fusion protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-GST and anti-His antibodies.
  • the 6X His tag is generated by adding 6 histidine codons to the cloning primer at the 3' end, e.g., of the open reading frame (ORF).
  • a proteolytic cleavage site such as the PreScissionTM recognition site in pGEX-6P-l, may be employed such that it permits cleavage of the GST tag from 213P1F11-related protein.
  • the ampicillin resistance gene and pBR322 origin permits selection and maintenance of the pGEX plasmids in £. coli.
  • pMAL Constructs To generate, in bacteria, recombinant 213P1F11 proteins that are fused to maltose-binding protein (MBP), all or parts of the 213P1F11 cDNA protein coding sequence are fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X vectors (New England Biolabs, Beverly, MA). These constructs allow controlled expression of recombinant 213P1F11 protein sequences with MBP fused at the amino-terminus and a 6X His epitope tag at the carboxyl-terminus.
  • MBP maltose-binding protein
  • the MBP and 6X His tags permit purification of the recombinant protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-MBP and anti-His antibodies.
  • the 6X His epitope tag is generated by adding 6 histidine codons to the 3' cloning primer.
  • a Factor Xa recognition site permits cleavage of the pMAL tag from 213P1F11.
  • the pMAL-c2X and pMAL-p2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds.
  • pET Constructs To express 213P1F11 in bacterial cells, all or parts of the 213P1F11 cDNA protein coding sequence are cloned into the pET family of vectors (Novagen, Madison, WI). These vectors allow tightly confrolled expression of recombinant 213P1F11 protein in bacteria with and without fusion to proteins that enhance solubility, such as NusA and thioredoxin (Trx), and epitope tags, such as 6X His and S-Tag TM that aid purification and detection of the recombinant protein. For example, constructs are made utilizing pET NusA fusion system 43.1 such that regions of the 213P1F11 protein are expressed as arnino-terminal fusions to NusA.
  • Yeast Constructs To express 213P1F11 in the yeast species Saccharomyces cerevisiae for generation of recombinant protein and functional studies, all or parts of the 213P1F11 cDNA protein coding sequence are cloned into the pESC family of vectors each of which contain 1 of 4 selectable markers, HIS3, TRPl, LEU2, and URA3 (Stratagene, La Jolla, CA). These vectors allow controlled expression from the same plasmid of up to 2 different genes or cloned sequences containing either FlagTM or Myc epitope tags in the same yeast cell. This system is useful to confirm protein-protein interactions of 213P1F11.
  • pESP Constructs To express 213P1F11 in the yeast species Saccharomyces pombe, all or parts of the 213P1F11 cDNA protein coding sequence are cloned into the pESP family of vectors. These vectors allow controlled high level of expression of a 213PlFl l protein sequence that is fused at either the amino terminus or at the carboxyl terminus to GST which aids purification of the recombinant protein.
  • a FlagTM epitope tag allows detection of the recombinant protein with anti- FlagTM antibody.
  • the full or partial length 213P1F11 cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 213P1F11 are expressed in these constructs, amino acids 1 to 242, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 213P1F11, variants, or analogs thereof.
  • a region of a specific variant of 213P1F11 is expressed that encodes an amino acid at a specific position which differs from the amino acid of any other variant found at that position.
  • a region ofa variant of 213P1F11 is expressed that lies partly or entirely within a sequence that is unique to that variant.
  • the constructs can be transfected into any one of a wide variety of mammalian cells such as 293T cells.
  • Transfected 293T cell lysates can be probed with the anti-213P1F11 polyclonal serum, described herein.
  • pcDNA4/HisMax Constructs To express 213P1F11 in mammalian cells, a 213P1F11 ORF, or portions thereof, of 213P1F11 are cloned into pcDNA4/HisMax Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter and the SP16 translational enhancer.
  • CMV cytomegalovirus
  • the recombinant protein has XpressTM and six histidine (6X His) epitopes fused to the an ⁇ no-terminus.
  • the pcDNA4/HisMax vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Zeocin resistance gene allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in E. coli.
  • pcDNA3.1/MycHis Constructs To express 213P1F11 in mammalian cells, a 213P1F11 ORF, or portions thereof, of 213P1F11 with a consensus Kozak translation initiation site are cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the myc epitope and 6X His epitope fused to the carboxyl-terminus.
  • CMV cytomegalovirus
  • the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability, along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene can be used, as it allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in ii. coli.
  • pcDNA3.1/CT-GFP-TOPO Construct To express 213P1F11 in mammalian cells and to allow detection of the recombinant proteins using fluorescence, a 213PlFl l ORF, or portions thereof, with a consensus Kozak translation initiation site are cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the Green Fluorescent Protein (GFP) fused to the carboxyl-te ⁇ ninus facilitating non-invasive, in vivo detection and cell biology studies.
  • GFP Green Fluorescent Protein
  • the pcDNA3.1CT-GFP-TOPO vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in E. coli. Additional constructs with an amino-terminal GFP fusion are made in pcDNA3.1/NT-GFP-TOPO spanning the entire length ofa 213PlFl l protein.
  • PAPtag A 213P1F11 ORF, or portions thereof, is cloned into pAPtag-5 (GenHunter Corp. Nashville, TN). This construct generates an alkaline phosphatase fusion at the carboxyl-te ⁇ ninus ofa 213P1F11 protein while fusing the IgG signal sequence to the amino-terminus. Constructs are also generated in which alkaline phosphatase with an amino-terminal IgGi signal sequence is fused to the amino- terminus of a 213P1F11 protein.
  • the resulting recombinant 213P1F11 proteins are optimized for secretion into the media of transfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with 213P1F11 proteins.
  • Protein expression is driven from the CMV promoter and the recombinant proteins also contain myc and 6X His epitopes fused at the carboxyl-terminus that facilitates detection and purification.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • ⁇ tag5 A 213P1F11 ORF, or portions thereof, is cloned into pTag-5.
  • This vector is similar to pAPtag but without the alkaline phosphatase fusion.
  • This construct generates 213P1F11 protein with an amino-terminal IgG ⁇ signal sequence and myc and 6X His epitope tags at the carboxyl-terminus that facilitate detection and affinity purification.
  • the resulting recombinant 213P1F11 protein is optimized for secretion into the media of transfected mammalian cells, and is used as immunogen or ligand to identify proteins such as ligands or receptors that interact with the 213P IF 11 proteins. Protein expression is driven from the CMV promoter.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the protein, and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • PsecFc A 213P1F11 ORF, or portions thereof, is also cloned into psecFc.
  • the psecFc vector was assembled by cloning the human immunoglobulin GI (IgG) Fc (hinge, CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This construct generates an IgGl Fc fusion at the carboxyl-terminus of the 213P1F11 proteins, while fusing the IgGK signal sequence to N-terminus. 213P1F11 fusions utilizing the murine IgGl Fc region are also used.
  • IgG human immunoglobulin GI
  • the resulting recombinant 213P1F11 proteins are optimized for secretion into the media of transfected mammalian cells, and can be used as immunogens or to identify proteins such as ligands or receptors that interact with 213P1F11 protein. Protein expression is driven from the CMV promoter.
  • the hygromycin resistance gene present in the vector allows for selection of mammalian cells that express the recombinant protein, and the ampicillin resistance gene permits selection of the plasmid in E. coli.
  • pSR ⁇ Constructs To generate mammalian cell lines that express 213P1F11 constitutively, 213P1F11 ORF, or portions thereof, of 213P1F11 are cloned into pSR ⁇ constructs.
  • Amphotropic and ecofropic refroviruses are generated by transfection of pSR ⁇ constracts into the 293T-10A1 packaging line or co-transfection of pSR ⁇ and a helper plasmid (containing deleted packaging sequences) into the 293 cells, respectively.
  • the retrovirus is used to infect a variety of mammalian cell lines, resulting in the integration of the cloned gene, 213P1F11, into the host cell- lines. Protein expression is driven from a long terminal repeat (LTR).
  • LTR long terminal repeat
  • the Neomycin resistance gene present in the vector allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColEl origin permit selection and maintenance of the plasmid in E. coli.
  • the retroviral vectors can thereafter be used for infection and generation of various cell lines using, for example, PC3, NIH 3T3, TsuPrl, 293 or rat-1 cells.
  • Additional pSR ⁇ constructs are made that fuse an epitope tag such as the FLAGTM tag to the carboxyl-terminus of 213P1F11 sequences to allow detection using anti-Flag antibodies.
  • the FLAGTM sequence 5' gat tac aag gat gac gac gat aag 3' (SEQ ID NO: 54) is added to cloning primer at the 3' end of the ORF.
  • Additional pSR ⁇ constracts are made to produce both amino-terminal and carboxyl-terminal GFP and myc/6X His fusion proteins of the full-length 213P1F11 proteins.
  • Additional Viral Vectors Additional constructs are made for viral-mediated delivery and expression of 213P1F11. High virus titer leading to high level expression of 213P1F11 is achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors.
  • a 213P1F11 coding sequences or fragments thereof are amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and virus packaging are performed according to the manufacturer's instructions to generate adenoviral vectors.
  • 213P1F11 coding sequences or fragments thereof are cloned into the HSV-1 vector (Imgenex) to generate herpes viral vectors.
  • the viral vectors are thereafter used for infection of various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • Regulated Expression Systems To confrol expression of 213P1F11 in mammalian cells, coding sequences of 213P IF 11, or portions thereof, are cloned into regulated mammalian expression systems such as the T-Rex System (Invitrogen), the GeneSwitch System (Invitrogen) and the tightly-regulated Ecdysone System (Sratagene). These systems allow the study of the temporal and concentration dependent effects of • recombinant 213P1F11. These vectors are thereafter used to control expression of 213P1F11 in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • T-Rex System Invitrogen
  • GeneSwitch System Invitrogen
  • Sratagene Ecdysone System
  • 213P1F11 ORF To generate recombinant 213P1F11 proteins in a baculovirus expression system, 213P1F11 ORF, or portions thereof, are cloned into the baculovirus transfer vector pBlueBac 4.5 (Invitrogen), which provides a His-tag at the N-terminus.
  • pBlueBac-213PlFl 1 is co-fransfected with helper plasmid pBac-N- Blue (Invitrogen) into SF9 (Spodoptera frugiperda) insect cells to generate recombinant baculovirus (see Invitrogen instruction manual for details). Baculovirus is then collected from cell supernatant and purified by plaque assay.
  • Recombinant 213P1F11 protein is then generated by infection of HighFive insect cells (Invifrogen) with purified baculovirus.
  • Recombinant 213P1F11 protein can be detected using anti-213PlFl 1 or anti-His- tag antibody.
  • 213P1F11 protein can be purified and used in various cell-based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for 213P1F11.
  • Example 9 Antigenicitv Profiles and Secondary Structure
  • Figure 5A-D, Figure 6A-D, Figure 7A-D, Figure 8A-D, and Figure 9A-D depict graphically five amino acid profiles of the 213P1F11 variants 1 through 4 respectively, each assessment available by accessing the ProtScale website located at the World Wide Web (.expasy.ch/cgi-bin protscale.pl) on the ExPasy molecular biology server.
  • Hydrophilicity (Figure 5), Hydropathicity ( Figure 6) and Percentage Accessible Residues ( Figure 7) profiles were used to determine stretches of hydrophilic amino acids (i.e., values greater than 0.5 on the Hydrophilicity and Percentage Accessible Residues profile, and values less than 0.5 on the Hydropathicity profile). Such regions are likely to be exposed to the aqueous environment, be present on the surface of the protein, and thus available for immune recognition, such as by antibodies.
  • Average Flexibility ( Figure 8) and Beta-turn ( Figure 9) profiles determine stretches of amino acids (i.e., values greater than 0.5 on the Beta-turn profile and the Average Flexibility profile) that are not constrained in secondary structures such as beta sheets and alpha helices. Such regions are also more likely to be exposed on the protein and thus accessible to immune recognition, such as by antibodies.
  • Antigenic sequences of the 213P1F11 protein and of the variant proteins indicated, e.g., by the profiles set forth in Figure 5A-D, Figure 6A-D, Figure 7A-D, Figure 8A-D, and/or Figure 9A-D are used to prepare immunogens, either peptides or nucleic acids that encode them, to generate therapeutic and diagnostic anti-213PlFll antibodies.
  • the immunogen can be any 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids, or the corresponding nucleic acids that encode them, from the 213P 1 F 11 protein variants listed in Figures 2 and 3.
  • peptide immunogens of the invention can comprise, a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment up to the full length of the respective variant's sequence that includes an amino acid position having a value greater than 0.5 in the Hydrophilicity profiles of Figure 5A-D; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment up to the full length of the respective variant's sequence that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figures 6 A-D; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment up to the full length of the respective variant's sequence that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profiles of Figure 7 A-D; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment up to the full length of the respective variant's sequence that includes an amino acid position having a value greater than
  • All immunogens of the invention, peptide or nucleic acid can be embodied in human unit dose form, or comprised by a composition that includes a pharmaceutical excipient compatible with human physiology.
  • Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
  • the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • computer algorithms are employed in design of immunogens that, based on amino acid sequence analysis contain characteristics of being antigenic and available for recognition by the immune system of the immunized host (see the Example entitled "Antigenicity Profiles and Secondary Structure").
  • Such regions would be predicted to be hydrophilic, flexible, in beta-turn conformations, and be exposed on the surface of the protein (see, e.g., Figure 5A-D, Figure 6 A-D, Figure 7 A-D, Figure 8 A-D, or Figure 9 A-D for amino acid profiles that indicate such regions of 213P1F11 and variants).
  • 213P1F11 recombinant bacterial fusion proteins or peptides containing hydrophilic, flexible, beta-turn regions of 213P1F11 variant proteins are used as antigens to generate polyclonal antibodies in New Zealand White rabbits.
  • regions include, but are not limited to, amino acids 1-17, amino acids 25-80, amino acids 88-108, amino acids 131-147, and 207-242 of 213P1F11 variant 1. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
  • immunogenic proteins examples include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • KLH keyhole limpet hemocyanin
  • serum albumin serum albumin
  • bovine thyroglobulin bovine thyroglobulin
  • soybean trypsin inhibitor soybean trypsin inhibitor.
  • a peptide encoding amino acids l-17 of213PlFl l variant 1 is conjugated to KLH and used to immunize the rabbit.
  • the immunizing agent may include all or portions of the 213P1F11 variant proteins, analogs or fusion proteins thereof.
  • the 213P1F11 variant 1 amino acid sequence can be fused using recombinant DNA techniques to any one of a variety of fusion protein partners that are well known in the art, such as glutathione-S-transferase (GST) and HIS tagged fusion proteins.
  • GST glutathione-S-transferase
  • HIS HIS tagged fusion proteins
  • a GST-fusion protein encoding amino acids 1-147, encompassing several predicted antigenic regions, is produced and purified and used as immunogen.
  • Other recombinant bacterial fusion proteins that may be employed include maltose binding protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant region (see the section entitled "Production of 213P1F11 in Prokaryotic Systems” and Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul et al. eds., 1995; Linsley, P.S., Brady, W., Umes, M., Grosmaire, L., Damle, N., and Ledbetter, L.(1991) J.Exp. Med. 174, 561-566).
