WO2000020638A2 - Methods and compositions for the diagnosis and therapy of prostate cancer - Google Patents

Abstract

Methods and compositions for the diagnosis and therapy of prostate cancer are described. The methods of the invention utilize isolated polynucleotides corresponding to the human Y-specific gene TSPY (testis-specific protein Y-encoded) (Arnemann, J et al., 1991, Genomics 11: 108-114), proteins encoded by the TSPY gene and fragments thereof, and antibodies capable of specifically recognizing and binding to TSPY proteins.

Description

METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND THERAPY OF PROSTATE CANCER

FIELD OF THE INVENTION

The invention described herein relates to methods and compositions for the diagnosis and therapy of prostate cancer utilizing isolated polynucleotides, polypeptides, antibodies, and related molecules which correspond to or are reactive with human

TSPY.

BACKGROUND OF THE INVENTION

Prostate cancer is the most frequently diagnosed cancer and second leading cause of cancer death in men. Some 45,000 men die annually of this disease. Only lung cancer has a higher mortality. The chance of a man developing invasive prostate cancer during his lifetime is 1 in 6. At the age of 50, a man has a greater than 40% chance of developing prostate cancer and nearly a 3% chance of dying from this disease. While some advances in the treatment of locally confined tumors have been achieved, prostate cancer is incurable once it has metastasized. Patients with metastatic prostate cancer are treated by hormonal ablation therapy, but with only short-term success. Eventually, these patients develop an androgen-refractory state leading to disease progression and death.

A continuing and fundamental problem in the management of prostate cancer is the absence of reliable diagnostic and prognostic markers capable of accurately detecting early-stage localized tumors and/or predicting disease susceptibility and progression. Early detection and diagnosis of prostate cancer currently relies on digital rectal examination (DRE), prostate specific antigen (PSA) measurements, trans rectal ultrasonography (TRUS), and transrectal needle biopsy (TRNB). Serum PSA measurements in combination with DRE represent the leading diagnostic approach at present. However, this approach has major limitations which have fueled intensive research into finding better diagnostic markers of this disease. A number of markers have been identified, and at least one, PSA, is in widespread clinical use. However, ideal prostate tumor markers have been extremely elusive and no marker has yet proven reliable for predicting progression of the disease. Thus, there is a need for more reliable and informative diagnostic and prognostic methods in the management of prostate cancer.

In addition, there is also great interest in identifying prostate-specific proteins that could be appropriate as therapeutic targets, as there is no effective treatment for patients who develop recurrent disease or who have been diagnosed with metastatic disease. Although hormone ablation therapy can palliate these patients, the majority inevitably progress to develop incurable, androgen-independent disease (Lalani et al., 1997, Cancer Metastasis Rev. 16: 29-66).

PSA is the most widely used tumor marker for screening, diagnosis, and monitoring prostate cancer today. In particular, several immunoassays for the detection of serum PSA are in widespread clinical use. Recently, a reverse transcriptase- polymerase chain reaction (RT-PCR) assay for PSA mRNA in serum has been developed. However, PSA is not a disease-specific marker, as elevated levels of PSA are detectable in a large percentage of patients with BPH and prostatitis (25- 86%)(Gao et al., 1997, Prostate 31 : 264-281), as well as in other nonmalignant disorders and in some normal men, a factor which significantly limits the diagnostic specificity of this marker. For example, elevations in serum PSA of between 4 to 10 ng/ml are observed in BPH, and even higher values are observed in prostatitis, particularly acute prostatitis. BPH is an extremely common condition in men. Further confusing the situation is the fact that serum PSA elevations may be observed without any indication of disease from DRE, and vice-versa. Moreover, it is now recognized that PSA is not prostate-specific (Gao et al., supra, for review).

Various methods designed to improve the specificity of PSA-based detection have been described, such as measuring PSA density and the ratio of free vs. complexed PSA. However, none of these methodologies have been able to reproducibly distinguish benign from malignant prostate disease. In addition, PSA diagnostics have sensitivities of between 57-79% (Cupp & Osterling, 1993, Mayo Clin Proc 68:297-306), and thus miss identifying prostate cancer in a significant population of men with the disease.

Prostate-Specific Membrane Antigen (PSMA) is a recently described cell surface marker of prostate cancer which has been the subject of various studies evaluating its use as a diagnostic and therapeutic marker. PSMA expression is largely restricted to prostate tissues, but detectable levels of PSMA mRNA have been observed in brain, salivary gland, small intestine, and renal cell carcinoma (Israeli et al., 1993, Cancer Res 53: 227-230). PSMA protein is highly expressed in most primary and metastatic prostate cancers, but is also expressed in most normal intraepithelial neoplasia specimens (Gao et al., supra). Preliminary results using an lndium-111 labeled, anti- PSMA monoclonal antibody to image recurrent prostate cancer show some promise (Sodee et al., 1996, Clin Nuc Med 21 : 759-766). PSMA is a hormone dependent antigen requiring the presence of functional androgen receptor. Since not all prostate cancer cells express androgen receptor, the clinical utility of PSMA as a therapeutic target may be inherently limited. Clinical trials designed to examine the effectiveness of PSMA immunotherapy are also underway.

Prostate Stem Cell Antigen (PSCA) is another very recently described cell surface marker of prostate cancer (Reiter et al., 1998, Proc. Natl. Acad. Sci. USA 95: 1735- 1740). PSCA expression has been shown to be prostate specific and widely over- expressed across all stages of prostate cancer, including high grade prostatic intraepithelial neoplasia (PIN), androgen-dependent and androgen-independent prostate tumors. The PSCA gene has been mapped to chromosome 8q24.2, a region of alleiic gain in more than 80% of prostate cancers. PSCA shows promise as a diagnostic and therapeutic target in view of its cell surface location, prostate specificity, and greatly upregulated expression in prostate cancer cells.

