EP1572117A2 - Production of ubiquinones - Google Patents

Production of ubiquinones

Info

Publication number
EP1572117A2
EP1572117A2 EP03812045A EP03812045A EP1572117A2 EP 1572117 A2 EP1572117 A2 EP 1572117A2 EP 03812045 A EP03812045 A EP 03812045A EP 03812045 A EP03812045 A EP 03812045A EP 1572117 A2 EP1572117 A2 EP 1572117A2
Authority
EP
European Patent Office
Prior art keywords
sequence
bacteria
nucleic acid
membranous bacteria
membranous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03812045A
Other languages
German (de)
French (fr)
Other versions
EP1572117A3 (en
EP1572117A4 (en
Inventor
Mary Jo Zidwick
Mervyn L. De Souza
Sherry R. Kollman
Ravi R. Gokarn
Holly Jessen
Carl Bauer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cargill Inc
Original Assignee
Cargill Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cargill Inc filed Critical Cargill Inc
Publication of EP1572117A3 publication Critical patent/EP1572117A3/en
Publication of EP1572117A2 publication Critical patent/EP1572117A2/en
Publication of EP1572117A4 publication Critical patent/EP1572117A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/66Preparation of oxygen-containing organic compounds containing the quinoid structure

Definitions

  • the invention relates to methods and materials involved in the production of ubiquinones, and more particularly, to membranous bacteria that produce elevated amounts of ubiquinones.
  • Coenzyme Q10 is an isoprenoid compound found in membranes throughout the cell. CoQ(lO) also is known as a ubiquinone or 2,3-dimethoxy, 5-methyl, 6-polyisoprene parabenzoquinone and contains 10 isoprene units (5 carbons each). CoQ(10) is a component of the oxidative phosphorylative process in mitochondria as well as a primary scavenger of free radicals and a participant in oxidation/reduction control of cell signaling. Crane, J. Am. Coll. Nutr. 20(6 ⁇ :591-598 (2001 . Since Co Q( 10) has several biochemical functions, it has been used in pharmaceuticals (e.g., for treatment of heart disease), nutraceuticals, and cosmetics. Current methods of manufacture include extraction from yeast or bacteria, but there is a need to improve the current processes.
  • the invention is based on the production of engineered microorganisms that produce elevated levels of ubiquinones (e.g., CoQ(10)) relative to corresponding microorganisms that have not been genetically modified and grown under similar culture conditions.
  • ubiquinones e.g., CoQ(10)
  • the engineered microorganisms described herein can be used in culture systems to produce large quantities of particular ubiquinones.
  • the invention features membranous bacteria that include a genomic disruption of at least a portion of appsR sequence and at least a portion of an erR sequence, wherein the genomic disruption renders the ppsR sequence and the ⁇ erR sequence non-functional, and wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the genomic disruption and grown under similar culture conditions.
  • the membranous bacteria can be purple non-sulfur photosynthetic bacteria.
  • the membranous bacteria can be a species of Rhodobacter such as Rhodobacter sphaeroides or Rhodobacter capsulatus.
  • the invention features membranous bacteria that include an exogenous nucleic acid encoding a fumarate nitrate reduction (Fnr) polypeptide.
  • the membranous bacteria produce an elevated amount of CoQ(lO) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and grown under similar culture conditions.
  • the Fnr polypeptide can be a Rhodobacter sphaeroides FnrL polypeptide or a R. capsulatus Fnr polypeptide.
  • the membranous bacteria can be purple non-sulfur photosynthetic bacteria.
  • the membranous bacteria can be a species of Rhodobacter such as Rhodobacter sphaeroides or Rhodobacter capsulatus.
  • the membranous bacteria further can include a genomic disruption of at least a portion of a crtE sequence, at least a portion of appsR sequence, and at least a portion of a ccoN sequence, wherein the genomic disruption renders the crtE sequence, the ppsR sequence, and the ccoN sequence non-functional, wherein the membranous bacteria produce an elevated amount of CoQ( 10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and the genomic disruption, and grown under similar culture conditions.
  • the invention also features a method of making a nutraceutical.
  • the method includes extracting CoQ(10) from membranous bacteria, the membranous bacteria including an exogenous nucleic acid encoding a Fnr polypeptide, wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and grown under similar culture conditions.
  • the membranous bacteria further can include a genomic disruption of at least a portion of a crtE sequence, at least a portion of appsR sequence, and at least a portion of a ccoN sequence, wherein the genomic disruption renders the crtE sequence, the ppsR sequence, and the ccoN sequence non-functional, wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and the genomic disruption and grown under similar culture conditions.
  • the invention features a method of making a nutraceutical.
  • the method includes extracting CoQ(10) from membranous bacteria, the membranous bacteria including a genomic disruption of at least a portion of appsR sequence and at least a portion of an ⁇ erR sequence, wherein the genomic disruption renders the ppsR sequence and the ⁇ erR sequence non- functional, and wherein the membranous bacteria produce an elevated amount of CoQ(lO) compared with corresponding membranous bacteria lacking the genomic disruption and grown under similar culture conditions.
  • the invention provides methods and materials related to the production of ubiquinones, 2,3-dimethoxy-5-methylbenzoquinone derivatives having a side chain containing at least one five-carbon isoprenoid unit.
  • ubiquinone is referred to as coenzyme Q (CoQ).
  • CoQ coenzyme Q
  • the number of isoprenoid units of a side chain of a particular ubiquinone is used to identify that particular ubiquinone.
  • CoQ(6) a ubiquinone with six isoprenoid units
  • CoQ(10) a ubiquinone with ten isoprenoid units
  • CoQ(10) also is referred to as ubidecarenone.
  • Examples of ubiquinones include, without limitation, CoQ(6), CoQ(8), CoQ(10), and CoQ(12).
  • microorganism refers to all microscopic organisms including, without limitation, bacteria, algae, fungi, and protozoa. It is noted that bacteria cells can be membraneous or non-membraneous.
  • non-membraneous refers to any bacteria lacking intracytoplasmic membrane.
  • membraneous refers to any naturally-occurring, genetically modified, or environmentally modified bacteria having an intracytoplasmic membrane.
  • An intracytoplasmic membrane can be organized in a variety of ways including, without limitation, vesicles, tubules, thylakoid-like membrane sacs, and highly organized membrane stacks.
  • Any method can be used to analyze bacteria for the presence of intracytoplasmic membranes including, without limitation, electron microscopy, light microscopy, and density gradients. See, e.g., Chory et al, J. Bacteriol, 159:540-554 (1984); Niederman and Gibson, Isolation and Physiochemical Properties of Membranes from Purple Photosynthetic Bacteria, hi: The Photosynthetic Bacteria, Ed.
  • membraneous bacteria examples include, without limitation, bacteria of the Rhodospirillaceae family such as those in the genus Rhodobacter (e.g., R. sphaeroides, R. capsulatus, R. sulfidophilus, R. adriaticus, andR. veldkampii), the genus Rhodospirillum (e.g., R. rubrum, R. photometricum, R. molischianum, R.
  • bacteria of the Rhodospirillaceae family such as those in the genus Rhodobacter (e.g., R. sphaeroides, R. capsulatus, R. sulfidophilus, R. adriaticus, andR. veldkampii), the genus Rhodospirillum (e.g., R. rubrum, R. photometricum, R. molischianum, R.
  • Rhodopseudomonas e.g., R. palustris, R. viridis, and R. sulfoviridis
  • the genus Rhodomicrobium e.g., the genus Rhodocyclus, and the genus Rhodopila
  • bacteria of the Chromatiaceae family such as those in the genus Chromatium, genus Thiocystis, the genus Thiospirillum, the genus Thiocapsa, the genus Lamprobacter, the genus
  • Lalmprocystis the genus Thiodictyon, the genus Amoebobacter, and the genus Thiopedia
  • green sulfur bacteria such as those in the genus Chlorobium and the genus Prosthecochloris
  • bacteria of the Methylococcaceae family such as those in the genus Methylococcus (e.g., M. capsulatus), and the genus Methylomonas (e.g., M. methanica)
  • bacteria of the Nitrobacteraceae family such as those in the genus
  • Nitrobacter e.g., N. winogradsky and N. hamburgensis
  • the genus Nitrococcus e.g., N. mobilis
  • the genus Nitrosomonas e.g., N. europaea
  • Membraneous bacteria can be highly membraneous bacteria.
  • the term "highly membraneous bacteria” as used herein refers to any bacterium having more intracytoplasmic membrane than R. sphaeroides (ATCC 17023) cells have after the R. sphaeroides (ATCC 17023) cells have been (1) cultured chemoheterotrophically under aerobic conditions for four days, (2) cultured chemoheterotrophically under oxygen- limited conditions for four hours, and (3) harvested.
  • the aerobic culture conditions involve culturing the cells at 30°C in the presence of 25% oxygen.
  • the oxygen-limited conditions involve culturing the cells at 30°C in the presence of 2% oxygen.
  • the R. sphaeroides (ATCC 17023) cells are harvested by centrifugation and analyzed for the presence of intracytoplasmic membranes as discussed above.
  • Engineered microorganisms of the invention produce elevated amounts of a ubiquinone (e.g., CoQ(lO)).
  • Elevated amount refers to a statistically significant increase in the absolute amount of ubiquinone per dry cell weight relative to the absolute amount per dry cell weight in a corresponding organism, grown under similar conditions, that does not contain the genetic modification(s).
  • Known statistical methods can be used to compare the absolute amount of ubiquinone/dry cell weight. A p value of ⁇ 0.05 is considered statistically significant.
  • Bacteria can produce more CoQ(10) when grown under anaerobic conditions as compared to aerobic conditions. For example, anaerobically cultured bacteria can produce about 3 to 4 fold more CoQ(10) than aerobically cultured bacteria of the same species.
  • ubiquinone can be extracted with one or more organic solvents then analyzed with reverse phase chromatography (C18) and a photodiode array (PDA) detector.
  • C18 reverse phase chromatography
  • PDA photodiode array
  • cells first can be extracted with ethanol then extracted with hexane.
  • the hexane layer can be dried and re-dissolved in a small volume of hexane.
  • the sample then can be analyzed using a Waters Nova-Pak C18 (3.9 x 150 mm: 4 ⁇ m) column with a PDA detector set from 200-300 nm.
  • any method can be used to produce engineered microorganisms, including disrupting endogenous genes and/or introducing one or more isolated, exogenous nucleic acids into a cell.
  • Endogenous genes can be disrupted using common knock-out techniques as well as antisense technology.
  • R. sphaeroides can be engineered to contain a cDNA that encodes an antisense molecule that prevents an enzyme from being made.
  • antisense molecule as used herein encompasses any nucleic acid that contains sequences that correspond to the coding strand of an endogenous polypeptide.
  • An antisense molecule also can have flanking sequences (e.g., regulatory sequences).
  • antisense molecules can be ribozymes or antisense oligonucleotides.
  • a ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.
  • Many methods also are available for introducing nucleic acid into a cell, whether in vivo or in vitro. For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, conjugation, and viral-mediated nucleic acid transfer are common methods that can be used to introduce nucleic acid into a cell.
  • naked DNA can be delivered directly to cells in vivo as described elsewhere (U.S. Patent No. 5,580,859 and U.S. Patent No. 5,589,466).
  • R. sphaeroides having a disrupted ⁇ erR sequence can be identified using common biochemical methods such as PCR amplification using primers specific for the ⁇ erR gene or flanking regions and, for example, examination of the size of the amplified product or sequence analysis.
  • PCR and nucleic acid hybridization techniques such as Northern and Southern analysis can be used to determine if a cell contains an exogenous nucleic acid.
  • immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of a polypeptide encoded by that particular nucleic acid. For example, detection of polypeptide X-immunoreactivity after introduction of an isolated nucleic acid encoding polypeptide X into a cell that does not normally express polypeptide X can indicate that that cell not only contains the introduced nucleic acid but also expresses the encoded polypeptide X from that introduced nucleic acid.
  • Any method can be used to direct the expression of an amino acid sequence from a nucleic acid. Such methods are well known to those skilled in the art, and include, without limitation, constructing a nucleic acid such that a regulatory element drives the expression of a nucleic acid sequence that encodes a polypeptide.
  • regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Such regulatory elements include, without limitation, promoters, enhancers, and the like.
  • any method for expressing a polypeptide from an exogenous nucleic acid molecule in microorganisms such as bacteria and yeast can be used.
  • any methods can be used to identify cells that express an amino acid sequence from a nucleic acid. Such methods are well known to those skilled in the art, and include, without limitation, immunocytochemistry, Western analysis, Northern analysis, and RT-PCR.
  • the cells described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid.
  • a bacterial cell can contain about 50 copies of exogenous nucleic acid X.
  • the cells described herein can contain more than one particular exogenous nucleic acid.
  • a bacterial cell can contain about 50 copies of exogenous nucleic acid X as well as about 75 copies of exogenous nucleic acid Y.
  • each different nucleic acid can encode a different polypeptide having its own unique enzymatic activity.
  • a bacterial cell can contain two or more different exogenous nucleic acids such that a high level of CoQ(10) is produced.
  • a single exogenous nucleic acid can encode one or more than one polypeptide.
  • a single nucleic acid can contain sequences that encode three different polypeptides.
  • one or both of the following polypeptides may be expressed in the microorganism: a fumarate nitrite reduction (Fnr) polypeptide and a response regulator (Reg) polypeptide.
  • Fnr fumarate nitrite reduction
  • Reg response regulator
  • polypeptide refers to any chain of amino acids, regardless of length or post-translational modification, that retains the function of the full-length, wild-type polypeptide.
  • suitable polypeptides can be less than full- length and/or have one or more amino acid insertions or substitutions if function of the full-length, wild-type polypeptide is retained.
  • Fnr polypeptide can serve either as a repressor of certain genes or, in the absence of oxygen, can be converted to an active form that regulates the synthesis of many genes.
  • Fnr requires an iron sulfur cluster that is involved in mediating the sensitivity of the fnr gene to oxygen.
  • Oxygen limitation affects gene expression in a number of microorganisms andfiir-li e genes have been identified in a number of species, including, for example, R. sphaeroides, R. capsulatus, Paracoccus denitrificans, Mesorhizobium loti, and Rhizobium leguminosarum. The R.
  • fnrL gene encodes an FnrL polypeptide that is 248 amino acids in length that regulates the synthesis of several genes in bacteriochlorophyll synthesis.
  • the fnrL gene is required for photosynthetic growth of R. sphaeroides.
  • the nucleic acid sequence of the fnrL genes from R. capsulatus and R. sphaeroides can be found in GenBank under Accession Nos. U78309 and Z49746, respectively.
  • the nucleic acid sequence of the fnr genes from P. denitrificans, M. loti, and R. leguminosarum can be found in GenBank under Accession Nos. U34353, AP003009, and U90520, respectively.
  • Suitable Fnr polypeptides will have at least 35% identity to the amino acid sequence of the R. sphaeroides Fnr polypeptide.
  • the R. capsulatus Fnr polypeptide has about 64% identity to the R. sphaeroides Fnr polypeptide.
  • the P. denitrificans and M. loti Fnr polypeptides have about 39% and 37% identity to the R. sphaeroides Fnr polypeptide, respectively.
  • Percent sequence identity is calculated by determining the number of matched positions in aligned nucleic acid sequences, dividing the number of matched positions by the total number of aligned nucleotides, and multiplying by 100.
  • a matched position refers to a position in which identical nucleotides occur at the same position in aligned nucleic acid sequences.
  • Percent sequence identity also can be determined for any amino acid sequence. To determine percent sequence identity, a target nucleic acid or amino acid sequence is compared to the identified nucleic acid or amino acid sequence using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained from Fish &
  • B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C: ⁇ seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C: ⁇ seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C: ⁇ output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting.
  • -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C: ⁇ seql.txt)
  • -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C: ⁇ seq2.txt)
  • -p is set to blastn
  • -o is set to any desired file name
  • the following command will generate an output file containing a comparison between two sequences: C: ⁇ B12seq -i c: ⁇ seql .txt -j c: ⁇ seq2.txt -p blastn -o c: ⁇ output.txt -q -1 -r 2. If the target sequence shares homology with any portion of the identified sequence, then the designated output file will present those regions of homology as aligned sequences. If the target sequence does not share homology with any portion of the identified sequence, then the designated output file will not present aligned sequences.
  • a length is determined by counting the number of consecutive nucleotides from the target sequence presented in alignment with sequence from the identified sequence starting with any matched position and ending with any other matched position.
  • a matched position is any position where an identical nucleotide is presented in both the target and identified sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides. Likewise, gaps presented in the identified sequence are not counted since target sequence nucleotides are counted, not nucleotides from the identified sequence.
  • the percent identity over a particular length is determined by counting the number of matched positions over that length and dividing that number by the length followed by multiplying the resulting value by 100.
  • Reg polypeptides regulate photosynthetic gene expression by oxygen and regulate some genes in bacteriochlorophyll and carotenoid synthesis and CO 2 and N 2 fixation.
  • Reg polypeptides include the RegA polypeptides from R. capsulatus, Rhodovulum sulfidophilum, and Roseobacter denitrificans (GenBank Accession No. P42508, AB010722, and AB010723, respectively) and the homolog from R. sphaeroides, PrrA (GenBank Accession Nos. L25895 and U22347 (includes prrB and prrC)).