  • mammalian expressed protein antigens are also used. These antigens are expressed from mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see the section entitled "Production of Recombinant 213P1F11 in Eukaryotic Systems"), and retain post- translational modifications such as glycosylations found in native protein.
  • the full length sequence of variant 1, amino acids 1-242 is cloned into the Tag5 mammalian secretion vector.
  • the recombinant protein is purified by metal chelate chromatography from tissue culture supematants of 293T cells stably expressing the recombinant vector.
  • the purified Tag5 213P1F11 protein is then used as immunogen.
  • adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic ttehalose dicorynomycolate).
  • CFA complete Freund's adjuvant
  • MPL-TDM adjuvant monophosphoryl Lipid A, synthetic ttehalose dicorynomycolate
  • rabbits are initially immunized subcutaneously with up to 200 ⁇ g, typically 100-200 ⁇ g, of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every two weeks with up to 200 ⁇ g, typically 100-200 ⁇ g, of the immunogen in incomplete Freund's adjuvant (IF A). Test bleeds are taken approximately 7-10 days following each immunization and used to monitor the titer of the antiserumby ELISA.
  • CFA complete Freund's adjuvant
  • cell lysates are probed with the anti-213PlFl 1 serum and with anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, CA) to determine specific reactivity to denatured 213P1F11 protein using the Western blot technique.
  • the immune serum is then tested by the Western blot technique against 293T- 213P1F11 cells.
  • the immune serum is tested by fluorescence microscopy, flow cytometry and immunoprecipitation against 293T and other recombinant 213P IF 11-expressing cells to determine specific recognition of native protein.
  • the antiserum is then affinity purified by passage over a column composed of a MBP-fusion protein also encoding amino acids 1-147 covalently coupled to Affigel matrix.
  • the serum is then further purified by protein G affinity chromatography to isolate the IgG fraction.
  • Sera from other His-tagged antigens and peptide immunized rabbits as well as fusion partner depleted sera are affinity purified by passage over a column matrix composed of the original protein immunogen or free peptide.
  • therapeutic mAbs to 213P1F11 variants comprise those that react with epitopes specific for each variant protein or specific to sequences in common between the variants that would disrupt or modulate the biological function of the 213P1F11 variants, for example those that would disrupt the interaction with ligands and binding partners.
  • Immunogens for generation of such mAbs include those designed to encode or contain the entire 213P1F11 protein variant sequence, regions of the 213P1F11 protein variants predicted to be antigenic from computer analysis of the amino acid sequence (see, e.g., Figure 5 A-D, Figure 6 A-D, Figure 7 A-D, Figure 8 A-D, or Figure 9 A-D, and the Example entitled "Antigenicity Profiles and Secondary Structure").
  • Immunogens include peptides, recombinant bacterial proteins, and mammalian expressed Tag 5 proteins and human and murine IgG FC fusion proteins.
  • cells engineered to express high levels of a respective 213P1F11 variant such as 293T-213P1F11 variant 1 or 300.19-213P1F11 variant lmurine Pre-B cells, are used to immunize mice.
  • mice are first immunized intraperitoneally (D?) with, typically, 10-50 ⁇ g of protein immunogen or 10 7 213P1F11-expressing cells mixed in complete Freund's adjuvant. Mice are then subsequently immunized IP every 2-4 weeks with, typically, 10-50 ⁇ g of protein immunogen or 10 7 cells mixed in incomplete Freund's adjuvant. Alternatively, MPL-TDM adjuvant is used in immunizations.
  • a DNA-based immunization protocol in which a mammalian expression vector encoding a 213P1F11 variant sequence is used to immunize mice by direct injection of the plasmid DNA.
  • a mammalian expression vector encoding a 213P1F11 variant sequence is used to immunize mice by direct injection of the plasmid DNA.
  • the full length variant 1 sequence, encoding amino acids 1-242 is cloned into the Tag5 mammalian secretion vector and the recombinant vector is used as immunogen.
  • the same amino acids are cloned into an Fc- fusion secretion vector in which the 213P1F11 variant 1 sequence is fused at the ammo-terminus to an IgK leader sequence and at the carboxyl-terminus to the coding sequence of the human or murine IgG Fc region.
  • This recombinant yector is then used as immunogen.
  • the plasmid immunization protocols are used in combination with purified proteins expressed from the same vector and with cells expressing the respective 213PlFl lvariant.
  • test bleeds are taken 7-10 days following an injection to monitor titer and specificity of the immune response. Once appropriate reactivity and specificity is obtained as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytomettic analyses, fusion and hybridoma generation is then ca ⁇ ied out with established procedures well known in the art (see, e.g., Hariow and Lane, 1988).
  • a Tag5-213P1F11 variant 1 antigen encoding amino acids 1-242 is expressed and purified from stably transfected 293T cells.
  • Balb C mice are initially immunized intraperitoneally with 25 ⁇ g of the Tag5-213P1F11 variant 1 protein mixed in complete Freund's adjuvant. Mice are subsequently immunized every two weeks with 25 ⁇ g of the antigen mixed in incomplete Freund's adjuvant for a total of three immunizations.
  • ELISA using the Tag5 antigen determines the titer of serum from immunized mice.
  • Reactivity and specificity of serum to full length 213P1F11 variant protein is monitored by Western blotting, immunoprecipitation and flow cytometry using 293T cells fransfected with an expression vector encoding the 213P1F11 variant 1 cDNA (see e.g., the Example entitled "Production of Recombinant 213P1F11 in Eukaryotic Systems").
  • Other recombinant 213P1F11 variant 1-expressing cells or cells endogenously expressing 213P1F11 variant 1 are also used. Mice showing the strongest reactivity are rested and given a final injection of Tag5 antigen in PBS and then sacrificed four days later.
  • mice The spleens of the sacrificed mice are harvested and fused to SPO/2 myeloma cells using standard procedures (Hariow and Lane, 1988). Supematants from HAT selected growth wells are screened by ELISA, Western blot, immunoprecipitation, fluorescent microscopy, and flow cytometry to identify 213P1F11 specific antibody-producing clones.
  • Monoclonal antibodies are also derived that react only with specific 213P1F11 variants.
  • immunogens are designed to encode amino acid regions specific to the respective variant.
  • a Tag5 immunogen encoding amino acids 175-230 of variant 2 is produced, purified, and used to immunize mice to generate hybridomas.
  • a KLH-coupled peptide encoding amino acids 135-146 of variant 3 is produced and used as immunogen.
  • amino acids 1-86 of variant 4 is fused to GST and used as immunogen.
  • Monoclonal antibodies raised to these immunogens are then screened for reactivity to cells expressing the respective variants but not to other 213P1F11 variants. These strategies for • raising 213P1F11 variant specific monoclonal antibodies are also applied to polyclonal reagents described in the Example entitled "Generation of 213P1F11 Polyclonal Antibodies.”
  • the binding affinity of a 213P1F11 monoclonal antibody is determined using standard technologies. Affinity measurements quantify the strength of antibody to epitope binding and are used to help define which 213P1F11 monoclonal antibodies prefe ⁇ ed for diagnostic or therapeutic use, as appreciated by one of skill in the art.
  • the BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity.
  • the BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor biomolecular interactions in real time. BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants.
  • HLA class I and class II binding assays using purified HLA molecules are performed in accordance with disclosed protocols (e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney et al, Current Protocols in Immunology 18.3.1 (1998); Sidney, et al, J. Immunol 154:247 (1995); Sette, et al, Mol. Immunol 31:813 (1994)).
  • purified MHC molecules (5 to 500 nM) are incubated with various unlabeled peptide inhibitors and 1-10 nM 125 I-radiolabeled probe peptides as described.
  • MHC-peptide complexes are separated from free peptide by gel filtration and the fraction of peptide bound is determined.
  • each MHC preparation is titered in the presence of fixed amounts of radiolabeled peptides to determine the concenfration of HLA molecules necessary to bind 10-20% of the total radioactivity. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.
  • Binding assays as outlined above may be used to analyze HLA supermotif and/or HLA motif- bearing peptides.
  • HLA vaccine compositions of the invention can include multiple epitopes.
  • the multiple epitopes can comprise multiple HLA supermotifs or motifs to achieve broad population coverage. This example illustrates the identification and confirmation of supermotif- and motif-bearing epitopes for the inclusion in such a vaccine composition. Calculation of population coverage is performed using the strategy described below.
  • Identified A2-, A3-, and DR-supermotif sequences are scored using polynomial algorithms to predict their capacity to bind to specific HLA-Class I or Class II molecules. These polynomial algorithms account for the impact of different amino acids at different positions, and are essentially based on the premise that the overall affinity (or ⁇ G) of peptide-HLA molecule interactions can be approximated as a linear polynomial function of the type:
  • the ARB values corresponding to the sequence of the peptide are multiplied. If this product exceeds a chosen threshold, the peptide is predicted to bind. Appropriate thresholds are chosen as a function of the degree of stringency of prediction desired.
  • Protein sequences from 213P1F11 are scanned utilizing motif identification software, to identify 8-, 9- 10- and 11-mer sequences containing the HLA- A2-supermotif main anchor specificity. Typically, these sequences are then scored using the protocol described above and the peptides co ⁇ esponding to the positive- scoring sequences are synthesized and tested for their capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201 is considered a prototype A2 supertype molecule).
  • A2-supertype molecules A*0202, A*0203, A*0206, and A*6802.
  • Peptides that bind to at least three of the five A2-supertype alleles tested are typically deemed A2 -supertype cross-reactive binders.
  • Preferred peptides bind at an affinity equal to or less than 500 nM to three or more HLA-A2 supertype molecules.
  • the 213P1F11 protein sequence(s) scanned above is also examined for the presence of peptides with the HLA-A3-supermotif primary anchors. Peptides co ⁇ esponding to the HLA A3 supermotif-bearing sequences are then synthesized and tested for binding to HLA-A*0301 and HLA-A*1101 molecules, the molecules encoded by the two most prevalent A3-supertype alleles.
  • the peptides that bind at least one of the two alleles with binding affinities of ⁇ 500 nM, often ⁇ 200 nM, are then tested for binding cross-reactivity to the other common A3-supertype alleles (e.g., A*3101, A*3301, and A*6801) to identify those that can bind at least three of the five HLA- A3 -supertype molecules tested.
  • A3-supertype alleles e.g., A*3101, A*3301, and A*6801
  • the 213P1F11 protein(s) scanned above is also analyzed for the presence of 8-, 9- 10-, or 11-mer peptides with the HLA-B7-supermotif.
  • Co ⁇ esponding peptides are synthesized and tested for binding to HLA-B*0702, the molecule encoded by the most common B7-supertype allele (i.e., the prototype B7 supertype allele).
  • Peptides binding B*0702 with IC 50 of ⁇ 500 nM are identified using standard methods. These peptides are then tested for binding to other common B7-supertype molecules (e.g., B*3501, B*5101, B*5301, and B*5401). Peptides capable of binding to three or more of the five B7-supertype alleles tested are thereby identified.
  • HLA-A1 and -A24 epitopes can also be incorporated into vaccine compositions.
  • An analysis of the 213P1F11 protein can also be performed to identify HLA-A1- and A24-motif-containing sequences.
  • Cross-reactive candidate CTL A2 -supermotif-bearing peptides that are identified as described herein are selected to confirm in vitro immunogenicity. Confirmation is performed using the following methodology:
  • the .221A2.1 cell line produced by transferring the HLA-A2.1 gene into the HLA-A, -B, -C null mutant human B-lymphoblastoid cell line 721.221, is used as the peptide-loaded target to measure activity of HLA-A2.1 -restricted CTL.
  • This cell line is grown in RPMI-1640 medium supplemented with antibiotics, sodium pyruvate, nonessential amino acids and 10% (v/v) heat inactivated FCS.
  • Cells that express an antigen of interest, or fransfectants comprising the gene encoding the antigen of interest can be used as target cells to confirm the ability of peptide-specific CTLs to recognize endogenous antigen.
  • DC Dendritic Cells
  • the wells are washed a total of three times with 3 ml RPMI to remove most of the non-adherent and loosely adherent cells.
  • Three ml of complete medium containing 50 ng/ml of GM-CSF and 1,000 U/ml of IL-4 are then added to each well.
  • TNF ⁇ is added to the DCs on day 6 at 75 ng/ml and the cells are used for CTL induction cultures on day 7.
  • CD8+ T-cells are isolated by positive selection with Dynal immunomagnetic beads (Dynabeads® M-450) and the detacha-bead® reagent. Typically about 200-250x10 6 PBMC are processed to obtain 24xlO ⁇ CD8 + T-cells (enough for a 48-well plate culture). Briefly, the PBMCs are thawed in RPMI with 30 ⁇ g/ml DNAse, washed once with PBS containing 1% human AB serum and resuspended in PBS/1% AB serum at a concentration of 20xl0 6 cells/ml.
  • the magnetic beads are washed 3 times with PBS/AB serum, added to the cells (140 ⁇ l beads/20xlO ⁇ cells) and incubated for 1 hour at 4°C with continuous mixing.
  • the beads and cells are washed 4x with PBS/AB serum to remove the nonadherent cells and resuspended at lOOxlO 6 cells/ml (based on the original cell number) in PBS/AB serum containing lOO ⁇ l ml detacha-bead® reagent and 30 ⁇ g/ml DNAse.
  • the mixture is incubated for 1 hour at room temperature with continuous mixing.
  • the beads are washed again with PBS/AB DNAse to collect the CD 8+ T-cells.
  • the DC are collected and centrifuged at 1300 rpm for 5-7 minutes, washed once with PBS with 1% BSA, counted and pulsed with 40 ⁇ g/ml of peptide at a cell concenfration of l-2xl0 6 /ml in the presence of 3 ⁇ g/ml ⁇ microglobulin for 4 hours at 20°C.
  • the DC are then i ⁇ adiated (4,200 rads), washed 1 time with medium and counted again.
  • cytokine-generated DC at lxlO 5 cells/ml
  • CD8+ T-cells at 2xl0 6 cell/ml
  • Recombinant human IL-10 is added the next day at a final concentration of 10 ng/ml and rhuman IL-2 is added 48 hours later at 10 IU/ml.
  • PBMCs are thawed and washed twice with RPMI and DNAse. The cells are resuspended at 5x10 ⁇ cells/ml and irradiated at ⁇ 4200 rads. The PBMCs are plated at 2xlO ⁇ in 0.5 ml complete medium per well and incubated for 2 hours at 37°C.
  • the plates are washed twice with RPMI by tapping the plate gently to remove the nonadherent cells and the adherent cells pulsed with lO ⁇ g/ml of peptide in the presence of 3 ⁇ g/ml ⁇ 2 microglobulin in 0.25ml RPMI/5%AB per well for 2 hours at 37°C.
  • Peptide solution from each well is aspirated and the wells are washed once with RPMI. Most of the media is aspirated from the induction cultures (CD8+ cells) and brought to 0.5 ml with fresh media. The cells are then fransfe ⁇ ed to the wells containing the peptide-pulsed adherent cells.
  • recombinant human IL-10 is added at a final concentration of 10 ng/ml and recombinant human IL2 is added the next day and again 2-3 days later at 50IU/ml (Tsai et al, Critical Reviews in Immunology 18(l-2):65-75, 1998). Seven days later, the cultures are assayed for CTL activity in a 51 Cr release assay. In some experiments the cultures are assayed for peptide-specific recognition in the in situ IFN ⁇ ELISA at the time of the second restimulation followed by assay of endogenous recognition 7 days later. After expansion, activity is measured in both assays for a side-by-side comparison.
  • cytotoxicity is determined in a standard (5 hr) 5I Cr release assay by assaying individual wells at a single E:T.
  • Peptide-pulsed targets are prepared by incubating the cells with lO ⁇ g/ml peptide overnight at 37°C.
  • Adherent target cells are removed from culture flasks with trypsin-EDTA.
  • Target cells are labeled with 200 ⁇ Ci of 51 Cr sodium chromate (Dupont, Wilmington, DE) for 1 hour at 37°C.
  • Labeled target cells are resuspended at 10 ⁇ per ml and diluted 1:10 with K562 cells at a concenfration of 3.3x10 6 /ml (an NK-sensitive erythroblastoma cell line used to reduce non-specific lysis).