Progress in the identification of specific markers has been has been slow due to a lack of experimental animal model systems that recapitulate clinical disease. Attempted solutions to this problem have included the generation of prostate cancer cell lines (Horoszewicz et al., 1983, Cancer Res. 43, 1809) and prostate cancer xenografts (Pretlow et al., 1991 , Cancer Res. 51 , 3814; van Weerden et al., 1996, Am. J. Pathol. 149, 1055; Klein et al., 1997, Nature Med. 3, 402). However, these approaches have met with limited success. For example, xenografts have generally produced low long- term survival rates. In addition, none of the most widely used human prostate cancer cell lines - PC-3, DU-145, and LnCaP - have been shown to reproducibly give rise to osteoblastic lesions typical of prostate cancer. A further limitation of the DU-145 and PC-3 cell lines is that these cells do not express prostate specific antigen (PSA) or androgen receptor (AR) (Kaighn et al., 1979, Invest. Urol. 17: 16-23; Gieave et al., 1992, Cancer Res. 52: 1598-1605), questioning their relevance to clinical prostate cancer. The LNCaP cell line is androgen responsive and expresses PSA, but contains a mutation in the androgen receptor which alters ligand specificity.

Recently, however, a series of prostate cancer xenografts demonstrating genetic and phenotypic characteristics closely paralleling the human clinical situation have been described (Klein et al., 1997, Nature Med. 3: 402). These LAPC (Los Angeles Prostate Cancer) xenografts have survived passage in severe combined immune deficient (SCID) mice for longer than one year. The LAPC-4 xenograft model system has the capacity to mimic the transition from androgen dependence to androgen independence (Klein et al., 1997, supra). LAPC-4 tumors regress in male mice after castration, but re-grow within 2-3 months as androgen independent tumors. Both androgen dependent (AD) and androgen independent (Al) LAPC-4 xenograft tumors express equal levels of the prostate specific markers PSA, PSMA (prostate specific membrane antigen) and PSCA (prostate stem cell antigen), which was identified using representational difference analysis of cDNAs derived from the AD and Al variants of the LAPC-4 xenograft.

SUMMARY OF THE INVENTION

The present invention relates to methods and compositions for the diagnosis and therapy of prostate cancer. The methods of the invention utilize isolated polynucleotides corresponding to the human Y-specific gene TSPY (testis-specific protein Y-encoded) (Arnemann, J et al., 1991 , Genomics 11 : 108-114), proteins encoded by the TSPY gene and fragments thereof, and antibodies capable of specifically recognizing and binding to TSPY proteins.

Expression of the TSPY gene in normal human tissues is largely restricted to testis as determined by RT-PCR analyses. Substantially lower expression is detected in prostate only after very high PCR amplification cycles. RT-PCR analysis also demonstrates that the TSPY gene is variably over-expressed in prostate cancer xenografts relative to normal prostate. The biochemical and functional characteristics of TSPY have yet to be defined. Nevertheless, the expression profile of TSPY disclosed herein suggests that TSPY may be a useful diagnostic marker and/or therapeutic target for prostate cancer. In view of its testis specific expression in normal tissues, TSPY may in particular represent an excellent target for prostate cancer vaccines and immunotherapeutics.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Nucleotide (A) and amino acid (B) sequences of human TSPY (Arnemann, J et al., 1991 , Genomics 11 : 108-114). Bold nucleotide sequence corresponds initially isolated SSH-derived fragment of the TSPY gene.

FIG. 2. Nucleotide sequence of the initially isolated SSH-derived fragment of the TSPY gene.

FIG. 3. RT-PCR analysis of TSPY gene expression in prostate cancer xenografts, normal prostate, and other tissues and cell lines, showing high level over-expression in the LAPC-4 AD and Al prostate cancer xenografts, and lower level over-expression in the LAPC-9 AD xenograft, relative to normal prostate (Panel A); and showing expression only in testis in normal tissues at 30 cycles of PCR amplification, and lower level expression in prostate only after 35 cycles (Panels B and C). FIG. 4. Northern blot showing testis-specific TSPY expression in normal tissues (Panels A and B) and up-regulated expression in prostate cancer (Panel C).

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to methods and compositions for the diagnosis and therapy of prostate cancer which utilize isolated polynucleotides corresponding to the human Y-specific gene TSPY (testis-specific protein Y-encoded) (Arnemann, J et al., 1991 , Genomics 11 : 108-114), proteins encoded by the TSPY gene and fragments thereof, and antibodies capable of specifically recognizing and binding to TSPY proteins. TSPY is a recently described gene which encodes a predicted 308 amino acid protein. The physiological role of TSPY is unknown.

The invention is based, in part, upon the isolation of a cDNA fragment corresponding to the TSPY gene by Suppression Subtraction Hybridization cloning. This cDNA, designated 31P1A2, was sequenced and analyzed for homology to known genes and ESTs in the major public databases. The 31 P1A2 cDNA showed identity to the extreme 3' end of the untranslated sequence of the TSPY gene. Primers designed to specifically amplify the gene corresponding to 31 1A2 were then used to characterize TSPY expression in prostate cancer xenografts, normal prostate, and a variety of other normal tissues. The nucleotide and amino acid sequences of TSPY are provided in FIG.1 , and the nucleotide sequence of the 31P1A2 cDNA, corresponding to and identifying the TSPY gene, is provided in FIG. 2.

The expression profile of TSPY suggests that it may represent an ideal diagnostic and therapeutic marker for prostate cancer. As determined by both Northern blot and RT- PCR expression analysis, the expression of TSPY in normal tissues is highly restricted to testis (FIGS. 3 and 4). Very low level expression is detectable by RT-PCR in prostate (FIG. 3). Further, expression analysis of TSPY expression in prostate cancer xenografts (by both Northern blot and RT-PCR) indicates that this gene is over-expressed in prostate cancers, and at very high levels in some cases (FIG. 3, Panel A).

Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd. edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and/or parameters unless otherwise noted.

As used herein, the terms "advanced prostate cancer", "locally advanced prostate cancer", "advanced disease" and "locally advanced disease" mean prostate cancers which have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage C1 - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system. In general, surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes compared to patients having clinically localized (organ-confined) prostate cancer. Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base. Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.

As used herein, the terms "metastatic prostate cancer" and "metastatic disease" mean prostate cancers which have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage TxNxM+ under the TNM system. As is the case with locally advanced prostate cancer, surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is the preferred treatment modality. Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation, and approximately half of these patients die within 6 months thereafter. The most common site for prostate cancer metastasis is bone. Prostate cancer bone metastases are, on balance, characteristically osteoblastic rather than osteolytic (i.e., resulting in net bone formation). Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuciide scans, skeletal radiography, and/or bone lesion biopsy. As used herein, the term "polynucleotide" means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA.

As used herein, the term "polypeptide" means a polymer of at least 10 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used.

As used herein, the terms "hybridize", "hybridizing", "hybridizes" and the like, used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/100 μg/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing in 0.1XSSC/0.1% SDS are above 55 degrees C, and most preferably to stringent hybridization conditions.

In the context of amino acid sequence comparisons, the term "identity" is used to express the percentage of amino acid residues at the same relative position which are the same. Also in this context, the term "homology" is used to express the percentage of amino acid residues at the same relative positions which are either identical or are similar, using the conserved amino acid criteria of BLAST analysis, as is generally understood in the art. Further details regarding amino acid substitutions, which are considered conservative under such criteria, are provided below.

Additional definitions are provided throughout the subsections which follow.

PROSTATE CANCER DIAGNOSTIC AND PROGNOSTIC ASSAYS AND METHODS Over-expression of the TSPY gene may correlate with and identify prostate cancer and disease progression. Determining the status of TSPY expression patterns in an individual may be used to diagnose cancer and may provide prognostic information useful in defining appropriate therapeutic options. Similarly, the expression status of TSPY may provide information useful for predicting susceptibility to particular disease stages, progression, and/or tumor aggressiveness. Accordingly, the invention provides assays for detecting and monitoring prostate cancer by identifying and quantifying over- expression of TSPY in prostate cells. TSPY expression status in patient samples may be analyzed by a number of means well known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro-dissected samples, western blot analysis of clinical samples and cell lines, and tissue array analysis. In one aspect, the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in TSPY mRNA or protein expression in a test cell or tissue sample relative to expression levels in the corresponding normal cell or tissue. The presence of TSPY mRNA may, for example, be evaluated in tissue samples including but not limited to prostate, seminal vessicles, bone, serum, semen and lymphatic tissues. The presence of significant TSPY expression in any of these tissues may be useful to indicate the emergence, presence and/or severity of prostate cancer.

In a related embodiment, TSPY expression status may be determined at the protein level rather than at the nucleic acid level. For example, such a method or assay would comprise determining the level of TSPY protein expressed by cells in a test tissue sample and comparing the level so determined to the level of TSPY expressed in a corresponding normal sample. In one embodiment, the presence of TSPY protein is evaluated, for example, using immunohistochemical methods. TSPY antibodies or binding partners capable of detecting TSPY protein expression may be used in a variety of assay formats well known in the art for this purpose. Again, for the detection of prostate cancer, tissue samples may be from prostate, seminal vessicles, semen, serum, bone and lymphatic tissues.

In addition, peripheral blood may be conveniently assayed for the presence of prostate cancer cells using RT-PCR to detect TSPY expression. The presence of RT-PCR amplifiable TSPY mRNA provides an indication of the presence of prostate cancer. RT- PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these include RT-PCR assays for the detection of cells expressing PSA and PSM (Verkaik et al., 1997, Urol. Res. 25: 373-384; Ghossein et al., 1995, J. Clin. Oncol. 13: 1195-2000; Heston et al., 1995, Clin. Chem. 41 : 1687-1688). RT-PCR assays are well known in the art.

A related aspect of the invention is directed to predicting susceptibility to developing prostate cancer in an individual. In one embodiment, a method for predicting susceptibility to prostate cancer comprises detecting TSPY mRNA or TSPY protein in a prostate, bone, seminal vessicle or lymph tissue sample, or in serum or semen, its presence indicating susceptibility to prostate cancer, wherein the degree of TSPY mRNA expression present is proportional to the degree of susceptibility. In a specific embodiment, the presence of TSPY in prostate tissue is examined, with the presence of TSPY in the sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor).

Yet another related aspect of the invention is directed to methods for gauging prostate tumor aggressiveness. In one embodiment, a method for gauging aggressiveness of a prostate tumor comprises determining the level of TSPY mRNA or TSPY protein expressed by cells in a sample of the tumor, comparing the level so determined to the level of TSPY mRNA or TSPY protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of TSPY mRNA or TSPY protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.

Methods for detecting and quantifying the expression of TSPY mRNA or protein are described herein and use standard nucleic acid and protein detection and quantification technologies well known in the art. Standard methods for the detection and quantification of TSPY mRNA include in situ hybridization using labeled TSPY riboprobes, Northern blot and related techniques using TSPY polynucleotide probes, RT-PCR analysis using primers specific for TSPY, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like. In a specific embodiment, semi-quantitative RT-PCR may be used to detect and quantify TSPY mRNA expression as described in the Examples which follow. Any number of primers capable of amplifying TSPY may be used for this purpose, including but not limited to the various primer sets specifically described herein. Standard methods for the detection and quantification of protein may be used for this purpose. In a specific embodiment, polyclonal or monoclonal antibodies specifically reactive with the wild-type TSPY protein may be used in an immunohistochemical assay of biopsied tissue.