  • Full-length RegA polypeptides from the above organisms are 184 amino acids in length. RegA is part of a two-component system with RegB, a sensor kinase (PrrB in R. sphaeroides).
  • one or more of the endogenous ppsR, aerR, crtE, and ccoN nucleic acid sequences may be disrupted in the microorganism's genome such than the nucleic acid sequence is non-functional, i.e., after transcription and translation of the disrupted sequence, the wild-type encoded gene product is not detectable or the gene product does not retain its natural function.
  • the endogenous crtE andppsR nucleic acids are disrupted.
  • the endogenous crtE, ccoN, and ppsR nucleic acids are disrupted.
  • One or more of the endogenous crtE, ccoN, and ppsR nucleic acids also can be disrupted in the genome of a microorganism that is expressing an exogenous nucleic acid encoding an Fnr polypeptide. Such a microorganism produces an elevated level of CoQ(10).
  • the crtE gene encodes geranylgeranyl pyrophosphate synthase, which can produce geranylgeranyl pyrophosphate (GGPP) by condensing together isopentenyl pyrophosphate (LPP) with famesyl pyrophosphate (FPP).
  • the nucleic acid sequence of the crtE gene from R. sphaeroides can be found in GenBank (Accession No.
  • the crtE gene from R. capsulatus also can be found in GenBank (Accession Nos. 152291 and Zl 1165).
  • GenBank accesion Nos. 152291 and Zl 1165.
  • the ccoN gene encodes a cbb3-type cytochrome oxidase, which has high affinity for oxygen and is part of a regulatory cascade that includes prrA and prrB. Disrupting ccoN can increase the amount of a RegA or PrrA polypeptide, which can allow the microorganism to produce an elevated level of CoQ(l 0).
  • GenBank accesion Nos.
  • TheppsR gene encodes a transcription factor that represses carotenoid and bacteriochlorophyll synthesis under both aerobic and limited oxygen conditions.
  • the nucleic acid sequence of the ppsR gene from R. sphaeroides can be found in GenBank (Accession No. L37197).
  • the R. capsulatus homolog of ppsR is called crtJ, the nucleic acid sequence of which can be found in GenBank under Accession No. Zl 1165.
  • a microorganism that is expressing an exogenous nucleic acid encoding a Reg polypeptide at least a portion of the endogenous crtE sequence can be disrupted.
  • Such microorganisms produce increased levels of CoQ(l 0) relative to a corresponding wild- type microorganism.
  • the endogenous ppsR and ccoN nucleic acid sequences can be disrupted.
  • a microorganism can include a genomic disruption of at least a portion of appsR nucleic acid sequence and at least a portion of an ⁇ erR nucleic acid sequence such that the ppsR and ⁇ erR nucleic acid sequences are non-functional.
  • the ⁇ erR gene also known as orfl92, pp ⁇ , and ppsS
  • the ⁇ erR gene is an aerobic repressor of photosynthetic gene expression and is located next to gene on the Rhodobacter chromosome. It has also been shown to act as an activator in certain Rhodobacter strains.
  • CoQ(10) production increases, as well as total carotenoid production.
  • nucleic acid encompasses both R ⁇ A and D ⁇ A, including cD ⁇ A, genomic D ⁇ A, and synthetic (e.g., chemically synthesized) D ⁇ A.
  • the nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be the sense or the antisense strand. In addition, nucleic acid can be circular or linear.
  • isolated refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived.
  • an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent.
  • an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
  • an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
  • isolated as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally- occurring genome.
  • non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid.
  • Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques.
  • Isolated non-naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote.
  • a non-naturally-occurring nucleic acid can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence.
  • a nucleic acid existing among hundreds to millions of other nucleic acid molecules within, for example, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.
  • exogenous refers to any nucleic acid that does not originate from that particular cell as found in nature. Thus, all non-naturally-occurring nucleic acid is considered to be exogenous to a cell once introduced into the cell. It is important to note that non- naturally-occurring nucleic acid can contain nucleic acid sequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature.
  • a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a cell once introduced into the cell, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature.
  • any vector, autonomously replicating plasmid, or virus e.g., retrovirus, adenovirus, or he ⁇ es virus
  • genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally- occurring nucleic acid.
  • Nucleic acid that is naturally-occurring can be exogenous to a particular cell.
  • an entire operon isolated from one bacteria is an exogenous nucleic acid with respect to a second bacteria once that operon is introduced into the second bacteria.
  • Isolated nucleic acid can be obtained using any method including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques.
  • PCR can be used to obtain an isolated nucleic acid encoding a Fnr polypeptide.
  • PCR refers to a procedure or technique in which target nucleic acid is amplified in a manner similar to that described in U.S. Patent No. 4,683,195, and subsequent modifications of the procedure described therein.
  • sequence information from the ends of the region of interest or beyond are used to design oligonucleotide primers that are identical or similar in sequence to opposite strands of a potential template to be amplified.
  • a nucleic acid sequence can be amplified from RNA or DNA.
  • a nucleic acid sequence can be isolated by PCR amplification from total cellular RNA, total genomic DNA, and cDNA as well as from bacteriophage sequences, plasmid sequences, viral sequences, and the like.
  • reverse transcriptase can be used to synthesize complimentary DNA strands.
  • Nucleic acid and amino acid databases can be used to obtain an isolated nucleic acid encoding a Fnr polypeptide.
  • GenBank ® Nucleic acid and amino acid databases
  • any nucleic acid sequence having some homology to a nucleic acid encoding a Fnr polypeptide can be used as a query to search GenBank ® .
  • nucleic acid hybridization techniques can be used to obtain a nucleic acid encoding a Fnr polypeptide. Briefly, any nucleic acid having homology to a sequence encoding a Fnr polypeptide can be used as a probe to identify a similar nucleic acid by hybridization under conditions of moderate to high stringency. Once identified, the nucleic acid then can be purified, sequenced, and analyzed to determine whether it is within the scope of the invention as described herein.
  • Hybridization can be done by Southern or Northern analysis to identify a DNA or RNA sequence, respectively, that hybridizes to a probe.
  • the probe can be labeled with a biotin, digoxygenin, an enzyme, or a radioisotope such as 32 P.
  • the DNA or RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al. , (1989) Molecular Cloning, second edition, Cold Spring
  • a probe is at least about 20 nucleotides in length.
  • Control pf Ubiquinone Production Production of ubiquinone can be controlled by expression of the ⁇ -r gene from an inducible promoter.
  • inducible refers to both up-regulation and down regulation.
  • An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed.
  • the inducer can be a chemical agent such as a protein, metabolite, growth regulator, phenolic compound, or a physiological stress imposed directly by heat, cold, salt, or toxic elements, or indirectly through the action of a pathogen or disease agent such as a virus.
  • the inducer also can be an illumination agent such as light, darkness and light's various aspects, which include wavelength, intensity, fluorescence, direction, and duration.
  • inducible promoters include the lac system and the tetracycline resistance system from E. coli.
  • expression of lac operator-linked sequences is constitutively activated by a lacR-NP16 fusion protein and is turned off in the presence of IPTG.
  • a lacR-NP16 variant is used that binds to lac operators in the presence of IPTG, which can be enhanced by increasing the temperature of the cells.
  • Components of the tetracycline (Tc) resistance system also can be used to regulate gene expression.
  • TetR Tet repressor
  • TetR Tet repressor
  • TetR can be fused to the activation domain of NP 16 to create a tetracycline-controlled transcriptional activator (tTA), which is regulated by tetracycline in the same manner as TetR, i.e., tTA binds to tet operator sequences in the absence of tetracycline but not in the presence of tetracycline.
  • ubiquinones are produced by providing a microorganism and culturing the provided microorganism in culture medium such that a ubiquinone is produced.
  • the culture media and/or culture conditions can be such that the microorganisms grow to an adequate density and produce the desired ubiquinone efficiently.
  • the following methods can be used. First, a large tank (e.g., a 100 gallon, 200 gallon, 500 gallon, or more tank) containing appropriate culture medium with, for example, a glucose carbon source is inoculated with a particular microorganism. After inoculation, the microorganisms are incubated to allow biomass to be produced.
  • the broth containing the microorganisms can be transferred to a second tank.
  • This second tank can be any size.
  • the second tank can be larger, smaller, or the same size as the first tank.
  • the second tank is larger than the first such that additional culture medium can be added to the broth from the first tank, hi addition, the culture medium within this second tank can be the same as, or different from, that used in the first tank.
  • the first tank can contain medium with xylose, while the second tank can contain medium with glucose.
  • the microorganism releases the desired ubiquinone into the broth
  • common separation techniques can be used to remove the biomass from the broth
  • common isolation procedures e.g., extraction, distillation, and ion-exchange procedures
  • the desired ubiquinone can be isolated while it is being produced, or it can be isolated from the broth after the product production phase has been terminated. If the microorganism retains the desired ubiquinone, then the biomass can be collected and treated to release the ubiquinone, and the released ubiquinone can be isolated.
  • Extracted ubiquinone (e.g., CoQ(lO)) can be formulated as a nutraceutical.
  • a nutraceutical refers to a compound(s) that has been incorporated into a food, tablet, powder, or other medicinal form that, upon ingestion by a subject, provides a specific medical or physiological benefit to the subject.
  • the nutraceutical can include one or more other components, including pharmaceutically acceptable carriers or excipients (e.g., buffers), vitamins, carotenoids, antioxidants such as ethoxyquin, vitamin E, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), or ascorbyl palmitate, vegetable oils such as corn oil, saffiower oil, sunflower oil, or soybean oil, and an edible emulsifier, such as soybean lecithin or sorbitan esters. Addition of antioxidants and vegetable oils can help prevent degradation of the ubiquinone during processing (e.g., drying), shipment, and storage.
  • pharmaceutically acceptable carriers or excipients e.g., buffers
  • vitamins e.g., carotenoids
  • antioxidants such as ethoxyquin, vitamin E, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), or ascorbyl palmitate
  • vegetable oils
  • the p OlppsS plasmid was introduced into R. sphaeroides strain ATCC 35053 and R. sphaeroides strain ATCC 35053 ⁇ crtE, by conjugation with an E. coli (SI 7-1) donor. Kanamycin resistance was used to select for single-crossover events between the truncated ppsS gene and the genomic ppsS gene that resulted in inco ⁇ oration of the pLOlppsS DNA into the genome.
  • the presence of the sacB gene on the vector allowed for subsequent selection for the loss of vector DNA from the genome as expression of this gene in the presence of sucrose is lethal to E. coli and to R. sphaeroides under growth conditions of 5% and 15% sucrose, respectively. A portion of the double- crossover events that led to loss of the sacB gene contained the truncated ppsS allele. This method of gene knockout is useful because no residual antibiotic resistance gene is left in the genome.
  • a three-step PCR process was used to create a 300 bp in-frame deletion in the ppsS gene.
  • the ppsS gene from R. sphaeroides strain 35053 was amplified by PCR using primers designed to introduce a Sail restriction site at the beginning of the amplified fragment and a Sph I restriction site at the end of the amplified fragment.
  • the sequences of the primers were as follows, with the restriction sites underlined:
  • the PCR reaction mix contained 0.2 ⁇ M each primer, IX Expand reaction buffer, 2.5 ⁇ l DMSO, 0.2 mM each dNTP, IX Expand/Pfu polymerase mix, and 1 ng of genomic DNA per 50 ⁇ L of reaction mix.
  • PCR was conducted in a Perkin Elmer Geneamp 2400 programmed for an initial denaturation at 94°C for 3 minutes followed by 32 cycles of denaturation for 30 sec at 94°C, annealing for 1 min at 58°C, and extension for 2 min at 72°C, with a final extension at 72°C for 7 minutes.
  • a 1.6 Kb reaction product was obtained by electrophoresis of a portion of the mixture (200 ⁇ l) through an 0.8% agarose gel in IX TAE buffer followed by gel-purification.
  • reaction A using primers RsppsSFSall (SEQ ID NO: 1) and RsppsSRl (SEQ ID NO:4, see below)
  • reaction B using primers R.sppsSRsphl (SEQ ID NO:2) and RsppsSFl (SEQ ID NO:3, see below).
  • each primer of this pair The 20 nucleotides on the 3' ends of each primer of this pair are located near the center of the ppsS gene, 300 bases apart from each other, and facing towards the start (RsppsSRl) and end (RsppsSFl) of the gene.
  • the 20 nucleotides on the 5' end of each primer of this pair are the reverse complement of the 3 ' end of the other primer in the pair. PCR of the two separate reactions was conducted as above, except that 0.05 ng of first round product per ⁇ L of reaction mix was used as template.
  • an initial denaturation for 3 min at 94°C was conducted followed by eight cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 47°C, and extension for 1 min 15 sec at 72°C, then eight cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 58°C, and extension for 1 min 15 sec at 72°C; 16 cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 63°C, and extension for lmin 15 sec at 72°C; and a final extension for 7 min at 72°C.
  • Both PCR products (approximately 770 and 750 bp in length), were separated on a 0.8% agarose gel in IX TAE buffer, excised, and gel purified.
  • the third round of PCR utilized the same primers and reaction mixture as the first round of PCR, except that a mixture of 10 ng of each second round fragment was used as template rather than genomic DNA (200 ⁇ L reaction).
  • the PCR program used was also the same as that used in the first round of PCR, with the annealing time lengthened to 2 minutes.
  • the 1.3 Kb third-round product was separated on a 0.8% agarose gel in IX TAE buffer and purified.
  • the 1.3 Kb PCR product (3 ⁇ g) was digested with Sph I and Sal I and purified using a QIAquick PCR Purification Kit.
  • Vector pLOl was prepared by digesting 3 ⁇ g of the vector with Sph I and Sal I, which were inactivated by heating to 65°C for 20 minutes, and dephosphorylating using shrimp alkaline phosphatase (Roche). The dephosphorylated vector was gel purified on a 1% TAE-agarose gel. Sphl and Sail digested vector DNA (66 ng) was ligated with 80 ng of the digested third-round PCR product at room temperature for 5 min using Rapid DNA ligase system (Roche). A portion of the ligation mixture (1 ⁇ l) was elecfroporated into 40 ⁇ L of E. coli ElectroMAX DH5 electrocompetent cells (Life Technologies).
  • Elecfroporated cells were plated on LB media containing 50 ⁇ g/ mL kanamycin (LBK 50 ). individual colonies were picked and patched to fresh LBK 5 o plates and simultaneously resuspended in 25 ⁇ l distilled water (D/W) and heated at 95 °C for 10 min to lyse the cells and release the DNA. Colonies with insert were identified using a PCR screen that was identical to the first round of PCR described earlier.
  • Donor E. coli colonies for conjugation were prepared by electroporating 1 ⁇ l of plasmid DNA into electrocompetent S17-1 cells. Elecfroporated cells were plated on LB media containing 25 ⁇ g/ mL of kanamycin, 25 ⁇ g/ mL of streptomycin, and 25 ⁇ g/ L of spectinomycin (LBKSMST). Strain S17-1 is resistant to SMST. Single colonies were used to start cultures for plasmid DNA isolation and use in conjugation. These colonies also were plated on LB media containing 5% sucrose and 25 ⁇ g/mL of kanamycin to ensure that the sacB gene was still functional. Only colonies that showed lethality on the sucrose media were used in conjugation. The presence of the correct insert size was confirmed using a PCR screen that was identical to the first round of PCR described above.
  • the cell mixture was pelleted, resuspended in 20 ⁇ L of LB media, spotted on an LB plate, and incubated at 30°C for 7 to 15 hours. The cells then were scraped off the surface of the plate, resuspended in 1.5 mL of Sistrom's salts, and 200 ⁇ L of resuspended cells were plated on each of seven plates of Sistrom's with 25 ⁇ g/mL kanamycin (SISK 5 ) media. Colonies that grew on the plates after approximately 10 days, representing proposed single-crossover events, were streaked to new plates of the same media. Upon growth, single colonies were streaked on LB with 25 ⁇ g/mL kanamycin (LBK 25 ) media.
  • LBK 25 25 ⁇ g/mL kanamycin
  • Rhodobacter sphaeroides shake flask protocol Five mL cultures of R. sphaeroides ATCC 35053 with various inserted genes or knockouts were grown in 13 mL culture tubes containing Sistrom's media with 4 g/L glucose (Sistrom, 1962. J. Gen. Microb. 28:607-616) and 1% yeast extract (Sigma Chemical Co., St. Louis, MO). The cultures were incubated for 48 to 72 hours at 30°C with 250 ⁇ m shaking in a New Brunswick Innova shaker. A 1.6 mL aliquot of culture was removed from the culture tube and added to 150 mL of Tris urea medium in a 500 mL baffled shake flask.
  • Tris urea medium is a modification of Sistrom's medium in which the ammonium sulfate has been removed and 50 mM Tris HC1, 1.6 g/L urea, and 10 g/L glucose have been added.
  • the flask was then incubated for 72 to 84 hours at 30°C with various shaking speeds in a New Brunswick Innova shaker. The entire contents of the flask were removed at the end of the incubation period for CoQ(10) or carotenoid analysis.
  • Rhodobacter capsulatus shake flask protocol Five mL cultures of R.
  • capsulatus SB 1003 with various inserted genes or knockouts were grown in 13 L culture tubes containing PY broth (0.3% peptone, 0.3% yeast extract, 1 rnM MgSO 4 and 1 mM CaCl 2 ). The cultures were incubated for 48 to 72 hours at 30°C with 250 rpm shaking in a New Brunswick Innova shaker. A 1.6 mL aliquot of culture was removed from the culture and added to 150 mL of RCV 2/3PY media (Young et al, 1989 Mol. Gen. Genet. 218:1-12) in a 500 mL baffled shake flask. The flask was then incubated for 72 to 84 hours at 30°C with various shaking speeds in a New Brunswick Innova shaker. The entire contents of the flask were removed at the end of the incubation period for CoQ(10) or carotenoid analysis.
