EP1576162A1 - Chimäres protein für das screening von agonisten und antagonisten der zellsignalisierungswegen, die von den g-protein gekoppelten rezeptoren abhängig sind. - Google Patents

Chimäres protein für das screening von agonisten und antagonisten der zellsignalisierungswegen, die von den g-protein gekoppelten rezeptoren abhängig sind.

Info

Publication number
EP1576162A1
EP1576162A1 EP03813931A EP03813931A EP1576162A1 EP 1576162 A1 EP1576162 A1 EP 1576162A1 EP 03813931 A EP03813931 A EP 03813931A EP 03813931 A EP03813931 A EP 03813931A EP 1576162 A1 EP1576162 A1 EP 1576162A1
Authority
EP
European Patent Office
Prior art keywords
subunit
chimeric protein
proteins
page
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03813931A
Other languages
English (en)
French (fr)
Inventor
Michel De Waard
Alain Dupuis
Didier Grunwald
Guillaume Sandoz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Commissariat a lEnergie Atomique et aux Energies Alternatives CEA
Original Assignee
Commissariat a lEnergie Atomique CEA
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commissariat a lEnergie Atomique CEA, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Commissariat a lEnergie Atomique CEA
Publication of EP1576162A1 publication Critical patent/EP1576162A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to a chimeric recombinant protein derived from the ai and ⁇ subunits of high-threshold calcium channels, as well as to its applications for the study of cell signaling pathways dependent on receptors coupled to G proteins (GPCR). and the identification of compounds modulating the activity of G proteins.
  • GPCR G proteins
  • the class of GPCR includes more than a thousand identified members, coded by genes representing 2 to 5% of the coding potential of the vertebrate genome (El Far and Betz, Biochem. J., 2002, 365, 329-336); there are 27 genes coding for G ⁇ subunits, 5 for G ⁇ subunits, and 14 for G ⁇ subunits (Albert and Robillard, Cell, 2002, 14, 407-418).
  • GPCRs are capable of ensuring recognition and transduction of messages as varied as those of amino acids (glutamic acid 7), peptides (angiotensin, neurotensin, somatostatin %), proteins (thyrotropin (TSH), follicle stimulating hormone (FSH) %) , amines (acetylcholine, adrenaline, serotonin %), lipids (prostaglandins, leukotrienes %), nucleotides and nucleosides (adenosine or ATP).
  • Ions Ca "1”
  • odorous and gustatory molecules odorous and gustatory molecules
  • photons and pheromones are also part of the extracellular signals recognized by GPCRs (for review, see Gether, Endocrine reviews, 2000, 21, 90-113 and Albert and Robillard, supra).
  • the extracellular signal is transduced inside the cell via the heterotrimeric G proteins binding the guanylic nucleotides (GDP and GTP), composed of subunits called G ⁇ , G ⁇ , G ⁇ ; recognition of the extracellular signal by the RCPG results in the activation of the G proteins, which results in the dissociation of the heterotrimer into G ⁇ and G ⁇ , and the binding of the G ⁇ subunit to GTP.
  • GDP and GTP guanylic nucleotides
  • the effectors controlled by the G ⁇ subunits can be enzymes (phospholipases A2 and C, adenylyl- and guanylylcyclases, c-jun kinase, tyrosine- phosphatase (SH-PTP2) ”), the activation of which will influence the rate of second messengers produced or released (phosphoinositides and diacyls-glycerols, Ca ++ , cAMP, cGMP Among channels (with potassium, calcium, sodium or chlorine conductances), ion exchangers (sodium / proton) or more recently kinases (Btk tyrosine kinases (Bruton's tyrosine kinase), MAP kinases (Mitogen-Activated protein kinase), (Albert and Robillard, supra).
  • enzymes phospholipases A2 and C, adenylyl- and guanylylcyclases, c-jun kin
  • G ⁇ can also modulate the activity of effectors at least as numerous as those controlled by G ⁇ , namely: channels (with sodium conductivity, calcium dependent on voltage (N and P / Q) or potassium with incoming rectification (GIRK: G protein inward rectifyer K + channel) Among, the so-called “classic” enzymes (phospholipases A2 and C, adenylyl-cyclase I, II, IV, tyrosine phosphatase (SH-PTP1) ”), as well as a number important kinases (phosphoinositide 3-kinase, ⁇ -adrenergic receptor kinases, c-jun kinase, MAP kinases, tyrosine kinases Btk and T-cell-specific kinase (Tsk), (for review see Albert and Robillard, supra).
  • channels with sodium conductivity, calcium dependent on voltage (N and P / Q) or potassium with incoming rectification
  • GIRK G
  • the calcium channels comprise channels of the low-threshold type, activating by weak depolarizations and channels of the high-threshold type, activating by strong depolarizations.
  • the high-threshold type channels represent a heteromultimeric complex ⁇ 2 ⁇ and ⁇ , in which the membrane ⁇ j subunit, constituting the channel proper, is associated with an intracellular regulatory subunit ⁇ (or Ca v ⁇ ), by through its interaction domain (AID domain for alpha interaction domain), with a conserved motif: QQ-E - L-GY-- WI - E (one-letter code; - representing any amino acid ; Pragnell et al., Nature, 1994, 368, 67-70; Figure 1) in which residues Y392, W395 and 1396 are essential for the binding of the ⁇ subunit (De Waard et al., FEBS, 1996, 380, 272-276).
  • the ⁇ regulatory subunit binds to the AID domain via its BID domain (bet ⁇ interaction domain; DeWaard et al., J. Biol. Chem., 1995, 270, 12056-12064) which is included in a domain GK-like (Hanlon et al., FEBS, 1999, 445, 366-370). Seven subunits have been identified: ⁇ i A (Ca v ⁇ 2 . ⁇ ), aie (Ca v a 2 .2) > aiE (Ca v a 2.