PROSTATE CANCER THERAPY

The identification of TSPY as a normally testis-specific protein that is highly expressed in cancers of the prostate opens a number of therapeutic approaches to the treatment of prostate cancers. Accordingly, therapeutic approaches aimed at inhibiting the activity of the TSPY protein are expected to be useful for patients suffering from prostate cancer. These therapeutic approaches generally fall into three classes. One class comprises various methods for inhibiting the binding or association of the TSPY protein with its binding partner or with others proteins. Another class comprises a variety of methods for inhibiting the transcription of the TSPY gene or translation of TSPY mRNA. A further class comprises various prostate cancer vaccine therapy strategies. A. THERAPEUTIC INHIBITION OF TSPY WITH INTRACELLULAR ANTIBODIES In one approach, recombinant vectors encoding single chain antibodies which specifically bind to TSPY may be introduced into TSPY expressing cells via gene transfer technologies, wherein the encoded single chain anti-TSPY antibody is expressed intracellularly, binds to TSPY protein, and thereby inhibits its function. Methods for engineering such intracellular single chain antibodies are well known. Such intracellular antibodies, also known as "intrabodies", may be specifically targeted to a particular compartment within the cell, providing control over where the inhibitory activity of the treatment will be focused. This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol. 13). Intrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors. See, for example, Richardson et al., 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141 ; Beerli et al., 1994, J. Biol. Chem. 289: 23931-23936; Deshane et al., 1994, Gene Ther. 1 : 332-337.

Single chain antibodies comprise the variable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide. Optionally, single chain antibodies may be expressed as a single chain variable region fragment joined to the light chain constant region. Well known intracellular trafficking signals may be engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to precisely target the expressed intrabody to the desired intracellular compartment. For example, intrabodies targeted to the endoplasmic reticulum (ER) may be engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif. Intrabodies intended to exert activity in the nucleus may be engineered to include a nuclear localization signal. Lipid moieties may be joined to intrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane. Intrabodies may also be targeted to exert function in the cytosol. For example, cytosolic intrabodies may be used to sequester factors within the cytosol, thereby preventing them from being transported to their natural cellular destination.

In order to specifically direct the expression of such intrabodies to prostate tumor cells, the transcription of the intrabody may be placed under the regulatory control of an appropriate prostate-specific promoter and/or enhancer, such as the PSA promoter and/or promoter/enhancer may be utilized (See, for example, U.S. Patent No. 5,919,652). B. THERAPEUTIC INHIBITION OF TSPY TRANSCRIPTION OR TRANSLATION Within the second class of therapeutic approaches, the invention provides various methods and compositions for inhibiting the transcription of the TSPY gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of TSPY mRNA into protein.

In one approach, a method of inhibiting the transcription of the TSPY gene comprises contacting the TSPY gene with a TSPY antisense polynucleotide. In another approach, a method of inhibiting TSPY mRNA translation comprises contacting the TSPY mRNA with an antisense polynucleotide. In another approach, a TSPY specific ribozyme may be used to cleave the TSPY message, thereby inhibiting translation. Such antisense and ribozyme based methods may also be directed to the regulatory regions of the TSPY gene, such as the TSPY promoter and/or enhancer elements. Similarly, proteins capable of inhibiting a TSPY gene transcription factor may be used to inhibit TSPY mRNA transcription. The various polynucleotides and compositions useful in the aforementioned methods have been described above. The use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.

Other factors which inhibit the transcription of TSPY through interfering with TSPY transcriptional activation may also be useful for the treatment of prostate cancers expressing TSPY. Similarly, factors which are capable of interfering with TSPY processing may be useful for the treatment of prostate cancers expressing TSPY.

TSPY PROSTATE CANCER VACCINES The invention further provides prostate cancer vaccines comprising a TSPY protein or fragment thereof, as well as DNA based vaccines. In view of the testis-restricted expression of TSPY in normal human tissues (and the existence of the testis-blood barrier), TSPY cancer vaccines are expected to be effective at specifically preventing and/or treating TSPY expressing cancers without creating non-specific effects on non- target tissues. The use of a tumor antigen in a vaccine for generating humoral and cell- mediated immunity for use in anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al., 1995, Int. J. Cancer 63: 231-237; Fong et al., 1997, J. Immunol. 159: 3113-3117). Such methods can be readily practiced by employing a TSPY protein, or fragment thereof, or a TSPY-encoding nucleic acid molecule and recombinant vectors capable of expressing and appropriately presenting the TSPY immunogen.

For example, viral gene delivery systems may be used to deliver a TSPY-encoding nucleic acid molecule. Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno-associated virus, lentivirus, and sindbus virus (Restifo, 1996, Curr. Opin. Immunol. 8: 658-663). Non-viral delivery systems may also be employed by using naked DNA encoding a TSPY protein or fragment thereof introduced into the patient (e.g., intramuscularly) to induce an anti- tumor response. In one embodiment, the full-length human TSPY cDNA may be employed. In another embodiment, TSPY nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) epitopes may be employed. CTL epitopes can be determined using specific algorithms (e.g., Epimer, Brown University) to identify peptides within a TSPY protein which are capable of optimally binding to specified HLA alleles.

Various ex vivo strategies may also be employed. One approach involves the use of dendritic cells to present TSPY antigen to a patient's immune system. Dendritic cells express MHC class I and II, B7 costimulator, and IL-12, and are thus highly specialized antigen presenting cells. In prostate cancer, autologous dendritic cells pulsed with peptides of the prostate-specific membrane antigen (PSMA) are being used in a Phase I clinical trial to stimulate prostate cancer patients' immune systems (Tjoa et al., 1996, Prostate 28: 65-69; Murphy et al., 1996, Prostate 29: 371-380). Dendritic cells can be used to present TSPY peptides to T cells in the context of MHC class I and II molecules. In one embodiment, autologous dendritic cells are pulsed with TSPY peptides capable of binding to MHC molecules. In another embodiment, dendritic cells are pulsed with the complete TSPY protein. Yet another embodiment involves engineering the overexpression of the TSPY gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al., 1997, Cancer Gene Ther. 4: 17-25), retrovirus (Henderson et al., 1996, Cancer Res. 56: 3763-3770), lentivirus, adeno-associated virus, DNA transfection (Ribas et al., 1997, Cancer Res. 57: 2865-2869), and tumor-derived RNA transfection (Ashley et al., 1997, J. Exp. Med. 186: 1177-1182). Cells expressing TSPY may also be engineered to express immune modulators, such as GM-CSF, and used as immunizing agents.

