EP1563080A1

EP1563080A1 - Method for expressing inducible rnai in cells, nucleic acid molecules therefor and cells transformed by said molecules

Info

Publication number: EP1563080A1
Application number: EP03786045A
Authority: EP
Inventors: Annick Harel-Bellan; Lauriane Fritsch; Redha Sekhri
Original assignee: Centre National de la Recherche Scientifique CNRS
Current assignee: Centre National de la Recherche Scientifique CNRS
Priority date: 2002-11-21
Filing date: 2003-11-21
Publication date: 2005-08-17
Also published as: AU2003295051A1; WO2004048581A1; US20060234966A1; FR2847588A1; FR2847588B1; CA2506763A1

Abstract

The invention concerns a method for expressing RNAi in cells comprising: (i) introducing in cells a nucleic acid molecule including the RNAi sense and antisense sequences placed under the control of a single transcription promoter, said sense and antisense sequences being separated by a DNA sequence including a sequence for arrest of said transcription, said DNA sequence being framed at each of its ends by a lox site, (ii) contacting the lox sites with Cre, to obtain by site-specific recombination elimination of the DNA sequence and of the transcription arrest sequence such that said sense and antisense sequences are no longer separated by the remaining lox sequence thus enabling the transcription of the RNAi integrally with the residual lox sequence as loop.

Description

METHOD FOR THE INDUCTIBLE EXPRESSION OF RNAi IN CELLS, NUCLEIC ACID MOLECULES FOR THEIR PROCESSING AND THE CELLS TRANSFORMED THEREBY.

The invention relates to the field of biology and more particularly to the preparation of double-stranded oligonucleotides for use in an RNA interference process (RNAi or RNAi).

RNA interference also designated “SiRNA” or “RNAi” or co-suppression, has been demonstrated in plants, where it has been observed that the introduction of a long double-stranded RNA, corresponding to a gene, induces specific and efficient repression of the targeted gene. The mechanism of this interference involves the degradation of double-stranded RNA into short duplexes of oligonucleotides of 20 to 22 nucleotides.

RNA interference has now been applied to mammals to specifically inhibit genes for applications in functional genetics. Indeed, siRNAs make it possible to identify the function of the genes revealed by the sequencing of the human genome, either in cell culture models, or in animal models in particular in mice. RNA interference is also useful in the therapeutic field for the treatment or prevention of cancers, infectious diseases and more generally of diseases involving a mutated heterologous or homologous gene (Elbashir, SM, Harborth, J., Lendec el, ., Yalcin, A., Weber, K., and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498; Elbashir, SM, Martinez, J. , Patkaniowska, A., Lendeckel, W., and Tuschl, T. (2001b). Functional anatomy of siRNAs for ediating efficient RNAi in Drosophila melanogaster embryo lysate. Embo J 20, 6877-6888). SiRNAs are short double-stranded RNA sequences, which can be introduced in the form of synthetic oligonucleotide or in the form of a plasmid allowing their transcription. The implementation of plasmids has many advantages, in particular for functional genetics applications. It makes it possible to express double-stranded RNA in a stable manner in cells, and therefore more easily inhibits proteins with a long half-life. Indeed, synthetic siRNAs have a half-life of 3 days in mammalian cells. It also makes it possible to analyze long-term effects. On the other hand, it requires establishing lines expressing the construction in a stable manner, which has several drawbacks. In particular, it is necessary to compare stable lines with each other, which is generally difficult to interpret because the cell lines derive. On the other hand, it is impossible to study the proteins essential for the cell, since their inhibition will block the proliferation of cells and therefore prevent the establishment of the stable line. It is therefore essential to be able to induce expression of siRNA at will.