  • a volume of 0.75 mL to 1.5 mL of culture was added to a 1.8 mL-microfuge tube and centrifuged at 10,000 ⁇ m for 3 min in an IEC MicroMax microfuge. The supernatant was discarded and the pellet was completely resuspended in 1.0 mL of acetone: methanol (7:2) and stored at room temperature in the dark for 30 min. The sample was mixed once during this incubation. After incubation, the sample was centrifuged at 10,000 rpm for 3 min. and the extract (supernatant) was collected. Samples were stored at -20°C if analysis was not performed immediately.
  • Carotenoid extracts were analyzed on a spectrophotometer, scanning in the range of 350 nm to 800 mm, and OD 48 o was recorded.
  • the amount of carotenoid (spheroidenone) in mg / 100 mL of culture was calculated using the following equation: spheroidenone (mg) / 100 mL culture - ((OD 480 - (0.0816 * OD 770 )) * 0.484) / vol of culture sample used in extraction From mg of spheroidenone /100 mL of culture, the amount of spheroidenone /mg of DCW was calculated using the DCW number as the conversion factor. Care was talcen to correct for any dilution factors required during spectrophotometric analysis of the samples.
  • CoQ(lO Analysis 130 mL of culture media containing cells was removed and placed in a tared 250 mL centrifuge bottle. The samples were centrifuged at 15,000 X G for 5 mins, the supernatant was poured off, and the samples were resuspended in 50 mL cold water. The samples were centrifuged again at 15,000 X G for 5 mins, and the supernatant was poured off. The wet weight of the biomass was determined, and the biomass was resuspended in 1.5 times its weight in water. The samples were stored covered with foil at -80°C before analysis.
  • the samples were warmed at 21°C for 15 min then 1.0 mL was withdrawn and sodium dodecyl sulfate was added to a final concentration of 5 %.
  • the samples were first extracted with 4 mL of ethanol and vortexed for 30 minutes and then were extracted with 10 mL of hexane and vortexed for an additional 30 minutes. After centrifuging the samples at 3500 ⁇ m for 5 min., 2.5 mL of the hexane layer was evaporated to dryness and the residue dissolved in 100 ⁇ L of hexane. An additional 2.4 mL of ethanol was added to a final volume of 2.5 mL.
  • the dry weight of the samples were determined by taking an aliquot and drying at 105°C in an aluminum weighing pan for at least four hours.
  • R. sphaeroides fnrL gene was overexpressed in R. sphaeroides using the native promoter for the fnrL gene in the vector pRK415.
  • the fnrL gene also was overexpressed in R. sphaeroides using the broad-host-range vector pBBRlMCS2 (Kovach et al, 1995 Gene 166:175-6), into which either a tet promoter or R. sphaeroides rrnB promoter had been inserted.
  • R. sphaeroides Five mL cultures of various R. sphaeroides strains were grown overnight at 30°C in Sistrom's media supplemented with 20%LB. Cultures were diluted 1/100 in 300 mL of the same media and grown to an OD 66 o of 0.5-0.8. Cells were chilled on ice for 10 minutes and then centrifuged for 6 minutes at 7,500 g. The supernatant was discarded and the cell pellet was resuspended in ice-cold 10% glycerol at half of the original volume. The cells were pelleted by centrifugation for 6 minutes at 7,500 g and the supernatant again was discarded.
  • Time constants of 8.5-10.0 resulted in good transformation efficiencies. Once an acceptable time constant was achieved, cells were aliquoted into cold microfuge tubes and stored at -80°C. All water used for media and glycerol was 18 Mohm or higher.
  • R. sphaeroides ATCC 2.4.1 strain carrying the ⁇ UI1970 plasmid (Zeilstra-Ryalls et al. 1997 J. Bacteriol. 179:7264-7273.) was obtained from Samuel Kaplan at the University of Texas, Houston.
  • the pUI1970 plasmid contains the R. sphaeroides fnrL gene and its promoter in vector pRK415. Plasmid DNA was isolated from these strains using a QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).
  • pRK415 or pUI1970 plasmid DNA (100-150 ng) was gently mixed with 40 ⁇ L of R.
  • sphaeroides BSl ATCC 35053/ ⁇ crtE ⁇ ppsR ⁇ ccoN electrocompetent cells.
  • the cell mixture then was transferred to an electroporation cuvette with a 0.2 cM electrode gap. Electroporations were conducted using a Biorad Gene Pulser II (Biorad, Hercules, CA) with settings at 2.5 kV of energy, 400 ohms of resistance, and 25 ⁇ F of capacitance. Cells were recovered in 400 ⁇ L SOC media at 30°C for 10-16 hours. The cells were then plated, 200 ⁇ L per plate, on selective media. Individual colonies were tested for presence of an insert of the expected size using PCR.
  • Colonies were resuspended in approximately 25 ⁇ L of 10 mM Tris buffer using a pipette tip and 2 ⁇ L of the resuspension was streaked onto LB media containing 0.8 ⁇ g tetracycline. The remaining resuspension was heated for 10 minutes at 95°C to break open the bacterial cells and two ⁇ L of the heated cells was used in a 25 ⁇ L PCR reaction using particular sets of primers.
  • FnrLF (5'- TCAAGAATTCGAAGGAAGAGCATGACGCTGCACGAAGTCCCA- 3' (SEQ ID NO:5);
  • FnrLR (5'-ATCATCTATGTTGAAGCTTGCTGCCTCTGCCCGCCTCGC - 3' (SEQ ID NO:6)).
  • the PCR mix contained the following: IX Taq PCR buffer, 0.2 ⁇ M each primer,
  • PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 30 cycles of denaturation for 30 seconds at 94°C and annealing and extension for 2.5 min at 72°C; and a final extension for 7 minutes at 72°C.
  • Colonies containing pUI1970 plasmid resulted in a heavy PCR product approximately 900 bp in size, whereas colonies that contained vector without the fnrL gene showed a faint band due to amplification from the genomic copy of the fnrL gene.
  • the pMCS2tetP vector was constructed by cloning the promoter for the tetA tetracycline resistance gene from transposon Tnl721 (Waters et. al., 1983 Nucleic Acids Res. 11(17):6089-6105) into the pBBRlMCS2 vector.
  • the pBBRlMCS2 vector is mobilizable and relatively small (5,144 bp), replicates in R. sphaeroides, has a multiple cloning site with lacZa color selection, and contains a kanamycin resistance gene.
  • tet-4 gene promoter (tetP) was amplified using plasmid pRK415 as template and primers designed to introduce an Xba I restriction site at the beginning of the amplified fragment and aBamHl site at the end of the amplified fragment.
  • the PCR mix contained the following: IX Native Plus Pfu buffer, 20 ng pRK415 plasmid DNA, 0.5 ⁇ M of each primer, 0.2 mM of each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase in a final volume of 200 ⁇ L.
  • the PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 1 minute; 8 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 45 seconds; 24 cycles of denaturation at 94°C for 30 seconds, annealing at 66°C for 45 seconds, and extension at 72°C for 45 seconds; and a final extension for 7 minutes at 72°C.
  • the amplification product was then separated by gel electrophoresis using a 2 % TAE-agarose gel. A 160 bp fragment was excised from the gel and purified.
  • the purified fragment was digested simultaneously with Xba I and BamH I restriction enzymes and purified with a QIAquick PCR Purification Kit.
  • Three ⁇ g of pBBRlMCS2 plasmid DNA was digested with BamH I and Xba I and the reaction was terminated by heating at 80°C for 20 minutes.
  • the digested vector then was dephosphorylated with shrimp alkaline phosphatase and gel purified on a 1% TAE-agarose gel.
  • pBBRlMCS2 vector 100 ng was ligated with digested tetP PCR product (36 ng) using T4 DNA ligase at 16°C for 16 hours.
  • E. coli ElectromaxTM DH5 ⁇ TM cells 40 ⁇ l were elecfroporated with 1 ⁇ L of ligation reaction. Elecfroporated cells were plated on LB media containing 25 ⁇ g/mL of kanamycin and 50 ⁇ g/mL of Xgal (LBKX). Individual, white colonies were resuspended in approximately 25 ⁇ L of 10 mM Tris with 2 ⁇ L plated on LBKX.
  • the remaining portion of the resuspended colony was heated for 10 minutes at 95°C to lyse the bacterial cells.
  • Two ⁇ L of the lysed cells were used in a 25 ⁇ L PCR reaction using the following primers homologous to the vector and flanking the cloning site: MCS2FS: 5'- AGGCGATTAAGTTGGGTAAC -3' (SEQ ID NO:9); and MCS2RS: 5'- GACCATGATTACGCCAAG -3' (SEQ ID NO:10).
  • the PCR mix contained the following: IX Taq PCR buffer, 0.5 ⁇ M each primer, 0.2 mM each dNTP, and 1 unit of Taq DNA polymerase per reaction.
  • the PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 32 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 1 minute; and a final extension for 7 minutes at 72°C. All colonies showed a single insertion event. Plasmid DNA was isolated from cultures of two individual colonies and sequenced to confirm the DNA sequence of the tet promoter in the construct.
  • the pMCS2rrnBP vector was constructed by inserting a copy of the R. sphaeroides rrnB promoter (rrnBP) into the vector pBBRlMCS2.
  • the rrnB promoter was isolated from the vector pTEX24 (S. Kaplan) by digesting with BamH to release the promoter as a 363 bp fragment. This fragment was gel purified from a 2% TAE agarose gel.
  • the pBBRlMCS2 vector also was digested with BamH I and the enzyme heat inactivated at 80°C for 20 minutes. The digested vector was then dephosphorylated with shrimp alkaline phosphatase (Roche
  • E. coli Electromax DH10B cells (Life Technologies, Inc., Rockville, MD) were elecfroporated (1 ⁇ l of the ligation reaction to 40 ⁇ l of cells) and plated on LB media containing 25 ⁇ g/mL of kanamycin (LBK 25 ). Plasmid DNA was isolated from cultures of single colonies and was digested with Hind III to confirm the presence of a single insertion of the rrnB promoter. The sequence of the rrnBP inserts for these colonies also was confirmed by DNA sequencing.
  • the R. sphaeroides fnrL gene was amplified by PCR using primers homologous to sequence upstream and downstream of the gene. These primers, FNRLF and FNRLR (SEQ ID NO: 5 and SEQ ID NO:6), were designed to introduce an EcoR I restriction site and a ribosomal binding site at the beginning of the amplified fragment and a Hind III site at the end of the amplified fragment.
  • the PCR mix contained the following: IX Native Plus Pfu buffer, 200 ng R.
  • sphaeroides genomic DNA 0.5 ⁇ M of each primer, 0.2 mM each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase (Stratagene, La Jolla, CA) in a final volume of 200 ⁇ L.
  • the PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 2 minutes; 8 cycles of 94°C for 30 seconds, 62°C for 1 minute, and 72°C for 2 minutes; 22 cycles of 94°C for 30 seconds, 66°C for 1 minute, and 72°C for 2 minutes; and a final extension for 7 minutes at 72°C.
  • the amplification product then was separated by gel electrophoresis using a 1% TAE-agarose gel. A fragment approximately 0.84 Kb in size was excised from the gel and purified. The purified fragment was digested with EcoR I restriction enzyme, purified with a QIAquick PCR Purification Kit, digested with Hind III restriction enzyme, purified again with a QIAquick PCR Purification Kit, and quantified on a minigel.
  • pMCS2tefP vector Three ⁇ g of the pMCS2tefP vector was digested with EcoR I, gel purified on a 1% TAE-agarose gel, digested with Hind HI, purified with a QIAquick PCR Purification Kit, dephosphorylated with shrimp alkaline phosphatase, and purified again with a QIAquick PCR Purification Kit.
  • the digested PCR product containing the R. sphaeroides fnrL gene (70 ng) and the prepared pMCS2tetP vector (75 ng) were ligated using T4 DNA ligase at 16°C for 16 hours.
  • ElectromaxTM DH10BTM cells were elecfroporated (1 ⁇ L of the ligation reaction per 40 ⁇ L of cells). Individual colonies were tested for presence of an insert of the expected size using PCR. Individual colonies were resuspended in approximately 25 ⁇ L of 10 mM Tris and 2 ⁇ L of the resuspension was plated on LBK media. The remnant resuspension was heated for 10 minutes at 95 °C to brealc open the bacterial cells and 2 ⁇ L of the heated cells used in a 25 ⁇ L PCR reaction using the TETXBAF and FNRLR primers.
  • the PCR mix contained the following: IX Taq PCR buffer, 0.5 ⁇ M each primer, 0.2 mM each dNTP, 5% DMSO (v/v), and 1 unit of Taq DNA polymerase (Roche) per reaction.
  • the PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 8 cycles of 94°C for 30 seconds, 62°C for 1 minute, and 72°C for 2 minutes; 22 cycles of 94°C for 30 seconds, 66°C for 1 minute, and 72°C for 2 minutes; and a final extension for 7 minutes at 72°C.
  • the sequence of the fnrL insert was confirmed by DNA sequencing of plasmid DNA of a colony with the desired insert size. Purified plasmid DNA having the correct sequence was then elecfroporated into electrocompetent cells of R. sphaeroides strains 35053 and 2A. ⁇ t ⁇ rL (Methods listed above). The transformed 35053 strains were plated on LBK plates. Individual colonies were screened for the desired insert size as described above. The strain designated 2.4.1 ⁇ //.rZ/MCS2tetP/Rs/ r--. was plated on SisLB plates containing 0.5% DMSO and placed in an anaerobic chamber. The growth of the strain under these conditions was used to confirm the proper functioning of the expression vector.
  • R. sphaeroides fnrL gene in pMCS2rrnBP Cloning of the R. sphaeroides fnrL gene in pMCS2rrnBP: The R. sphaeroides fnrL gene was amplified by PCR using the primers FNRLCLAF and FNRLKPNR. These primers were designed to introduce a Cla I restriction site and a ribosomal binding site at the beginning of the amplified fragment and aKpn I site at the end of the amplified fragment.
  • FNRLCLAF 5'- TCAAATCGATGAAGGAAGGGCATGACGCTGCACGAAGTCC -3* (SEQ ID NO: 11);
  • FNRLKPNR 5'- TCGGAAGTACGGTACCTGATGGCGCACTGACGGAAGAAG -3' (SEQ ID NO: 12).
  • the PCR mix contained the following: IX Native Plus Pfu buffer, 200 ng R. sphaeroides genomic DNA, 0.5 ⁇ M of each primer, 0.2 mM each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase (Stratagene, La Jolla, CA) in a final volume of 200 ⁇ L.
  • the PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 3 minutes; 30 cycles of 94°C for 30 seconds, 58°C for 1 minute, and 72°C for 1.5 minutes; and a final extension for 7 minutes at 72°C.
  • the amplification product was then separated by gel electrophoresis using a 1% TAE-agarose gel. A fragment approximately 0.87 Kb in size was excised from the gel and purified.
  • the purified fragment was digested with Kpn I restriction enzyme, purified with a QIAquick PCR Purification Kit, digested with Cla I restriction enzyme, purified again with a QIAquick PCR Purification Kit, and quantified on a SmartSpec3000.
  • pMCS2rrnBP vector Three ⁇ g of the pMCS2rrnBP vector was digested with the restriction enzyme Cla I, gel purified on a 1% TAE-agarose gel, digested with Kpn I, purified with a QIAquick PCR Purification Kit, dephosphorylated with shrimp alkaline phosphatase, and purified again with a QIAquick PCR Purification Kit.
  • the digested PCR product 45 ng
  • containing the R. sphaeroides fnrL gene, described above, and 100 ng of the prepared pMCS2rrnBP vector was ligated using T4 DNA ligase at room temperature for 5 minutes (Roche Rapid Ligation Kit).
  • the ligation reaction was purified with a High-Pure PCR clean kit (Roche). Ten ⁇ L of the ligation reaction was used to electroporate 40 ⁇ L of E. coli ⁇ lectromaxTM DH10BTM cells. Individual colonies were tested for presence of an insert of the expected size using PCR. Colonies were resuspended in approximately 20 ⁇ l of sterile distilled water using a pipette tip; the residual cells were streaked on LBK 25 media. The resuspended cells were heated for 10 minutes at 95 °C to lyse the bacterial cells and 5 ⁇ L of the lysed cells were used in a 25 ⁇ l PCR reaction using the original PCR primers (above).
  • the PCR mix contained the following: IX Taq PCR buffer, 0.2 ⁇ M each primer, 0.2 mM each dNTP, 5% DMSO (v/v), and 1 unit of Taq DNA polymerase (Roche) per reaction.
  • the PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 3 minutes; 30 cycles of 94°C for 30 seconds, 58°C for 1 minute, and 72°C for 1.5 minutes; and a final extension for 7 minutes at 72°C.
  • the sequence of the fnrL insert was confirmed by DNA sequencing of plasmid DNA of colonies with the desired insert size.
  • Purified plasmid DNA having the correct sequence was then elecfroporated into electrocompetent cells of R. sphaeroides strains 35053 and 2A.l/SfnrL.
  • the transformed 35053 strains were plated on LBK 25 media. Individual colonies were screened for the desired insert size as described above.
  • the 2.4.1 ⁇ rE/pMCS2rrnBP/Rs wrE strain was plated on SisLB plates containing 0.5% DMSO and placed in an anaerobic chamber. The growth of the strain under these conditions was used to confirm the proper functioning of the expression vector.
  • Example 1 Effect of the ppsS gene on the production of CoQ and carotenoids in R. sphaeroides
  • R. sphaeroides ATCC 35053, ATCC 35053/ ⁇ crtE, ATCC 35053/ AppsS, and ATCC 35053/ AcrtEAppsS were grown in 150 mL of Tris urea media in shake flasks at 30°C with 80 rpm shaking. At the end of a three-day incubation period, the cells were harvested and analyzed for CoQ(10) and carotenoids as described above. The results are provided in Table 1. TABLE 1
  • R. sphaeroides ATCC 35053 strain with inactivated crtE and ppsS genes showed a 30% - 43.7% increase in CoQlO.
  • the ppsS gene knock-out resulted in an increase in carotenoid (14% - 15.84%) and a 5.8% - 6.8% increase in CoQlO.
  • Each value listed here is an average of three shake flask experimental points.
  • Example 2 Effect of the aerR R ne on the production of CoQ(lO and carotenoids inR. capsulatus R. capsulatus strain SB 1003 (rifampicin resistant) and R. capsulatus SB 1003 with various gene knockouts (obtained from Carl Bauer, Indiana University) were grown in 150 mL of PYS RCV2/3PY media in triplicate in 500 mL shake flasks with 80 ⁇ shaking. At the end of a three-day incubation period at 30°C, the cells were harvested and assayed for CoQlO production. The results are presented in Table 2 and show that strains with inactivated ppsR and ppsR and ⁇ erR together increase both CoQ(10) and carotenoid production. TABLE 2
  • Example 3 Effect of the fnrL gene with its native promoter on CoQ(lO production in Rhodobacter sphaeroides R. sphaeroides ATCC 35053/AcrtEAppsRAccoN containing the plasmid pRK415 (Keen et al, 1988 Gene 70:191-197.) and R. sphaeroides ATCC
  • Example 4 Effect of fnrL gene on CoQClO) production in R. sphaeroides under semi-aerobic conditions
  • R. sphaeroides ATCC 35053 containing the plasmid pMCS2 with either the rrnB promoter or the tet promoter in front of the fnrL gene from R. sphaeroides ATCC 35053 were grown as described in Example 3, except 100 mL of culture was used in a 1 L flask. At the end of a three-day incubation period, the cells were harvested and analyzed for CoQ(lO). The results are shown in Table 4.
  • Example 5 Effect of fnrL gene on coenzyme Ql 0 production in R. sphaeroides under aerobic conditions
  • R. sphaeroides ATCC 35053 containing the plasmid pMCS2 with either the rrnB promoter or the tet promoter operably linked to the fnrL gene from R. sphaeroides ATCC 35053 were grown as described in Example 3.
  • the cells were shaken at 200 ⁇ m in a New Brunswick Innova shaker. At the end of the three-day incubation period, the cells were harvested and analyzed for CoQ(10). The results were as follows:

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Membranous bacteria that produce enhanced amounts of a ubiquinone are described, as well as methods for making nutraceuticals.

Description

PRODUCTION OF UBIQTJINONES
TECHNICAL FIELD
The invention relates to methods and materials involved in the production of ubiquinones, and more particularly, to membranous bacteria that produce elevated amounts of ubiquinones.
BACKGROUND
Coenzyme Q10 (CoQ(lO)) is an isoprenoid compound found in membranes throughout the cell. CoQ(lO) also is known as a ubiquinone or 2,3-dimethoxy, 5-methyl, 6-polyisoprene parabenzoquinone and contains 10 isoprene units (5 carbons each). CoQ(10) is a component of the oxidative phosphorylative process in mitochondria as well as a primary scavenger of free radicals and a participant in oxidation/reduction control of cell signaling. Crane, J. Am. Coll. Nutr. 20(6^:591-598 (2001 . Since Co Q( 10) has several biochemical functions, it has been used in pharmaceuticals (e.g., for treatment of heart disease), nutraceuticals, and cosmetics. Current methods of manufacture include extraction from yeast or bacteria, but there is a need to improve the current processes.
SUMMARY The invention is based on the production of engineered microorganisms that produce elevated levels of ubiquinones (e.g., CoQ(10)) relative to corresponding microorganisms that have not been genetically modified and grown under similar culture conditions. The engineered microorganisms described herein can be used in culture systems to produce large quantities of particular ubiquinones. In one aspect, the invention features membranous bacteria that include a genomic disruption of at least a portion of appsR sequence and at least a portion of an erR sequence, wherein the genomic disruption renders the ppsR sequence and the αerR sequence non-functional, and wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the genomic disruption and grown under similar culture conditions. The membranous bacteria can be purple non-sulfur photosynthetic bacteria. The membranous bacteria can be a species of Rhodobacter such as Rhodobacter sphaeroides or Rhodobacter capsulatus.
In another aspect, the invention features membranous bacteria that include an exogenous nucleic acid encoding a fumarate nitrate reduction (Fnr) polypeptide. The membranous bacteria produce an elevated amount of CoQ(lO) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and grown under similar culture conditions. The Fnr polypeptide can be a Rhodobacter sphaeroides FnrL polypeptide or a R. capsulatus Fnr polypeptide. The membranous bacteria can be purple non-sulfur photosynthetic bacteria. The membranous bacteria can be a species of Rhodobacter such as Rhodobacter sphaeroides or Rhodobacter capsulatus. The membranous bacteria further can include a genomic disruption of at least a portion of a crtE sequence, at least a portion of appsR sequence, and at least a portion of a ccoN sequence, wherein the genomic disruption renders the crtE sequence, the ppsR sequence, and the ccoN sequence non-functional, wherein the membranous bacteria produce an elevated amount of CoQ( 10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and the genomic disruption, and grown under similar culture conditions.
The invention also features a method of making a nutraceutical. The method includes extracting CoQ(10) from membranous bacteria, the membranous bacteria including an exogenous nucleic acid encoding a Fnr polypeptide, wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and grown under similar culture conditions. The membranous bacteria further can include a genomic disruption of at least a portion of a crtE sequence, at least a portion of appsR sequence, and at least a portion of a ccoN sequence, wherein the genomic disruption renders the crtE sequence, the ppsR sequence, and the ccoN sequence non-functional, wherein the membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking the exogenous nucleic acid and the genomic disruption and grown under similar culture conditions. In yet another aspect, the invention features a method of making a nutraceutical.
The method includes extracting CoQ(10) from membranous bacteria, the membranous bacteria including a genomic disruption of at least a portion of appsR sequence and at least a portion of an αerR sequence, wherein the genomic disruption renders the ppsR sequence and the αerR sequence non- functional, and wherein the membranous bacteria produce an elevated amount of CoQ(lO) compared with corresponding membranous bacteria lacking the genomic disruption and grown under similar culture conditions.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
DETAILED DESCRIPTION
In general, the invention provides methods and materials related to the production of ubiquinones, 2,3-dimethoxy-5-methylbenzoquinone derivatives having a side chain containing at least one five-carbon isoprenoid unit. Typically, ubiquinone is referred to as coenzyme Q (CoQ). The number of isoprenoid units of a side chain of a particular ubiquinone is used to identify that particular ubiquinone. For example, a ubiquinone with six isoprenoid units is referred to as CoQ(6), while a ubiquinone with ten isoprenoid units is referred to as CoQ(10). It is noted that CoQ(10) also is referred to as ubidecarenone. Examples of ubiquinones include, without limitation, CoQ(6), CoQ(8), CoQ(10), and CoQ(12).
Engineered Microorganisms
The term "microorganism" as used herein refers to all microscopic organisms including, without limitation, bacteria, algae, fungi, and protozoa. It is noted that bacteria cells can be membraneous or non-membraneous. The term "non-membraneous" as used herein refers to any bacteria lacking intracytoplasmic membrane. The term "membraneous" as used herein refers to any naturally-occurring, genetically modified, or environmentally modified bacteria having an intracytoplasmic membrane. An intracytoplasmic membrane can be organized in a variety of ways including, without limitation, vesicles, tubules, thylakoid-like membrane sacs, and highly organized membrane stacks. Any method can be used to analyze bacteria for the presence of intracytoplasmic membranes including, without limitation, electron microscopy, light microscopy, and density gradients. See, e.g., Chory et al, J. Bacteriol, 159:540-554 (1984); Niederman and Gibson, Isolation and Physiochemical Properties of Membranes from Purple Photosynthetic Bacteria, hi: The Photosynthetic Bacteria, Ed. By
Roderick K. Clayton and William R. Sistrom, Plenum Press, pp. 79-118 (1978); and Lueking et al., J. Biol. Chem., 253: 451-457 (1978). Examples of membraneous bacteria that can be used herein include, without limitation, bacteria of the Rhodospirillaceae family such as those in the genus Rhodobacter (e.g., R. sphaeroides, R. capsulatus, R. sulfidophilus, R. adriaticus, andR. veldkampii), the genus Rhodospirillum (e.g., R. rubrum, R. photometricum, R. molischianum, R. fulvum, and R. salinarum), the genus Rhodopseudomonas (e.g., R. palustris, R. viridis, and R. sulfoviridis), the genus Rhodomicrobium, the genus Rhodocyclus, and the genus Rhodopila; bacteria of the Chromatiaceae family such as those in the genus Chromatium, genus Thiocystis, the genus Thiospirillum, the genus Thiocapsa, the genus Lamprobacter, the genus
Lalmprocystis, the genus Thiodictyon, the genus Amoebobacter, and the genus Thiopedia; green sulfur bacteria such as those in the genus Chlorobium and the genus Prosthecochloris; bacteria of the Methylococcaceae family such as those in the genus Methylococcus (e.g., M. capsulatus), and the genus Methylomonas (e.g., M. methanica); and particular bacteria of the Nitrobacteraceae family such as those in the genus
Nitrobacter (e.g., N. winogradsky and N. hamburgensis), the genus Nitrococcus (e.g., N. mobilis), and the genus Nitrosomonas (e.g., N. europaea).
Membraneous bacteria can be highly membraneous bacteria. The term "highly membraneous bacteria" as used herein refers to any bacterium having more intracytoplasmic membrane than R. sphaeroides (ATCC 17023) cells have after the R. sphaeroides (ATCC 17023) cells have been (1) cultured chemoheterotrophically under aerobic conditions for four days, (2) cultured chemoheterotrophically under oxygen- limited conditions for four hours, and (3) harvested. The aerobic culture conditions involve culturing the cells at 30°C in the presence of 25% oxygen. The oxygen-limited conditions involve culturing the cells at 30°C in the presence of 2% oxygen. After the four hour culturing step under oxygen-limiting conditions, the R. sphaeroides (ATCC 17023) cells are harvested by centrifugation and analyzed for the presence of intracytoplasmic membranes as discussed above.
Engineered microorganisms of the invention produce elevated amounts of a ubiquinone (e.g., CoQ(lO)). "Elevated amount" refers to a statistically significant increase in the absolute amount of ubiquinone per dry cell weight relative to the absolute amount per dry cell weight in a corresponding organism, grown under similar conditions, that does not contain the genetic modification(s). Known statistical methods can be used to compare the absolute amount of ubiquinone/dry cell weight. A p value of <0.05 is considered statistically significant. Bacteria can produce more CoQ(10) when grown under anaerobic conditions as compared to aerobic conditions. For example, anaerobically cultured bacteria can produce about 3 to 4 fold more CoQ(10) than aerobically cultured bacteria of the same species.
In general, ubiquinone can be extracted with one or more organic solvents then analyzed with reverse phase chromatography (C18) and a photodiode array (PDA) detector. For example, cells first can be extracted with ethanol then extracted with hexane. The hexane layer can be dried and re-dissolved in a small volume of hexane. The sample then can be analyzed using a Waters Nova-Pak C18 (3.9 x 150 mm: 4 μm) column with a PDA detector set from 200-300 nm.
Any method can be used to produce engineered microorganisms, including disrupting endogenous genes and/or introducing one or more isolated, exogenous nucleic acids into a cell. Endogenous genes can be disrupted using common knock-out techniques as well as antisense technology. For example, R. sphaeroides can be engineered to contain a cDNA that encodes an antisense molecule that prevents an enzyme from being made. The term "antisense molecule" as used herein encompasses any nucleic acid that contains sequences that correspond to the coding strand of an endogenous polypeptide. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus, antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA. Many methods also are available for introducing nucleic acid into a cell, whether in vivo or in vitro. For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, conjugation, and viral-mediated nucleic acid transfer are common methods that can be used to introduce nucleic acid into a cell. In addition, naked DNA can be delivered directly to cells in vivo as described elsewhere (U.S. Patent No. 5,580,859 and U.S. Patent No. 5,589,466).
Any method can be used to identify cells that lack a functional endogenous gene and/or contain an exogenous nucleic acid. For example, R. sphaeroides having a disrupted αerR sequence (also known as orfl92,ppa, snάppsS) can be identified using common biochemical methods such as PCR amplification using primers specific for the αerR gene or flanking regions and, for example, examination of the size of the amplified product or sequence analysis.
PCR and nucleic acid hybridization techniques such as Northern and Southern analysis can be used to determine if a cell contains an exogenous nucleic acid. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid by detecting the expression of a polypeptide encoded by that particular nucleic acid. For example, detection of polypeptide X-immunoreactivity after introduction of an isolated nucleic acid encoding polypeptide X into a cell that does not normally express polypeptide X can indicate that that cell not only contains the introduced nucleic acid but also expresses the encoded polypeptide X from that introduced nucleic acid.
Any method can be used to direct the expression of an amino acid sequence from a nucleic acid. Such methods are well known to those skilled in the art, and include, without limitation, constructing a nucleic acid such that a regulatory element drives the expression of a nucleic acid sequence that encodes a polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Such regulatory elements include, without limitation, promoters, enhancers, and the like. In addition, any method for expressing a polypeptide from an exogenous nucleic acid molecule in microorganisms such as bacteria and yeast can be used. For example, well-known methods for making and using nucleic acid constructs that are capable of expressing exogenous polypeptides within Rhodobacter species (e.g., R. sphaeroides and R. capsulatus) can be used. See, e.g., Dryden and Dowhan, J. Bacteriol, 178(4):1030-1038 (1996); Nasilyeva et al, Applied Biochemistry and Biotechnology, 77-79:337-345 (1999); Graichen et al, J. Bacteriol, 181(14):4216-4222 (1999); Johnson et al, J. Bacteriol, 167(2):604-610 (1986); and Duport et al, Gene, 145:103-108 (1994). Further, any methods can be used to identify cells that express an amino acid sequence from a nucleic acid. Such methods are well known to those skilled in the art, and include, without limitation, immunocytochemistry, Western analysis, Northern analysis, and RT-PCR.
The cells described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid. For example, a bacterial cell can contain about 50 copies of exogenous nucleic acid X. In addition, the cells described herein can contain more than one particular exogenous nucleic acid. For example, a bacterial cell can contain about 50 copies of exogenous nucleic acid X as well as about 75 copies of exogenous nucleic acid Y. In these cases, each different nucleic acid can encode a different polypeptide having its own unique enzymatic activity. For example, a bacterial cell can contain two or more different exogenous nucleic acids such that a high level of CoQ(10) is produced. In addition, a single exogenous nucleic acid can encode one or more than one polypeptide. For example, a single nucleic acid can contain sequences that encode three different polypeptides. Depending on the microorganism and the metabolites present within the microorganism, one or both of the following polypeptides may be expressed in the microorganism: a fumarate nitrite reduction (Fnr) polypeptide and a response regulator (Reg) polypeptide. As used herein, the term "polypeptide" refers to any chain of amino acids, regardless of length or post-translational modification, that retains the function of the full-length, wild-type polypeptide. Thus, suitable polypeptides can be less than full- length and/or have one or more amino acid insertions or substitutions if function of the full-length, wild-type polypeptide is retained.
An Fnr polypeptide can serve either as a repressor of certain genes or, in the absence of oxygen, can be converted to an active form that regulates the synthesis of many genes. Fnr requires an iron sulfur cluster that is involved in mediating the sensitivity of the fnr gene to oxygen. Oxygen limitation affects gene expression in a number of microorganisms andfiir-li e genes have been identified in a number of species, including, for example, R. sphaeroides, R. capsulatus, Paracoccus denitrificans, Mesorhizobium loti, and Rhizobium leguminosarum. The R. sphaeroides fnrL gene encodes an FnrL polypeptide that is 248 amino acids in length that regulates the synthesis of several genes in bacteriochlorophyll synthesis. The fnrL gene is required for photosynthetic growth of R. sphaeroides. The nucleic acid sequence of the fnrL genes from R. capsulatus and R. sphaeroides can be found in GenBank under Accession Nos. U78309 and Z49746, respectively. The nucleic acid sequence of the fnr genes from P. denitrificans, M. loti, and R. leguminosarum can be found in GenBank under Accession Nos. U34353, AP003009, and U90520, respectively.
Suitable Fnr polypeptides will have at least 35% identity to the amino acid sequence of the R. sphaeroides Fnr polypeptide. For example, the R. capsulatus Fnr polypeptide has about 64% identity to the R. sphaeroides Fnr polypeptide. The P. denitrificans and M. loti Fnr polypeptides have about 39% and 37% identity to the R. sphaeroides Fnr polypeptide, respectively. Percent sequence identity is calculated by determining the number of matched positions in aligned nucleic acid sequences, dividing the number of matched positions by the total number of aligned nucleotides, and multiplying by 100. A matched position refers to a position in which identical nucleotides occur at the same position in aligned nucleic acid sequences. Percent sequence identity also can be determined for any amino acid sequence. To determine percent sequence identity, a target nucleic acid or amino acid sequence is compared to the identified nucleic acid or amino acid sequence using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained from Fish &