  • the high-threshold calcium channels of type N and P / Q are directly involved in triggering the functioning of the synapse: their opening under the effect of an action potential induces calcium entry into the presynaptic termination. This signal triggers the secretion of neuromediators such as glutamate in the synaptic cleft and, thus, the propagation of nerve impulses in postsynaptic dendrite.
  • the N and P / Q channels are regulated by receptors linked to trimeric G proteins (GPCR) such as metabotropic class III glutamate receptors (for review: El Far and Betz., Supra) or noradrenergic, muscarinic, GABAergic (GABA 5 ⁇ -aminobutyric acid), serotonergic, dopaminergic, and opioid receptors (for review: Hille, Trends NeuroSci., 1994, 17, 531-536) .
  • GPCR trimeric G proteins
  • G ⁇ subcomplex is directly responsible for an inhibition of the activity of P / Q channels which results from a direct fixation of G ⁇ on the intra-cytoplasmic loop connecting the membrane domains I and II (loop I-II) of the ⁇ j subunit (De Waard et al., Nature, 1997, 385, 446-450).
  • this loop has several interaction sites with G ⁇ , overlapping the binding domain with the regulatory subunit Ca v ⁇ (AID domain; Figure 1), including a consensus motif QQ - RL-GY included in the domain AID, is essential for the binding of G ⁇ ( Figure 1; De Waard et al., Nature 1997, 385, 446-450; Zamponi et al., Nature, 1997, 385, 442-446).
  • the Ca v ⁇ regulatory subunit seems to counteract the functional effect of G proteins (Bourinet et al, PNAS, 1996, 93, 1486-1491).
  • the inventors have constructed chimeric proteins by NH 2 and / or COOH terminal fusion: (i) of the loop I-II of the subunit ai of high-threshold calcium channels sensitive or insensitive to the G proteins (respectively, ⁇ i A or Ca v ⁇ . ⁇ constituting a P / Q type neural channel and ⁇ j c or Ca v ⁇ . 2 constituting a cardiovascular type L channel) or a fragment thereof; said loop corresponds to positions 367 to 487 with reference to the sequence of the Ca v ⁇ 2 . ⁇ subunit, and comprises the domain for binding to a ⁇ subunit of a calcium channel (or AID domain) and the sites of binding to a G ⁇ subunit of a G protein (FIG. 1), and
  • the inventors have shown that the chimeric protein derived from an ai subunit sensitive to G proteins exists in two "closed” or “open” forms, respectively in the absence or in the presence of G ⁇ subunit capable of binding to said fragment of the ⁇ j subunit, either in the form of G ⁇ monomer, either in the form of a G ⁇ heterodimer.
  • the chimeric protein is capable of folding, thus allowing the domains of interaction of the ai and ⁇ subunits of the calcium channel to associate by a stable intramolecular bond (closed form).
  • the intramolecular bond is destroyed and the domains of interaction of the ai and ⁇ subunits of the calcium channel dissociate (open form), thus allowing each of the domains to interact respectively with G ⁇ (interaction domain of the ai subunit: AID domain) and / or an ai subunit of a calcium channel (interaction domain of the ⁇ subunit: BID domain).
  • the chimeric protein derived from an ⁇ j subunit insensitive to G proteins is capable of folding, thus allowing the interaction domains of the ai and ⁇ subunits of the calcium channel to associate by a stable intramolecular bond. (closed form).
  • the intramolecular bond can also be destroyed and the interaction domains of the ai and ⁇ subunits of the calcium channel dissociate (open form), thus allowing each of the domains to interact respectively with said antagonist other than G ⁇ or G ⁇ (interaction domain of the ⁇ j subunit: AID domain) and / or an a subunit of a calcium channel (interaction domain of the ⁇ subunit: BID domain).
  • chimeric proteins derived from the ai and ⁇ subunits of high-threshold calcium channels represent tools that are simple to implement, sensitive, specific and useful for the following applications:
  • chimeric proteins derived from a subunit ai sensitive to G proteins make it possible to determine the variations in cell concentration in free G ⁇ subunits, ex vivo, in time and therefore to measure the activation of G proteins in cells: such chimeric proteins represent ubiquitous biosensors for the activation of G proteins perfectly suited to the study of cellular signaling and regulatory pathways dependent on receptors coupled to G proteins and to the screening of agonists / antagonists of these signaling pathways capable of increasing or decreasing the concentration of free G ⁇ subunits in cells and therefore of modulating the activity of these regulatory and cellular signaling dependent on receptors coupled to G proteins.
  • - chimeric proteins derived from a subunit ai sensitive or resistant to G proteins represent simple, sensitive and specific tools, perfectly suited to screening for antagonists of the interaction between the ai and ⁇ subunits, capable of modulating the activity of all high-threshold calcium channels.
  • the chimeric proteins derived from an ai subunit and from a ⁇ subunit of a high-threshold calcium channel as defined above are also useful for the systematic pharmaco-toxicological control of new drugs in phase I and the search for natural orphan receptor agonists.
  • the subject of the present invention is a chimeric protein derived from a high threshold calcium channel, characterized in that it comprises at least one ⁇ subunit or a fragment thereof including at least the BID domain, fused (e) at its NH 2 or COOH end with the loop I-II of an ⁇ j subunit or a fragment thereof including at least the AID domain.