The invention aims precisely to overcome these drawbacks by providing a system for expressing an siRNA in a stable and inducible manner. This goal is achieved through the use of the CRE-lox system for the expression of a siRNA in mammalian cells. The subject of the invention is therefore a method of expression of RNAi in cells comprising: - the introduction into eukaryotic cells of a nucleic acid molecule comprising the sense and antisense sequences of RNAi placed under the control of a single transcription promoter, said sense and antisense sequences being separated by a DNA sequence comprising a stop sequence for said transcription, said DNA sequence being flanked at each of its ends by a lox site,

- bringing the lox sites into contact with Cre, to obtain, by site-specific recombination, the elimination of the DNA sequence and of the transcription stop sequence so that said sense and antisense sequences are no longer separated only by the remaining lox sequence and thus allow transcription of the entire RNAi with the residual lox sequence as a loop.

According to a particular form of implementation of the method of the invention, said nucleic acid molecule comprises from 5 ′ to 3 ′, as shown in FIG. 1, a transcription promoter compatible with said cells, the sense sequence of RNAi, a first lox site, a DNA sequence comprising a transcription terminator, the second lox site and the antisense sequence of RNAi. Advantageously, said nucleic acid molecule is a plasmid. It can also be a retrovirus.

The cells transfected with this nucleic acid molecule are mammalian cells. The method is applicable to the transfection of cells in culture as well as directly in animals.

Indeed, the invention makes it possible to reliably analyze human genes from a functional point of view, in cells in culture or in animals, in particular in mice. Indeed, there are systems allowing the inducible expression of CRE, in cells and in animals. In mice, CRE can also be expressed in a tissue-specific manner, allowing the inactivation of a gene specifically in these tissues. CRE can be contacted with lox sites via transfection of cells with a nucleic acid molecule comprising a regulatory sequence and the cre gene. The DNA sequence separating the sense and antisense sequences from the AR i and comprising the transcription terminator is advantageously a gene for resistance to an antibiotic, such as neomycin, thus also making it possible to select the transfected cells. The invention also relates to a nucleic acid molecule described above for the implementation of the method of inducible expression of RNAi in cells.

The invention also relates to a cell or a cell line transfected with a nucleic acid molecule described above and animals whose cells have been transfected with said nucleic acid molecule. The invention finally relates to compositions, in particular pharmaceutical compositions comprising as active substance at least one molecule of nucleic acid above or cells transformed by this optionally combined in the composition with a compatible excipient.

Other advantages and characteristics of the invention will appear from the examples which follow and in which reference will be made to the appended drawings in which:

FIG. 1 represents the strategy for the expression of siRNAs in an inducible manner according to the invention.

Figure 2 and Figure 3 show the induction of RNAi activity by CRE. Figure 4 shows the inhibition of the GFP marker by RNAi.

FIG. 5 represents the inhibition of the GFP marker dependent on CRE during transfection in two stages. FIG. 6 represents the inhibition by the RNAi of the GFP marker integrated into a cell line.

FIG. 7 represents the inhibition by the RNAi of the endogenous p53 gene with establishment of stable cell lines.

Figure 8 shows the in vitro activity of RNAi.

EXAMPLE 1.

The plasmid plox siRNA includes a Pol II promoter controlling a gene for resistance to an antibiotic, neomycin. The neomycin cassette is surrounded by lox sites. Initially, a Pol III promoter (Hl) was inserted in the opposite direction to the Pol II promoter. The H1 promoter introduced into the plasmid behind the second loxp region, with the restriction enzymes Nhel and Xbal, is obtained by PCR from the following primers:

5 'CTAGCTAGCCCATGGAATTCGAACGCTGACGTC 3' For ard (SEQ ID NO. 1)

5 'GCTCTAGAGTGGTCTCATACAGAACTTATAAGATTCCC 3' Reverse (SEQ ID NO. 2)

This plasmid is inspired by the plasmid pSUPER, allowing the constitutive expression of siRNA and described by Brummelkamp et al.

The DNA sequences corresponding to the sense SiRNA were then introduced immediately after the H1 promoter at the Xbal site. SiRNA meaning:

5 'CTAGACCCGCAAGCTGACCCTGAAGTTCATT 3' (SEQ ID NO. 3) SiRNA complementary sense: 5 'CTAGAATGAACTTCAGGGTCAGCTTGCGGT 3' (SEQ ID NO. 4)

Finally, the DNA sequences corresponding to the antisense siRNA were introduced following the second loxp region at the Bamhl and Kpnl sites. Anti-sense SiRNA:

5 'GATCCATGAACTTCAGGGTCAGCTTGCTTTTTTGGAAAGGTAC 3' (SEQ ID NO. 5)

Complementary antisense SiRNA: 5 'CTTTCCAAAAAAGCAAGCTGACCCTGAAGTTCATG 3' (SEQ ID NO.