Richardson's web site (www.fr.com/blast) or the U.S. government's National Center for Biotechnology Information web site (www.ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. The following command will generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql .txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. If the target sequence shares homology with any portion of the identified sequence, then the designated output file will present those regions of homology as aligned sequences. If the target sequence does not share homology with any portion of the identified sequence, then the designated output file will not present aligned sequences.
Once aligned, a length is determined by counting the number of consecutive nucleotides from the target sequence presented in alignment with sequence from the identified sequence starting with any matched position and ending with any other matched position. A matched position is any position where an identical nucleotide is presented in both the target and identified sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides. Likewise, gaps presented in the identified sequence are not counted since target sequence nucleotides are counted, not nucleotides from the identified sequence. The percent identity over a particular length is determined by counting the number of matched positions over that length and dividing that number by the length followed by multiplying the resulting value by 100. For example, if (1) a 1000 nucleotide target sequence is compared to the sequence of the R. sphaeroides fnr gene (2) the B12seq program presents 969 nucleotides from the target sequence aligned with a region of the R. sphaeroides fnr gene where the first and last nucleotides of that 969 nucleotide region are matches, and (3) the number of matches over those 969 aligned nucleotides is 900, then the 1000 nucleotide target sequence contains a length of 969 and a percent identity over that length of 93 (i.e., 900 ÷969 x 100 = 93).
It will be appreciated that different regions within a single nucleic acid target sequence that aligns with an identified sequence can each have their own percent identity. It is noted that the percent identity value is rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2. It also is noted that the length value will always be an integer.
Reg polypeptides regulate photosynthetic gene expression by oxygen and regulate some genes in bacteriochlorophyll and carotenoid synthesis and CO2 and N2 fixation.
Non-limiting examples of suitable Reg polypeptides include the RegA polypeptides from R. capsulatus, Rhodovulum sulfidophilum, and Roseobacter denitrificans (GenBank Accession No. P42508, AB010722, and AB010723, respectively) and the homolog from R. sphaeroides, PrrA (GenBank Accession Nos. L25895 and U22347 (includes prrB and prrC)). Full-length RegA polypeptides from the above organisms are 184 amino acids in length. RegA is part of a two-component system with RegB, a sensor kinase (PrrB in R. sphaeroides).
To increase production of ubiquinones, one or more of the endogenous ppsR, aerR, crtE, and ccoN nucleic acid sequences may be disrupted in the microorganism's genome such than the nucleic acid sequence is non-functional, i.e., after transcription and translation of the disrupted sequence, the wild-type encoded gene product is not detectable or the gene product does not retain its natural function. In one embodiment, the endogenous crtE andppsR nucleic acids are disrupted. In another embodiment, the endogenous crtE, ccoN, and ppsR nucleic acids are disrupted. One or more of the endogenous crtE, ccoN, and ppsR nucleic acids also can be disrupted in the genome of a microorganism that is expressing an exogenous nucleic acid encoding an Fnr polypeptide. Such a microorganism produces an elevated level of CoQ(10). The crtE gene encodes geranylgeranyl pyrophosphate synthase, which can produce geranylgeranyl pyrophosphate (GGPP) by condensing together isopentenyl pyrophosphate (LPP) with famesyl pyrophosphate (FPP). The nucleic acid sequence of the crtE gene from R. sphaeroides can be found in GenBank (Accession No. AJ010302). The crtE gene from R. capsulatus also can be found in GenBank (Accession Nos. 152291 and Zl 1165). The ccoN gene encodes a cbb3-type cytochrome oxidase, which has high affinity for oxygen and is part of a regulatory cascade that includes prrA and prrB. Disrupting ccoN can increase the amount of a RegA or PrrA polypeptide, which can allow the microorganism to produce an elevated level of CoQ(l 0). The nucleic acid sequence of the ccoN gene from R. sphaeroides and R. capsidatus can be found in GenBank (Accession Nos. U58092 and AF016223, respectively). TheppsR gene encodes a transcription factor that represses carotenoid and bacteriochlorophyll synthesis under both aerobic and limited oxygen conditions. The nucleic acid sequence of the ppsR gene from R. sphaeroides can be found in GenBank (Accession No. L37197). The R. capsulatus homolog of ppsR is called crtJ, the nucleic acid sequence of which can be found in GenBank under Accession No. Zl 1165.
In a microorganism that is expressing an exogenous nucleic acid encoding a Reg polypeptide, at least a portion of the endogenous crtE sequence can be disrupted. Such microorganisms produce increased levels of CoQ(l 0) relative to a corresponding wild- type microorganism. To further increase CoQ(10) production, the endogenous ppsR and ccoN nucleic acid sequences can be disrupted.
In other embodiments, a microorganism can include a genomic disruption of at least a portion of appsR nucleic acid sequence and at least a portion of an αerR nucleic acid sequence such that the ppsR and αerR nucleic acid sequences are non-functional. The αerR gene (also known as orfl92, ppα, and ppsS) is an aerobic repressor of photosynthetic gene expression and is located next to gene on the Rhodobacter chromosome. It has also been shown to act as an activator in certain Rhodobacter strains. hi a microorganism containing a genomic disruption in the ppsR and αerR nucleic acid sequences, CoQ(10) production increases, as well as total carotenoid production.
Nucleic acids encoding Fnr Polypeptides
The term "nucleic acid" as used herein encompasses both RΝA and DΝA, including cDΝA, genomic DΝA, and synthetic (e.g., chemically synthesized) DΝA. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be the sense or the antisense strand. In addition, nucleic acid can be circular or linear.
The term "isolated" as used herein with reference to nucleic acid refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived. For example, an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. h addition, an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
The term "isolated" as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally- occurring genome. For example, non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid. Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques. Isolated non-naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote. In addition, a non-naturally-occurring nucleic acid can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence. A nucleic acid existing among hundreds to millions of other nucleic acid molecules within, for example, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.
The term "exogenous" as used herein with reference to nucleic acid and a particular cell refers to any nucleic acid that does not originate from that particular cell as found in nature. Thus, all non-naturally-occurring nucleic acid is considered to be exogenous to a cell once introduced into the cell. It is important to note that non- naturally-occurring nucleic acid can contain nucleic acid sequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a cell once introduced into the cell, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature. Thus, any vector, autonomously replicating plasmid, or virus (e.g., retrovirus, adenovirus, or heφes virus) that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid. It follows that genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally- occurring nucleic acid.
Nucleic acid that is naturally-occurring can be exogenous to a particular cell. For example, an entire operon isolated from one bacteria is an exogenous nucleic acid with respect to a second bacteria once that operon is introduced into the second bacteria. Isolated nucleic acid can be obtained using any method including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. For example, PCR can be used to obtain an isolated nucleic acid encoding a Fnr polypeptide. PCR refers to a procedure or technique in which target nucleic acid is amplified in a manner similar to that described in U.S. Patent No. 4,683,195, and subsequent modifications of the procedure described therein. Generally, sequence information from the ends of the region of interest or beyond are used to design oligonucleotide primers that are identical or similar in sequence to opposite strands of a potential template to be amplified. Using PCR, a nucleic acid sequence can be amplified from RNA or DNA. For example, a nucleic acid sequence can be isolated by PCR amplification from total cellular RNA, total genomic DNA, and cDNA as well as from bacteriophage sequences, plasmid sequences, viral sequences, and the like. When using RNA as a source of template, reverse transcriptase can be used to synthesize complimentary DNA strands.
Nucleic acid and amino acid databases (e.g., GenBank®) can be used to obtain an isolated nucleic acid encoding a Fnr polypeptide. For example, any nucleic acid sequence having some homology to a nucleic acid encoding a Fnr polypeptide can be used as a query to search GenBank®.
Further, nucleic acid hybridization techniques can be used to obtain a nucleic acid encoding a Fnr polypeptide. Briefly, any nucleic acid having homology to a sequence encoding a Fnr polypeptide can be used as a probe to identify a similar nucleic acid by hybridization under conditions of moderate to high stringency. Once identified, the nucleic acid then can be purified, sequenced, and analyzed to determine whether it is within the scope of the invention as described herein.
Hybridization can be done by Southern or Northern analysis to identify a DNA or RNA sequence, respectively, that hybridizes to a probe. The probe can be labeled with a biotin, digoxygenin, an enzyme, or a radioisotope such as 32P. The DNA or RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al. , (1989) Molecular Cloning, second edition, Cold Spring
Harbor Laboratory, Plainview, NY. Typically, a probe is at least about 20 nucleotides in length.
Control pf Ubiquinone Production Production of ubiquinone can be controlled by expression of the^-r gene from an inducible promoter. As used herein, "inducible" refers to both up-regulation and down regulation. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, phenolic compound, or a physiological stress imposed directly by heat, cold, salt, or toxic elements, or indirectly through the action of a pathogen or disease agent such as a virus. The inducer also can be an illumination agent such as light, darkness and light's various aspects, which include wavelength, intensity, fluorescence, direction, and duration. Examples of inducible promoters include the lac system and the tetracycline resistance system from E. coli. In one version of the lac system, expression of lac operator-linked sequences is constitutively activated by a lacR-NP16 fusion protein and is turned off in the presence of IPTG. In another version of the lac system, a lacR-NP16 variant is used that binds to lac operators in the presence of IPTG, which can be enhanced by increasing the temperature of the cells. Components of the tetracycline (Tc) resistance system also can be used to regulate gene expression. For example, the Tet repressor (TetR), which binds to tet operator sequences in the absence of tetracycline and represses gene transcription, can be used to repress transcription from a promoter containing tet operator sequences. TetR also can be fused to the activation domain of NP 16 to create a tetracycline-controlled transcriptional activator (tTA), which is regulated by tetracycline in the same manner as TetR, i.e., tTA binds to tet operator sequences in the absence of tetracycline but not in the presence of tetracycline. Thus, in this system, in the continuous presence of Tc, gene expression is repressed, and to induce transcription, Tc is removed.
Production of Ubiquinones
Typically, ubiquinones are produced by providing a microorganism and culturing the provided microorganism in culture medium such that a ubiquinone is produced. In general, the culture media and/or culture conditions can be such that the microorganisms grow to an adequate density and produce the desired ubiquinone efficiently. For large- scale production processes, the following methods can be used. First, a large tank (e.g., a 100 gallon, 200 gallon, 500 gallon, or more tank) containing appropriate culture medium with, for example, a glucose carbon source is inoculated with a particular microorganism. After inoculation, the microorganisms are incubated to allow biomass to be produced. Once a desired biomass is reached, the broth containing the microorganisms can be transferred to a second tank. This second tank can be any size. For example, the second tank can be larger, smaller, or the same size as the first tank. Typically, the second tank is larger than the first such that additional culture medium can be added to the broth from the first tank, hi addition, the culture medium within this second tank can be the same as, or different from, that used in the first tank. For example, the first tank can contain medium with xylose, while the second tank can contain medium with glucose. Once transferred, the microorganisms can be incubated to allow for the production of the desired ubiquinone. Once produced, any method can be used to isolate the desired compound. For example, if the microorganism releases the desired ubiquinone into the broth, then common separation techniques can be used to remove the biomass from the broth, and common isolation procedures (e.g., extraction, distillation, and ion-exchange procedures) can be used to obtain the ubiquinone from the microorganism-free broth. In addition, the desired ubiquinone can be isolated while it is being produced, or it can be isolated from the broth after the product production phase has been terminated. If the microorganism retains the desired ubiquinone, then the biomass can be collected and treated to release the ubiquinone, and the released ubiquinone can be isolated. Extracted ubiquinone (e.g., CoQ(lO)) can be formulated as a nutraceutical. As used herein, a nutraceutical refers to a compound(s) that has been incorporated into a food, tablet, powder, or other medicinal form that, upon ingestion by a subject, provides a specific medical or physiological benefit to the subject. The nutraceutical can include one or more other components, including pharmaceutically acceptable carriers or excipients (e.g., buffers), vitamins, carotenoids, antioxidants such as ethoxyquin, vitamin E, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), or ascorbyl palmitate, vegetable oils such as corn oil, saffiower oil, sunflower oil, or soybean oil, and an edible emulsifier, such as soybean lecithin or sorbitan esters. Addition of antioxidants and vegetable oils can help prevent degradation of the ubiquinone during processing (e.g., drying), shipment, and storage.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES
Methods and Materials All restriction enzymes and T4 DNA ligase were obtained from New England Biolabs (Beverly, MA) unless otherwise indicated. All plasmid DNA preparations were done using QIAprep Spin Miniprep Kits or Qiagen Maxi Prep Kits and all gel purifications were done using QIAquick Gel Extraction Kits (Qiagen, Valencia, CA).
Creation of a markerless ppsS knockout using sacB selection in wild-type Rhodobacter svhaeroides 35053 and aR. syhaeroides ΔcrtE strain: A truncated ppsS gene was cloned into pLOl, a suicide vector in R. sphaeroides, to produce -pLQlppsS. The pLOl vector contains a kanamycin resistance gene, a Bacillus subtilis sacB gene, an oriT sequence, a ColEI replicon, and a multiple cloning site (Lenz et al., 1994 J. Bacteriol. 176:4385-4393). The p OlppsS plasmid was introduced into R. sphaeroides strain ATCC 35053 and R. sphaeroides strain ATCC 35053 ΔcrtE, by conjugation with an E. coli (SI 7-1) donor. Kanamycin resistance was used to select for single-crossover events between the truncated ppsS gene and the genomic ppsS gene that resulted in incoφoration of the pLOlppsS DNA into the genome. The presence of the sacB gene on the vector allowed for subsequent selection for the loss of vector DNA from the genome as expression of this gene in the presence of sucrose is lethal to E. coli and to R. sphaeroides under growth conditions of 5% and 15% sucrose, respectively. A portion of the double- crossover events that led to loss of the sacB gene contained the truncated ppsS allele. This method of gene knockout is useful because no residual antibiotic resistance gene is left in the genome.
A three-step PCR process was used to create a 300 bp in-frame deletion in the ppsS gene. The ppsS gene from R. sphaeroides strain 35053 was amplified by PCR using primers designed to introduce a Sail restriction site at the beginning of the amplified fragment and a Sph I restriction site at the end of the amplified fragment. The sequences of the primers were as follows, with the restriction sites underlined:
RsppsSFSall 5'- AATTGTCGACTCGCGCACGCTGTTCCTC-3 ' (SEQ ID NO: 1); and RsppsSRsphl 5'- AATTGCATGCGCAGGCGGTGCAGGATGTA -3' (SEQ ID NO:2). The PCR reaction mix contained 0.2 μM each primer, IX Expand reaction buffer, 2.5 μl DMSO, 0.2 mM each dNTP, IX Expand/Pfu polymerase mix, and 1 ng of genomic DNA per 50 μL of reaction mix. PCR was conducted in a Perkin Elmer Geneamp 2400 programmed for an initial denaturation at 94°C for 3 minutes followed by 32 cycles of denaturation for 30 sec at 94°C, annealing for 1 min at 58°C, and extension for 2 min at 72°C, with a final extension at 72°C for 7 minutes. A 1.6 Kb reaction product was obtained by electrophoresis of a portion of the mixture (200 μl) through an 0.8% agarose gel in IX TAE buffer followed by gel-purification.
The second round of PCR consisted of two separate reactions: reaction A, using primers RsppsSFSall (SEQ ID NO: 1) and RsppsSRl (SEQ ID NO:4, see below), and reaction B, using primers R.sppsSRsphl (SEQ ID NO:2) and RsppsSFl (SEQ ID NO:3, see below).
RsppsSFl 5 '- CCCTCGCCGAGCTCTACATCGACGCCATAATGATTTCCCT - 3 ' (SEQ ID NO:3); and RsppsSRl 5'- AGGGAAATCATTATGGCGTCGATGTAGAGCTCGGCGAGGG- 3' (SEQ ID NO:4).
The 20 nucleotides on the 3' ends of each primer of this pair are located near the center of the ppsS gene, 300 bases apart from each other, and facing towards the start (RsppsSRl) and end (RsppsSFl) of the gene. The 20 nucleotides on the 5' end of each primer of this pair are the reverse complement of the 3 ' end of the other primer in the pair. PCR of the two separate reactions was conducted as above, except that 0.05 ng of first round product per μL of reaction mix was used as template. Also, an initial denaturation for 3 min at 94°C was conducted followed by eight cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 47°C, and extension for 1 min 15 sec at 72°C, then eight cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 58°C, and extension for 1 min 15 sec at 72°C; 16 cycles of denaturation for 30 sec at 94°C, annealing for 45 sec at 63°C, and extension for lmin 15 sec at 72°C; and a final extension for 7 min at 72°C. Both PCR products (approximately 770 and 750 bp in length), were separated on a 0.8% agarose gel in IX TAE buffer, excised, and gel purified. The third round of PCR utilized the same primers and reaction mixture as the first round of PCR, except that a mixture of 10 ng of each second round fragment was used as template rather than genomic DNA (200 μL reaction). The PCR program used was also the same as that used in the first round of PCR, with the annealing time lengthened to 2 minutes. The 1.3 Kb third-round product was separated on a 0.8% agarose gel in IX TAE buffer and purified. The 1.3 Kb PCR product (3 μg) was digested with Sph I and Sal I and purified using a QIAquick PCR Purification Kit.
Vector pLOl was prepared by digesting 3 μg of the vector with Sph I and Sal I, which were inactivated by heating to 65°C for 20 minutes, and dephosphorylating using shrimp alkaline phosphatase (Roche). The dephosphorylated vector was gel purified on a 1% TAE-agarose gel. Sphl and Sail digested vector DNA (66 ng) was ligated with 80 ng of the digested third-round PCR product at room temperature for 5 min using Rapid DNA ligase system (Roche). A portion of the ligation mixture (1 μl) was elecfroporated into 40 μL of E. coli ElectroMAX DH5 electrocompetent cells (Life Technologies). Elecfroporated cells were plated on LB media containing 50 μg/ mL kanamycin (LBK50). individual colonies were picked and patched to fresh LBK5o plates and simultaneously resuspended in 25 μl distilled water (D/W) and heated at 95 °C for 10 min to lyse the cells and release the DNA. Colonies with insert were identified using a PCR screen that was identical to the first round of PCR described earlier.
Donor E. coli colonies for conjugation were prepared by electroporating 1 μl of plasmid DNA into electrocompetent S17-1 cells. Elecfroporated cells were plated on LB media containing 25 μg/ mL of kanamycin, 25 μg/ mL of streptomycin, and 25 μg/ L of spectinomycin (LBKSMST). Strain S17-1 is resistant to SMST. Single colonies were used to start cultures for plasmid DNA isolation and use in conjugation. These colonies also were plated on LB media containing 5% sucrose and 25 μg/mL of kanamycin to ensure that the sacB gene was still functional. Only colonies that showed lethality on the sucrose media were used in conjugation. The presence of the correct insert size was confirmed using a PCR screen that was identical to the first round of PCR described above.
Growing cultures of R. sphaeroides ATCC strain 35053 were sub-cultured, using 1/5 and 1/10 volumes of inoculum, in 5 mL Sistrom's media supplemented with 20% LB and were grown at 30°C for 12 hours. The S17-1 donor colonies were grown in LBKSMST media at 37°C for 12 hours. An aliquot of each culture (1.5 - 3.0 mL) was pelleted and the pellets were washed four times with LB media. Relative pellet size was estimated and approximately 2 volumes of ATCC strain 35053 cells were used to 1 volume of SI 7-1 cells. The cell mixture was pelleted, resuspended in 20 μL of LB media, spotted on an LB plate, and incubated at 30°C for 7 to 15 hours. The cells then were scraped off the surface of the plate, resuspended in 1.5 mL of Sistrom's salts, and 200 μL of resuspended cells were plated on each of seven plates of Sistrom's with 25 μg/mL kanamycin (SISK 5) media. Colonies that grew on the plates after approximately 10 days, representing proposed single-crossover events, were streaked to new plates of the same media. Upon growth, single colonies were streaked on LB with 25 μg/mL kanamycin (LBK25) media. Purified colonies were patched to Sistrom's media supplemented with IX LB, 15% sucrose, 0.04% DMSO (v/v), and 25 μg/mL kanamycin (SisLBK15%SucDMSO). These were grown in an anaerobic chamber (Becton Dickinson, Sparks, MD) at 30°C for 5 days to check for lethality of the sacB gene in the proposed single-crossover events. Colonies were purified from these cultures and were tested by PCR to show that they contained the truncated ppsS allele. Potential double crossovers also were streaked on LBK25 plates to confirm sensitivity to kanamycin. Rhodobacter sphaeroides shake flask protocol: Five mL cultures of R. sphaeroides ATCC 35053 with various inserted genes or knockouts were grown in 13 mL culture tubes containing Sistrom's media with 4 g/L glucose (Sistrom, 1962. J. Gen. Microb. 28:607-616) and 1% yeast extract (Sigma Chemical Co., St. Louis, MO). The cultures were incubated for 48 to 72 hours at 30°C with 250 φm shaking in a New Brunswick Innova shaker. A 1.6 mL aliquot of culture was removed from the culture tube and added to 150 mL of Tris urea medium in a 500 mL baffled shake flask. Tris urea medium is a modification of Sistrom's medium in which the ammonium sulfate has been removed and 50 mM Tris HC1, 1.6 g/L urea, and 10 g/L glucose have been added. The flask was then incubated for 72 to 84 hours at 30°C with various shaking speeds in a New Brunswick Innova shaker. The entire contents of the flask were removed at the end of the incubation period for CoQ(10) or carotenoid analysis. Rhodobacter capsulatus shake flask protocol: Five mL cultures of R. capsulatus SB 1003 with various inserted genes or knockouts were grown in 13 L culture tubes containing PY broth (0.3% peptone, 0.3% yeast extract, 1 rnM MgSO4 and 1 mM CaCl2). The cultures were incubated for 48 to 72 hours at 30°C with 250 rpm shaking in a New Brunswick Innova shaker. A 1.6 mL aliquot of culture was removed from the culture and added to 150 mL of RCV 2/3PY media (Young et al, 1989 Mol. Gen. Genet. 218:1-12) in a 500 mL baffled shake flask. The flask was then incubated for 72 to 84 hours at 30°C with various shaking speeds in a New Brunswick Innova shaker. The entire contents of the flask were removed at the end of the incubation period for CoQ(10) or carotenoid analysis.
Analysis of spheroidenone fromR. sphaeroides: Samples with a volume of 20 mL were harvested by centrifugation at 3500 rpm for 10 min. The sample was washed once in 20 mL of distilled water and resuspended in an equal volume of distilled water. A 10 mL sample was centrifuged in a separate tube at 3500 rpm for 10 min., resuspended in approximately one mL of distilled water, and poured into a tared pan for dry cell weight analysis. The sample was dried for 24 hours at 100°C and the dry cell weight (DCW) / mL of culture was calculated. For extraction, a volume of 0.75 mL to 1.5 mL of culture was added to a 1.8 mL-microfuge tube and centrifuged at 10,000 φm for 3 min in an IEC MicroMax microfuge. The supernatant was discarded and the pellet was completely resuspended in 1.0 mL of acetone: methanol (7:2) and stored at room temperature in the dark for 30 min. The sample was mixed once during this incubation. After incubation, the sample was centrifuged at 10,000 rpm for 3 min. and the extract (supernatant) was collected. Samples were stored at -20°C if analysis was not performed immediately. Carotenoid extracts were analyzed on a spectrophotometer, scanning in the range of 350 nm to 800 mm, and OD 48o was recorded. The amount of carotenoid (spheroidenone) in mg / 100 mL of culture was calculated using the following equation: spheroidenone (mg) / 100 mL culture - ((OD480 - (0.0816 * OD 770)) * 0.484) / vol of culture sample used in extraction From mg of spheroidenone /100 mL of culture, the amount of spheroidenone /mg of DCW was calculated using the DCW number as the conversion factor. Care was talcen to correct for any dilution factors required during spectrophotometric analysis of the samples.
CoQ(lO Analysis: 130 mL of culture media containing cells was removed and placed in a tared 250 mL centrifuge bottle. The samples were centrifuged at 15,000 X G for 5 mins, the supernatant was poured off, and the samples were resuspended in 50 mL cold water. The samples were centrifuged again at 15,000 X G for 5 mins, and the supernatant was poured off. The wet weight of the biomass was determined, and the biomass was resuspended in 1.5 times its weight in water. The samples were stored covered with foil at -80°C before analysis. Before analysis, the samples were warmed at 21°C for 15 min then 1.0 mL was withdrawn and sodium dodecyl sulfate was added to a final concentration of 5 %. The samples were first extracted with 4 mL of ethanol and vortexed for 30 minutes and then were extracted with 10 mL of hexane and vortexed for an additional 30 minutes. After centrifuging the samples at 3500 φm for 5 min., 2.5 mL of the hexane layer was evaporated to dryness and the residue dissolved in 100 μL of hexane. An additional 2.4 mL of ethanol was added to a final volume of 2.5 mL. The samples then were analyzed on a Waters Nova-Pak C18 (3.9 x 150 mm: 4 Um) column with a PDA detector set from 200-300 nm. Resolution was at 1.2 nm, with a maximum absorbance at 275 nm. The run time was 10 min and the injection volume was 20 μL. CoQ(10) standards were obtained from Sigma Chemical (C-9538).
The dry weight of the samples were determined by taking an aliquot and drying at 105°C in an aluminum weighing pan for at least four hours.
Overexpression of the fnrL gene inR. sphaeroides: The R. sphaeroides fnrL gene was overexpressed in R. sphaeroides using the native promoter for the fnrL gene in the vector pRK415. The fnrL gene also was overexpressed in R. sphaeroides using the broad-host-range vector pBBRlMCS2 (Kovach et al, 1995 Gene 166:175-6), into which either a tet promoter or R. sphaeroides rrnB promoter had been inserted.
Making electrocompetent cells of R. sphaeroides: Five mL cultures of various R. sphaeroides strains were grown overnight at 30°C in Sistrom's media supplemented with 20%LB. Cultures were diluted 1/100 in 300 mL of the same media and grown to an OD66o of 0.5-0.8. Cells were chilled on ice for 10 minutes and then centrifuged for 6 minutes at 7,500 g. The supernatant was discarded and the cell pellet was resuspended in ice-cold 10% glycerol at half of the original volume. The cells were pelleted by centrifugation for 6 minutes at 7,500 g and the supernatant again was discarded. Cells were resuspended in ice cold 10% glycerol at one quarter of the original volume. The last centrifugation and resuspension steps were repeated, followed by centrifugation for 6 minutes at 7,500 g. The supernatant was decanted and the cells resuspended in the small volume of glycerol that did not drain out. Additional ice-cold 10% glycerol was added to resuspend the cells if necessary. Forty μL of the resuspended cells was used in a test electroporation (see below) to determine if the cells needed to be concentrated by centrifugation or diluted with 10% ice-cold glycerol. Time constants of 8.5-10.0 resulted in good transformation efficiencies. Once an acceptable time constant was achieved, cells were aliquoted into cold microfuge tubes and stored at -80°C. All water used for media and glycerol was 18 Mohm or higher.
Electroporation into R. sphaeroides: R. sphaeroides ATCC 2.4.1 strain carrying the ρUI1970 plasmid (Zeilstra-Ryalls et al. 1997 J. Bacteriol. 179:7264-7273.) was obtained from Samuel Kaplan at the University of Texas, Houston. The pUI1970 plasmid contains the R. sphaeroides fnrL gene and its promoter in vector pRK415. Plasmid DNA was isolated from these strains using a QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). pRK415 or pUI1970 plasmid DNA (100-150 ng) was gently mixed with 40 μL of R. sphaeroides BSl (ATCC 35053/ΔcrtEΔppsRΔccoN) electrocompetent cells. The cell mixture then was transferred to an electroporation cuvette with a 0.2 cM electrode gap. Electroporations were conducted using a Biorad Gene Pulser II (Biorad, Hercules, CA) with settings at 2.5 kV of energy, 400 ohms of resistance, and 25 μF of capacitance. Cells were recovered in 400 μL SOC media at 30°C for 10-16 hours. The cells were then plated, 200 μL per plate, on selective media. Individual colonies were tested for presence of an insert of the expected size using PCR. Colonies were resuspended in approximately 25 μL of 10 mM Tris buffer using a pipette tip and 2 μL of the resuspension was streaked onto LB media containing 0.8 μg tetracycline. The remaining resuspension was heated for 10 minutes at 95°C to break open the bacterial cells and two μL of the heated cells was used in a 25 μL PCR reaction using particular sets of primers.
To check for the presence of the^nrZ gene, the following primers were used: FnrLF (5'- TCAAGAATTCGAAGGAAGAGCATGACGCTGCACGAAGTCCCA- 3' (SEQ ID NO:5); and
FnrLR (5'-ATCATCTATGTTGAAGCTTGCTGCCTCTGCCCGCCTCGC - 3' (SEQ ID NO:6)). The PCR mix contained the following: IX Taq PCR buffer, 0.2 μM each primer,
0.2 mM each dNTP, 5% DMSO (v/v), and 1 unit of Taq DNA polymerase (Roche) per reaction. The PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 30 cycles of denaturation for 30 seconds at 94°C and annealing and extension for 2.5 min at 72°C; and a final extension for 7 minutes at 72°C. Colonies containing pUI1970 plasmid resulted in a heavy PCR product approximately 900 bp in size, whereas colonies that contained vector without the fnrL gene showed a faint band due to amplification from the genomic copy of the fnrL gene.
Cultures of R. sphaeroides strain BSl carrying pUI1970 were grown in culture tubes containing 5 mL of Sistrom's media with 4 g/L glucose, 20% LB, and 0.8 μg/mL of tetracycline. The cultures were incubated for 48 hours at 30°C with 250 rpm shaking. Three milliliters of these cultures was then used to inoculate 40 mL of Tris urea media containing 0.8 μg/mL of tetracycline in a 250 mL baffled flask. After one day of growth at 30°C with 250 rpm shaking, 6.25 mL of culture was used to inoculate each of three 500 L baffled shake flasks containing 125 mL of Tris urea medium. This media was fortified with an additional 7mg/L of FeSO4. The flask was then incubated for 84 hours at 30°C with 70 φm shaking in a New Brunswick Innova shaker. The entire contents of the flask were removed at the end of the incubation period for CoQIO analysis. All cultures were grown in the dark due to the light sensitivity of tetracycline. Construction of the pMCS2tetP vector: The pMCS2tetP vector was constructed by cloning the promoter for the tetA tetracycline resistance gene from transposon Tnl721 (Waters et. al., 1983 Nucleic Acids Res. 11(17):6089-6105) into the pBBRlMCS2 vector. The pBBRlMCS2 vector is mobilizable and relatively small (5,144 bp), replicates in R. sphaeroides, has a multiple cloning site with lacZa color selection, and contains a kanamycin resistance gene. The tet-4 gene promoter (tetP) was amplified using plasmid pRK415 as template and primers designed to introduce an Xba I restriction site at the beginning of the amplified fragment and aBamHl site at the end of the amplified fragment.
(TETXBAF 5'- TTATCTAGAACCGTCTACGCCGACCTCGTTCAAC - 3' (SEQ ID NO:7); and TETBAMR, 5 '- TTAGGATCCCCTCCGCTGGTCCGATTGAAC - 3 ' (SEQ ID NO: 8)). The PCR mix contained the following: IX Native Plus Pfu buffer, 20 ng pRK415 plasmid DNA, 0.5 μM of each primer, 0.2 mM of each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase in a final volume of 200 μL. The PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 1 minute; 8 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 45 seconds; 24 cycles of denaturation at 94°C for 30 seconds, annealing at 66°C for 45 seconds, and extension at 72°C for 45 seconds; and a final extension for 7 minutes at 72°C. The amplification product was then separated by gel electrophoresis using a 2 % TAE-agarose gel. A 160 bp fragment was excised from the gel and purified. The purified fragment was digested simultaneously with Xba I and BamH I restriction enzymes and purified with a QIAquick PCR Purification Kit. Three μg of pBBRlMCS2 plasmid DNA was digested with BamH I and Xba I and the reaction was terminated by heating at 80°C for 20 minutes. The digested vector then was dephosphorylated with shrimp alkaline phosphatase and gel purified on a 1% TAE-agarose gel.