  • Target cells (100 ⁇ l) and effectors (lOO ⁇ l) are plated in 96 well round-bottom plates and incubated for 5 hours at 37°C. At that time, 100 ⁇ l of supernatant are collected from each well and percent lysis is determined according to the formula:
  • a positive culture is defined as one in which the specific lysis (sample- background) is 10% or higher in the case of individual wells and is 15% or more at the two highest E:T ratios when expanded cultures are assayed.
  • Immulon 2 plates are coated with mouse anti-human IFN ⁇ monoclonal antibody (4 ⁇ g/ml 0.1M NaHC0 3 , pH8.2) overnight at 4°C.
  • the plates are washed with Ca 2+ , Mg 2+ -free PBS/0.05% Tween 20 and blocked with PBS/ 10% FCS for two hours, after which the CTLs (100 ⁇ l/well) and targets (100 ⁇ l/well) are added to each well, leaving empty wells for the standards and blanks (which received media only).
  • the target cells either peptide-pulsed or endogenous targets, are used at a concentration of lxlO 6 cells/ml.
  • the plates are incubated for 48 hours at 37°C with 5% C0 2 .
  • Recombinant human IFN-gamma is added to the standard wells starting at 400 pg or 1200pg/100 microliter/well and the plate incubated for two hours at 37°C.
  • the plates are washed and 100 ⁇ l of biotinylated mouse anti-human IFN-gamma monoclonal antibody (2 microgram/ml in PBS/3%FCS/0.05% Tween 20) are added and incubated for 2 hours at room temperature. After washing again, 100 microliter HRP-streptavidin (1 :4000) are added and the plates incubated for one hour at room temperature.
  • TMB 1 100 microliter/well developing solution
  • TMB 1 100 microliter/well developing solution
  • the reaction is stopped with 50 microliter/well IM H 3 P0 4 and read at OD450.
  • a culture is considered positive if it measured at least 50 pg of IFN-gamma/well above background and is twice the background level of expression.
  • Those cultures that demonstrate specific lytic activity against peptide-pulsed targets and/or tumor targets are expanded over a two week period with anti-CD3.
  • 5xl0 4 CD8+ cells are added to a T25 flask containing the following: lxlO 6 irradiated (4,200 rad) PBMC (autologous or allogeneic) per ml, 2xl0 5 i ⁇ adiated (8,000 rad) EBV- transformed cells per ml, and OKT3 (anti-CD3) at 30ng per ml in RPMI-1640 ' containing 10% (v/v) human AB serum, non-essential amino acids, sodium pyruvate, 25 ⁇ M 2-mercaptoethanol, L-glutamine and penicillin/streptomycin.
  • Recombinant human IL2 is added 24 hours later at a final concenfration of 200IU/ml and every three days thereafter with fresh media at 50IU/ml.
  • the cells are split if the cell concentration exceeds lxl0 6 /ml and the cultures are assayed between days 13 and 15 at E:T ratios of 30, 10, 3 and 1:1 in the 51 Cr release assay or at lxl0 ⁇ /ml in the in situ IFN ⁇ assay using the same targets as before the expansion.
  • Cultures are expanded in the absence of anti-CD3 + as follows. Those, cultures that demonstrate specific lytic activity against peptide and endogenous targets are selected and 5x10 CD8 cells are added to a T25 flask containing the following: l lO 6 autologous PBMC per ml which have been peptide-pulsed with 10 ⁇ g/ml peptide for two hours at 37°C and irradiated (4,200 rad); 2x10 5 frradiated (8,000 rad) EBV-fransformed cells per ml RPMI-1640 containing 10%(v/v) human AB serum, non-essential AA, sodium pyruvate, 25mM 2-ME, L-glutamine and gentamicin.
  • A2-supermotif cross-reactive binding peptides are tested in the cellular assay for the ability to induce peptide-specific CTL in normal individuals.
  • a peptide is typically considered to be an epitope if it induces peptide-specific CTLs in at least individuals, and preferably, also recognizes the endogenously expressed peptide.
  • PBMCs isolated from patients bearing a tumor that expresses 213P1F11. Briefly, PBMCs are isolated from patients, re-stimulated with peptide-pulsed monocytes and assayed for the ability to recognize peptide-pulsed target cells as well as transfected cells endogenously expressing the antigen.
  • HLA- A3 supermotif-bearing cross-reactive binding peptides are also evaluated for immunogenicity using methodology analogous for that used to evaluate the immunogenicity of the HLA-A2 supermotif peptides.
  • Example 15 Implementation of the Extended Supermotif to Improve the Binding Capacity of Native Epitopes by Creating Analogs
  • HLA motifs and supermotifs are useful in the identification and preparation of highly cross-reactive native peptides, as demonstrated herein.
  • the definition of HLA motifs and supermotifs also allows one to engineer highly cross-reactive epitopes by identifying residues within a native peptide sequence which can be analoged to confer upon the peptide certain characteristics, e.g. greater cross-reactivity within the group of HLA molecules that comprise a supertype, and/or greater binding affinity for some or all of those HLA molecules. Examples of analoging peptides to exhibit modulated binding affinity are set forth in this example.
  • Peptide engineering strategies are implemented to further increase the cross-reactivity of the epitopes.
  • the main anchors of A2-supermotif-bearing peptides are altered, for example, to introduce a preferred L, I, V, or M at position 2, and I or V at the C-terminus.
  • each engineered analog is initially tested for binding to the prototype A2 supertype allele A*Q201, then, if A*0201 binding capacity is maintained, for A2- supertype cross-reactivity.
  • a peptide is confirmed as binding one or all supertype members and then analoged to modulate binding affinity to any one (or more) of the supertype members to add population coverage.
  • the selection of analogs for immunogenicity in a cellular screening analysis is typically further restricted by the capacity of the parent wild type (WT) peptide to bind at least weakly, i.e., bind at an IC 50 of 5000nM or less, to three of more A2 supertype alleles.
  • WT wild type
  • the rationale for this requirement is that the WT peptides must be present endogenously in sufficient quantity to be biologically relevant.
  • Analoged peptides have been shown to have increased immunogenicity and cross-reactivity by T cells specific for the parent epitope (see, e.g., Parkhurst et al, J. Immunol. 157:2539, 1996; and Pogue et al, Proc. Natl Acad. Sci. USA 92:8166, 1995).
  • analog-specific CTLs are also able to recognize the wild-type peptide and, when possible, target cells that endogenously express the epitope.
  • Analogs of HLA-A3 supermotif-bearing epitopes are generated using strategies similar to those employed in analoging HLA-A2 supermotif-bearing peptides. For example, peptides binding to 3/5 of the A3 -supertype molecules are engineered at primary anchor residues to possess a preferred residue (V, S, M, or A) at position 2.
  • analog peptides are then tested for the ability to bind A*03 and A*l 1 (prototype A3 supertype alleles). Those peptides that demonstrate ⁇ 500 nM binding capacity are then confirmed as having A3- supertype cross-reactivity.
  • B7 supermotif-bearing peptides are, for example, engineered to possess a prefe ⁇ ed residue (V, I, L, or F) at the C-terminal primary anchor position, as demonstrated by Sidney et al (J. Immunol. 157:3480-3490, 1996).
  • analog-specific CTLs are also able to recognize the wild-type peptide and, when possible, targets that endogenously express the epitope.
  • HLA supermotifs are of value in engineering highly cross-reactive peptides and/or peptides that bind HLA molecules with increased affinity by identifying particular residues at secondary anchor positions that are associated with such properties. For example, the binding capacity of a B7 supermotif-bearing peptide with an F residue at position 1 is analyzed. The peptide is then analoged to, for example, substitute L for F at position 1. The analoged peptide is evaluated for increased binding affinity, binding half life and/or increased cross-reactivity. Such a procedure identifies analoged peptides with enhanced properties.
  • Engineered analogs with sufficiently improved binding capacity or cross-reactivity can also be tested for immunogenicity in HLA-B7-transgenic mice, following for example, IFA immunization or lipopeptide immunization.
  • Analoged peptides are additionally tested for the ability to stimulate a recall response using PBMC from patients with 213P1F11-expressing tumors.
  • cysteine has the propensity to form disulfide bridges and sufficiently alter the peptide structurally so as to reduce binding capacity.
  • substitution of ⁇ - amino butyric acid for cysteine not only alleviates this problem, but has been shown to improve binding and crossbinding capabilities in some instances (see, e.g., the review by Sette et al, In: Persistent Viral Infections, Eds. R. Ahmed and I. Chen, John Wiley & Sons, England, 1999).
  • the binding properties and/or cross-reactivity of peptide ligands for HLA supertype molecules can be modulated.
  • Example 16 Identification and confirmation of 213P1F11-derived sequences with HLA-DR binding motifs
  • Peptide epitopes bearing an HLA class II supermotif or motif are identified and confirmed as outlined below using methodology similar to that described for HLA Class I peptides.
  • a 213P1F11 antigen is analyzed for the presence of sequences bearing an HLA-DR-motif or supermotif. Specifically, 15-mer sequences are selected comprising a DR-supermotif, comprising a 9-mer core, and three-residue N- and C-terminal flanking regions (15 amino acids total).
  • Protocols for predicting peptide binding to DR molecules have been developed (Southwood et al, J. Immunol. 160:3363-3373, 1998). These protocols, specific for individual DR molecules, allow the scoring, and ranking, of 9-mer core regions. Each protocol not only scores peptide sequences for the presence of DR- supermotif primary anchors (i.e., at position 1 and position 6) within a 9-mer core, but additionally evaluates sequences for the presence of secondary anchors. Using allele-specific selection tables (see, e.g., Southwood et al, ibid.), it has been found that these protocols efficiently select peptide sequences with a high probability of binding a particular DR molecule. Additionally, it has been found that performing these protocols in tandem, specifically those for DR1, DR4w4, and DR7, can efficiently select DR cross-reactive peptides.
  • the 213P1F11-derived peptides identified above are tested for their binding capacity for various common HLA-DR molecules. All peptides are initially tested for binding to the DR molecules in the primary panel: DR1, DR4w4, and DR7. Peptides binding at least two of these three DR molecules are then tested for binding to DR2w2 ⁇ l, DR2w2 ⁇ 2, DR6wl9, and DR9 molecules in secondary assays. Finally, peptides binding at least two of the four secondary panel DR molecules, and thus cumulatively at least four of seven different DR molecules, are screened for binding to DR4wl5, DR5wl 1, and DR8w2 molecules in tertiary assays.
  • Peptides binding at least seven of the ten DR molecules comprising the primary, secondary, and tertiary screening assays are considered cross-reactive DR binders.
  • 213P1F11-derived peptides found to bind common HLA-DR alleles are of particular interest.
  • DR3 binding capacity is a relevant criterion in the selection of HTL epitopes.
  • peptides shown to be candidates may also be assayed for their DR3 binding capacity.
  • peptides binding only to DR3 can also be considered as candidates for inclusion in a vaccine formulation.
  • target 213P1F11 antigens are analyzed for sequences carrying one of the two DR3-specific binding motifs reported by Geluk et al. (J. Immunol 152:5742-5748, 1994).
  • the co ⁇ esponding peptides are then synthesized and confirmed as having the ability to bind DR3 with an affinity of 1 ⁇ M or better, i.e., less than 1 ⁇ M.
  • Peptides are found that meet this binding criterion and qualify as HLA class II high affinity binders.
  • DR3 binding epitopes identified in this manner are included in vaccine compositions with DR supermotif-bearing peptide epitopes.
  • the class II motif-bearing peptides are analoged to improve affinity or cross-reactivity.
  • aspartic acid at position 4 of the 9-mer core sequence is an optimal residue for DR3 binding, and substitution for that residue often improves DR 3 binding.
  • This example determines immunogenic DR supermotif- and DR3 motif-bearing epitopes among those identified using the methodology set forth herein.
  • Immunogenicity of HTL epitopes are confirmed in a manner analogous to the determination of immunogenicity of CTL epitopes, by assessing the ability to stimulate HTL responses and/or by using appropriate transgenic mouse models. Immunogenicity is determined by screening for: 1.) in vitro primary induction using normal PBMC or 2.) recall responses from patients who have 213P1F11-expressing tumors.
  • Example 18 Calculation of phenotypic frequencies of HLA-supertypes in various ethnic backgrounds to determine breadth of population coverage
  • This example illustrates the assessment of the breadth of population coverage of a vaccine composition comprised of multiple epitopes comprising multiple supermotifs and/or motifs.
  • the A3-like supertype may also include A34, A66, and A*7401, these alleles were not included in overall frequency calculations.
  • confirmed members of the A2-like supertype family are A*0201, A*0202, A*0203, A*0204, A*0205, A*0206, A*0207, A*6802, and A*6901.
  • the B7-like supertype-confirmed alleles are: B7, B*3501-03, B51, B*5301, B*5401, B*5501-2, B*5601, B*6701, and B*7801 (potentially also B*1401, B*3504-06, B*4201, and B*5602).
  • Population coverage achieved by combining the A2-, A3- and B7-supertypes is approximately 86% in five major ethnic groups. Coverage may be extended by including peptides bearing the Al and A24 motifs. On average, Al is present in 12% and A24 in 29% of the population across five different major ethnic groups (Caucasian, North American Black, Chinese, Japanese, and Hispanic). Together, these alleles are represented with an average frequency of 39% in these same ethnic populations. The total coverage across the major ethnicities when Al and A24 are combined with the coverage of the A2-, A3- and B7- supertype alleles is >95%. An analogous approach can be used to estimate population coverage achieved with combinations of class II motif-bearing epitopes.
  • an average population coverage is predicted to be greater than 95% in each of five major ethnic populations.
  • the game theory Monte Carlo simulation analysis which is known in the art (see e.g., Osborne, M.J. and Rubinstein, A. "A course in game theory” MIT Press, 1994), can be used to estimate what percentage of the individuals in a population comprised of the Caucasian, North American Black, Japanese, Chinese, and Hispanic ethnic groups would recognize the vaccine epitopes described herein. A preferred percentage is 90%. A more preferred percentage is 95%.
  • Effector cells isolated from transgenic mice that are immunized with peptide epitopes are re-stimulated in vitro using peptide-coated stimulator cells. Six days later, effector cells are assayed for cytotoxicity and the cell lines that contain peptide-specific cytotoxic activity are further re-stimulated. An additional six days later, these cell lines are tested for cytotoxic activity on 5I Cr labeled Jurkat-A2.1/K b target cells in the absence or presence of peptide, and also tested on 51 Cr labeled target cells bearing the endogenously synthesized antigen, i.e. cells that are stably transfected with 213P1F11 expression vectors.
  • transgenic mouse model The results demonsfrate that CTL lines obtained from animals primed with peptide epitope recognize endogenously synthesized 213P1F11 antigen.
  • the choice of transgenic mouse model to be used for such an analysis depends upon the epitope(s) that are being evaluated.
  • HLA-A*0201/K b transgenic mice several other transgenic mouse models including mice with human Al l, which may also be used to evaluate A3 epitopes, and B7 alleles have been characterized and others (e.g., transgenic mice for HLA-A1 and A24) are being developed.
  • HLA-DR1 and HLA-DR3 mouse models have also been developed, which may be used to evaluate HTL epitopes.
  • the vaccine composition used herein comprise peptides to be administered to a patient with a 213P1F11-expressing tumor.
  • the peptide composition can comprise multiple CTL and/or HTL epitopes.
  • the epitopes are identified using methodology as described herein.
  • This example also illustrates that enhanced immunogenicity can be achieved by inclusion of one or more HTL epitopes in a CTL vaccine composition; such a peptide composition can comprise an HTL epitope conjugated to a CTL epitope.
  • the CTL epitope can be one that binds to multiple HLA family members at an affinity of 500 nM or less, or analogs of that epitope.
  • the peptides may be lipidated, if desired.
  • mice which are transgenic for the human HLA A2.1 allele and are used to confirm the immunogenicity of HLA-A*0201 motif- or HLA-A2 supermotif-bearing epitopes, and are primed subcutaneously (base of the tail) with a 0.1 ml of peptide in Incomplete Freund's Adjuvant, or if the peptide composition is a lipidated CTL/HTL conjugate, in DMSO/saline, or if the peptide composition is a polypeptide, in PBS or Incomplete Freund's Adjuvant. Seven days after priming, splenocytes obtained from these animals are restimulated with syngenic irradiated LPS-activated lymphoblasts coated with peptide. ,
