KR20080047144A - Rhodobacter sphaeroides sk2h2 strain having high content of coenzyme q10 and the method of producing coenzyme q10 using the same - Google Patents

Abstract

A novel Rhodobacter sphaeroides SK2H2 strain is provided to contain higher coenzyme Q10 than that of conventional strains. A method for producing the coenyzme Q10 using the same is provided to prepare the coenzyme Q10 economically by culturing the same strain. A Rhodobacter sphaeroides SK2H2 strain having high content of coenzyme Q10 is deposited as a deposition no. KCTC10915BP. A method for producing the coenzyme Q10 comprises the steps of: (a) culturing the Rhodobacter sphaeroides SK2H2 strain in a culture medium including 1.6% of bacto tryptone, 1% of an yeast extract, 0.5% of NaCl, 4% of molasses, and 2% of glycerol; and (b) isolating the coenzyme Q10 from a culture material obtained from the step(a). Further, the culture medium is maintained to pH 6.0-8.0 at 25-35°C.

Description

Rhodobacter sphaeroides SK2H2 strain having high content of Coenzyme Q10 and the method of producing coenzyme Q10 using the same}

The present invention relates to a Rhodobacter strain seupaeroyi Death and method for producing coenzyme Q10 using the same having a high content of coenzyme Q10, Rhodobacter seupaeroyi using genetic engineering and mutagen des (Rhodobacter sphaeroides, or less then the mutation represented by the R. sphaeroides) screening the increase in activity by the mutant strains obtained coenzyme Q10 new strain of the content of the significant increase in Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H2 and this strain under certain culture conditions Increased productivity of coenzyme Q10 by culturing It relates to a production method of coenzyme Q10.

Coenzyme Q10 (Coenzyme Q10, abbreviated as CoQ10) is called Ubiquinone 10, and the formula is 2,3-dimethoxy-dimethyl-6-decaprenyl-1,4-benzoquinone (2,3 -Dimethoxy-dimethyl-6-decaprenyl-1,4-benzoquinone) refers to a fat-soluble benzoquinone having an isoprenoid side chain composed of C-5 isoprenoid units as represented by the following formula (1).

[Formula 1]

Coenzyme Q10 is present in microorganisms, plants and animals, including the human body, and plays an important role in maintaining the health of life and protecting it from disease. Coenzyme Q10 is an essential coenzyme of the mitochondrial electron transport system and plays an important role in ATP biosynthesis and acts as a fat-soluble antioxidant that prevents the oxidation of DNA, lipids and proteins in cells. In addition, coenzyme Q10 has proven to be a promising compound for the prevention and treatment of heart disease and neurodegenerative diseases, and is expected to greatly increase the use of medicines and dietary supplements (Zahiri, HS et al., Metabolic engineering, 8, 406). -416, 2006)

The preparation method of coenzyme Q10 includes 1) extraction from natural products such as animal and plant tissues, 2) chemical synthesis, and 3) synthesis from microorganisms through fermentation.

However, extraction from natural products is very economical due to the very low content in natural products, and chemical synthesis methods are expensive due to the complex structure of coenzyme Q10. Therefore, the production method through fermentation is now the most economically commercial process. Fermentation may be achieved by 1) using microorganisms that naturally produce coenzyme Q10, 2) by using microorganisms that have the ability to synthesize coenzyme Q10 through genetic manipulation, or 3) naturally producing coenzyme Q10. There is a method of selecting and optimizing strains with increased activity by inducing mutations in the microorganisms and many studies have been conducted. Production method of coenzyme Q10 through fermentation of microorganisms published and the content of coenzyme Q10 (mgCoQ10 / gDCW, hereinafter mg / gDCW) and yield (mgCoQ10 / L, MG / L) Looking at the following).

Nagao in a way the first naturally using microorganisms to produce coenzyme Q10 (Nakao), etc. Spokane Lee audio bolus (Sporidiobolus) and Osu Forest Stadium (Oosporidium) by culturing in the microorganisms were to have a coenzyme Q10 content of 1.3 mg / gDCW (Nakao, Y. et al., USP 4,070,244 (1978)), Shimada et al., Torulopsis magnoliae ) strain was used to have a coenzyme Q10 content of 1.4 mg / gDCW (Shimada, Y. et al., USP 4,194,065 (1980)), and Kaneko et al. The microorganisms of the genus Rhodotorula were cultured to have a coenzyme Q10 content of 1.7 mg / gDCW (Kaneko, Y. et al., USP 4,367,289 (1983)). Later, Urakami et al. Conducted fermentation of many microorganisms in Rhodopseudomonas and Rhodobacter and measured the coenzyme Q10 content to find microorganisms with a maximum content of 3.8 mg / gDCW. Urakami T. et al., J. Ferment.Bioeng., 76, 191-194, 1993).