Prepared pBBRlMCS2 vector (100 ng) was ligated with digested tetP PCR product (36 ng) using T4 DNA ligase at 16°C for 16 hours. E. coli Electromax™ DH5α™ cells (40 μl) were elecfroporated with 1 μL of ligation reaction. Elecfroporated cells were plated on LB media containing 25 μg/mL of kanamycin and 50 μg/mL of Xgal (LBKX). Individual, white colonies were resuspended in approximately 25 μL of 10 mM Tris with 2 μL plated on LBKX. The remaining portion of the resuspended colony was heated for 10 minutes at 95°C to lyse the bacterial cells. Two μL of the lysed cells were used in a 25 μL PCR reaction using the following primers homologous to the vector and flanking the cloning site: MCS2FS: 5'- AGGCGATTAAGTTGGGTAAC -3' (SEQ ID NO:9); and MCS2RS: 5'- GACCATGATTACGCCAAG -3' (SEQ ID NO:10). The PCR mix contained the following: IX Taq PCR buffer, 0.5 μM each primer, 0.2 mM each dNTP, and 1 unit of Taq DNA polymerase per reaction. The PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 32 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 1 minute; and a final extension for 7 minutes at 72°C. All colonies showed a single insertion event. Plasmid DNA was isolated from cultures of two individual colonies and sequenced to confirm the DNA sequence of the tet promoter in the construct.
Construction of the pMCS2rrnBP vector: The pMCS2rrnBP vector was constructed by inserting a copy of the R. sphaeroides rrnB promoter (rrnBP) into the vector pBBRlMCS2. The rrnB promoter was isolated from the vector pTEX24 (S. Kaplan) by digesting with BamH to release the promoter as a 363 bp fragment. This fragment was gel purified from a 2% TAE agarose gel. The pBBRlMCS2 vector also was digested with BamH I and the enzyme heat inactivated at 80°C for 20 minutes. The digested vector was then dephosphorylated with shrimp alkaline phosphatase (Roche
Molecular Biochemicals, Indianapolis, IN), and gel purified from a 1% TAE-agarose gel. The prepared vector and the rrnBP fragment were ligated using T4 DNA ligase at 16°C for 16 hours. E. coli Electromax DH10B cells (Life Technologies, Inc., Rockville, MD) were elecfroporated (1 μl of the ligation reaction to 40 μl of cells) and plated on LB media containing 25 μg/mL of kanamycin (LBK25). Plasmid DNA was isolated from cultures of single colonies and was digested with Hind III to confirm the presence of a single insertion of the rrnB promoter. The sequence of the rrnBP inserts for these colonies also was confirmed by DNA sequencing.
Cloning of the R. sphaeroides fnrL gene in pMCS2tetP: The R. sphaeroides fnrL gene was amplified by PCR using primers homologous to sequence upstream and downstream of the gene. These primers, FNRLF and FNRLR (SEQ ID NO: 5 and SEQ ID NO:6), were designed to introduce an EcoR I restriction site and a ribosomal binding site at the beginning of the amplified fragment and a Hind III site at the end of the amplified fragment. The PCR mix contained the following: IX Native Plus Pfu buffer, 200 ng R. sphaeroides genomic DNA, 0.5 μM of each primer, 0.2 mM each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase (Stratagene, La Jolla, CA) in a final volume of 200 μL. The PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 2 minutes; 8 cycles of 94°C for 30 seconds, 62°C for 1 minute, and 72°C for 2 minutes; 22 cycles of 94°C for 30 seconds, 66°C for 1 minute, and 72°C for 2 minutes; and a final extension for 7 minutes at 72°C. The amplification product then was separated by gel electrophoresis using a 1% TAE-agarose gel. A fragment approximately 0.84 Kb in size was excised from the gel and purified. The purified fragment was digested with EcoR I restriction enzyme, purified with a QIAquick PCR Purification Kit, digested with Hind III restriction enzyme, purified again with a QIAquick PCR Purification Kit, and quantified on a minigel.
Three μg of the pMCS2tefP vector was digested with EcoR I, gel purified on a 1% TAE-agarose gel, digested with Hind HI, purified with a QIAquick PCR Purification Kit, dephosphorylated with shrimp alkaline phosphatase, and purified again with a QIAquick PCR Purification Kit. The digested PCR product containing the R. sphaeroides fnrL gene (70 ng) and the prepared pMCS2tetP vector (75 ng) were ligated using T4 DNA ligase at 16°C for 16 hours. E. coli Electromax™ DH10B™ cells were elecfroporated (1 μL of the ligation reaction per 40 μL of cells). Individual colonies were tested for presence of an insert of the expected size using PCR. Individual colonies were resuspended in approximately 25 μL of 10 mM Tris and 2 μL of the resuspension was plated on LBK media. The remnant resuspension was heated for 10 minutes at 95 °C to brealc open the bacterial cells and 2 μL of the heated cells used in a 25 μL PCR reaction using the TETXBAF and FNRLR primers. The PCR mix contained the following: IX Taq PCR buffer, 0.5 μM each primer, 0.2 mM each dNTP, 5% DMSO (v/v), and 1 unit of Taq DNA polymerase (Roche) per reaction. The PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 2 minutes; 8 cycles of 94°C for 30 seconds, 62°C for 1 minute, and 72°C for 2 minutes; 22 cycles of 94°C for 30 seconds, 66°C for 1 minute, and 72°C for 2 minutes; and a final extension for 7 minutes at 72°C. The sequence of the fnrL insert was confirmed by DNA sequencing of plasmid DNA of a colony with the desired insert size. Purified plasmid DNA having the correct sequence was then elecfroporated into electrocompetent cells of R. sphaeroides strains 35053 and 2A.\t ιrL (Methods listed above). The transformed 35053 strains were plated on LBK plates. Individual colonies were screened for the desired insert size as described above. The strain designated 2.4.1Δ//.rZ/MCS2tetP/Rs/ r--. was plated on SisLB plates containing 0.5% DMSO and placed in an anaerobic chamber. The growth of the strain under these conditions was used to confirm the proper functioning of the expression vector.
Cloning of the R. sphaeroides fnrL gene in pMCS2rrnBP: The R. sphaeroides fnrL gene was amplified by PCR using the primers FNRLCLAF and FNRLKPNR. These primers were designed to introduce a Cla I restriction site and a ribosomal binding site at the beginning of the amplified fragment and aKpn I site at the end of the amplified fragment.
FNRLCLAF: 5'- TCAAATCGATGAAGGAAGGGCATGACGCTGCACGAAGTCC -3* (SEQ ID NO: 11); and
FNRLKPNR: 5'- TCGGAAGTACGGTACCTGATGGCGCACTGACGGAAGAAG -3' (SEQ ID NO: 12). The PCR mix contained the following: IX Native Plus Pfu buffer, 200 ng R. sphaeroides genomic DNA, 0.5 μM of each primer, 0.2 mM each dNTP, 5% DMSO (v/v) and 10 units of native Pfu DNA polymerase (Stratagene, La Jolla, CA) in a final volume of 200 μL. The PCR reaction was performed in a Perkin Elmer Geneamp PCR System 2400 under the following conditions: an initial denaturation at 94°C for 3 minutes; 30 cycles of 94°C for 30 seconds, 58°C for 1 minute, and 72°C for 1.5 minutes; and a final extension for 7 minutes at 72°C. The amplification product was then separated by gel electrophoresis using a 1% TAE-agarose gel. A fragment approximately 0.87 Kb in size was excised from the gel and purified. The purified fragment was digested with Kpn I restriction enzyme, purified with a QIAquick PCR Purification Kit, digested with Cla I restriction enzyme, purified again with a QIAquick PCR Purification Kit, and quantified on a SmartSpec3000.
Three μg of the pMCS2rrnBP vector was digested with the restriction enzyme Cla I, gel purified on a 1% TAE-agarose gel, digested with Kpn I, purified with a QIAquick PCR Purification Kit, dephosphorylated with shrimp alkaline phosphatase, and purified again with a QIAquick PCR Purification Kit. The digested PCR product (45 ng) containing the R. sphaeroides fnrL gene, described above, and 100 ng of the prepared pMCS2rrnBP vector was ligated using T4 DNA ligase at room temperature for 5 minutes (Roche Rapid Ligation Kit). The ligation reaction was purified with a High-Pure PCR clean kit (Roche). Ten μL of the ligation reaction was used to electroporate 40 μL of E. coli Εlectromax™ DH10B™ cells. Individual colonies were tested for presence of an insert of the expected size using PCR. Colonies were resuspended in approximately 20 μl of sterile distilled water using a pipette tip; the residual cells were streaked on LBK25 media. The resuspended cells were heated for 10 minutes at 95 °C to lyse the bacterial cells and 5 μL of the lysed cells were used in a 25 μl PCR reaction using the original PCR primers (above). The PCR mix contained the following: IX Taq PCR buffer, 0.2 μM each primer, 0.2 mM each dNTP, 5% DMSO (v/v), and 1 unit of Taq DNA polymerase (Roche) per reaction. The PCR reaction was performed in a MJ Research PTC 100 under the following conditions: an initial denaturation at 94°C for 3 minutes; 30 cycles of 94°C for 30 seconds, 58°C for 1 minute, and 72°C for 1.5 minutes; and a final extension for 7 minutes at 72°C. The sequence of the fnrL insert was confirmed by DNA sequencing of plasmid DNA of colonies with the desired insert size.
Purified plasmid DNA having the correct sequence was then elecfroporated into electrocompetent cells of R. sphaeroides strains 35053 and 2A.l/SfnrL. The transformed 35053 strains were plated on LBK25 media. Individual colonies were screened for the desired insert size as described above. The 2.4.1Δ rE/pMCS2rrnBP/Rs wrE strain was plated on SisLB plates containing 0.5% DMSO and placed in an anaerobic chamber. The growth of the strain under these conditions was used to confirm the proper functioning of the expression vector.
Example 1. Effect of the ppsS gene on the production of CoQ and carotenoids in R. sphaeroides
R. sphaeroides ATCC 35053, ATCC 35053/ΔcrtE, ATCC 35053/ AppsS, and ATCC 35053/ AcrtEAppsS were grown in 150 mL of Tris urea media in shake flasks at 30°C with 80 rpm shaking. At the end of a three-day incubation period, the cells were harvested and analyzed for CoQ(10) and carotenoids as described above. The results are provided in Table 1. TABLE 1
R. sphaeroides ATCC 35053 strain with inactivated crtE and ppsS genes showed a 30% - 43.7% increase in CoQlO. hi a wild-type (35053) background, the ppsS gene knock-out resulted in an increase in carotenoid (14% - 15.84%) and a 5.8% - 6.8% increase in CoQlO. Each value listed here is an average of three shake flask experimental points. These results demonstrated that the inactivation of ppsS increased the production of CoQlO as well as carotenoids in R. sphaeroides ATCC 35053.
Example 2. Effect of the aerR R ne on the production of CoQ(lO and carotenoids inR. capsulatus R. capsulatus strain SB 1003 (rifampicin resistant) and R. capsulatus SB 1003 with various gene knockouts (obtained from Carl Bauer, Indiana University) were grown in 150 mL of PYS RCV2/3PY media in triplicate in 500 mL shake flasks with 80 φ shaking. At the end of a three-day incubation period at 30°C, the cells were harvested and assayed for CoQlO production. The results are presented in Table 2 and show that strains with inactivated ppsR and ppsR and αerR together increase both CoQ(10) and carotenoid production. TABLE 2
Example 3. Effect of the fnrL gene with its native promoter on CoQ(lO production in Rhodobacter sphaeroides R. sphaeroides ATCC 35053/AcrtEAppsRAccoN containing the plasmid pRK415 (Keen et al, 1988 Gene 70:191-197.) and R. sphaeroides ATCC
35053 /AcrtEAppsRAccoN containing the plasmid pRK415 with the R. sphaeroides fnrL gene (Zeilstra-Ryalls and Kaplan, 1995 J. Bacteriol. 177: 6422-6431) were grown in 150 mL of Tris urea media with 25 μg/mL kanamycin in triplicate in 500 mL shake flasks at 30°C with 80 rpm shaking. At the end of a three-day incubation period, the cells were harvested and analyzed for CoQ(10). The results are shown in Table 3 and demonstrate that additional copies of the fnrL gene improve CoQ(10) production over a strain without the additional copies.
TABLE 3
Example 4. Effect of fnrL gene on CoQClO) production in R. sphaeroides under semi-aerobic conditions R. sphaeroides ATCC 35053 containing the plasmid pMCS2 with either the rrnB promoter or the tet promoter in front of the fnrL gene from R. sphaeroides ATCC 35053 were grown as described in Example 3, except 100 mL of culture was used in a 1 L flask. At the end of a three-day incubation period, the cells were harvested and analyzed for CoQ(lO). The results are shown in Table 4.
TABLE 4
Example 5. Effect of fnrL gene on coenzyme Ql 0 production in R. sphaeroides under aerobic conditions R. sphaeroides ATCC 35053 containing the plasmid pMCS2 with either the rrnB promoter or the tet promoter operably linked to the fnrL gene from R. sphaeroides ATCC 35053 were grown as described in Example 3. The cells were shaken at 200 φm in a New Brunswick Innova shaker. At the end of the three-day incubation period, the cells were harvested and analyzed for CoQ(10). The results were as follows:
TABLE 5
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:
1. Membranous bacteria comprising a genomic disruption of at least a portion of appsR sequence and at least a portion of an αerR sequence, wherein said genomic disruption renders said ppsR sequence and said αerR sequence non-functional, and wherein said membranous bacteria produce an elevated amount of coenzyme Q 10 (CoQ(lO)) compared with corresponding membranous bacteria lacking said genomic disruption and grown under similar culture conditions.
2. The membranous bacteria of claim 1 , wherein said membranous bacteria are puφle non-sulfur photosynthetic bacteria.
3. The membranous bacteria of claim 1, wherein said membranous bacteria are a species of Rhodobacter.
4. The membranous bacteria of claim 3, wherein said species of Rhodobacter is Rhodobacter sphaeroides or Rhodobacter capsulatus.
5. Membranous bacteria comprising an exogenous nucleic acid encoding a fumarate nitrate reduction (Fnr) polypeptide, wherein said membranous bacteria produce an elevated amount of CoQlO compared with corresponding membranous bacteria lacking said exogenous nucleic acid and grown under similar culture conditions.
6. The membranous bacteria of claim 5, wherein said Fnr polypeptide is a Rhodobacter sphaeroides FnrL polypeptide.
7. The membranous bacteria of claim 5, wherein said Fnr polypeptide is a R. capsulatus Fnr polypeptide.
8. The membranous bacteria of claim 5, wherein said membranous bacteria are puφle non-sulfur photosynthetic bacteria.
9. The membranous bacteria of claim 5, wherein said membranous bacteria are a species of Rhodobacter.
10. The membranous bacteria of claim 9, wherein said species of Rhodobacter is Rhodobacter sphaeroides or Rhodobacter capsulatus.
11. The membranous bacteria of claim 5, said membranous bacteria further comprising a genomic disruption of at least a portion of a crtE sequence, at least a portion of a ppsR sequence, and at least a portion of a ccoN sequence, wherein said genomic disruption renders said crtE sequence, saidppsR sequence, and said ccoN sequence nonfunctional, wherein said membranous bacteria produce an elevated amount of CoQlO compared with corresponding membranous bacteria lacking said exogenous nucleic acid and said genomic disruption, and grown under similar culture conditions.
12. A method of making a nutraceutical, said method comprising extracting CoQ(10) from membranous bacteria, said membranous bacteria comprising an exogenous nucleic acid encoding a Fnr polypeptide, wherein said membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking said exogenous nucleic acid and grown under similar culture conditions.
13. The method of claim 12, said membranous bacteria further comprising a genomic disruption of at least a portion of a crtE sequence, at least a portion of appsR sequence, and at least a portion of a ccoN sequence, wherein said genomic disruption renders said crtE sequence, saidppsR sequence, and said ccoN sequence non-functional, wherein said membranous bacteria produce an elevated amount of CoQ(10) compared with corresponding membranous bacteria lacking said exogenous nucleic acid and said genomic disruption and grown under similar culture conditions.
14. A method of making a nutraceutical, said method comprising extracting
CoQ(10) from membranous bacteria, said membranous bacteria comprising a genomic disruption of at least a portion of appsR sequence and at least a portion of an αerR sequence, wherein said genomic disruption renders saidppsR sequence and said αerR sequence non-functional, and wherein said membranous bacteria produce an elevated amount of CoQ(lO) compared with corresponding membranous bacteria lacking said genomic disruption and grown under similar culture conditions.
EP03812045A 2002-11-25 2003-11-25 Production of ubiquinones Withdrawn EP1572117A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US42885502P 2002-11-25 2002-11-25
US428855P 2002-11-25
PCT/US2003/037824 WO2004047763A2 (en) 2002-11-25 2003-11-25 Production of ubiquinones