  • the AID and BID domains are as defined above; the loop I-II of the ai subunit comprises the AID domain for binding to the ⁇ subunit and the sites for binding to the G ⁇ subunit of a G protein, including a consensus binding site which is included in this AID domain.
  • Figure 1 The invention encompasses chimeric proteins derived from the ai and ⁇ subunits of vertebrates, in particular from human or non-human mammals and from their orthologs in invertebrates.
  • loop I-II or its fragment is either fused directly to the NH 2 or COOH end of the ⁇ subunit or of its fragment, or the two sequences are separated by a spacer peptide, the size and amino acid sequence are such that the AID and BID domains of the chimeric protein containing said spacer are capable of interacting to form an intramolecular bond which is displaced in the presence of an antagonist (change from closed to open form) ; such a spacer peptide is in particular represented by a polyglycine sequence.
  • said chimeric protein comes from a high-threshold calcium channel sensitive to G proteins.
  • said chimeric protein comprises a fragment of a subunit ai selected from ctiA, "and ⁇ i £.
  • said ⁇ subunit is selected from the group consisting of ⁇ i, ⁇ 2 , ⁇ 3 and ⁇ 4 .
  • the invention also includes chimeric proteins constituted by sequences functionally equivalent to the sequences as defined above, that is to say of which the ⁇ subunit and the loop I-II of the ai subunit or their fragments as defined above are capable of forming an intramolecular bond via their interaction domains; said bond possibly being destroyed in the presence of free G ⁇ or G ⁇ subunits or other antagonists of the interaction between the ⁇ j and ⁇ subunits ("open form").
  • sequences there may be mentioned for example the sequences derived from the preceding sequences by: - mutation (substitution and / or deletion, and / or addition) of one or more amino acids of the sequences as defined above,
  • non-proteinogenic amino acid residue any amino acid which does not form part of a natural protein or peptide, in particular any amino acid whose carbon carrying the side chain R, namely the group - CHR-, located between -CO- and -NH- in the natural peptide chain, is replaced by a motif which does not form part of the constitution of a natural protein or peptide.
  • the subject of the present invention is in particular a variant chimeric protein derived from a chimeric protein as defined above, characterized in that it has a mutation of at least one amino acid in the sequences of said ⁇ subunit and / or loop I-II of a subunit ⁇ j.
  • said variant has a mutation which modifies the affinity of the ⁇ subunit for the loop I-II of the ai subunit and / or vice versa; such mutations make it possible to obtain a chimeric protein more or less sensitive to the concentration of free G ⁇ or G ⁇ subunit.
  • mutations in the AID domain of the loop I-II of the ⁇ ls subunit as described in Pragnell et al., Cited above and Waard et al. FEBS, 1996, 380, 272-276, namely: Q383A, Q384A, E386D, E386S, L389H, G391R, Y392S, Y392F, W395A, I396A and E400A.
  • said chimeric protein or its variant is coupled, preferably covalently, to at least one suitable marker allowing the detection and / or the purification and / or the immobilization of said protein, for example: an antigenic epitope, a label of the polyhistidine type, a luminescent compound (fluorophore such as GFP or one of its variants: CFP, YFP and BFP), radioactive, or enzymatic.
  • a suitable marker allowing the detection and / or the purification and / or the immobilization of said protein, for example: an antigenic epitope, a label of the polyhistidine type, a luminescent compound (fluorophore such as GFP or one of its variants: CFP, YFP and BFP), radioactive, or enzymatic.
  • said coupling is carried out by any suitable means, in particular by a peptide bond via the COOH and / or NH 2 functions which are terminal of the peptide chain, or else by another covalent bond, such as for example : an ester, ether, thioether, thioester bond, via reactive functions of the side chain of an amino acid of the peptide chain.
  • said chimeric protein comprises a fluorophore acceptor or donor respectively at its NH 2 and or COOH end.
  • the acceptor fluorophores for example CFP or BFP
  • CFP or BFP can be coupled either to the NH or COOH end of the chimeric protein
  • the donor fluorophores for example GFP or YFP are fused to the opposite end of said chimeric protein.
  • Such chimeric proteins are useful for the ex vivo study in real time of the activation of G proteins and the screening of molecules capable of modulating this activation by measurement of fluorescence transfer (FRET).
  • labeling with a luminescent compound has the advantage of obtaining a localized signal which does not require the presence of other reagents as is the case for enzymatic labeling.
  • This type of marking also allows the use of phenomena such as energy transfer which can be carried out by different mechanisms: energy transfer by resonance, transfer of radiative energy (the acceptor absorbs the light emitted by the donor ) and electron transfer.