However, when optimizing using a wild type strain as described above, it is difficult to develop an economical process due to the low content of coenzyme Q10, which is difficult to industrialize. Therefore, foreign genes related to the synthesis of coenzyme Q10 are introduced to solve this problem. A study was conducted to increase the content and yield of coenzyme Q10.

Zhu et al. Found that coenzyme Q10 biosynthesis genes, including ubiA , were introduced into E. coli through plasmids, resulting in a three-fold improvement in coenzyme Q10 content over wild-type strains. The maximum content of coenzyme Q10 was also very low, such as 1 mg / gDCW (Zhu, X. et al., J. Fermentation & Bioengin., 79, 493-5, 1995).

Miyake et al. Of Kyowa hakko kogyo Co., Ltd., using the strain R. sphaeroides KY4113, decaprenyl diphosphate synthase and hydroxybenzoic acid-decaprenyl A process for preparing co-enzyme Q10 using a modified microorganism with enhanced transferase (Hydroxybenzoic acid-decaprenyl transferase) activity and reduced geranylgeranyl transferase activity was presented. The content was 6.6 mg / gDCW (Miyake, K. et al., WO 01/27286 (2001)).

Cargill azide wick (Zidwick) and the like Rhodobacter seupaeroyi Death (R. sphaeroides) are three result of inactivating the gene and, over-expression of one gene, a coenzyme Q10 content of the ATCC 35053 strain of 13.9 mg (Cargill Inc.) / gDCW level was reached (Zidwick, MJ et al., WO 2004/047763 (2004)).

Cheong et al. Agrobacterium Tmefaciens tumefaciens strains were introduced by introducing 1-deoxy-D-xylulose 5-phosphate synthase and decaprenyl diphosphate synthase genes. A method of optimizing the fermentation process of the transformed and transformed strains to produce coenzyme Q10 with a yield of 642 mg / L was reported, and the content was 7.3 mg / gDCW (Cheong, SR et al., US 2005). / 0181490 (2005).

Berry et al., Paracoccus Mevalonate operon of zeaxanthinifaciens ) was introduced into a microorganism of the genus Rhodobacter and cultured to produce coenzyme Q10, resulting in the development of a mutant strain with a content of up to 3.8 mg / gDCW (Berry, A. et al., WO 2005/005650 (2005), US 2006/0154349 (2006). As a result of the preparation of the transformed strain by introducing the foreign gene, the coenzyme Q10 content per dry cell weight was 13.9 mg / gDCW, which was considerably improved compared with the direct use of the wild type strain, but the economical process development was not as high as the coenzyme Q10 content in the strain was not high. Is not easy.

Unlike the above, there is an example of developing an industrialization process by randomly generating a mutation by treating a microorganism with a naturally occurring coenzyme Q10 production capacity, selecting a strain having excellent activity from among them, and optimizing culture conditions.

Sakato of Kyowa hakko kogyo Co., Ltd., Rhodopseudomonas has the ability to synthesize coenzyme Q10. sphaeroides ) reported a method of producing coenzyme Q10 in a yield of 770 mg / L using a strain lacking carotenoid production. At this time, the coenzyme Q10 content was 14.3 mg / gDCW, which was the highest among the results studied so far (Sakato K. et al., Biotechnol. Appl. Biochem. 16, 19-28, 1992).

Alternatively Yoshida (Yoshida) As a result of culturing bakteo seupaeroyi Death (R. sphaeroides) KY4113 strain and also recognizes that a significant effect of the air passage (Aeration) the coenzyme Q10 production optimization on the volume of the culture solution in the culture medium in a volume Coenzyme Q10 was produced in a yield of 350 mg / L with a coenzyme Q10 content of 8.7 mg / gDCW (Yoshida, H. et al., J. Gen. Appl. Microbiol. 44, 19-26, 1998).