  • Target cells for peptide-specific cytotoxicity assays are Jurkat cells transfected with the HLA-A2.1/K b chimeric gene (e.g., Vitiello et al, J. Exp. Med. 173:1007, 1991)
  • spleen cells (30xlO ⁇ cells/flask) are co-cultured at 37°C with syngeneic, irradiated (3000 rads), peptide coated lymphoblasts (lOxlO 6 cells/flask) in 10 ml of culture medium/T25 flask. After six days, effector cells are harvested and assayed for cytotoxic activity.
  • Target cells 1.0 to 1.5xl0 6
  • Peptide is added where required at a concentration of 1 ⁇ g/ml.
  • 10 4 51 Cr-labeled target cells are added to different concentrations of effector cells (final volume of 200 ⁇ l) in U-bottom 96-well plates. After a six hour incubation period at 37°C, a 0.1 ml aliquot of supernatant is removed from each well and radioactivity is determined in a Micromedic automatic gamma counter.
  • % 51 Cr release data is expressed as lytic units/10 6 cells.
  • One lytic unit is arbitrarily defined as the number of effector cells required to achieve 30% lysis of 10,000 target cells in a six hour 5I Cr release assay.
  • the lytic units/10 6 obtained in the absence of peptide is subtracted from the lytic units/10 6 obtained in the presence of peptide.
  • results are analyzed to assess the magnitude of the CTL responses of animals injected with the immunogenic CTL/HTL conjugate vaccine preparation and are compared to the magnitude of the CTL response achieved using, for example, CTL epitopes as outlined above in the Example entitled "Confirmation of Immunogenicity.” Analyses similar to this may be performed to confirm the immunogenicity of peptide conjugates containing multiple CTL epitopes and/or multiple HTL epitopes. In accordance with these procedures, it is found that a CTL response is induced, and concomitantly that an HTL response is induced upon adminisfration of such compositions.
  • Example 21 Selection of CTL and HTL epitopes for inclusion in a 213PlFll-specific vaccine.
  • the peptides in the composition can be in the form of a nucleic acid sequence, either single or one or more sequences (i.e., minigene) that encodes peptide(s), or can be single and/or polyepitopic peptides.
  • the following principles are utilized when selecting a plurality of epitopes for inclusion in a vaccine composition. Each of the following principles is balanced in order to make the selection.
  • Epitopes are selected which, upon adminisfration, mimic immune responses that are correlated with 213P1F11 clearance.
  • the number of epitopes used depends on observations of patients who spontaneously clear 213P1F11. For example, if it has been observed that patients who spontaneously clear 213P1F11- expressing cells generate an immune response to at least three (3) from 213P1F11 antigen, then at least three epitopes should be included for HLA class I. A similar rationale is used to determine HLA class II epitopes.
  • Epitopes are often selected that have a binding affinity of an IC 50 of 500 nM or less for an HLA class I molecule, or for class II, an IC 50 of 1000 nM or less; or HLA Class I peptides with high binding scores from the BIMAS web site, at URL bimas.dcrt.nih.gov/.
  • sufficient supermotif bearing peptides or a sufficient a ⁇ ay of allele-specific motif bearing peptides, are selected to give broad population coverage.
  • epitopes are selected to provide at least 80% population coverage.
  • Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess breadth, or redundancy, of population coverage.
  • a protein sequence for the vaccine composition is selected because it has maximal number of epitopes contained within the sequence, i.e., it has a high concenfration of epitopes.
  • Epitopes may be nested or overlapping (i.e., frame shifted relative to one another).
  • two 9- mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide.
  • Each epitope can be exposed and bound by an HLA molecule upon administration of such a peptide.
  • a multi-epitopic, peptide can be generated synthetically, recombinantly, or via cleavage from the native source.
  • an analog can be made of this native sequence, whereby one or more of the epitopes comprise substitutions that alter the cross-reactivity and/or binding affinity properties of the polyepitopic peptide.
  • Such a vaccine composition is administered for therapeutic or prophylactic purposes.
  • This embodiment provides for the possibility that an as yet undiscovered aspect of immune system processing will apply to the native nested sequence and thereby facilitate the production of therapeutic or prophylactic immune response-inducing vaccine compositions. Additionally such an embodiment provides for the possibility of motif-bearing epitopes for an HLA makeup that is presently unknown. Furthermore, this embodiment (absent the creating of any analogs) directs the immune response to multiple peptide sequences that are actually present in 213P1F11, thus avoiding the need to evaluate any junctional epitopes. Lastly, the embodiment provides an economy of scale when producing nucleic acid vaccine compositions. Related to this embodiment, computer programs can be derived in accordance with principles in the art, which identify in a target sequence, the greatest number of epitopes per sequence length.
  • a vaccine composition comprised of selected peptides, when administered, is safe, efficacious, and elicits an immune response similar in magnitude to an immune response that controls or clears cells that bear or overexpress 213P1F11.
  • Minigene plasmids may, of course, contain various configurations of B cell, CTL and/or HTL epitopes or epitope analogs as described herein.
  • a minigene expression plasmid typically includes multiple CTL and HTL peptide epitopes.
  • HLA-A2, -A3, -B7 supermotif-bearing peptide epitopes and HLA-A1 and -A24 motif- bearing peptide epitopes are used in conjunction with DR supermotif-bearing epitopes and/or DR3 epitopes.
  • HLA class I supermotif or motif-bearing peptide epitopes derived 213P1F11 are selected such that multiple supermotifs/motifs are represented to ensure broad population coverage.
  • HLA class II epitopes are selected from 213P1F11 to provide broad population coverage, i.e.
  • both HLA DR- 1-4-7 supermotif-bearing epitopes and HLA DR-3 motif-bearing epitopes are selected for inclusion in the minigene construct: The selected CTL and HTL epitopes are then incorporated into a minigene for expression in an expression vector.
  • Such a construct may additionally include sequences that direct the HTL epitopes to the endoplasmic reticulum.
  • the Ii protein may be fused to one or more HTL epitopes as described in the art, wherein the CLIP sequence of the Ii protein is removed and replaced with an HLA class II epitope sequence so that HLA class II epitope is directed to the endoplasmic reticulum, where the epitope binds to an HLA class II molecules.
  • This example illustrates the methods to be used for construction of a minigene-bearing expression plasmid.
  • Other expression vectors that may be used for minigene compositions are available and known to those of skill in the art.
  • the minigene DNA plasmid of this example contains a consensus Kozak sequence and a consensus murine kappa Ig-light chain signal sequence followed by CTL and/or HTL epitopes selected in accordance with principles disclosed herein.
  • the sequence encodes an open reading frame fused to the Myc and His antibody epitope tag coded for by the pcDNA 3.1 Myc-His vector.
  • Overlapping oligonucleotides that can, for example, average about 70 nucleotides in length with 15 nucleotide overlaps, are synthesized and HPLC-purified.
  • the oligonucleotides encode the selected peptide epitopes as well as appropriate linker nucleotides, Kozak sequence, and signal sequence.
  • the final multiepitope minigene is assembled by extending the overlapping oligonucleotides in three sets of reactions using PCR.
  • a Perkin/Elmer 9600 PCR machine is used and a total of 30 cycles are performed using the following conditions: 95°C for 15 sec, annealing temperature (5° below the lowest calculated Tm of each primer pair) for 30 sec, and 72°C for 1 min.
  • the full-length dimer products are gel-purified, and two reactions containing the product of 1+2 and 3+4, and the product of 5+6 and 7+8 are mixed, annealed, and extended for 10 cycles. Half of the two reactions are then mixed, and 5 cycles of annealing and extension carried out before flanking primers are added to amplify the full length product.
  • the full-length product is gel-purified and cloned into pCR-blunt (Invitrogen) and individual clones are screened by sequencing.
  • Example 23 The Plasmid Construct and the Degree to Which It Induces Immunogenicity.
  • a plasmid construct for example a plasmid constructed in accordance with the previous Example, is able to induce immunogenicity is confirmed in vitro by determining epitope presentation by APC following transduction or transfection of the APC with an epitope-expressing nucleic acid construct. Such a study determines "antigenicity" and allows the use of human APC.
  • the assay determines the ability of the epitope to be presented by the APC in a context that is recognized by a T cell by quantifying the density of epitope-HLA class I complexes on the cell surface. Quantitation can be performed by directly measuring the amount of peptide eluted from the APC (see, e.g., Sijts et al, J.
  • immunogenicity is confirmed through in vivo injections into mice and subsequent in vitro assessment of CTL and HTL activity, which are analyzed using cytotoxicity and proliferation assays, respectively, as detailed e.g., in Alexander et al, Immunity 1:751-761, 1994.
  • HLA-A2.1/K b transgenic mice for example, are immunized intramuscularly with 100 ⁇ g of naked cDNA.
  • a control group of animals is also immunized with an actual peptide composition that comprises multiple epitopes synthesized as a single polypeptide as they would be encoded by the minigene.
  • Splenocytes from immunized animals are stimulated twice with each of the respective compositions (peptide epitopes encoded in the minigene or the polyepitopic peptide), then assayed for peptide-specific cytotoxic activity in a 51 Cr release assay.
  • the results indicate the magnitude of the CTL response directed against the A2-restricted epitope, thus indicating the in vivo immunogenicity of the minigene vaccine and polyepitopic vaccine.
  • the minigene elicits immune responses directed toward the HLA-A2 supermotif peptide epitopes as does the polyepitopic peptide vaccine.
  • a similar analysis is also performed using other HLA-A3 and HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 and HLA- B7 motif or supermotif epitopes, whereby it is also found that the minigene elicits appropriate immune responses directed toward the provided epitopes.
  • I-A b - resfricted mice are immunized intramuscularly with 100 ⁇ g of plasmid DNA.
  • a group of confrol animals is also immunized with an actual peptide composition emulsified in complete Freund's adjuvant.
  • CD4+ T cells i.e.
  • HTLs are purified from splenocytes of immunized animals and stimulated with each of the respective compositions (peptides encoded in the minigene).
  • the HTL response is measured using a 3 H-thymidine incorporation proliferation assay, (see, e.g., Alexander et al Immunity 1:751-761, 1994). The results indicate the magnitude of the HTL response, thus demonstrating the in vivo immunogenicity of the minigene.
  • DNA minigenes constructed as described in the previous Example, can also be confirmed as a vaccine in combination with a boosting agent using a prime boost protocol.
  • the boosting agent can consist of recombinant protein (e.g., Barnett et al, Aids Res. and Human Refroviruses 14, Supplement 3:S299-S309, 1998) or recombinant vaccinia, for example, expressing a minigene or DNA encoding the complete protein of interest (see, e.g., Hanke et al, Vaccine 16:439-445, 1998; Sedegah et al, Proc. Natl. Acad. Sci USA 95:7648-53, 1998; Hanke and McMichael, Immunol. Letters 66:177-181, 1999; and Robinson et al, Nature Med. 5:526-34, 1999).
  • recombinant protein e.g., Barnett et al, Aids Res. and Human Refroviruses 14, Supplement 3
  • the efficacy of the DNA minigene used in a prime boost protocol is initially evaluated- in transgenic mice.
  • A2.1/K b transgenic mice are immunized IM with 100 ⁇ g of a DNA minigene encoding the immunogenic peptides including at least one HLA-A2 supermotif-bearing peptide.
  • the mice are boosted IP with 10 7 pfu/mouse ofa recombinant vaccinia virus expressing the same sequence encoded by the DNA minigene.
  • mice are immunized with 100 ⁇ g of DNA or recombinant vaccinia without the minigene sequence, or with DNA encoding the minigene, but without the vaccinia boost. After an additional incubation period of two weeks, splenocytes from the mice are immediately assayed for peptide-specific activity in an ELISPOT assay. Additionally, splenocytes are stimulated in vitro with the A2-restricted peptide epitopes encoded in the minigene and recombinant vaccinia, then assayed for peptide-specific activity in an alpha, beta and/or gamma IFN ELISA.
  • Vaccine compositions of the present invention can be used to prevent 213P1F11 expression in persons who are at risk for tumors that bear this antigen.
  • a polyepitopic peptide epitope composition (or a nucleic acid comprising the same) containing multiple CTL and HTL epitopes such as those selected in the above Examples, which are also selected to target greater than 80% of the population, is administered to individuals at risk for a 213PlFll-associated tumor.
  • a peptide-based composition is provided as a single polypeptide that encompasses multiple epitopes.
  • the vaccine is typically administered in a physiological solution that comprises an adjuvant, such as Incomplete Freunds Adjuvant.
  • the dose of peptide for the initial immunization is from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
  • the initial administration of vaccine is followed by booster dosages at 4 weeks followed by evaluation of the magnitude of the immune response in the patient, by techniques that determine the presence of epitope-specific CTL populations in a PBMC sample. Additional booster doses are administered as required.
  • the composition is found to be both safe and efficacious as a prophylaxis against 213P1F11 -associated disease.
  • composition typically comprising transfecting agents is used for the adminisfration of a nucleic acid-based vaccine in accordance with methodologies known in the art and disclosed herein.
  • Example 25 Polyepitopic Vaccine Compositions Derived from Native 213P1F11 Sequences
  • a native 213P1F11 polyprotein sequence is analyzed, preferably using computer algorithms defined for each class I and/or class II supermotif or motif, to identify "relatively short” regions of the polyprotein that comprise multiple epitopes.
  • the "relatively short” regions are preferably less in length than an entire native antigen. This relatively short sequence that contains multiple distinct or overlapping, "nested” epitopes is selected; it can be used to generate a minigene construct.
  • the construct is engineered to express the peptide, which corresponds to the native protein sequence.
  • the "relatively short” peptide is generally less than 250 amino acids in length, often less than 100 amino acids in length, preferably less than 75 amino acids in length, and more preferably less than 50 amino acids in length.
  • the protein sequence of the vaccine composition is selected because it has maximal number of epitopes contained within the sequence, i.e., it has a high concentration of epitopes.
  • epitope motifs may be nested or overlapping (i.e., frame shifted relative to one another). For example, with overlapping epitopes, two 9-mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide. Such a vaccine composition is administered for therapeutic or prophylactic purposes.
  • the vaccine composition will include, for example, multiple CTL epitopes from 213P1F11 antigen and at least one HTL epitope.
  • This polyepitopic native sequence is administered either as a peptide or as a nucleic acid sequence which encodes the peptide.
  • an analog can be made of this native sequence, whereby one or more of the epitopes comprise substitutions that alter the cross-reactivity and/or binding affinity properties of the polyepitopic peptide.
  • the embodiment of this example provides for the possibility that an as yet undiscovered aspect of immune system processing will apply to the native nested sequence and thereby facilitate the production of therapeutic or prophylactic immune response-inducing vaccine compositions. Additionally such an embodiment provides for the possibility of motif-bearing epitopes for an HLA makeup(s) that is presently unknown. Furthermore, this embodiment (excluding an analoged embodiment) directs the immune response to multiple peptide sequences that are actually present in native 213P1F11, thus avoiding the need to evaluate any junctional epitopes. Lastly, the embodiment provides an economy of scale when producing peptide or nucleic acid vaccine compositions.