  • D and A which are coupled at each end of the chimeric protein so that the energy transfer takes place only when the intramolecular intercation between the BID and AID domains takes place (closed form). This phenomenon results in a reduction or extinction of the luminescence of D and an emission of luminescence of A if the latter is luminescent, when D is excited. During these assays, the variation in the luminescence of A is measured, or the variation in the luminescence of D; the nature of A and D being variable.
  • two fluorescent proteins can be used as donor and acceptor, or else a rare earth complex (europium, terbium) with a chelate, cryptate or macrocycle as donor and a fluorescent protein as acceptor .
  • the measurement of the variation in luminescence of D is based on the ability of a compound (A) to decrease or suppress the luminescence of another compound (D) when these are sufficiently close (“Quench").
  • the range of molecules A that can be used is therefore more extensive and thus includes non-luminescent compounds such as heavy metals, heavy atoms, chemical molecules such as for example methyl red, nanoparticles such as those sold under the name Nanogold ® by the company Nanoprobes (USA), or even the molecules sold under the names DABCYL® (Eurogentec, Belgium), QSY Dyes (Molecular Probes Inc., USA), ElleQuencher® (Oswell / Eurogentec) or Black Hole Quenchers® ( Biosearch Technologies Inc., USA).
  • non-luminescent compounds such as heavy metals, heavy atoms, chemical molecules such as for example methyl red
  • nanoparticles such as those sold under the name Nanogold ® by the company Nanoprobes (USA)
  • DABCYL® Eurogentec, Belgium
  • QSY Dyes Molecular Probes Inc., USA
  • ElleQuencher® Oswell / Eurogentec
  • Black Hole Quenchers® Biosearch Technologies Inc., USA
  • the present invention also relates to a peptide, characterized in that it comprises a fragment of at least 7 amino acids of the sequence of the chimeric protein as defined above, located at the junction of the ⁇ subunit and of the loop I-II of the ai subunit or of their fragments as defined above; such peptides make it possible in particular to produce antibodies specific for the chimeric protein according to the invention.
  • the present invention also relates to antibodies, characterized in that they are directed against a chimeric protein or a peptide as defined above.
  • said antibodies are either monoclonal antibodies or polyclonal antibodies.
  • These antibodies can be obtained by conventional methods, known per se, comprising in particular the immunization of an animal with a protein or a peptide in accordance with the invention, in order to make it produce antibodies directed against said protein or said peptide.
  • Such antibodies are useful in particular for immobilizing the chimeric protein on a solid support, purifying it or even detecting it.
  • the present invention also relates to a nucleic acid molecule, characterized in that it is selected from the group consisting of the sequences coding for a chimeric protein or a peptide as defined above and the sequences complementary to the preceding, sense or antisense.
  • the invention also relates to probes and primers, characterized in that they comprise a sequence of approximately 10 to 30 nucleotides corresponding to that located at the junction of the ⁇ subunit and of the I-II loop of the subunit ai or their fragments as defined above; these probes and these primers make it possible to specifically detect / amplify said nucleic acid molecules encoding the chimeric protein according to the invention.
  • the subject of the invention is also other primers making it possible to specifically amplify the ⁇ subunit and / or the loop I-II of the ai subunit or their fragments as defined above, characterized in that '' they are selected from the group consisting of the sequences SEQ ID NO: 1, 2, 4, 6, 7, 8 and 9.
  • nucleic acid molecules according to the invention are obtained by conventional methods, known in themselves, by following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley andson lnc, L ⁇ brary ofCongress, USA).
  • sequences coding for a chimeric protein according to the invention can be obtained by amplification of a nucleic sequence by PCR or RT-PCR using an appropriate primer pair or else by screening of genomic DNA libraries by hybridization with a homologous probe.
  • the derivative nucleic acid molecules, coding for a variant of the chimeric protein according to the invention are obtained by conventional methods, making it possible to introduce mutations into a nucleic acid sequence, known in themselves, following the aforementioned standard protocols.
  • the sequence coding for a variant of the chimeric protein according to the invention can be obtained by site-directed mutagenesis according to the method of Kunkel et al., (PNAS, 1985, 82, 488-492).
  • the present invention also relates to a recombinant eukaryotic or prokaryotic vector, characterized in that it comprises an insert consisting of the nucleic acid molecules coding for a chimeric protein as defined above.
  • said recombinant vector is an expression vector in which said nucleic acid molecule or one of its fragments is placed under the control of regulatory elements for appropriate transcription and translation.
  • said vector may comprise sequences fused in phase with the 5 'and / or 3' end of said insert, useful for the immobilization, and / or the detection and / or the purification of the protein expressed from said vector.
  • nucleic acid molecule of interest can be inserted in order to introduce and maintain it in a eukaryotic or prokaryotic host cell