Anti-idiotypic anti-TSPY antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a TSPY protein. Specifically, the generation of anti-idiotypic antibodies is well known in the art and can readily be adapted to generate anti-idiotypic anti-TSPY antibodies that mimic an epitope on a TSPY protein (see, for example, Wagner et al., 1997, Hybridoma 16: 33-40; Foon et al., 1995, J Clin Invest 96: 334-342; Herlyn et al., 1996, Cancer Immunol Immunother 43: 65-76). Such an anti-idiotypic antibody can be used in cancer vaccine strategies. Genetic immunization methods may be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing TSPY. Constructs comprising DNA encoding a TSPY protein/immunogen and appropriate regulatory sequences may be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded TSPY protein/immunogen. Expression of the TSPY protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against prostate cancer. Various prophylactic and therapeutic genetic immunization techniques known in the art may be used (for review, see information and references published at Internet address www.genweb.com).

P. GENERAL CONSIDERATIONS

Gene transfer and gene therapy technologies may be used for delivering therapeutic polynucleotide molecules to tumor cells synthesizing TSPY (i.e., antisense, ribozyme, polynucleotides encoding intrabodies and other TSPY inhibitory molecules). A number of gene therapy approaches are known in the art. Recombinant vectors encoding TSPY antisense polynucleotides, ribozymes, factors capable of interfering with TSPY transcription, and so forth, may be delivered to target tumor cells using such gene therapy approaches.

The above therapeutic approaches may be combined with chemotherapy or radiation therapy regimens. These therapeutic approaches may also enable the use of reduced dosages of chemotherapy and/or less frequent administration, particularly in patients that do not tolerate the toxicity of the chemotherapeutic agent well.

The anti-tumor activity of a particular composition (e.g., antisense, ribozyme, intrabody), or a combination of such compositions, may be evaluated using various in vitro and in vivo assay systems. In vitro assays for evaluating therapeutic potential include cell growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of determining the extent to which a therapeutic composition will inhibit the binding of TSPY to a binding partner, etc.

In vivo, the effect of a TSPY therapeutic composition may be evaluated in a suitable animal model. For example, xenogenic prostate cancer models wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice, are appropriate in relation to prostate cancer and have been described (Klein et al., 1997, Nature Medicine 3: 402- 408). For Example, PCT Patent Application W098/16628, Sawyers et al., published April 23, 1998, describes various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Various bladder carcinoma models are known (see, for example, Russell et al., 1986, Cancer Res. 46: 2035-2040; Raghavan et al., 1992, Semin. Surg. Oncol. 8: 279-284; Rieger et al., 1995, Br. J. Cancer 72: 683-690; Oshinsky et al., 1995, J. Urol. 154: 1925-1929). Efficacy may be predicted using assays which measure inhibition of tumor formation, tumor regression or metastasis, and the like. See, also, the Examples below.

In vivo assays which qualify the promotion of apoptosis may also be useful in evaluating potential therapeutic compositions. In one embodiment, xenografts from bearing mice treated with the therapeutic composition may be examined for the presence of apoptotic foci and compared to un-treated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition.

The therapeutic compositions used in the practice of the foregoing methods may be formulated into pharmaceutical compositions comprising a carrier suitable for the desired delivery method. Suitable carriers include any material which when combined with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generally, Remington's Pharmaceutical Sciences 16^th Edition, A. Osal., Ed., 1980).

Therapeutic formulations may be solubilized and administered via any route capable of delivering the therapeutic composition to the tumor site. Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, intratumor, intradermal, intraorgan, orthotopic, and the like. A preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP. Therapeutic protein preparations may be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water containing, for example, benzyl alcohol preservative, or in sterile water prior to injection.

Dosages and administration protocols for the treatment of prostate cancers using the foregoing methods will vary with the method and the target cancer and will generally depend on a number of other factors appreciated in the art. KITS

For use in the diagnostic and therapeutic applications described or suggested above, kits are also provided by the invention. Such kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method. For example, one of the container means may comprise a probe which is or can be detectably labeled. Such probe may be an antibody or polynucleotide specific for a TSPY protein or a TSPY gene or message, respectively. Where the kit utilizes nucleic acid hybridization to detect the target nucleic acid, the kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.

TSPY COMPOSITIONS USED IN THE PRACTICE OF THE INVENTION For polynucleotide based detection of TSPY, various polynucleotides based on the structure of the TSPY cDNA provided herein are employed (FIG. 1). Standard molecular cloning, manipulation and synthesis technologies may be used to generate these compositions. TSPY polynucleotides useful in this aspect of the invention may comprise all or part of the cDNA provided herein (FIG. 1), or probes and primers designed to hybridize or amplify the TSPY message in a sample. In addition to DNA and RNA molecules, polynucleotides with alternative backbones or including alternative bases, whether derived from natural sources or synthesized, may also be employed. Antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, that specifically bind DNA or RNA in a base pair-dependent manner. A skilled artisan can readily obtain these classes of nucleic acid molecules using the TSPY gene and protein sequences.

Probes may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme. Such probes and primers can be used to detect the presence of a TSPY polynucleotide in a sample and as a means for detecting a cell expressing a TSPY protein. Examples of such probes include polypeptides comprising all or part of the human TSPY cDNA sequence shown in FIG. 1. Examples of primer pairs capable of specifically amplifying TSPY mRNAs are also described in the Examples which follow. As will be understood by the skilled artisan, a great many different primers and probes may be prepared based on the sequences provided in herein and used effectively to amplify and/or detect a TSPY mRNA.