Faller and others are Sporidiobolus using ultraviolet or chemical substances. Ruineniae strains were mutated and strains with increased activity were selected using compounds that inhibit the respiratory chain of the electron transport system, such as Paraquat or Linolenic acid. The coenzyme Q10 content was 3.5 mg / gDCW and the yield was 22.9 mg / L (Pfaller R. et al., US 2004/0209368 (2004)). As such, the maximum coenzyme Q10 content was greatly improved in the experiments in which the strains that naturally induced mutations and increased activity of the microorganisms capable of producing coenzyme Q10 were optimized. However, even at this time, the maximum coenzyme Q10 content per dry cell weight is up to 14.3 mg / gDCW, which requires an increase in activity.

As mentioned above, research on coenzyme Q10 is mainly conducted using microbial strains, and many studies have been conducted on it, and Cargill using R. sphaeroides and Cargill fermentation industry (Kyowa hakko kogyo) ), The coenzyme Q10 content reached 13.9 mg / gDCW and 14.3 mg / gDCW, respectively. However, when the content of coenzyme Q10 per dry cell weight is further improved, high yield of coenzyme Q10 can be produced according to Equation 1 when the strain is cultured in a large amount through fed-batch culture. Economical process development becomes possible.

Yield of coenzyme Q10 [mg / L] = amount of cells in culture [gDCW / L]

                  Coenzyme Q10 content per mg dry cell weight [mgCoQ10 / gDCW]

Coenzyme Q10 is currently produced by many companies using microbial fermentation processes. However, many preparation methods are known to have a disadvantage in that the cost of the coenzyme Q10 is low due to the low intracellular content of the enzyme (Cheong, S. R. et al., US 2005/0181490 (2005)).

The above-mentioned result of research to solve this problem, a low content of coenzyme Q10 in the fermentation process as described, Rhodobacter (Rhodobacter) in the microorganisms, in particular Rhodobacter seupaeroyi Death (R. sphaeroides) fire the crtE gene in the strain KCCM35488 activation and been able to then mutagenic Rhodobacter seupaeroyi increase the active strains screened death (R. sphaeroides) SK2H2 and significant increase in the amount of coenzyme Q10 in the result obtained by changing the culture method using a strain NTG, the present invention is Based on this, it was completed.

Accordingly, it is an object of the present invention to provide a new Rhodobacter sphaeroides strain having a high coenzyme Q10 content.

Another object of the present invention is to provide a method for producing coenzyme Q10 which efficiently produces coenzyme Q10 by culturing the strain.

According to one aspect of the invention, Rhodobacter sphaeroides SK2H2 ( Rhodobacter sphaeroides ) characterized by having a high coenzyme Q10 content SK2H2 ) (Accession No .: KCTC10915BP) strain is provided.

According to another aspect of the present invention, there is provided a method for producing coenzyme Q10, comprising culturing Rhodobacter sphaeroides ( Rhodobacter sphaeroides) (Accession Number: KCTC10915BP) strain and separating coenzyme Q10 from the culture.

Hereinafter, the present invention will be described in detail.

Also has a high content of coenzyme Q10 in the cell in order to achieve the object of the present invention bakteo seupaeroyi Death (R. sphaeroides) SK2H2 strain is also bakteo seupaeroyi Death (R. sphaeroides) inactivating crtE gene in the strain and KCCM35488, crtE gene that processes the NTG in the inactivated strain is obtained by generating a random mutant strain, and, among the mutant strains also produce the amount of coenzyme Q10 per dry cell weight increased screening bakteo seupaeroyi death (R. sphaeroides) strain. The strain thus obtained may be cultured and coenzyme Q10 may be separated from the culture to more efficiently produce coenzyme Q10.

As described above, bakteo seupaeroyi Death (R. sphaeroides) method for producing a SK2H2 is bakteo seupaeroyi Death (R. sphaeroides) also by homologous recombination (Homologous recombination) method also has a high content of coenzyme Q10 of the present invention Beginning by removing part of the crtE gene of the KCCM35488 strain, details are as follows. The crtE gene is a product that produces Geranylgeranyl pyrophosphate synthase as a product, and carotenoid synthesis is inhibited when part or all of the gene is removed.

First, primers containing the crtE gene are used to amplify some DNA fragments of the crtE gene and to isolate and purify the amplified DNA fragments. The purified DNA was cut with a specific restriction enzyme and inserted into a vector plasmid cut with the same restriction enzyme to complete a vector for homologous recombination, and transformed to introduce the vector into Escherichia coli, thereby transforming E. coli. do. Transformed to move the switch and the E. coli Rhodobacter seupaeroyi Death (R. sphaeroides) plasmid as Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488 strain via conjugation (Conjugation) of KCCM35488. Rhodobacter seupaeroyi through homologous recombination Death (R. sphaeroides) the strain vector is introduced on the chromosome of KCCM35488 is the kanamycin (Kanamycin) LB agar medium supplemented with 7% sucrose with antibiotics is added in a concentration of 20 μg / ml It can be selected in the form of colonies because they survive in successive LB agar medium. The selected colony as a template selected, confirmed the mutant strain is crtE gene inactivation through a polymerase chain reaction with the starting material and displays it to the Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488 (Δ crtE ).