  • choice of an appropriate vector depends on the envisaged use for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or else integration into the chromosomal material of the 'host), as well as the nature of the host cell.
  • viral or non-viral vectors such as plasmids can be used.
  • vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods, which are known per se.
  • said recombinant vector it is a eukaryotic expression vector having a sequence selected from the group consisting of the sequences SEQ ID NO: 5 and SEQ ID NO: 10;
  • the plasmid SEQ ID NO: 5 contains the loop I-II of the Ca v ⁇ 2 . ⁇ rabbit subunit fused to the C-terminal end of the Ca v ⁇ 3 subunit of rat, under the control of the promoter CMN and the plasmid SEQ ID ⁇ O: 10 contains an insert consisting of 5 'to 3' by the phase fusion of the following fragments: the sequence GAP-43, the AD ,c coding for EGFP (fluorescence donor), the GK-like domain of the rat Ca v ⁇ 3 subunit, the loop I-II of the rabbit Ca v ⁇ 2.
  • the present invention also relates to cells modified by a chimeric protein, a nucleic acid molecule or else a recombinant vector as defined above.
  • said cells are eukaryotic cells.
  • said cells express at least one receptor capable of binding to G proteins (RCPG); said cells are either cells constitutively expressing at least one RCPG, or modified cells which express a recombinant RCPG.
  • RCPG G proteins
  • Modified cells in accordance with the invention can be obtained by any means, known in themselves, making it possible to introduce a nucleic acid molecule or a protein into a host cell.
  • viral vectors such as adenoviruses, retroviruses, lentiviruses and ANAs, in which the sequence of interest has been inserted, can be used, among others.
  • the subject of the present invention is animals and in particular non-human transgenic mammals, characterized in that all or part of their cells are transformed by a nucleic acid molecule according to the invention.
  • These are, for example, animals into which a sequence coding for the chimeric protein according to the invention has been introduced under the control of the control of regulatory elements for appropriate transcription and translation.
  • Such transgenic animals are useful, in particular for the secondary screening stages: i) to evaluate the cellular or even tissue targeting of an active molecule on GPCRs or calcium channels, identified during a primary screening, ii) to study bioavailability of such a molecule, and iii) for research, as a first approach, for possible side effects of such a molecule.
  • the present invention also relates to the use of a product selected from the group consisting of chimeric proteins, nucleic acid molecules, recombinant vectors, modified cells and transgenic non-human mammals as defined above. above, for the study of cellular signaling and regulatory pathways dependent on receptors coupled to G proteins.
  • the present invention also relates to the use of a product selected from the group consisting of chimeric proteins, nucleic acid molecules, recombinant vectors, modified cells and transgenic non-human mammals as defined above. above, for the screening of agonists and / or antagonists of cellular signaling and regulatory pathways dependent on receptors coupled to G proteins.
  • the present invention also relates to the use of a product selected from the group consisting of chimeric proteins, nucleic acid molecules, recombinant vectors, modified cells and transgenic non-human mammals as defined above, for the screening of antagonists of the interaction between the ai and ⁇ subunits high-threshold calcium channels; such antagonists are useful for modulating the activity of all of the high-threshold calcium channels and therefore represent drugs capable of being used in the treatment of diseases linked to a dysfunction of calcium homeostasis and of pathologies where modulation calcium intake can compensate for a cellular deficit, in particular epilepsies, ataxias, migraines, muscular hypo- and hyper-calcemias, diabetes, and cardiovascular diseases.
  • the study of cellular signaling and regulatory pathways dependent on receptors coupled to G proteins is carried out by a method comprising at least the following steps: ai) the culture of modified cells expressing a chimeric protein derived from a calcium channel sensitive to G proteins and a receptor coupled to G protein, as defined above, bi) transducing a signal via said G protein-coupled receptor by any suitable means, and ci) determining, by any suitable means, the proportion of said chimeric protein expressed in said cells which is linked to a G ⁇ subunit.
  • the screening of agonists / antagonists of the cellular signaling and regulatory pathways dependent on receptors coupled to G proteins is carried out by a method comprising at least the following steps: a 2 ) the culture of modified cells expressing a chimeric protein originating from a calcium channel sensitive to G proteins and a receptor coupled to G proteins, as defined above, b 2 ) transduction of a signal via said coupled receptor to protein G, by any suitable means, c 2 ) the comparative determination, by any appropriate means, of the proportion of said chimeric protein expressed in cells which is linked to a G ⁇ subunit, before and after bringing said contacts into contact cells in b 2 ) with a molecule to be tested, and d 2 ) the identification of agonist / antagonist molecules of the signaling and regulatory pathways areas dependent on receptors coupled to G proteins, corresponding to those capable of respectively increasing and decreasing the cell concentration in free G ⁇ subunits.