TSPY proteins and polypeptides are useful in the practice of the prostate cancer vaccine therapies described herein as well as for the generation of antibodies specific for TSPY. Such TSPY proteins and polypeptides may be produced by a number of means well known in the art, including recombinant expression technologies and peptide systhesis methods. TSPY polypeptides containing particularly interesting structures can be predicted and/or identified using various analytical techniques well known in the art, including, for example, the methods of Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis, or on the basis of immunogenicity. Fragments containing such structures are particularly useful in generating subunit specific anti-TSPY antibodies or in identifying cellular factors that bind to TSPY.

Host-vector systems comprising a recombinant DNA molecule containing all or part of the TSPY coding sequence within a suitable prokaryotic or eukaryotic host cell may be used to express recombinant TSPY or polypeptides corresponding to part of TSPY. A wide range of host-vector systems suitable for the expression of TSPY proteins or fragments thereof are available, see for example, Sambrook et al., 1989, supra; Current Protocols in Molecular Biology, 1995, supra). Examples of suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 or HighFive cell). Examples of suitable mammalian cells include various prostate cancer cell lines such LnCaP, PC-3, DU145, LAPC-4, TsuPM , other transfectable or transducible prostate cancer cell lines, as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). For example, TSPY may be conveniently expressed in 293T cells transfected with a CMV-dtiven expression vector encoding TSPY with a C-terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen). The secreted HlS-tagged TSPY in the culture media may then be purified using a nickel column using standard techniques. Other preferred vectors for mammalian expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSRαtkneo (Muller et al., 1991 , MCB 11 :1785). Expression constructs encoding a leader peptide joined in frame to the TSPY coding sequence may be used for the generation of a secreted form of recombinant TSPY protein.

Antibodies specific for TSPY, useful in the prostate cancer diagnostic/prognostic and therapeutic methods described above, may be prepared using standard technologies widely used in the art. For example, antibodies may be prepared by immunizing a suitable mammalian host using a TSPY protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)). In addition, fusion proteins of TSPY may also be used, such as a TSPY GST-fusion protein (see Examples). In a particular embodiment, a GST fusion protein comprising one or more of the extracellular loops of the TSPY protein may be produced and used as an immunogen to generate appropriate extracellular-reactive TSPY antibodies. In another embodiment, a TSPY peptide may be synthesized and used as an immunogen. Cells expressing or overexpressing TSPY may also be used for immunizations. Similarly, any cell engineered to express TSPY may be used. Such strategies may result in the production of monoclonal antibodies with enhanced capacities for recognizing endogenous TSPY.

In addition, naked DNA immunization techniques known in the art may be used (with or without purified TSPY protein or TSPY expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly et al., 1997, Ann. Rev. Immunol. 15: 617-648).

The amino acid sequence of TSPY as shown in FIG. 1 may be used to select specific regions of the TSPY protein for generating antibodies. For example, hydrophobicity and hydrophilicity analyses of the TSPY amino acid sequence may be used to identify hydrophilic regions in the TSPY structure. Regions of the TSPY protein that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis. Methods for the generation of TSPY antibodies are further illustrated by way of the examples provided herein.

Methods for preparing a protein or polypeptide for use as an immunogen and for preparing immunogenic conjugates of a protein with a carrier such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be used; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be effective. Administration of a TSPY immunogen is conducted generally by injection over a suitable time period and with use of a suitable adjuvant, as is generally understood in the art. During the immunization schedule, titers of antibodies can be taken to determine adequacy of antibody formation. TSPY monoclonal antibodies are preferred and may be produced by various means well known in the art. For example, immortalized cell lines which secrete a desired monoclonal antibody may be prepared using the standard hybridoma technology of Kohler and Milstein or modifications which immortalize producing B cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the TSPY protein or a TSPY fragment. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells may be expanded and antibodies produced either from in vitro cultures or from ascites fluid.

As mentioned above, numerous TSPY polypeptides may be used as immunogens for generating monoclonal antibodies using traditional methods. A particular embodiment comprises an antibody which immunohistochemically stains cells transfected with an expression plasmid carrying the TSPY coding sequence, wherein the transfected cells express TSPY protein, but which does not immunohistochemically stain untransfected cells. Any mammalian cell line which is capable of expressing the TSPY protein on the cell surface is suitable, such as 293T cells.

For example, TSPY monoclonal antibodies may be generated using NIH 3T3 cells expressing TSPY as an immunogen to generate mAbs that recognize the cell surface epitopes of TSPY. Reactive mAbs may be screened by cell-based ELISAs using PC-3 cells over-expressing TSPY. In another specific embodiment, recombinant TSPY protein generated with an amino-terminal His-tag using a suitable expression system (e.g., baculovirus expression system pBlueBac4.5, Invitrogen) is purified using a Nickel column and used as immunogen.

The antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of the TSPY protein can also be produced in the context of chimeric or CDR grafted antibodies of multiple species origin. Humanized or human TSPY antibodies may also be produced and are preferred for use in therapeutic contexts. Methods for humanizing murine and other non-human antibodies by substituting one or more of the non-human antibody CDRs for corresponding human antibody sequences are well known (see for example, Jones et al., 1986, Nature 321 : 522-525; Riechmnan et al., 1988, Nature 332: 323-327; Verhoeyen et al., 1988, Science 239: 1534-1536). See also, Carter et al., 1993, Proc. Natl. Acad. Sci. USA 89: 4285 and Sims et al., 1993, J. Immunol. 151 : 2296. Methods for producing fully human monoclonal antibodies include phage display and transgenic methods (for review, see Vaughan et al., 1998, Nature Biotechnology 16: 535-539). Fully human TSPY monoclonal antibodies may be generated using cloning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man. Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. ]d., pp 65- 82). Fully human TSPY monoclonal antibodies may also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application W098/24893, Kucherlapati and Jakobovits et al., published December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614). This method avoids the in vitro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.