The crtE gene is measured optical density (expressed as Optical density 600nm, or less OD) at 600nm to bakteo seupaeroyi Death (R. sphaeroides) also inactivated by culturing KCCM35488 (Δ crtE) strain in a nutrient medium using a spectrophotometer When the cell is recovered from about 0.7 to 1.0, the cells are recovered, and then, a buffer solution containing the mutagen is added thereto, followed by incubation for 10 minutes at 30 ° C. After the incubation is completed, the mutant cells are recovered, and the buffer solution is treated several times to completely remove the mutagen and dilute at an appropriate ratio to plate the viable strains in a medium having a selection pressure. After culturing the surviving strains again in a nutrient medium, the cells were recovered, extracted with a solvent, quantitatively analyzed for coenzyme Q10 content through HPLC analysis, and the strains having the highest coenzyme Q10 content were selected. The selected strains were named as bakteo seupaeroyi Death (R. sphaeroides) also SK2H2, was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center (Korean Collection for Type Cultures, KCTC ) The accession number KCTC10915BP (2006. 3. Deposits 3 days )to be.

Mutants used to prepare strains of the present invention include N-methyl-N'-nitro-N-nitroso-guanidine (N-methyl-N'-nitro-N-nitrosoguanidine, NTG), ethyl nitroso-urea (Ethyl) nitrosourea (ENU), ethyl methane sulfonate (EMS), dimethyl sulfate (DMS), ethidium bromide, acridine orange, ultraviolet (UV), etc. Among them, NTG was mainly used.

In addition, as a medium for selecting mutant strains, a medium containing a compound capable of giving selection pressure to the nutrient medium was used. The compounds used here include intermediates of coenzyme Q10 biosynthesis, structural analogues, respiratory inhibitors that inhibit the electron transport system, and oxidants that increase antioxidant activity. 4-Hydroxy benzoic acid, Chorismic acid, Shikimic acid, etc. are intermediates of coenzyme Q10, 1,4-benzoquinone, 2 2,6-dimethyl benzoquinone and 2,3-dimethyl-5-methyl benzoquinone act as structural analogues. Menadione (2-Methyl-1,4-naphthoquinone) and antimycin A are used as respiratory inhibitors and paraquat (1,1'-Dimethyl-4,4'-bipyridinium) or linolenic acid ) Is used as an oxidant to increase intracellular oxidation.

Also selected by the above method bakteo seupaeroyi Death (R. sphaeroides) When properly cultured SK2H2 strain in a nutrient medium containing molasses and glycerol, the content of coenzyme Q10 per dry cell weight. The results up to more than 20mg / gDCW. In one embodiment, the Rhodobacter sphaeroides SK2H2 strain may be cultured in a medium consisting of 1.6% Bactobacillus tryptone, 1% yeast extract, 0.5% sodium chloride, 4% molasses, 2% glycerol.

After incubation, coenzyme Q10 can be easily isolated and quantified by conventional methods. For example, the cells are recovered by centrifugation from the culture, mixed with lysozyme (Lysozme) and a compound that dissolves cells such as CellyticB solution (Sigma) and incubated at 37 ° C. When the incubation is completed, add a solvent in which Hexane and Propanol are properly mixed and stir. After stirring and centrifugation to form two layers, the supernatant is recovered. The recovered supernatant is dried with a dryer to completely remove the solvent, and then completely dissolved by adding ethanol and analyzed by liquid chromatography (HPLC).

In the analysis of liquid chromatography, Mightysil RP-18 GP 150-4.6 (5 μm) manufactured by Kanto Chemical (Kanto Chemical, Japan) was used, and methanol and ethanol were 1: 1 (vol.:vol. Using a mixed solution mixed at the ratio of) and flowing at a rate of 1 ml per minute, the culture product is detected at UV 275 nm. Coenzyme Q10, the product of the culture, can be easily distinguished since it is detected at 16.7 minutes. The measured values can be quantified by coenzyme Q10 by substituting equations obtained through standard calibration curves.