Publications (3)

Publication Number Publication Date
EP1572117A3 EP1572117A3 (en) 2005-08-18
EP1572117A2 true EP1572117A2 (en) 2005-09-14
EP1572117A4 EP1572117A4 (en) 2006-07-19

Family

ID=32393466

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03812045A Withdrawn EP1572117A4 (en) 2002-11-25 2003-11-25 Production of ubiquinones

Country Status (4)

Country Link
EP (1) EP1572117A4 (en)
JP (1) JP2006507009A (en)
AU (1) AU2003297563A1 (en)
WO (1) WO2004047763A2 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2371967B1 (en) 2005-03-18 2015-06-03 DSM IP Assets B.V. Production of carotenoids in oleaginous yeast and fungi
US8166166B2 (en) * 2005-12-15 2012-04-24 International Business Machines Corporation Apparatus system and method for distributing configuration parameter
US8691555B2 (en) 2006-09-28 2014-04-08 Dsm Ip Assests B.V. Production of carotenoids in oleaginous yeast and fungi
KR20080047144A (en) * 2006-11-24 2008-05-28 에스케이에너지 주식회사 Rhodobacter sphaeroides SB2H2 strain having high coenzyme Q10 content and method for producing coenzyme Q10 using the same
WO2008100782A2 (en) * 2007-02-12 2008-08-21 Cargill, Incorporated Process for the preparation of coenzyme qlo by culturing rhodobacter sphaeroides in a defined medium
CN112760275B (en) * 2019-10-21 2023-06-06 华东理工大学 Recombinant bacterium for producing porphyrin compound and method for producing porphyrin compound
CN116555314A (en) * 2023-05-29 2023-08-08 华东理工大学 Establishment and application of Rhodobacter sphaeroides strain with high production of coenzyme Q10

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60132498T2 (en) * 2000-09-29 2009-01-15 Cargill, Inc., Wayzata ISOPRENOIDPRODUKTION

Also Published As

Publication number Publication date
EP1572117A4 (en) 2006-07-19
WO2004047763A3 (en) 2005-08-18
WO2004047763A2 (en) 2004-06-10
AU2003297563A1 (en) 2004-06-18
JP2006507009A (en) 2006-03-02
AU2003297563A8 (en) 2004-06-18

Similar Documents

Publication Publication Date Title
AU2001296359B2 (en) Isoprenoid production
Ye et al. Construction of the astaxanthin biosynthetic pathway in a methanotrophic bacterium Methylomonas sp. strain 16a
AU2001296359A2 (en) Isoprenoid production
AU2001296359A1 (en) Isoprenoid production
CN101466834B (en) Method for producing carotenoid-synthetic microorganisms and method for producing carotenoids
US20050003474A1 (en) Carotenoid biosynthesis
KR20150036502A (en) Biorefinery system, methods and compositions thereof
EP1780281B1 (en) Method of producing astaxanthin or metabolic product thereof by using carotenoid ketolase and carotenoid hydroxylase genes
Ide et al. Enhanced production of astaxanthin in Paracoccus sp. strain N-81106 by using random mutagenesis and genetic engineering
Karava et al. Bacillus subtilis spore surface display of photodecarboxylase for the transformation of lipids to hydrocarbons
Tao et al. Expression of bacterial hemoglobin genes to improve astaxanthin production in a methanotrophic bacterium Methylomonas sp.
CA2436366A1 (en) Carotenoid biosynthesis
Ro et al. Recent advances in the genetic manipulation of Methylosinus trichosporium OB3b
US20030207947A1 (en) Production of lutein in microorganisms
WO2004047763A2 (en) Production of ubiquinones
WO2002041833A2 (en) Carotenoid biosynthesis
Schneider et al. Genomics-based insights into the biosynthesis and unusually high accumulation of free fatty acids by Streptomyces sp. NP10
Iniesta et al. Conversion of the lycopene monocyclase of Myxococcus xanthus into a bicyclase
JP2003525626A (en) Lutein production in microorganisms
CN108949788A (en) Lycopene synthesis related gene and its application
US20070065902A1 (en) Process for chromosomal expression of foreign genes in the fliC region of a methylotrophic microbial host cell
US20070065900A1 (en) Process for chromosomal expression of foreign genes in the cytochrome-C peroxidase (cytCP) region of a methylotrophic microbial host cell
JP5023474B2 (en) Method for producing carotenoid-synthesizing microorganism and method for producing carotenoid
BR112019012259A2 (en) methods to produce phytoene
HK1062580B (en) Isoprenoid production

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

17P Request for examination filed

Effective date: 20050624

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12N 1/20 A

RIC1 Information provided on ipc code assigned before grant

Ipc: C12P 7/66 19800101ALI20051117BHEP

Ipc: C12N 1/20 19800101AFI20051117BHEP

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20060616

17Q First examination report despatched

Effective date: 20070219

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080304