  • Example 26 Polyepitopic Vaccine Compositions From Multiple Antigens
  • the 213P1F11 peptide epitopes of the present invention are used in conjunction with epitopes from other target tumor-associated antigens, to create a vaccine composition that is useful for the prevention or freatment of cancer that expresses 213P1F11 and such other antigens.
  • a vaccine composition can be provided as a single polypeptide that incorporates multiple epitopes from 213P1F11 as well as tumor- associated antigens that are often expressed with a target cancer associated with 213P1F11 expression, or can be administered as a composition comprising a cocktail of one or more discrete epitopes.
  • the vaccine can be administered as a minigene construct or as dendritic cells which have been loaded with the peptide epitopes in vitro.
  • Example 27 Use of peptides to evaluate an immune response
  • Peptides of the invention may be used to analyze an immune response for the presence of specific antibodies, CTL or HTL directed to 213P1F11. Such an analysis can be performed in a manner described by Ogg et al, Science 279:2103-2106, 1998.
  • peptides in accordance with the invention are used as a reagent for diagnostic or prognostic purposes, not as an immunogen.
  • teframers highly sensitive human leukocyte antigen tetrameric complexes
  • teframers highly sensitive human leukocyte antigen tetrameric complexes
  • 213P1F11 HLA-A*0201-specific CTL frequencies from HLA A*0201-positive individuals at different stages of disease or following immunization comprising a 213P1F11 peptide containing an A*0201 motif.
  • Tetrameric complexes are synthesized as described (Musey et al, N. Engl J. Med. 337: 1267, 1997). Briefly, purified HLA heavy chain (A*0201 in this example) and ⁇ 2-microglobulin are synthesized by means of a prokaryotic expression system.
  • the heavy chain is modified by deletion of the fransmembrane-cytosolic tail and COOH-terminal addition ofa sequence containing a BirA enzymatic biotinylation site.
  • the heavy chain, ⁇ 2-microglobulin, and peptide are refolded by dilution.
  • the 45-kD refolded product is isolated by fast protein liquid chromatography and then biotinylated by BirA in the presence of biotin (Sigma, St. Louis, Missouri), adenosine 5' triphosphate and magnesium.
  • Sfreptavidin- phycoerythrin conjugate is added in a 1:4 molar ratio, and the tetrameric product is concentrated to 1 mg/ml.
  • the resulting product is referred to as teframer-phycoerythrin.
  • PBMCs For the analysis of patient blood samples, approximately one million PBMCs are centrifuged at 300g for 5 minutes and resuspended in 50 ⁇ l of cold phosphate-buffered saline. Tri-color analysis is performed with the teframer-phycoerythrin, along with anti-CD8-Tricolor, and anti-CD38. The PBMCs are incubated with teframer and antibodies on ice for 30 to 60 min and then washed twice before formaldehyde fixation. Gates are applied to contain >99.98% of control samples. Controls for the teframers include both A*0201- negative individuals and A*0201 -positive non-diseased donors.
  • the percentage of cells stained with the teframer is then determined by flow cytometry.
  • the results indicate the number of cells in the PBMC sample that contain epitope-restricted CTLs, thereby readily indicating the extent of immune response to the 213P1F11 epitope, and thus the status of exposure to 213P1F11, or exposure to a vaccine that elicits a protective or therapeutic response.
  • the peptide epitopes of the invention are used as reagents to evaluate T cell responses, such as acute or recall responses, in patients. Such an analysis may be performed on patients who have recovered from 213P1F11-associated disease or who have been vaccinated with a 213P1F11 vaccine.
  • the class I restricted CTL response of persons who have been vaccinated may be analyzed.
  • the vaccine may be any 213P1F11 vaccine.
  • PBMC are collected from vaccinated individuals and HLA typed.
  • Appropriate peptide epitopes of the invention that, optimally, bear supermotifs to provide cross- reactivity with multiple HLA supertype family members, are then used for analysis of samples derived from individuals who bear that HLA type.
  • PBMC from vaccinated individuals are separated on Ficoll-Histopaque density gradients (Sigma Chemical Co., St. Louis, MO), washed three times in HBSS (GIBCO Laboratories), resuspended in RPMI- 1640 (GIBCO Laboratories) supplemented with L-glutamine (2mM), penicillin (50U/ml), streptomycin (50 ⁇ g/ml), and Hepes (lOmM) containing 10% heat-inactivated human AB serum (complete RPMI) and plated using microculture formats.
  • a synthetic peptide comprising an epitope of the invention is added at 10 ⁇ g/ml to each well and HBV core 128-140 epitope is added at 1 ⁇ g/ml to each well as a source of T cell help during the first week of stimulation.
  • a positive CTL response requires two or more of the eight replicate cultures to display greater than 10% specific 5l Cr release, based on comparison with non-diseased confrol subjects as previously described (Rehermann, et al, Nature Med. 2:1104,1108, 1996; Rehermann et al, J. Clin. Invest. 97:1655-1665, 1996; and Rehermann et al J. Clin. Invest. 98:1432-1440, 1996).
  • Target cell lines are autologous and allogeneic EBV-fransformed B-LCL that are either purchased from the American Society for Histocompatibility and Immunogenetics (ASHI, Boston, MA) or established from the pool of patients as described (Guilhot, et al. J. Virol. 6 " 6:2670-2678, 1992).
  • Target cells consist of either allogeneic HLA-matched or autologous EBV-fransformed B lymphoblastoid cell line that are incubated overnight with the synthetic peptide epitope of the invention at 10 ⁇ M, and labeled with 100 ⁇ Ci of 51 Cr (Amersham Corp., Arlington Heights, IL) for 1 hour after which they are washed four times with HBSS.
  • Cytolytic activity is determined in a standard 4-h, split well 5I Cr release assay using U-bottomed 96 well plates containing 3,000 targets/well. Stimulated PBMC are tested at effector/target (E/T) ratios of 20- 50: 1 on day 14. Percent cytotoxicity is determined from the formula: 100 x [(experimental release- spontaneous release)/maximum release-spontaneous release)]. Maximum release is determined by lysis of targets by detergent (2% Triton X-100; Sigma Chemical Co., St. Louis, MO). Spontaneous release is ⁇ 25% of maximum release for all experiments.
  • results of such an analysis indicate the extent to which HLA-restricted CTL populations have been stimulated by previous exposure to 213P1F11 or a 213P1F11 vaccine.
  • Class II restricted HTL responses may also be analyzed.
  • Purified PBMC are cultured in a 96-well flat bottom plate at a density of 1.5xl0 5 cells/well and are stimulated with 10 ⁇ g/ml synthetic peptide of the invention, whole 213P1F11 antigen, or PHA. Cells are routinely plated in replicates of 4-6 wells for each condition. After seven days of culture, the medium is removed and replaced with fresh medium containing lOU/ml IL-2. Two days later, 1 ⁇ Ci 3 H-thymidine is added to each well and incubation is continued for an additional 18 hours. Cellular DNA is then harvested on glass fiber mats and analyzed for 3 H-thymidine incorporation. Antigen-specific T cell proliferation is calculated as the ratio of 3 H-thymidine incorporation in the presence of antigen divided by the 3 H-thymidine incorporation in the absence of antigen.
  • a human clinical trial for an immunogenic composition comprising CTL and HTL epitopes of the invention is set up as an IND Phase I, dose escalation study and carried out as a randomized, double-blind, placebo-controlled trial.
  • Such a trial is designed, for example, as follows:
  • a total of about 27 individuals are enrolled and divided into 3 groups:
  • Group I 3 subjects are injected with placebo and 6 subjects are injected with 5 ⁇ g of peptide composition
  • Group II 3 subjects are injected with placebo and 6 subjects are injected with 50 ⁇ g peptide composition;
  • Group III 3 subjects are injected with placebo and 6 subjects are injected with 500 ⁇ g of peptide composition.
  • the endpoints measured in this study relate to the safety and tolerability of the peptide composition as well as its immunogenicity.
  • Cellular immune responses to the peptide composition are an index of the intrinsic activity of this the peptide composition, and can therefore be viewed as a measure of biological efficacy.
  • Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll- Hypaque density gradient centrifugation, aliquoted in freezing media and stored frozen. Samples are assayed for CTL and HTL activity.
  • Example 30 Phase II Trials In Patients Expressing 213P1F11
  • Phase II trials are performed to study the effect of administering the CTL-HTL peptide compositions to patients having cancer that expresses 213P1F11.
  • the main objectives of the trial are to determine an effective dose and regimen for inducing CTLs in cancer patients that express 213P1F11, to establish the safety of inducing a CTL and HTL response in these patients, and to see to what extent activation of CTLs improves the clinical picture of these patients, as manifested, e.g., by the reduction and/or shrinking of lesions.
  • Such a study is designed, for example, as follows:
  • the studies are performed in multiple centers.
  • the trial design is an open-label, uncontrolled, dose escalation protocol wherein the peptide composition is administered as a single dose followed six weeks later by a single booster shot of the same dose.
  • the dosages are 50, 500 and 5,000 micrograms per injection. Drug-associated adverse effects (severity and reversibility) are recorded.
  • the first group is injected with 50 micrograms of the peptide composition and the second and third groups with 500 and 5,000 micrograms of peptide composition, respectively.
  • the patients within each group range in age from 21-65 and represent diverse ethnic backgrounds. All of them have a tumor that expresses 213P1F11.
  • the vaccine composition is found to be both safe and efficacious in the freatment of 213P1F11-associated disease.
  • a prime boost protocol similar in its underlying principle to that used to confirm the efficacy of a DNA vaccine in transgenic mice, such as described above in the Example entitled "The Plasmid Construct and the Degree to Which It Induces Immunogenicity,” can also be used for the administration of the vaccine to humans.
  • Such a vaccine regimen can include an initial administration of, for example, naked DNA followed by a boost using recombinant virus encoding the vaccine, or recombinant protein/polypeptide or a peptide mixture administered in an adjuvant.
  • the initial immunization may be performed using an expression vector, such as that constructed in the Example entitled "Construction of "Minigene” Multi-Epitope DNA Plasmids” in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
  • the nucleic acid (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
  • a booster dose is then administered.
  • the booster can be recombinant fowlpox virus administered at a dose of 5-10 7 to 5xl0 9 pfu.
  • An alternative recombinant virus such as an MVA, canarypox, adenovirus, or adeno-associated virus, can also be used for the booster, or the polyepitopic protein or a mixture of the peptides can be administered.
  • an MVA, canarypox, adenovirus, or adeno-associated virus can also be used for the booster, or the polyepitopic protein or a mixture of the peptides can be administered.
  • patient blood samples are obtained before immunization as well as at intervals following adminisfration of the initial vaccine and booster doses of the vaccine.
  • Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted in freezing media and stored frozen. Samples are assayed for CTL and HTL activity.
  • Example 32 Administration of Vaccine Compositions Using Dendritic Cells (DC)
  • Vaccines comprising peptide epitopes of the invention can be admimstered using APCs, or "professional" APCs such as DC.
  • peptide-pulsed DC are administered to a patient to stimulate a CTL response in vivo.
  • dendritic cells are isolated, expanded, and pulsed with a vaccine comprising peptide CTL and HTL epitopes of the invention.
  • the dendritic cells are infused back into the patient to elicit CTL and HTL responses in vivo.
  • the induced CTL and HTL then destroy or facilitate destruction, respectively, of the target cells that bear the 213P1F11 protein from which the epitopes in the vaccine are derived.
  • a cocktail of epitope-comprising peptides is administered ex vivo to PBMC, or isolated DC therefrom.
  • a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Monsanto, St. Louis, MO) or GM-CSF/IL-4. After pulsing the DC with peptides, and prior to reinfiision into patients, the DC are washed to remove unbound peptides.
  • the number of DC reinfused into the patient can vary (see, e.g., Nature Med. 4:328, 1998; Nature Med. 2:52, 1996 and Prostate 32:272, 1997). Although 2-50 x 10 6 DC per patient are typically administered, larger number of DC, such as 10 7 or 10 8 can also be provided. Such cell populations typically contain between 50- 90% DC.
  • peptide-loaded PBMC are injected into patients without purification of the DC.
  • PBMC generated after freatment with an agent such as ProgenipoietinTM are injected into patients without purification of the DC.
  • the total number of PBMC that are admimstered often ranges from 10 8 to 10 10 .
  • the cell doses injected into patients is based on the percentage of DC in the blood of each patient, as determined, for example, by immunofluorescence analysis with specific anti-DC antibodies.
  • ProgenipoietinTM mobilizes 2% DC in the peripheral blood ofa given patient, and that patient is to receive 5 x 10 ⁇ DC, then the patient will be injected with a total of 2.5 x 10 8 peptide-loaded PBMC.
  • the percent DC mobilized by an agent such as ProgenipoietinTM is typically estimated to be between 2-10%, but can vary as appreciated by one of skill in the art.
  • ex vivo CTL or HTL responses to 213P1F11 antigens can be induced by incubating, in tissue culture, the patient's, or genetically compatible, CTL or HTL precursor cells together with a source of APC, such as DC, and immunogenic peptides. After an appropriate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded into effector cells, the cells are infused into the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their specific target cells, i.e., tumor cells.
  • CTL destroy
  • HTL facilitate destruction
  • Example 33 An Alternative Method of Identifying and Confirming Motif-Bearing Peptides
  • Another method of identifying and confirming motif-bearing peptides is to elute them from cells bearing defined MHC molecules.
  • EBV transformed B cell lines used for tissue typing have been extensively characterized to determine which HLA molecules they express. In certain cases these cells express only a single type of HLA molecule.
  • These cells can be transfected with nucleic acids that express the antigen of interest, e.g. 213P1F11. Peptides produced by endogenous antigen processing of peptides produced as a result of transfection will then bind to HLA molecules within the cell and be transported and displayed on the cell's surface.
  • Peptides are then eluted from the HLA molecules by exposure to mild acid conditions and their amino acid sequence determined, e.g., by mass spectral analysis (e.g., Kubo et al, J. Immunol. 152:3913, 1994). Because the majority of peptides that bind a particular HLA molecule are motif- bearing, this is an alternative modality for obtaining the motif-bearing peptides co ⁇ elated with the particular HLA molecule expressed on the cell.
  • cell lines that do not express endogenous HLA molecules can be transfected with an expression construct encoding a single HLA allele. These cells can then be used as described, i.e., they can then be transfected with nucleic acids that encode 213P1F11 to isolate peptides co ⁇ esponding to 213P1F11 that have been presented on the cell surface. Peptides obtained from such an analysis will bear motif(s) that correspond to binding to the single HLA allele that is expressed in the cell.
  • Sequences complementary to the 213P1F11 -encoding sequences, or any parts thereof, are used to detect, decrease, or inhibit expression of naturally occurring 213P1F11.
  • oligonucleotides comprising from about 15 to 30 base pairs is described, essentially the same procedure is used with smaller or with larger sequence fragments.
  • Appropriate oligonucleotides are designed using, e.g., OLIGO 4.06 software (National Biosciences) and the coding sequence of 213P1F11.
  • a complementary oligonucleotide is designed from the most unique 5' sequence and used to prevent promoter binding to the coding sequence.
  • a complementary oligonucleotide is designed to prevent ribosomal binding to a 213P1F11-encoding franscript.
  • Example 35 Purification of Naturally-occurring or Recombinant 213P1F11 Using 213P1F11- Specific Antibodies
  • Naturally occurring or recombinant 213P1F11 is substantially purified by immunoafffriity chromatography using antibodies specific for 213P1F11.
  • An immunoaffinity column is constructed by covalently coupling anti-213PlFl 1 antibody to an activated chromatographic resin, such as CNBr-activated SEPHAROSE (Amersham Pharmacia Biotech). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