Therefore, the mutant strain used in the present invention increases the content of coenzyme Q10 per 20 mg / gDCW per dry cell weight by more than 40% compared to 14.3 mg / gDCW, which is the maximum content of existing strains and processes, and through fed-batch culture. Incubating large strains can produce high concentrations of coenzyme Q10, enabling economic commercial development.

 In the present invention, the pH of the strain culture is appropriately in the range of pH6.5 ~ 8.5, there is a disadvantage that the content per dry cell weight is reduced when the pH is less than 6.5, or exceeds pH8.5. In addition, the culture temperature is preferably 25 ~ 40 ℃, if the temperature is less than 25 ℃ has the disadvantage of too slow culture rate, if the culture temperature exceeds 40 ℃ has a disadvantage that the content per dry cell weight is reduced.

On the other hand, an appropriate range is also required for the volume of the culture solution. Although not limited thereto, the culture medium is preferably cultured at 20 to 40 mL based on a 250 mL Erlenmeyer flask. If the deviation of the above is less ventilated growth or high dissolved oxygen concentration has a disadvantage in that the content per dry cell weight is reduced. In addition, the culture time is preferably 72 to 96 hours.

As above When the Rhodobacter sphaeroides ( R. sphaeroides ) SK2H2 strain is cultured under the above conditions, the content per dry cell weight reaches 20 mg / gDCW or more.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

<Example 1> Rhodobacter seupaeroyi Death (R. sphaeroides) of KCCM35488 strain crtE Gene inactivation

Also used in the experiment bakteo seupaeroyi Death (R. sphaeroides) KCCM35488 strain were given pre-sale from the Korea Culture Center of Microorganisms (Korean culture center of microorganisms, KCCM ) experiment part of the crtE gene on the homologous chromosome using recombinant (Homologous recombination) method by removing the Rhodobacter seupaeroyi death (R. sphaeroides) it was inactivated the crtE gene in the strain KCCM35488. The following primers were synthesized to prepare a homologous recombination vector to remove the nucleotide sequence of about 0.7 kb in the crtE gene.

crtE -f1 (5'-CATGCTGCAGCGTTGAAGACGATGTGATCG)

crtE -r1 (5'-TTCAGCCGCTCATCTTGTGCCTCATAGGACA)

crtE -f2 (5'-GCACAAGATGAGCGGCTGAAGGACATCCTC)

crtE -r2 (ACTGCTGCAGTGTCAACTTTATTGGACAGT)

First, DNA fragments of about 1.0 kb were amplified by polymerase chain reaction (PCR) from R. sphaeroides KCCM35488 using crtE -f1 and crtE -r1 primers. Amplified DNA fragments were isolated and purified through a Qiagen PCR purification kit (Qiagen). Next, using crtE -f2 and crtE -r2 starting materials DNA fragments of about 1.4 kb were amplified from polymerase chain reaction (PCR) from R. sphaeroides KCCM35488. Amplified DNA fragments were isolated and purified through a Qiagen PCR purification kit (Qiagen). The two DNA fragments of about 1.0 kb and 1.4 kb obtained through the polymerase chain reaction were mixed in one microtube, and crtE -f1 and crtE -r2 primers were added thereto, and then the polymerase chain reaction was carried out about 2.4. kb DNA fragments were amplified. Amplified DNA fragments were isolated and purified by Qiagen PCR purification kit and then digested with restriction enzyme PstI. PLO1 plasmid (Kmr sacB , RP4 oriT, ColE1 ori) (Lenz, O. et al., J. Bacteriol., 176: 4385-4393, 1994), digested with PstI, about 2.4 kb DNA fragment ) And named it pLO1-dcrtE to complete the vector for homologous recombination. E. coli S17-1 (Tra + recA pro thi hsdR chr :: RP4-2) (Simon, R. et al., Bio / Technology 1: 784-791, 1983) was transformed using the completed pLO1-dcrtE plasmid. Subsequently, the pLO1-dcrtE plasmid was transformed from R. coli S17-1 via a spot mating technique (Simon, R. et al., Bio / Technology 1: 784-791, 1983). R. sphaeroides) was transferred to KCCM35488 strain. Kanamycin antibiotic was added at a concentration of 20 μg / ml to strains in which the pLO1-dcrtE plasmid was introduced into a single crossover through homologous recombination on the chromosome of R. sphaeroides KCCM35488. Were selected in a prepared LB agar medium (1.0% bacto tryptone, 0.5% yeast extract, 1.0% sodium chloride, 1.5% agar). The selected colonies were placed in LB medium (1.0% Bakto tryptone, 0.5% yeast extract, 1.0% sodium chloride), suspended and plated in LB agar medium containing 7% sucrose. The colonies produced here are colonies in which the pLO1-dcrtE plasmid portion introduced onto the chromosome has a genotype that is released from the chromosome through a double crossover. These colonies are mixed with two genotypes of genotypes, the wild type with the crtE gene intact and the mutant type with about 0.7 kb removed from the crtE gene. When each colony was used as a template and amplified DNA fragments by polymerase chain reaction using crtE -f1 and crtE -r2 initiators , a mutation of about 2.4 kb resulted in the mutation of the crtE gene, and about 3.1 The kb DNA fragments were classified as wild type. Colonies showing the final 2.4 kb DNA fragments were identified by polymerase chain reaction and selected as crtE inactivated strains of R. sphaeroides KCCM35488 strains and R. sphaeroides KCCM35488 ( ΔcrtE ).