  • said cells modified in ai ) or in a 2 ) express a chimeric protein as defined above coupled at its ends
  • the screening of antagonists of the interaction between the ⁇ j and ⁇ subunits of the high-threshold calcium channels is carried out by a method comprising at least the following steps: a) setting in contact with a molecule to be tested with a chimeric protein derived from a calcium channel sensitive or insensitive to G proteins as defined above and with a peptide comprising the AID domain of an ai subunit insensitive to G proteins, b 3 ) measuring, by any appropriate means, the binding of said chimeric protein to said peptide, and c 3 ) identifying the antagonists of the interaction between the subunits ai and ⁇ corresponding to those with which a binding of said chimeric protein to said peptide.
  • said peptide comprising the AID domain is immobilized on a solid support, and said chimeric protein is coupled to a marker allowing the measurement of said bond in b), as defined above, including a fluorophore.
  • the subject of the invention is also a kit for implementing the methods as defined above, characterized in that it includes at least one of the following products: a chimeric protein, an antibody, a recombinant vector, a modified cell or a transgenic non-human mammal, as defined above.
  • the invention also comprises other arrangements, which will emerge from the description which follows, which refers to examples of use of the chimeric protein which is the subject of the present invention as well as to annexed drawings, in which:
  • FIG. 1 illustrates the overlap, in the loop I-II of the Ca v ⁇ . ⁇ j subunit of the binding domains to the ⁇ subunit (AID domain) and to the G ⁇ complex.
  • the AID domain is represented by a black box (positions 383 to 400).
  • the binding sites for the G ⁇ (G ⁇ ) subunit are represented by hatched boxes; the site in the central position (QQ - RL-GY) which is essential for the binding of the G ⁇ subunit (G ⁇ ) is included in the AID domain.
  • FIGS. 2 and 3 illustrate the displacement of the interaction Ca v ⁇ . ⁇ - Ca v ⁇ by the G ⁇ complex of the G proteins:
  • FIG. 2a illustrates the linkage of the ⁇ 3 subunit (1 to 3 pM) with the AID ⁇ domain. 2 of the GST-AID ⁇ fusion protein. 2 (1 ⁇ M),
  • FIG. 2b shows that the fusion of the ⁇ 3 subunit with the loop I-II of the ⁇ 2 . ⁇ subunit (Chimera Ca v ⁇ 3 - I-II 2 . ⁇ ) prevents its binding with the domain AIDj.2 of the GST-AID ⁇ .2 fusion protein,
  • FIG. 2c shows that the deletion of the 18 amino acids from the AID 2 . ⁇ domain (Chimera Ca v ⁇ 3 - I-II 2 . ⁇ AID) restores the bond of the ⁇ 3 subunit with the AID ⁇ .2 domain of the GST-AID ⁇ fusion protein .
  • - Figure 3 shows that the addition of G ⁇ complex displaces the intramolecular interaction between the Ca v ⁇ subunit and the loop I-II of the ⁇ 2.
  • ⁇ subunit of the chimera Ca v ⁇ 3 - I- II 2.1 thus allowing the ⁇ 3 subunit to bind with the domain AIDj. 2 of the fusion protein GST-AID1.2; the concentration of G ⁇ , capable of displacing 50% of the bond between the Ca v ⁇ subunit and the AID domain .
  • ⁇ (IC 50 ) is l60nM
  • FIGS. 4 to 7 illustrate the FRET analysis of the disassembly of the P / Q calcium channel, induced by the G ⁇ complex:
  • FIG. 4a illustrates the labeling with Cy3 of the purified His-Ca v ⁇ 3 subunit.
  • CB Coomassie blue staining of an SDS-PAGE gel illustrating the purity of the protein.
  • FS recording of the fluorescence of an uncolored gel showing the covalent labeling of the protein,
  • FIG. 4b illustrates the effect of the Ca v ⁇ subunit coupled to a fluorochrome (Cy3-Ca v ⁇ 3 ) on the current-voltage relationship of Ca v ⁇ 2 . ⁇ channels expressed in xenopus oocytes, by comparison with the unlabeled Ca v ⁇ 3 subunit (injection of cRNA),
  • FIG. 6 illustrates the kinetics of decrease in the fluorescence transfer induced by the injection of 100 nM of G ⁇ .
  • Upper panel variations in the fluorescence emission spectrum
  • lower panel variations in the ratio of fluorescence intensities (R f ) at 585 irai and 525 nm,
  • FIG. 7 illustrates the R f values of non-injected oocytes (-), injected with G ⁇ (100 nM) or with heat-inactivated G ⁇ (HI-G ⁇ ).
  • FIG. 8 illustrates the sequence of the plasmid pcDNA3Cav ⁇ 3- I-II2.1 (SEQ ID NO: 5) containing the loop I-II of the subunit Ca v ⁇ 2.
  • FIG. 9 illustrates the sequence of the plasmid pCHIC (SEQ ID NO: 10) derived from the vector pEYFPmemb.
  • PCR amplification and the cloning of the recombinant DNA are carried out by the conventional techniques known to those skilled in the art, following standard protocols such as those described for example in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000 , Wiley and son Inc, Library of Congress, USA).
  • An expression plasmid containing a cDNA encoding a chimeric protein according to the invention constituted by the C-terminal fusion of the rat ⁇ 3 subunit with the intracellular loop I-II of the rabbit ai subunit and has been constructed as follows:
  • the cDNA of the rat Ca v ⁇ 3 subunit (corresponding to positions 98 to 1545 of the GENBANK M88755 sequence) is amplified by PCR using the following sense and antisense primers: - 5'-TTTGGTACCATGGATGACGACTCCTACGTGCCCGGGTTTGAGGACTCGGAGGCGGGTT- 3 '(SEQ ID NO: 1), and - ⁇ '-GCGGAATTCGTAGCTGTCCTTAGGCCAAGGCCGGTTACGCTGCCAGTT-S', (SEQ ID NO: 2).