  • Media containing 213P1F11 are passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of 213P1F11 (e.g., high ionic strength buffers in the presence of detergent).
  • the column is eluted under conditions that disrupt antibody/213PlFll binding (e.g., a buffer of pH 2 to pH 3, or a high concentration ofa chaofrope, such as urea or thiocyanate ion), and GCR.P is collected.
  • Example 36 Identification of Molecules Which Interact with 213P1F11
  • 213P1F11 or biologically active fragments thereof, are labeled with 121 1 Bolton-Hunter reagent.
  • Bolton-Hunter reagent See, e.g., Bolton et al. (1973) Biochem. J. 133:529.
  • Candidate molecules previously a ⁇ ayed in the wells of a multi-well plate are incubated with the labeled 213P1F11, washed, and any wells with labeled 213P1F11 complex are assayed. Data obtained using different concentrations of 213P1F11 are used to calculate values for the number, affinity, and association of 213P1F11 with the candidate molecules.
  • the effect of the 213P1F11 protein on tumor cell growth is evaluated in vivo by evaluating tumor development and growth of cells expressing or lacking 213P1F11.
  • SCID mice are injected subcutaneously on each flank with 1 x 106 of either prostate, bladder or breast cancer cell lines (such as PC3, DU145, UM-UC3, J82, MCF7) or NIH-3T3 cells containing tkNeo empty vector or 213P1F11.
  • At least two strategies may be used: (1) Constitutive 213P1F11 expression under regulation of a promoter such as a constitutive promoter obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a refrovirus, hepatitis-B vires and Simian Virus 40 (SV40), or from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, provided such promoters are compatible with the host cell systems, and (2) Regulated expression under confrol of an inducible vector system, such as ecdysone, tet, etc., provided such promoters are compatible with the host cell systems.
  • a promoter such as a constitutive promoter obtained from the genomes of viruses such as
  • Tumor volume is then monitored at the appearance of palpable tumors and followed over time to determine if 213P IF 11-expressing cells grow at a faster rate and whether tumors produced by 213P IF 11-expressing cells demonstrate characteristics of altered aggressiveness (e.g. enhanced metastasis, vascularization, reduced responsiveness to chemotherapeutic drugs).
  • mice can be implanted with 1 x 105 of the same cells orthotopically to determine if 213P1F11 has an effect on local growth in the prostate or on the ability of the cells to metastasize, specifically to lungs, lymph nodes, and bone marrow.
  • the assay is also useful to determine the 213P1F11 inhibitory effect of candidate therapeutic compositions, such as for example, 213P1F11 infrabodies, 213P1F11 antisense molecules and ribozymes.
  • Example 38 213P1F11 Monoclonal Antibody-mediated Inhibition of Tumors In Vivo
  • 213P1F11 The significant expression of 213P1F11 in cancer tissues, together with its restricted expression in normal tissues, makes 213P1F11 an excellent target for antibody therapy.
  • the monoclonal antibody target is a cell surface protein
  • antibodies have been shown to be efficacious at inhibiting tumor growth (See, e.g., (Saffian, D., et al, PNAS 10:1073-1078 or the World Wide Web at .pnas.org/cgi/doi/10.1073/pnas.051624698).
  • 213P1F11 is a target for T cell-based immunotherapy.
  • Antibody efficacy on tumor growth and metastasis formation is confirmed, e.g., in a mouse orthotopic prostate or bladder cancer xenograft models, as well as SCID mice injected with prostate, bladder and breast cancer cell lines, such as those described in the Example entitled "In Vivo Assay for 213P1F11 Tumor Growth Promotion," designed to express or lack 213P1F11.
  • Therapeutic efficacy of anti-213PlFl 1 mAbs in prostate cancer is also evaluated in human prostate xenograft mouse models sucha s the LAPC-9 xenografts (Craft, N., et al.,. Cancer Res, 1999. 59(19): p. 5030-6).
  • the antibodies can be unconjugated, as discussed in this Example, or can be conjugated to a therapeutic modality, as appreciated in the art. It is confirmed that anti-213PlFl 1 mAbs inhibit formation of 213P1F11-expressing tumors. Anti-213P1F11 mAbs inhibit formation of the androgen-independent LAPC-9- Al tumor xenografts, as well as PC3- 213P1F11, MCF7-213P1F11 and UM-UC3-213P1F11 tumors. Anti-213P1F11 mAbs also retard the growth of established orthotopic tumors and prolong survival of tumor-bearing mice.
  • Monoclonal antibodies are raised against 213P1F11 as described in the Example entitled "Generation of 213P1F11 Monoclonal Antibodies (mAbs)."
  • the antibodies are characterized by ELISA, Western blot, FACS, and immunoprecipitation , in accordance with techniques known in the art, for their capacity to bind 213P1F11.
  • Epitope mapping data for the anti-213PlFl 1 mAbs as determined by ELISA and Western analysis, recognize epitopes on the 213P IF 11 protein. Immunohistochemical analysis of bladder cancer tissues and cells with these antibodies is performed.
  • the monoclonal antibodies are purified from ascites or hybridoma tissue culture supematants by Protein-G Sepharose chromatography, dialyzed against PBS, filter sterilized, and stored at -20°C. Protein determinations are performed by a Bradford assay (Bio-Rad, Hercules, CA). A therapeutic monoclonal antibody or a cocktail comprising a mixture of individual monoclonal antibodies is prepared and used for the treatment of mice receiving subcutaneous or orthotopic injections of bladder tumor xenografts. Cancer Xenograft and Cell Lines
  • the LAPC-9 xenograft which expresses a wild-type androgen receptor and produces prostate- specific antigen (PSA), is passaged in 6- to 8-week-old male ICR-severe combined immunodeficient (SCID) mice (Taconic Farms) by s.c. trocar implant (Craft, N., et al., supra).
  • Prostate, bladder or breast cancer cell lines (such as PC3, DU145, UM-UC3, J82, MCF7) expressing 213P1F11 are generated by retroviral gene transfer as described in Hubert, R.S., et al., STEAP: a prostate-specific cell-surface antigen highly expressed in human prostate tumors. Proc Natl Acad Sci U S A, 1999.
  • Anti-213P1F11 staining is detected by using an FITC-conjugated goat anti-mouse antibody (Southern Biotechnology Associates) followed by analysis on a Coulter Epics-XL flow cytometer.
  • Subcutaneous (s.c.) tumors are generated by injection of 1 x 10 6 213P1F11-expressing cancer cells mixed at a 1 : 1 dilution with Matrigel (Collaborative Research) in the right flank of male SCID mice.
  • i.p. antibody injections are started on the same day as tumor-cell injections.
  • mice are injected with either purified mouse IgG (ICN) or PBS; or a purified monoclonal antibody that recognizes an i ⁇ eleva ⁇ t antigen not expressed in human cells. In preliminary studies, no difference is found between mouse IgG or PBS on tumor growth.
  • Tumor sizes are determined by vernier caliper measurements, and the tumor volume is calculated as length x width x height. Mice with s.c. tumors greater than 1.5 cm in diameter are sacrificed. Circulating levels of anti-213PlFl 1 mAbs are determined by a capture ELISA kit (Bethyl Laboratories, Montgomery, TX). (See, e.g., (Saffran, D., et al., PNAS 10:1073-1078)
  • Orthotopic injections are performed, for example, in two alternative embodiments, under anesthesia by, for example, use of ketamine/xylazine.
  • an infravesicular injection of bladder cancer cells is administered directly through the urethra and into the bladder (Peralta, E. A., et al, J. Urol., 1999. 162:1806-1811).
  • an incision is made through the abdominal wall, the bladder is exposed, and bladder tumor tissue pieces (1-2 mm in size) derived from a s.c. tumor are surgically glued onto the exterior wall of the bladder, termed "onplantation" (Fu, X., et al, Int. J. Cancer, 1991.
  • Antibodies can be administered to groups of mice at the time of tumor injection or onplantation, or after 1-2 weeks to allow tumor establishment.
  • the effect of anti-213PlFl 1 mAbs on tumor formation is tested by using the prostate and bladder orthotopic models.
  • the orthotopic model which requires surgical attachment of tumor tissue directly on the prostate or bladder, results in a local tumor growth, development of metastasis in distal sites, and subsequent death (Fu, X., et al, Int. J. Cancer, 1991. 49: p. 938-939; Chang, S., et al, Anticancer Res., 1997. 17: p. 3239-3242).
  • This feature make the orthotopic model more representative of human disease progression and allows one to follow the therapeutic effect of mAbs, as well as other therapeutic modalities, on clinically relevant end points.
  • 213P1F11-expressing tumor cells are implanted orthotopically, and 2 days later, the mice are segregated into two groups and treated with either: a) 50-2000 ⁇ g, usually 200-500 ⁇ g, of anti- 213P1F11 Ab, or b) PBS, three times per week for two to five weeks. Mice are monitored weekly for indications of tumor growth.
  • a major advantage of the orthotopic prostate and bladder cancer models is the ability to study the development of metastases. Formation of metastasis in mice bearing established orthotopic tumors is studied by histological analysis of tissue sections, including lung and lymph nodes (Fu, X., et al., Int. J. Cancer, 1991. 49:938-939; Chang, S., et al, Anticancer Res., 1997. 17:3239-3242). Additionally, IHC analysis using anti-213PlFl 1 antibodies can be performed on the tissue sections.
  • mice bearing established orthotopic 213P1F11-expressing tumors are administered lOOO ⁇ g injections of either anti-213PlFl 1 mAb or PBS over a 4-week period.
  • Mice in both groups are allowed to establish a high tumor burden (1-2 weeks growth), to ensure a high frequency of metastasis formation in mouse lungs and lymph nodes. Mice are then sacrificed and their local bladder tumor and lung and lymph node tissue are analyzed for the presence of tumor cells by histology and IHC analysis.
  • anti-213P1F11 antibodies inhibit tumor formation and retard the growth of already established tumors and prolong the survival of treated mice.
  • anti- 213P1F11 mAbs demonsfrate a dramatic inhibitory effect on the spread of local prostate, bladder and breast tumors to distal sites, even in the presence ofa large tumor burden.
  • anti-213PlFl 1 mAbs are efficacious on major clinically relevant end points including lessened tumor growth, lessened metastasis, and prolongation of survival.
  • Example 39 Therapeutic and Diagnostic use of Anti-213P1F11 Antibodies in Humans.
  • Anti-213P1F11 monoclonal antibodies are safely and effectively used for diagnostic, prophylactic, prognostic and/or therapeutic purposes in humans.
  • Western blot and immunohistochemical analysis of cancer tissues and cancer xenografts with anti-213PlFl 1 mAb show strong extensive staining in carcinoma but significantly lower or undetectable levels in normal tissues.
  • Detection of 213P1F11 in carcinoma and in metastatic disease demonstrates the usefulness of the mAb as a diagnostic and/or prognostic indicator.
  • Anti- 213P1F11 antibodies are therefore used in diagnostic applications such as immunohistochemistry of kidney biopsy specimens to detect cancer from suspect patients.
  • anti-213PlFl 1 mAb specifically binds to carcinoma cells.
  • anti-213PlFl 1 antibodies are used in diagnostic whole body imaging applications, such as radioimmunoscintigraphy and radioimmunotherapy, (see, e.g., Potamianos S., et. al. Anticancer Res 20(2A):925-948 (2000)) for the detection of localized and metastatic cancers that exhibit expression of 213P 1 F 11. Shedding or release of an exfracellular domain of 213P 1 F 11 into the extracellular milieu, such as that seen for alkaline phosphodiesterase B10 (Meerson, N. R., Hepatology 27:563-568 (1998)), allows diagnostic detection of 213P IF 11 by anti-213PlFl 1 antibodies in serum and/or urine samples from suspect patients.
  • Anti-213P1F11 antibodies that specifically bind 213P1F11 are used in therapeutic applications for the treatment of cancers that express 213P1F11.
  • Anti-213P1F11 antibodies are used as an unconjugated modality and as conjugated form in which the antibodies are attached to one of various therapeutic or imaging modalities well known in the art, such as a prodrugs, enzymes or radioisotopes.
  • unconjugated and conjugated anti-213PlFl 1 antibodies are tested for efficacy of tumor prevention and growth inhibition in the SCID mouse cancer xenograft models, e.g., kidney cancer models AGS-K3 and AGS-K6, (see, e.g., the Example entitled "213P1F11 Monoclonal Antibody-mediated Inhibition of Bladder and Lung Tumors In Vivo ").
  • Conjugated and unconjugated anti-213PlFl 1 antibodies are used as a therapeutic modality in human clinical trials either alone or in combination with other freatments as described in following Examples.
  • Example 40 Human Clinical Trials for the Treatment and Diagnosis of Human Carcinomas through use of Human Anti-213P1F11 Antibodies In vivo
  • Antibodies are used in accordance with the present invention which recognize an epitope on 213P1F11, and are used in the freatment of certain tumors such as those listedin Table I. Based upon a number of factors, including 213P1F11 expression levels, tumors such as those listed in Table I are presently prefe ⁇ ed indications. In connection with each of these indications, three clinical approaches are successfully pursued.
  • Adjunctive therapy In adjunctive therapy, patients are treated with anti-213PlFl 1 antibodies in combination with a chemotherapeutic or antineoplastic agent and/or radiation therapy.
  • Primary cancer targets such as those listed in Table I, are treated under standard protocols by the addition anti- 213P1F11 antibodies to standard first and second line therapy. Protocol designs address effectiveness as assessed by reduction in tumor mass as well as the ability to reduce usual doses of standard chemotherapy. These dosage reductions allow additional and or prolonged therapy by reducing dose-related toxicity of the chemotherapeutic agent.
  • Anti-213P1F11 antibodies are utilized in several adjunctive clinical trials in combination with the chemotherapeutic or antineoplastic agents adriamycin (advanced prostrate carcinoma), cisplatin (advanced head and neck and lung carcinomas), taxol (breast cancer), and doxorubicin (preclinical).
  • Monotherapy In connection with the use of the anti-213P1F11 antibodies in monotherapy of tumors, the antibodies are administered to patients without a chemotherapeutic or antineoplastic agent.
  • monotherapy is conducted clinically in end stage cancer patients with extensive metastatic disease. Patients show some disease stabilization. Trials demonstrate an effect in refractory patients with cancerous tumors.
  • Imaging Agent Through binding a radionuclide (e.g., iodine or yttrium (I 131 , Y 90 ) to anti- 213P1F11 antibodies, the radiolabeled antibodies are utilized as a diagnostic and/or imaging agent. In such a role, the labeled antibodies localize to both solid tumors, as well as, metastatic lesions of cells expressing 213P1F11. In connection with the use of the anti-213PlFl 1 antibodies as imaging agents, the antibodies are used as an adjunct to surgical treatment of solid tumors, as both a pre-surgical screen as well as a postoperative follow-up to determine what tumor remains and/or returns.
  • a radionuclide e.g., iodine or yttrium (I 131 , Y 90 .
  • a ( 1 U In)-213P1F11 antibody is used as an imaging agent in a Phase I human clinical trial in patients having a carcinoma that expresses 213P1F11 (by analogy see, e.g., Divgi et al J. Natl Cancer Inst. 83:97-104 (1991)). Patients are followed with standard anterior and posterior gamma camera. The results indicate that primary lesions and metastatic lesions are identified
  • anti-213PlFl 1 antibodies can be administered with doses in the range of 5 to 400 mg/m 2 , with the lower doses used, e.g., in connection with safety studies.
  • the affinity of anti-213PlFl 1 antibodies relative to the affinity of a known antibody for its target is one parameter used by those of skill in the art for determining analogous dose regimens.
  • anti-213PlFl 1 antibodies that are fully human antibodies have slower clearance; accordingly, dosing in patients with such fully human anti-213PlFl l antibodies can be lower, perhaps in the range of 50 to 300 mg/m 2 , and still remain efficacious.
  • Dosing in mg/m 2 is a measurement based on surface area and is a convenient dosing measurement that is designed to include patients of all sizes from infants to adults.
  • intravenous delivery is one standard delivery technique for many tumors.
  • tumors in the peritoneal cavity such as tumors of the ovaries, biliary duct, other ducts, and the like
  • intraperitoneal administration may prove favorable for obtaining high dose of antibody at the tumor and to also minimize antibody clearance.
  • certain solid tumors possess vasculature that is appropriate for regional perfusion. Regional perfusion allows for a high dose of antibody at the site ofa tumor and minimizes short term clearance of the antibody.