<Example 2> also random mutation of bakteo seupaeroyi Death (R. sphaeroides) KCCM35488 (Δ crtE ) strains carried

Example 1 Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488 (Δ crtE ) the strains inoculated in 3ml of LB medium, and then cultured at 30 ℃ 24 hours, at 30 ℃ was inoculated at 2% concentration in the same medium of 30ml of Incubate. When the OD at 600 nm was 0.7-1.0 using a spectrophotometer, 1 ml of the culture solution was taken in a microtube, and the cells were recovered by centrifugation (13,000 rpm, 5 minutes), and the same amount of phosphate buffer solution (0.8% sodium chloride, 0.02 Wash and recover the cells with% potassium chloride, 0.144% sodium diphosphate, 0.024%, potassium dihydrogen phosphate, pH 7.4).

The recovered cells were added with a phosphate buffer containing NTG at a concentration ranging from 0.001 to 0.01 mg / ml as a mutagen and incubated at 30 ° C. for 10 minutes. After the incubation is completed, the cells are recovered by centrifugation (13,000 rpm, 5 minutes), 1 ml of phosphate buffer solution is treated twice to completely remove the mutagen, and then suspended in 1 ml of phosphate buffer solution. After diluting the suspension sequentially at a ratio of 1/10, it was plated on LB agar medium containing 4-hydroxy benzoic acid at 4 days by selection pressure for selection of strains having increased biosynthetic activity of coenzyme Q10. After culturing for 200 species of surviving mutant strains were obtained.

<Example 3> coenzyme Q10 Rhodobacter seupaeroyi content is increased Death (R. sphaeroides) SK2H2 screening

Colonies of each of the mutant strains secured in Example 2 were inoculated in a test tube containing 3 ml of LB medium using platinum and incubated at 30 ° C. using a shake incubator (JIOTECH, SI-600R) (24 hours). , 200 rpm). When the incubation is complete, a 2% concentration is placed in a 250 ml Erlenmeyer flask containing 30 ml of coenzyme Q10 culture medium (1.6% bacto tryptone, 1.0% yeast extract, 0.5% sodium chloride, 4% molasses, 2% glycerol, pH 7.0). Inoculation was incubated for 3 days in a shaker (30 ℃, 200rpm).

When the incubation is completed, take an appropriate amount of the culture medium and dry cell weight (gDCW / L), yield (mgCoQ10 / L, hereinafter mg / L), content (Content, mgCoQ10 / gDCW, MG / gDCW). ) Were selected by comparison with wild-type strains and strains in which the crtE gene was inactivated.

To determine the dry cell weight (gDCW / L), 5 ml of the strain culture was collected, added to a 50 ml centrifuge tube, centrifuged (8,000 rpm, 10 minutes), and the supernatant was removed to recover the cells. 20 ml of sterile distilled water solution is added to the recovered cells, suspended and centrifuged to completely remove the culture components and recover the cells. 5 ml of sterile distilled water is added to the recovered cells, completely suspended, and then added to an aluminum weighing dish, which has previously been weighed in mg. At this time, the centrifuge tube is washed with sterile distilled water and the washing solution is also added to the weighing dish. The weighing dish was dried in a dry oven at 105 ° C. for at least 12 hours and then cooled to measure the weight (in mg) of the weighing dish. Dry cell weight (g / L) was calculated using Equation 2.