Reactivity of TSPY antibodies with a TSPY protein may be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, TSPY proteins, peptides, TSPY-expressing cells or extracts thereof.

A TSPY antibody or fragment thereof of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to a TSPY positive cell (Vitetta, E.S. et al., 1993,

Immunotoxin Therapy, in DeVita, Jr., V.T. et al., eds, Cancer: Principles and Practice of Oncology, 4th ed., J.B. Lippincott Co., Philadelphia, 2624-2636). Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme. Further, bi-specific antibodies specific for two or more TSPY epitopes may be generated using methods generally known in the art. Homodimeric antibodies may also be generated by cross-linking techniques known in the art (e.g., Wolff et al., Cancer Res.

53: 2560-2565).

EXAMPLES

EXAMPLE 1 : SSH-GENERATED ISOLATION OF cDNA FRAGMENT OF TSPY GENE

MATERIALS AND METHODS LAPC Xenografts:

LAPC xenografts were obtained from Dr. Charles Sawyers (UCLA) and generated as described (Klein et al, 1997, Nature Med. 3: 402-408). Androgen dependent and independent LAPC-4 xenografts LAPC-4 AD and Al, respectively) and LAPC-9 AD xenografts were grown in male SCID mice and were passaged as small tissue chunks in recipient males. LAPC-4 Al xenografts were derived from LAPC-4 AD tumors. Male mice bearing LAPC-4 AD tumors were castrated and maintained for 2-3 months. After the LAPC-4 tumors re-grew, the tumors were harvested and passaged in castrated males or in female SCID mice.

Cell Lines:

Human cell lines (e.g., HeLa) were obtained from the ATCC and were maintained in

DMEM with 5% fetal calf serum.

RNA Isolation:

Tumor tissue and cell lines were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue or 10 ml/ 10⁸ cells to isolate total RNA. Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by spectrophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.

Oliqonucleotides:

The following HPLC purified oligonucleotides were used.

DPNCDN (cDNA synthesis primer):

5'TTTTGATCAAGCTT₃₀3'

Adaptor 1 :

5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3'

3^*GGCCCGTCCTAG5'

Adaptor 2:

5'GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG3' 3'CGGCTCCTAG5'

PCR primer 1 :

5'CTAATACGACTCACTATAGGGC3'

Nested primer (NP)1 : 5 CGAGCGGCCGCCCGGGCAGGA3'

Nested primer (NP)2: 5ΑGCGTGGTCGCGGCCGAGGA3' Suppression Subtractive Hybridization:

Suppression Subtractive Hybridization (SSH) was used to identify cDNAs corresponding to genes which may be differentially expressed in prostate cancer. The SSH reaction utilized cDNA from two different LAPC-4 xenografts, wherein the LAPC-4 Al xenograft was used as the source of the "tester" cDNA, while the LAPC-9 Al xenograft was used as the source of the "driver" cDNA.

Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 μg of poly(A)⁺ RNA isolated from the relevant xenograft tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1 , Catalog No. K1804-1). The resulting cDNA was digested with Dpn II for 3 hrs. at 37°C. Digested cDNA was extracted with phenol/chloroform (1 :1) and ethanol precipitated.

Driver cDNA was generated by combining in a 1 :1 ratio Dpn II digested cDNA from the relevant xenograft source (see above) with a mix of digested cDNAs derived from human benign prostatic hyperplasia (BPH), the human cell lines HeLa, 293, A431 , Colo205, and mouse liver.

Tester cDNA was generated by diluting 1 μl of Dpn II digested cDNA from the relevant xenograft source (see above) (400 ng) in 5 μl of water. The diluted cDNA (2 μl, 160 ng) was then ligated to 2 μl of Adaptor 1 and Adaptor 2 (10 μM), in separate ligation reactions, in a total volume of 10 μl at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 μl of 0.2 M EDTA and heating at 72°C for 5 min.

The first hybridization was performed by adding 1.5 μl (600 ng) of driver cDNA to each of two tubes containing 1.5 μl (20 ng) Adaptor 1- and Adaptor 2- ligated tester cDNA. In a final volume of 4 μl, the samples were overlaid with mineral oil, denatured in an MJ Research thermal cycler at 98°C for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68°C. The two hybridizations were then mixed together with an additional 1 μl of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C. The second hybridization was then diluted in 200 μl of 20 mM Hepes, pH 8.3, 50 mM NaCI, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.

PCR Amplification. Cloning and Sequencing of Gene Fragments Generated from SSH: To amplify gene fragments resulting from SSH reactions, two PCR amplifications were performed, in the primary PCR reaction 1 μl of the diluted final hybridization mix was added to 1 μl of PCR primer 1 (10 μM), 0.5 μl dNTP mix (10 μM), 2.5 μl 10 x reaction buffer (CLONTECH) and 0.5 μl 50 x Advantage cDNA polymerase Mix (CLONTECH) in a final volume of 25 μl. PCR 1 was conducted using the following conditions: 75°C for 5 min., 94°C for 25 sec, then 27 cycles of 94°C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment. The products were pooled and diluted 1 :10 with water. For the secondary PCR reaction, 1 μl from the pooled and diluted primary PCR reaction was added to the same reaction mix as used for PCR 1 , except that primers NP1 and NP2 (10 μM) were used instead of PCR primer 1. PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, 72°C for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.

The PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed E. coli were subjected to blue/white and ampicillin selection. White colonies were picked and arrayed into 96 well plates and were grown in liquid culture overnight. To identify inserts, PCR amplification was performed on 1 ml of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.

Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.