  • the CDP follows and develops treatments of anti-213PlFl 1 antibodies in connection with adjunctive therapy, monotherapy, and as an imaging agent. Trials initially demonstrate safety and thereafter confirm efficacy in repeat doses. Trails are open label comparing standard chemotherapy with standard therapy plus anti-213PlFl 1 antibodies. As will be appreciated, one criteria that can be utilized in connection with enrollment of patients is 213P1F11 expression levels in their tumors as determined by biopsy.
  • safety concerns are related primarily to (i) cytokine release syndrome, i.e., hypotension, fever, shaking, chills; (ii) the development of an immunogenic response to the material (i.e., development of human antibodies by the patient to the antibody therapeutic, or HAHA response); and, (iii) toxicity to normal cells that express 213P1F11. Standard tests and follow-up are utilized to monitor each of these safety concerns.
  • Anti-213P1F11 antibodies are found to be safe upon human administration.
  • a phase I human clinical trial is initiated to assess the safety of six intravenous doses of a human anti-213PlFl 1 antibody in connection with the treatment ofa solid tumor, e.g., a cancer ofa tissue listed in Table I.
  • a solid tumor e.g., a cancer ofa tissue listed in Table I.
  • an antineoplastic or chemotherapeutic agent such as cisplatin, topotecan, doxorabicin, adriamycin, taxol, or the like.
  • the trial design includes delivery of six single doses of an anti-213PlFll antibody with dosage of antibody escalating from approximately about 25 mg/m 2 to about 275 mg/m 2 over the course of the treatment in accordance with the following schedule: Day O Day 7 Day 14 Day 21 Day 28 Day 35
  • Patients are closely followed for one-week following each administration of antibody and chemotherapy.
  • patients are assessed for the safety concerns mentioned above: (i) cytokine release syndrome, i.e., hypotension, fever, shaking, chills; (ii) the development of an immunogenic response to the material (i.e., development of human antibodies by the patient to the human antibody therapeutic, or HAHA response); and, (iii) toxicity to normal cells that express 213P1F11. Standard tests and follow-up are utilized to monitor each of these safety concerns.
  • Patients are also assessed for clinical outcome, and particularly reduction in tumor mass as evidenced by MRI or other imaging.
  • the anti-213PlFl 1 antibodies are demonstrated to be safe and efficacious, Phase.II trials confirm the efficacy and refine optimum dosing.
  • Anti-213P1F11 antibodies are safe in connection with the above-discussed adjunctive trial, a Phase II human clinical trial confirms the efficacy and optimum dosing for monotherapy. Such trial is accomplished, and entails the same safety and outcome analyses, to the above-described adjunctive trial with the exception being that patients do not receive chemotherapy concurrently with the receipt of doses of anti- 213P1F11 antibodies.
  • the 213P1F11 gene is homologous to a previously cloned gene, namely the human caspase 14 precursor (gi 6912286) (Hu S et al, J. Biol. Chem. 1998, 273:29648), also known as mini-ICE (MICE).
  • the 213P1F11 gene resulted in several protein variants, which share several characteristics (Table XXII), including homology to ICE family of cysteine proteases.
  • Several variants of 213P1F11 namely 213P1F11- v.2, -v.3 and -v.4, are novel proteins that maintain some homology to the published caspase 14 precursor (gi 6912286).
  • 213P1F1 l-v.2 shows 100% identity to the human caspase 14 precursor (gi 6912286) over the first 174 aa of the protein ( Figure 4D), while differing from the published caspase 14 precurspr protein by 56 amino acids at its C-terminus, thus resulting in 76% overall identity to caspase 14 precursor.
  • 213P1F1 l-v.2 also maintains homology to the mouse caspase 14, and shows 83% homology and 72%> identity to that protein (gi 6753280) ( Figure 4F).
  • the 213P1F11-V.3 variant protein show 100% identity to the human caspase 14 precursor (gi 6912286) over 134 amino acids, while differing from that protein by 12 aa at its C-terminus.
  • 213P1F1 l-v.4 shows 97% identity with the human caspase 14 precursor over 235 amino acids, while differing from the human caspase 14 precursor (gi 6912286) by 86 aa at its N- terminus ( Figure 4G).
  • 213P 1 F 11 -v.1 consists of 242 amino acids, with calculated molecular weight of 28.0 kDa, and pi of 5.4.
  • 213P1F11-V.1 is an intercellular protein, located in the cytosol with potential localization to the nucleus (Table XXII). Similar localization patterns are observed for 213P1F11 protein variants 1, 3, and 4 (Table XXII). Bioinformatic analysis indicates that 213P1F1-V.2 may also localize to the mitochondria (Table XXII).
  • Caspases are a family of cyteine proteases that function as effectors of apoptosis or programmed cell death (Salvesen GS, Dixit V, Cell. 1997, 91:443; Thornberry N, Lazebnik Y, Science. 281: 1312). These proteases cleave different cellular substrates in an aspartate-specific manner. Cleavage may result in activation or inactivation of the cleaved cellular proteins, but not in protein degradation (Nunez et al, Oncogene. 1998, 17:3237; Stennicke HR, Salvesen GS, Cell Death Differ 1999, 6:1054).
  • Caspases traditionally exist as precursor proteins also known as single polypeptide zymogens consisting ofa pro- domain, and 2 catalytic subunits, p20 and p 10 and contain a conserved QACXG active site (Stennicke HR, Salvesen GS, Cell Death Differ 1999, 6:1054; Cohen M. Biochem J 1997, 326:1). Similar to other members of the caspase family, 213P1F11 contains two catalytic subumts, p20 and plO, in addition to the conserved penta-peptide active site. In 213PlFl l v.l, p20 spans aa 16-139 and plO spans aa 155-241, while the active site is located at aa 129.
  • 213P1F11 v.4 carries both p20 and plO subunits
  • 213P1F11 v.2 and v.3 contain the p20 subunit only, indicating that all 4 variants of 213P1F11 can function in a similar manner.
  • Caspases are activated by proteolytic cleavage of their internal aspartate by an upstream enzyme, often another caspase. However, unlike other caspases with short pro-domains, caspase 14 is not reported to associate with known caspases (Hu S et al, J. Biol. Chem. 1998, 273:29648).
  • Caspase 14 has been shown to be processed by caspase 8 and caspase 10 as well as granzyme B, resulting in two catalytic subunits, ⁇ 20 and plO (Ahmad M et al, Cancer Res. 1998, 58:5201). These 2 cleavage products are detected in human • epidermis and in vitro during keratinocyte differentiation (Eckhart L et al, J. Invest. Drmatol. 2000, 115:1148). Overexpression of caspase 14 in breast carcinoma cells MCF7 resulted in the apoptosis of these cells, suggesting that caspase 14 participates in the process of programmed cell death (Hu S et al, J. Biol. Chem. 1998, 273:29648).
  • 213P1F11 is highly expressed in several cancers while showing a restricted expression pattern in normal tissues suggests that the 213P1F11 gene plays an important role in various cancers, including cancers of the prostate, bladder and breast.
  • 213P1F11 Based on its similarity to caspase 14 213P1F11 has the ability to control tumor growth, apoptosis, survival, differentiation and progression. Accordingly, when 213P1F11 functions as a regulator of cell growth and apoptosis, or expression, 213P1F11 is used for therapeutic, diagnostic, prognostic or preventative purposes.
  • 213P1F11 is highly expressed in several cancers while showing a restricted expression pattern in normal tissues suggests that the 213P1F11 gene plays an important role in various cancers, including cancers of the prostate, bladder and breast.
  • 213P1F11 Based on its similarity to caspase 14 213P1F11 has the ability to control tumor growth, apoptosis, survival, differentiation and progression. Accordingly, when 213P1F11 functions as a regulator of cell growth and apoptosis, or expression, 213P1F11 is used for therapeutic, diagnostic, prognostic or preventative purposes.
  • proteins are identified that associate with 213P1F11 and mediate signaling events.
  • 213P1F11 Several pathways known to play a role in cancer biology can be regulated by 213P1F11, including phospholipid pathways such as PI3K, survival pathways such as AKT, NFkB, etc, adhesion and migration pathways, including FAK, Rho, Rac-1, etc, as well as mitogenic/survival cascades such as ERK, p38, etc (Cell Growth Differ. 2000,11:279; J Biol Chem. 1999, 274:801; Oncogene. 2000, 19:3003, J. Cell Biol. 1997, 138:913.).
  • the phosphorylation of 213P1F11 is provided by the present invention to lead to activation of the above listed pathways.
  • 213P1F11 uses, e.g., Western blotting techniques to regulate these pathways.
  • Cells expressing or lacking 213P1F11 are either left untreated or stimulated with cytokines, hormones and anti-integrin antibodies.
  • Cell lysates are analyzed using anti-phospho-specific antibodies (Cell Signaling, Santa Cruz Biotechnology) in order to detect phosphorylation and regulation of ERK, ⁇ 38, AKT, PI3K, PLC and other signaling molecules.
  • 213P1F11 plays a role in the regulation of signaling pathways, whether individually or communally, it is used as a target for diagnostic, prognostic, preventative and therapeutic purposes.
  • luciferase (luc) based transcriptional reporter assays are carried out in cells expressing individual genes. These transcriptional reporters contain consensus-binding sites for known transcription factors that lie downstream of well-characterized signal transduction pathways. The reporters and examples of these associated transcription factors, signal transduction pathways, and activation stimuli are listed below.
  • NFkB-luc NFkB/Rel
  • Ik-kinase/SAPK growth/apoptosis/stress SRE-luc, SRF/TCF/ELKl
  • MAPK/SAPK g ⁇ owth/diffirentiation AP-l-luc, FOS/JUN
  • MAPK/SAPK PKC growth/apoptosis/stress ARE-luc, androgen receptor
  • steroids/MAPK growth/differentiation/apoptosis p53-luc, p53
  • SAPK growth/differentiatiori/apoptosis CRE-luc, CREB/ATF2
  • PKA/p38 growth/apoptosis/stress
  • Luciferase reporter plasmids can be introduced by lipid-mediated transfection (TFX-50, Promega). Luciferase activity, an indicator of relative transcriptional activity, is measured by incubation of cell extracts with luciferin substrate and luminescence of the reaction is monitored in a luminometer.
  • 213P1F11 Signaling pathways activated by 213P IF 11 are mapped and used for the identification and validation of therapeutic targets.
  • 213P1F11 is involved in cell signaling, it is used as target for diagnostic, prognostic, preventative and therapeutic purposes.
  • Some apoptosis intermediates such as DcRl, FLICE and TRAIL-R3, function as cellular inhibitors of apoptosis by acting as decoys and interfering with normal function of the apoptotic machinery (Sheikh MS et al, Oncogene. 1999, 18:4153; Ashkenazi A, Dixit VM. Cu ⁇ Opin Cell Biol. 1999, 11:255).
  • 213P1F11 functions as a decoy, it can contribute to the growth of cancer cells.
  • the role of 213P1F11 in tumor growth is confirmed in a variety of primary and transfected cell lines including prostate, bladder and breast cell lines as well as NIH 3T3 cells engineered to stably express 213P1F11.
  • Parental cells lacking 213P1F11 and cells expressing 213P1F11 are evaluated for cell growth using a well-documented proliferation assay (Fraser SP, Grimes JA, Djamgoz MB. Prostate. 2000;44:61, Johnson DE, Ochieng J, Evans SL. Anticancer Drugs. 1996, 7:288).
  • a well-established assay is used, e.g., a Transwell Insert System assay (Becton Dickinson) (Cancer Res. 1999, 59:6010).
  • Control cells including prostate, colon, bladder and kidney cell lines lacking 213P1F11 are compared to cells expressing 213P1F11.
  • Cells are loaded with the fluorescent dye, calcein, and plated in the top well of the Transwell insert coated with a basement membrane analog. Invasion is determined by fluorescence of cells in the lower chamber relative to the fluorescence of the entire cell population.
  • 213P1F11 can also play a role in cell cycle and apoptosis.
  • Parental cells and cells expressing 213P 1 F 11 are compared for differences in cell cycle regulation using a well-established BrdU assay (Abdel- Malek ZA. J Cell Physiol. 1988, 136:247).
  • BrdU assay Abdel- Malek ZA. J Cell Physiol. 1988, 136:247).
  • cells are grown under both optimal (full serum) and limiting (low serum) conditions are labeled with BrdU and stained with anti-BrdU Ab and propidium iodide.
  • Cells are analyzed for entry into the GI, S, and G2M phases of the cell cycle.
  • the effect of sfress on apoptosis is evaluated in control parental cells and cells expressing 213P1F11, including normal and tumor bladder cells.
  • Engineered and parental cells are treated with various chemotherapeutic agents, such as paclitaxel, gemcitabine, etc, and protein synthesis inhibitors, such as cycloheximide.
  • Cells are stained with annexin V-FITC and cell death is measured by FACS analysis.
  • the modulation of cell death by 213P1F11 can play a critical role in regulating tumor progression and tumor load.
  • 213P1F11 plays a role in cell growth, transformation, invasion or apoptosis, it is used as a target for diagnostic, prognostic, preventative and therapeutic purposes.
  • angiogenesis or new capillary blood vessel formation is necessary for tumor growth (Hanahan D, Folkman J. Cell. 1996, 86:353; Folkman J. Endocrinology. 1998 139:441).
  • Assays have been developed to measure angiogenesis in vitro and in vivo, such as the tissue culture assays, endothelial cell tube formation, and endothelial cell proliferation. Using these assays as well as in vitro neo-vascularization, the effect of 213P1F11 on angiogenesis is confirmed.
  • endothelial cells engineered to express 213P1F11 are evaluated using tube formation and proliferation assays. The effect of 213P1F11 is also confirmed in animal models in vivo.
  • cells either expressing or lacking 213P1F11 are implanted subcutaneously in immunocompromised mice. Endothelial cell migration and angiogenesis are evaluated 5- 15 days later using immunohistochemistry techniques.
  • 213P1F11 affects angiogenesis, it is used as a target for diagnostic, prognostic, preventative and therapeutic purposes
  • the localization of 213P1F11 to the cytoplasm with potential nuclear localization (Table XXII), support the present invention use of 213P1F11 based on its role in the franscriptional regulation of eukaryotic genes. Regulation of gene expression is confirmed, e.g., by studying gene expression in cells expressing or lacking 213P 1F11. For this purpose, two types of experiments are performed.
  • RNA from parental and 213PlFll-expressing cells are extracted and hybridized to commercially available gene arrays (Clontech) (Smid-Koopman E et al. Br J Cancer. 2000. 83:246). Resting cells as well as cells treated with FBS or androgen are compared. Differentially expressed genes are identified in accordance with procedures known in the art. The differentially expressed genes are then mapped to biological pathways (Chen K et al., Thyroid. 2001. 11:41.).
  • 213P1F11 plays a role in gene regulation, it is used as a target for diagnostic, prognostic, preventative and therapeutic purposes.
  • the cellular location of 213P1F11 can be assessed using subcellular fractionation techniques widely used in cellular biology (Storrie B, et al. Methods Enzymol. 1990;182:203-25).
  • a variety of cell lines, including prostate, bladder and breast cell lines as well as cell lines engineered to express 213P1F11 are separated into nuclear, cytosolic and membrane fractions. Gene expression and location in nuclei, heavy membranes (lysosomes, peroxisomes, and mitochondria), light membranes (plasma membrane and endoplasmic reticulum), and soluble protein fractions are tested using Western blotting techniques.
  • 293T cells can be transfected with an expression vector encoding individual genes, HIS-tagged (PCDNA 3.1 MYC/HIS, Invitrogen) and the subcellular localization of these genes is determined as described above.
  • the transfected cells can be harvested and subjected to a differential subcellular fractionation protocol (Pemberton, P.A. et al, 1997, J of Histochemistry and Cytochemistry, 45:1697-1706.). Location of the HIS-tagged genes is followed by Western blotting.
  • 213P1F11 antibodies it is possible to demonstrate cellular localization by immuno fluorescence and immunohistochemistry. For example, cells expressing or lacking 213P1F11 are adhered to a microscope slide and stained with anti-213PlFl 1 specific Ab. Cells are incubated with an FITC- coupled secondary anti-species Ab, and analyzed by fluorescent microscopy.
  • 213P1F11 When 213P1F11 is localized to specific cell compartments, it is used as a target for diagnostic, preventative and therapeutic purposes.
  • 213P1F11 The similarity of 213P1F11 to casapase cysteine proteases supports the use of 213P1F11 as a- protease. Protease activity can be confirmed using on in vitro protease assay coupled to detection of protein fragments by western blotting (Hu S et al, above; Slee E et al, J Biol Chem 2001, 276:7320).
  • recombinant 213P1F11 protein is incubated with apoptotic subsfrates, including other caspases known to associate with caspase 14, namely caspase 2 and caspase 4, as well as recombinant RIP and poly(ADP-ribose) polymerase (i.e.
  • 213P1F11 When 213P1F11 functions as a protease, it is used as a target for diagnostic, preventative and therapeutic purposes