Dry cell weight (g / L) = Dish weight after drying (mg)-Dish weight before drying (mg) / 5

The method for measuring the yield (mg / L) of coenzyme Q10 is as follows. After incubation, 0.5ml of the culture solution is taken into a microtube and centrifuged (13,000rpm, 5 minutes) to recover the cells. 1 ml of phosphate buffer was added to the recovered cells, washed well, and centrifuged to recover the cells. 1 ml of 20 mM Tris-HCl (pH 7.6) was added to the recovered microtubes, and the cells were uniformly suspended and centrifuged to recover the cells. 0.45 ml of CellyticB solution (Sigma) is added and uniformly suspended using a mixer, 0.05 ml of 20 mg / ml lysozyme (Lysozme) is added, mixed well, and incubated at 37 ° C. for 30 minutes. When the incubation is completed, 0.9 ml of Hexane / Propanol (5/3) is added and stirred for 5 minutes. After stirring and centrifugation to form two layers, the supernatant is recovered. The recovered supernatant is dried in a dryer to completely remove the solvent. 0.5 ml of ethanol is added to the microtube to dissolve completely. This was analyzed using liquid chromatography (HPLC).

The analysis conditions of the liquid chromatography are as follows. For liquid chromatography, Hewlett Packard's 1050 series was used, and Mightysil RP-18 GP 150-4.6 (5 μm) from Kanto Chemical (Japan) was used as a column, and methanol and ethanol as eluents. The mixed solution was mixed at a ratio of 1: 1 (vol.:vol.) At a rate of 1 ml per minute, and the culture product was detected at UV 275 nm. Coenzyme Q10, the product of the culture, can be easily distinguished because it is detected at 16.7 min. The amount of coenzyme Q10 was determined by substituting the measured values into the equation obtained through the standard calibration curve. At this time, for preparing a standard calibration curve, standard coenzyme Q10 (Aldrich) was purchased, dissolved in ethanol, diluted in ethanol at different concentrations, and measured by HPLC.

The content of coenzyme Q10 (mg / gDCW) was calculated using Equation 3 using the dry cell weight (gDCW / L) and the yield of coenzyme Q10 (mg / L).

Coenzyme Q10 content (mg / gDCW) = coenzyme Q10 yield (mg / L) / dry cell weight (gDCW / L)

By weight of each dry 200 species in the cell condition (gDCW / L), yield (mg / L), the content (mg / gDCW) to obtain Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488, Rhodobacter seupaeroyi Death (R. This sphaeroides ) KCCM35488 ( Δ crtE ) and other strains were selected from eight strains of 10% increased activity compared to the results of cultivation and shown in Table 1 below, the highest content of R. sphaeroides ( R. sphaeroides) SK2H2 strain It was selected and deposited in the Korea Collection for Type Cultures (KCTC), and the deposit number was KCTC10915BP (March 3, 2006).

Mutant Strains of R. sphaeroides with Increased Coenzyme Q10 Content Strain name Dry cell weight (gDCW / L) Yield (mg / L) Content (mg / gDCW) Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488 13.4 89.4 6.7 Rhodobacter seupaeroyi Death (R. sphaeroides) KCCM35488 (Δ crtE ) 11.0 99.5 9.0 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H2 8.4 147.3 17.4 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H4 8.8 138.4 15.7 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H14 8.4 132.5 15.8 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H49 8.8 134.1 15.3 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H52 8.2 122.7 15.0 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H62 8.7 130.7 15.1 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H92 8.6 139.1 16.2 Rhodobacter seupaeroyi Death (R. sphaeroides) SK2H108 9.0 144.6 16.1

<Example 4> also according to the incubation time bakteo seupaeroyi Death (R. sphaeroides) dried cells of SK2H2 weight, yield, content

Colonies of R. sphaeroides SK2H2 strain secured in Example 3 were inoculated into a test tube containing 3 ml of LB medium and incubated at 30 ° C. using a shake incubator (24 hours, 200 rpm). When the incubation was complete, inoculate 2% concentration into a 250 ml Erlenmeyer flask containing 30 ml of coenzyme Q10 culture medium (1.6% Bakto tryptone, 1.0% yeast extract, 0.5% sodium chloride 4% molasses, 2% glycerol, pH 7.0). Incubated for 4 days in a shaker (30 ℃, 200rpm). When the culture was completed, the culture medium was taken, and the dry cell weight (gDCW / L), yield (mg / L), and content (mg / gDCW) were obtained by the method of Example 3, and the results are shown in Table 2 below.