  • the fragment thus obtained was cloned between the Kpn I and EcoR I sites of the expression plasmid (pcDNA3, IN VITROGEN) to give the recombinant plasmid pcDNA3-Ca v ⁇ 3.
  • the cDNA fragment corresponding to loop I-II of the Ca v ⁇ 2 . ⁇ rabbit subunit (positions 1383 to 1754 of the GENBANK X57477 sequence), the sequence is illustrated in FIG. 1, was amplified by PCR using the following sense and antisense primers:
  • the fragment obtained was cloned at the EcoR I site of the plasmid pcDNA3-Cav ⁇ 3 to give the recombinant plasmid pcDNA3-Ca v ⁇ 3-I-II 2 . ⁇ .
  • a control plasmid containing a cDNA encoding a chimeric protein constituted by the C-terminal fusion of the rat ⁇ 3 subunit with the intracellular loop I-II of the rabbit Cav ⁇ 2 . ⁇ subunit deleted from the AID domain has been constructed in the same way ; the recombinant plasmid thus obtained is called pcDNA3-Cav ⁇ 3-I-II 2 . ⁇ AID.
  • has the sequence SEQ ID NO: 5.
  • presents the expected sequence for a chimeric protein according to the invention.
  • ⁇ AID corresponds to that expected for a chimeric protein deleted from the AID domain.
  • ⁇ AID, and the subunit Ca v ⁇ 3 are transcribed and translated in vitro in the presence of [ 35 S] -methionine , from the plasmids as described in Example 1, using the TNT system PROMEGA kit, following the manufacturer's instructions.
  • FIG. 2b shows that the fusion of the ⁇ 3 subunit with the loop I-II of the ⁇ 2 . ⁇ subunit (Chimera Ca v ⁇ 3 - I-II 2.1 ) prevents its binding with the domain
  • FIG. 2c shows that the deletion of the 18 amino acids from the AID 2 domain. 1 (Chimera Ca v ⁇ 3 - I-II2.1 ⁇ AID) restore the binding of the ⁇ 3 subunit with the domain AID ⁇ .2 of the fusion protein GST-AID ⁇ .2 , - Figure 3 shows that the addition of G ⁇ complex displaces the intramolecular interaction between the Ca v ⁇ subunit and the I-II loop of the subunit ⁇ 2 . ⁇ of the chimera Ca v ⁇ 3 - I-II 2.1 , thus allowing the ⁇ 3 subunit to bind with the AID 1.2 domain of the fusion protein GST-AID ⁇ .
  • the IC 50 concentration of G ⁇ capable of displacing 50% of the bond between the Ca v ⁇ subunit and AID 2 domain .
  • after 30 min of incubation at 30 ° C, is 160nM; this value is 2 to 3 times higher than that relating to the affinity of G ⁇ for the loop I-II 2 . ⁇ , previously reported (De Waard et al., Nature, 1997, 385, 446-450).
  • EXAMPLE 3 EX VIVO HIGHLIGHTING OF THE DISPLACEMENT OF THE INTERACTION Ca v ⁇ 2 . Ca v ⁇ THROUGH THE G ⁇ COMPLEX OF PROTEINS G. 1) Materials and methods a) Cy3 labeling of the purified recombinant His-Cay ⁇ 3 protein.
  • the purified His-Ca v ⁇ 3 recombinant protein (Geib et al., Biochem J., 2002, 364, 285-292; Fathallah et al., Eur. J. Neurosci., 2002, 16, 219-228) is coupled to the monoreactive Cy3 maleimide following the manufacturer's instructions (Amersham Pharmacia Biotech).
  • the oocytes are analyzed by confocal microscopy (TCS-SP2 microscope, LEICA, in "XY ⁇ ” mode), 4 to 7 days after the injection.
  • the fluorescence emission is recorded using an argon laser with an excitation at 488 nm and a dicliroic mirror (488/543/633). Fluorescence is measured through 14 filters (10 nm thick) to reconstruct the emission spectrum. For each measurement, two different regions are analyzed to ensure the reproducibility of the measurement. FRET levels are estimated by the ratio (585/525) between fluorescence at 585 nm (emission peak of the Cy3 acceptor) and fluorescence at 525 nm (emission peak of the GFP donor). 2) Results
  • Cav ⁇ 2 . ⁇ and Cy3-Cav ⁇ 3 induces a rapid disappearance of the fluorescence transfer ( Figure 6).
  • the injection of G ⁇ has no effect in cells containing only GFP-Cav ⁇ 2 . ⁇ or Cy3-Cav ⁇ 3 .
  • a chimeric protein containing a fluorescence donor fluorophore (EGFP) at its NH end and a fluorescence acceptor fluorophore (CFP) at its COOH end is constructed from the vector pEYFPmemb (CLONTECH).
  • This vector has the advantage of having:
  • Anchoring to the membrane has the advantage on the one hand of maintaining the protein on the membrane and on the other hand of increasing the probability of encounter between the chimeric protein and its ligand G ⁇ which is itself anchored to the membrane by a palmitoylation type bond, and
  • PCR amplification is carried out using the following sense and antisense primers: BsiWI Pvu 1 - 5'- AGCCGTACGCGATCGCATCTCTAGCCAAGCAGAAGCAAA - 3 '(SEQ ID NO: 6)
  • the cDNA coding for the ECP is amplified by PCR and then cloned into the preceding plasmid, 3 'to the insert ⁇ 3 -I-II. More specifically, the ECFP is amplified by PCR from the pECFP vector (Clontech), using the following sense and antisense primers: Spe l
  • the PCR product obtained is cloned between the Spe I and Hpa I sites of the plasmid pEYFmemChimBéta3I-II to give the plasmid pCHIC corresponding to the sequence SEQ ID NO: 10.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP03813931A 2002-12-23 2003-12-22 Chimäres protein für das screening von agonisten und antagonisten der zellsignalisierungswegen, die von den g-protein gekoppelten rezeptoren abhängig sind. Withdrawn EP1576162A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0216576 2002-12-23
FR0216576A FR2849041B1 (fr) 2002-12-23 2002-12-23 Proteine chimerique pour le criblage d'agonistes et d'antagonistes des voies de signalisation cellulaires dependantes des recepteurs couples aux proteines g
PCT/FR2003/003860 WO2004058977A1 (fr) 2002-12-23 2003-12-22 Proteine chimerique pour le criblage d'agonistes et d'antagonistes des voies de signalisation cellulaire dependantes des recepteurs couples aux proteines g