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Wood Science & Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pregnancy & Childbirth (AREA)
  • General Chemical & Material Sciences (AREA)
  • Reproductive Health (AREA)
  • Gynecology & Obstetrics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
EP02728647A 2002-04-01 2002-04-01 Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und entsprechendes protein mit der bezeichnung 213p1f11 Withdrawn EP1578980A4 (de)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2002/010220 WO2003085121A2 (en) 2002-04-01 2002-04-01 Nucleic acid and corresponding protein entitled 213p1f11 useful in treatment and detection of cancer

Publications (2)

Publication Number Publication Date
EP1578980A2 true EP1578980A2 (de) 2005-09-28
EP1578980A4 EP1578980A4 (de) 2013-01-02

Family

ID=28789615

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02728647A Withdrawn EP1578980A4 (de) 2002-04-01 2002-04-01 Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und entsprechendes protein mit der bezeichnung 213p1f11

Country Status (5)

Country Link
EP (1) EP1578980A4 (de)
AU (1) AU2002258689C1 (de)
CA (1) CA2480811A1 (de)
IL (2) IL164326A0 (de)
WO (1) WO2003085121A2 (de)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040019915A1 (en) 2002-04-01 2004-01-29 Challita-Eid Pia M. Nucleic acid and corresponding protein entitled 213P1F11 useful in treatment and detection of cancer
US7947274B2 (en) 2007-01-04 2011-05-24 Humabs, LLC. Human cytomegalovirus neutralising antibodies and use thereof
GB0700133D0 (en) 2007-01-04 2007-02-14 Humabs Llc Human cytomegalovirus neutralising antibodies and use thereof
CA3022196A1 (en) 2008-07-16 2010-01-21 Institute For Research In Biomedicine Human cytomegalovirus neutralizing antibodies and use thereof
CN114262683B (zh) * 2022-03-01 2022-06-17 中国科学院动物研究所 一种表达vegfr3 d2多肽的细菌制剂及其构建方法和应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998011219A1 (en) * 1996-09-11 1998-03-19 Incyte Pharmaceuticals, Inc. Disease associated membrane protein (damp)
WO2000004149A2 (en) * 1998-07-14 2000-01-27 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
WO2000020638A2 (en) * 1998-10-02 2000-04-13 Urogenesys, Inc. Methods and compositions for the diagnosis and therapy of prostate cancer
WO2001059110A2 (en) * 2000-02-08 2001-08-16 Agensys, Inc. 34p3d7: a tissue specific protein highly expressed in prostate cancer
WO2001081595A2 (en) * 2000-04-27 2001-11-01 Knoll Gmbh Human caspase-14 compositions

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6432628B1 (en) * 1997-08-26 2002-08-13 Thomas Jefferson University Caspase-14, an apoptotic protease, nucleic acids encoding and methods of use
US6340740B1 (en) * 1997-08-26 2002-01-22 Thomas Jefferson University Caspase-14, an apoptotic protease, nucleic acids encoding and methods of use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998011219A1 (en) * 1996-09-11 1998-03-19 Incyte Pharmaceuticals, Inc. Disease associated membrane protein (damp)
WO2000004149A2 (en) * 1998-07-14 2000-01-27 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
WO2000020638A2 (en) * 1998-10-02 2000-04-13 Urogenesys, Inc. Methods and compositions for the diagnosis and therapy of prostate cancer
WO2001059110A2 (en) * 2000-02-08 2001-08-16 Agensys, Inc. 34p3d7: a tissue specific protein highly expressed in prostate cancer
WO2001081595A2 (en) * 2000-04-27 2001-11-01 Knoll Gmbh Human caspase-14 compositions

Also Published As

Publication number Publication date
AU2002258689A1 (en) 2003-10-20
WO2003085121A9 (en) 2012-01-12
AU2002258689C1 (en) 2008-04-24
WO2003085121A2 (en) 2003-10-16
AU2002258689B8 (en) 2003-10-20
CA2480811A1 (en) 2003-10-16
AU2002258689B2 (en) 2007-08-16
EP1578980A4 (de) 2013-01-02
IL164326A0 (en) 2005-12-18
IL164326A (en) 2011-03-31

Similar Documents

Publication Publication Date Title
US7928196B2 (en) Nucleic acid and corresponding protein entitled 125P5C8 useful in treatment and detection of cancer
US7879570B2 (en) Nucleic acid and corresponding protein entitled 184P1E2 useful in treatment and detection of cancer
US7642342B2 (en) Nucleic acid and corresponding protein entitled 161P5C5 useful in treatment and detection of cancer
EP1311675A2 (de) Nukleinsäure und protein, genannt 158p1d7, für die behandlung und erkennung von blasenkrebs und anderen krebsarten
WO2002014361A2 (en) NUCLEIC ACIDS AND CORRESPONDING PROTEINS ENTITLED 83P2H3 AND CaTrF2E11 USEFUL IN TREATMENT AND DETECTION OF CANCER
US20100086985A1 (en) Nucleic acid and corresponding protein entitled 205p1b5 useful in treatment and detection of cancer
AU2002305169A1 (en) Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer
AU2002258626A1 (en) Nucleid acid and corresponding protein entitled 158P3D2 useful in treatment and detection of cancer
US20040019915A1 (en) Nucleic acid and corresponding protein entitled 213P1F11 useful in treatment and detection of cancer
EP1578980A2 (de) Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und entsprechendes protein mit der bezeichnung 213p1f11
EP2311863A1 (de) Nucleinsäure und zugehöriges Protein mit der Bezeichnung 121P1F1 für die Behandlung und den Nachweis von Krebs
US8647826B2 (en) Nucleic acid and corresponding protein entitled 125P5C8 useful in treatment and detection of cancer
AU2002324842A1 (en) 205P1B5 in treatment and detection of cancer
WO2002014501A2 (en) Nucleic acids and corresponding proteins entitled phor1-a11 and phor1-f5d6 useful in treatment and detection of cancer
EP1790662A1 (de) Nukleinsäure und entsprechendes Protein mit der Bezeichnung 121P2A3 für die Behandlung und den Nachweis von Krebs
WO2003085081A2 (en) Nucleic acid and corresponding protein entitled 238p1b2 useful in treatment and detection of cancer
AU2002307250A1 (en) Nucleic acid and corresponding protein entitled 121P2A3 useful in treatment and detection of cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041019

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AGENSYS, INC.

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

A4 Supplementary search report drawn up and despatched

Effective date: 20121203

RIC1 Information provided on ipc code assigned before grant

Ipc: G01N 33/574 20060101ALI20121127BHEP

Ipc: C07K 14/47 20060101ALI20121127BHEP

Ipc: G01N 33/68 20060101ALI20121127BHEP

Ipc: C07K 16/18 20060101ALI20121127BHEP

Ipc: C12Q 1/68 20060101AFI20121127BHEP

17Q First examination report despatched

Effective date: 20130322

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140904