Rhodobacter seupaeroyi according to the incubation time Death (R. sphaeroides) dried cells of SK2H2 weight, yield, content Incubation time (hours) Dry cell weight (gDCW / L) Yield (mg / L) Content (mg / gDCW) 48 6.9 59.6 8.6 72 8.4 147.3 17.4 96 9.8 201.7 20.5

<Examples 5 to 9 and Comparative Example 1>

Among the conditions of Example 4, the culture temperature, the volume of the culture medium, and the speed of the incubator were maintained under the same conditions as in Example 3, and the pH of the culture solution was varied to 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and then Rhodobacter sparrow Inoculated with Death ( R. sphaeroides) SK2H2 strain and incubated for 3 days, the culture medium was taken to obtain the dry cell weight (gDCW / L), yield (mg / L), content (mg / gDCW) by the method of Example 3 Shown in Table 3

Dry Cell Weight, Yield, and Content of R. sphaeroides SK2H2 with Different pH of Culture Example Culture temperature pH Dry cell weight (gDCW / L) Yield (mg / L) Content (mg / gDCW) 5 6.0 9.2 134.0 14.6 6 6.5 8.9 135.6 15.2 7 7.0 8.4 147.3 17.4 8 7.5 8.5 137.6 16.1 9 8.0 8.4 136.5 16.2 Comparative Example 1 8.5 8.0 91.1 11.4

<Examples 10 to 13 and Comparative Example 2>

In the conditions of Example 4, the pH of the culture medium, the volume of the culture medium, and the speed of the incubator were maintained under the same conditions as in Example 3, and after varying the culture temperature to 25, 30, 35, 40, 45 ℃, Rhodobacter spheroides ( R. sphaeroides) inoculated with SK2H2 strain and incubated for 4 days, the culture medium was taken to obtain the dry cell weight (gDCW / L), yield (mg / L), content (mg / gDCW) by the method of Example 3 Shown in 4

Culture temperature Rhodobacter seupaeroyi Death (R. sphaeroides) according to the change in dry cell weight SK2H2, yield, content Example Culture temperature (℃) Dry cell weight (gDCW / L) Yield (mg / L) Content (mg / gDCW) 10 25 9.2 83.8 9.1 11 27 8.5 126.5 14.9 12 30 8.4 147.3 17.4 13 35 9.5 135.9 14.3 Comparative Example 2 40 7.5 43.3 6.1

<Examples 14 to 17 and Comparative Example 3>

The pH, culture temperature, and incubator speed of the culture medium in Example 4 were maintained under the same conditions as in Example 3, and variously changed the volume of the culture medium to 20, 25, 30, 40, 50 ml, and then Rhodobacter spheroids. ( R. sphaeroides ) Inoculated with SK2H2 strain and incubated for 4 days, and the culture medium was taken to obtain dry cell weight (gDCW / L), yield (mg / L), and content (mg / gDCW) by the method of Example 3. Shown in 5

Rhodobacter seupaeroyi culture medium according to the volume change of Death (R. sphaeroides) dried cells of SK2H2 weight, yield, content Example Culture volume (ml) Dry cell weight (gDCW / L) Yield (mg / L) Content (mg / gDCW) 14 20 9.3 139.3 14.9 15 25 8.5 113.7 13.4 16 30 8.4 147.3 17.4 17 40 7.0 106.2 15.3 Comparative Example 3 50 6.2 95.6 15.5

Rhodobacter sphaeroides SK2H2 (Accession No .: KCTC10915BP) strain of the present invention has a very high coenzyme Q10 content of 20 mg / gDCW or more as compared to the previously developed strains. Therefore, when culturing the strain in large quantities, it is possible to economically prepare coenzyme Q10.

Claims (6)

Rhodobacter Rhodobacter, characterized by a high coenzyme Q10 content sphaeroides SK2H2) (Accession No .: KCTC10915BP) strain. Paragraph (1) Rhodobacter seupaeroyi des SK2H2 (Rhodobacter sphaeroides ) (Accession Number: KCTC10915BP) A method for producing coenzyme Q10, comprising culturing a strain and separating coenzyme Q10 from the culture. The coenzyme Q10 according to claim 2, wherein the Rhodobacter sphaeroides SK2H2 strain is cultured in a medium containing 1.6% of bacto tryptone, 1% of yeast extract, 0.5% of sodium chloride, 4% of molasses, and 2% of glycerol. Production method. 4. The method of claim 3, wherein said medium is maintained at pH 6.0-8.0. The method of claim 3, wherein the medium is maintained at 25-35 ° C. 5. The method of claim 3, wherein the medium has a volume of 20 to 40 mL.