RT-PCR Expression Analysis:

First strand cDNAs were generated from 1 μg of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Preamplification system. The manufacturers protocol was used and included an incubation for 50 min at 42°C with reverse transcriptase followed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume was increased to 200 μl with water prior to normalization. First strand cDNAs from 16 different normal human tissues were obtained from Clontech.

Normalization of the first strand cDNAs from multiple tissues was performed by using the primers 5'atatcgccgcgctcgtcgtcgacaa3' and 5'agccacacgcagctcattgtagaagg 3' to amplify β-actin. First strand cDNA (5 μl) was amplified in a total volume of 50 μl containing 0.4 μM primers, 0.2 μM each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCI₂, 50 mM KCI, pH8.3) and 1X Klentaq DNA polymerase (Clontech). Five μl of the PCR reaction was removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis. PCR was performed using an MJ Research thermal cycler under the following conditions: initial denaturation was at 94°C for 15 sec, followed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min. After agarose gel electrophoresis, the band intensities of the 283 bp β-actin bands from multiple tissues were compared by visual inspection. Dilution factors for the first strand cDNAs were calculated to result in equal β-actin band intensities in all tissues after 22 cycles of PCR. Three rounds of normalization were required to achieve equal band intensities in all tissues after 22 cycles of PCR.

To determine expression levels of the TSPY gene, 5 μl of normalized first strand cDNA was analyzed by PCR using 25, 30, and 35 cycles of amplification using the following primer pairs, which were designed with the assistance of (MIT; for details, see, www.genome.wi.mit.edu):

5' - CCT GAT CAC TGA CGA AGA TGA AGA - 3' 5' - AAG AAG TTA AGG CTG CTG TTG TGG - 3'

Semi quantitative expression analysis was achieved by comparing the PCR products at cycle numbers that give light band intensities.

RESULTS:

The SSH experiment described in the Materials and Methods, supra, led to the isolation of numerous candidate gene fragment clones (SSH clones). All candidate clones were sequenced and subjected to homology analysis against all sequences in the major public gene and EST databases in order to provide information on the identity of the corresponding gene and to help guide the decision to analyze a particular gene for differential expression. In general, gene fragments which had no homology to any known sequence in any of the searched databases, and thus considered to represent novel genes, as well as gene fragments showing homology to previously sequenced expressed sequence tags (ESTs), were subjected to differential expression analysis by RT-PCR and/or Northern analysis.

One of the SHH clones comprising about 107 bp, showed identity to the human Y- specific gene TSPY (testis-specific protein Y-encoded) (Arnemann, J et al., 1991 , Genomics 11 : 108-114). The nucleotide sequence of this SHH clone is shown in FIG. 2. Differential expression analysis by RT-PCR showed over-expression in all LAPC xenografts relative to normal prostate tissue, with the highest levels observed in the LAPC-4 xenografts (FIG. 3, Panel A). In addition, RT-PCR expression analysis of first strand cDNAs from 16 normal tissues detected expression only in testis after 30 cycles of PCR amplification (FIG. 3, panels B and C). After 35 cycles of amplification, the only other tissue in which expression of TSPY was detected was prostate, but only at significantly lower levels in relation to expression in testis (FIG. 3, Panels B and C).

Throughout this application, various publications are referenced within parentheses. The disclosures of these publications are hereby incorporated by reference herein in their entireties.

The present invention is not to be limited in scope by the embodiments disclosed herein, which are intended as single illustrations of individual aspects of the invention, and any which are functionally equivalent are within the scope of the invention. Various modifications to the models and methods of the invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and teachings, and are similarly intended to fall within the scope of the invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.

Claims

CLAIMS:

1. A method of diagnosing the presence of prostate cancer in an individual comprising:

(a) obtaining a test sample of tissue from the individual;

(b) determining the level of TSPY mRNA expressed in the test sample;

(c) comparing the level so determined to the level of TSPY mRNA expressed in a comparable known normal tissue sample,

the presence of elevated TSPY mRNA expression in the test sample relative to the normal tissue sample providing an indication of the presence of prostate cancer.

2. The method of claim 1 , wherein the test and normal tissue samples are selected from the group consisting of prostate, bone, lymphatic, and seminal vessicle tissue, serum, blood and semen.

3. A method of diagnosing the presence of prostate cancer in an individual comprising:

(a) obtaining a test sample of tissue from the individual;

(b) determining the level of TSPY protein expressed in the test sample;

(c) comparing the level so determined to the level of TSPY protein expressed in a comparable known normal tissue sample,

the presence of elevated TSPY protein in the test sample relative to the normal tissue sample providing an indication of the presence of prostate cancer.

4. The method of claim 1 , wherein the test and normal tissue samples are selected from the group consisting of prostate, bone, lymphatic, and seminal vessicle tissue, serum, blood and semen.

5. A method of treating a patient with a prostate cancer that expresses TSPY which comprises inhibiting the transcription of TSPY in the cells of said prostate cancer.

6. The method according to claim 5, wherein TSPY transcription is inhibited by contacting the TSPY gene with an antisense polynucleotide complementary to the coding sequence of human TSPY as shown in FIG. 1.

7. A method of treating a patient with a prostate cancer that expresses TSPY which comprises inhibiting the translation of TSPY mRNA in the cells of said prostate cancer.

8. The method according to claim 7, wherein TSPY mRNA translation is inhibited by contacting the TSPY mRNA with an antisense polynucleotide complementary to the coding sequence of human TSPY as shown in FIG. 1.

9. The method according to claim 7, wherein TSPY mRNA translation is inhibited by contacting the TSPY mRNA with a ribozyme capable of cleaving said TSPY mRNA.

10. A vaccine composition for the treatment of a prostate cancer comprising the TSPY protein or an immunogenic portion of at least 20 amino acids thereof and a physiologically acceptable carrier.

11. A method of inhibiting the development of a prostate cancer in a patient, comprising administering to the patient an effective amount of the vaccine composition of claim 10.