Publications (1)

Publication Number Publication Date
EP1576162A1 true EP1576162A1 (de) 2005-09-21

Family

ID=32406448

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03813931A Withdrawn EP1576162A1 (de) 2002-12-23 2003-12-22 Chimäres protein für das screening von agonisten und antagonisten der zellsignalisierungswegen, die von den g-protein gekoppelten rezeptoren abhängig sind.

Country Status (7)

Country Link
US (1) US20070141665A1 (de)
EP (1) EP1576162A1 (de)
JP (1) JP2006526982A (de)
AU (1) AU2003303351A1 (de)
CA (1) CA2511213A1 (de)
FR (1) FR2849041B1 (de)
WO (1) WO2004058977A1 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2890174B1 (fr) * 2005-08-30 2009-04-24 Cis Bio Internat Sa Procede pour la mise en evidence d'un processus biologique par mesure d'un fret
JP2008189662A (ja) * 2007-01-12 2008-08-21 New Industry Research Organization スフィンゴシン1リン酸による神経伝達物質の放出促進機能とその応用
CN103086899B (zh) * 2013-02-01 2014-09-17 黄河三角洲京博化工研究院有限公司 一种2-氨基-4'-氟-二苯甲酮的合成方法

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6329156B1 (en) * 1999-03-22 2001-12-11 The Regents Of The University Of California Method for screening inhibitors of the toxicity of Bacillus anthracis
FR2827867B1 (fr) * 2001-07-27 2004-06-18 Centre Nat Rech Scient Utilisation de fragments peptidiques de la sous-unite alpha-1 des canaux calciques, comportant le cas echeant des mutations, pour le criblage de molecules d'interet therapeutique

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004058977A1 *

Also Published As

Publication number Publication date
AU2003303351A1 (en) 2004-07-22
CA2511213A1 (fr) 2004-07-15
JP2006526982A (ja) 2006-11-30
AU2003303351A8 (en) 2004-07-22
WO2004058977A1 (fr) 2004-07-15
FR2849041A1 (fr) 2004-06-25
US20070141665A1 (en) 2007-06-21
FR2849041B1 (fr) 2005-03-04

Similar Documents

Publication Publication Date Title
JP2024032952A (ja) 異所性石灰化障害を治療するための組成物およびそれを使用する方法
US10041935B2 (en) Identification of olfactory receptors sensitive to different odorants
WO2010126590A1 (en) Ptp1b inhibitors
CN113631033B (zh) 与enpp1或enpp3缺乏有关的疾病的治疗
CN110511286B (zh) 一种rna碱基编辑分子
JPWO2012099279A1 (ja) 酸化ストレスインジケーター発現用核酸構築物とその使用
US10214567B2 (en) Tagged hepadnavirus E antigen and its use in screening antiviral substances
DK2262905T3 (en) Cell, method and kit for carrying out a test for neutralizing antibodies
KR20200090927A (ko) 내이에 대한 치료적 항체의 aav-매개 전달
KR20060079239A (ko) 전통적으로 면역원성이 낮은 항원에 특이적인 단클론 항체개발 및 이를 이용하는 방법, 키트 및 조성물
Kameda et al. Targeting green fluorescent protein to dendritic membrane in central neurons
Lee et al. Prominin‐1‐Radixin axis controls hepatic gluconeogenesis by regulating PKA activity
EP1576162A1 (de) Chimäres protein für das screening von agonisten und antagonisten der zellsignalisierungswegen, die von den g-protein gekoppelten rezeptoren abhängig sind.
Siddiqui et al. Smaug regulates germ plasm assembly and primordial germ cell number in Drosophila embryos
US20240148907A1 (en) Liver specific production of enpp1 or enpp3
US20040235157A1 (en) Gene reporter assay, kit, and cells for determining the presence and/or the level of a molecule that activates signal transduction activity of a cell surface protein
RU2853644C2 (ru) Лечение заболеваний, включающих дефицит enpp1 или enpp3
KR100514979B1 (ko) 갈렉틴-3 관련 질병을 예방 및 치료하기 위한 약학 조성물
KR102596599B1 (ko) 미토콘드리아 표적화 서열을 포함하는 면역질환의 예방 또는 치료용 조성물
HK40063782A (en) Treatment of diseases involving deficiency of enpp1 or enpp3
Cary Functional and Structural Studies of Family BG Protein-Coupled Receptors
Rayamajhi Investigating the Role of Foxj1 and Gmnn in the Differentiation of Multiciliated Cells and Ciliated Olfactory Sensory Neurons in Zebrafish
Marchese A Structural and Functional Analysis of the VCAM-1 Cytoplasmic Domain: Rac1 Activation and Leukocyte Transendothelial Migration
CN114231568A (zh) 一种提高dna修复效率的辅助蛋白及其基因编辑载体和应用
und neue Therapieansätze Merkel Cell Carcinoma: Investigations on its carcinogenesis and new therapeutic approaches

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050711

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20080929

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090210