6)

The psiRNA lox is obtained by inserting the entire DNA sequence of the siRNA directly after the H1 promoter at the Xbal site. The sense and antisense siRNAs are separated by a loop.

siRNA:

5 'CTAGTTTCCAAAAAAGCAAGCTGACCCTGAAGTTCATTCTCTTGAAATGAAC TTCAGGGTCAGCTTGCGGGT 3' (SEQ ID NO. 7)

Complementary SiRNA: 5 'CTAGACCCGCAAGCTGACCCTGAAGTTCATTTCAAGAGAATGAACTTCAGGG

TCAGCTTGCTTTTTTGGAAA 3 '(SEQ ID NO. 8)

COS-7 mammalian cells were transfected with polyfect (Qiagen) with 4 μg of siRNA expression vectors (plox siRNA, psiRNAlox or plox) as indicated and a vector expressing CRE recombinase or the corresponding empty vector (8 μg) as well as a Green Fluorescent Protein or GFP expression vector (500 ng). Sixty hours after transfection, a western blot was produced from the total extracts using an antibody directed against GFP (Santa cruz) or cellular tubulin (Sigma) in order to evaluate the quantity of proteins used for this test (figure 2). Fibroblast cells (3T3) were transfected with 0.5 μg or 1 μg of plox siRNA expression vector, as indicated in FIG. 3, and a vector expressing CRE recombinase or the corresponding empty vector (8 μg) as well as 'a GFP expression vector (500 ng). Sixty hours after transfection, a western blot was produced from the total extracts using an antibody directed against GFP (Santa cruz) or cellular tubulin (Sigma) to assess the amount of protein used for this test (Figure 3).

In the absence of CRE, the two constituent parts of siRNA (sense strand and antisense) are separated by the neomycin gene which includes a transcription stop sequence for Pol III. Under these conditions, only the sense strand of siRNA is transcribed and the siRNA is inactive: the target protein is expressed normally as shown in FIG. 2 and in FIG. 3, 3 ^rd and 4 ^th line. In the presence of CRE, the plasmid undergoes a recombination process in the cell, giving a product in which the neomycin sequence is eliminated, and in which the two 1/2 siRNAs are no longer separated except by the remaining lox sequence, in which it there is no transcription stop sequence for Pol III. The siRNA is therefore transcribed in its entirety, with the residual lox sequence which serves as a “loop”. This siRNA is active and the target protein is inhibited (compare lines 1 or 2 with lines 3 or 4, Figures 2 and 3). The inhibition is well linked to the activity of siRNA, since in the presence of CRE, inhibition is observed only in the presence of complete siRNA, and not in the presence of the expression vector of empty siRNA (line 1) . Its activity is equivalent to that of a siRNA serving as a positive control, expressed in a constitutive manner (because the entire sequence from which it is transcribed is placed before the neomycin gene).

On the other hand, analysis by Northern shows the processing of the precursor and the synthesis of siRNA induced by CRE (Figure 4). The total RNA of the COS-7 cells was extracted after 6Oh of transfection and then analyzed by northern blot with a 32P-labeled probe directed against the antisense strand of the siRNAs produced: 5 'CTTTCCAAAAAAGCAAGCTGACCCTGAAGTTCATG 3' (SEQ ID NO.

9)

FIG. 4 shows that the inhibition is indeed linked to the expression of siRNA, induced by CRE.

EXAMPLE 2.

1) Methods.

Plasmid constructions were carried out according to the method presented in Example 1. The plox vector was constructed by inserting, in the plasmid ploxNeo, the Pol III (H1) promoter as an Nhel-Xba insert. The sequences corresponding to the sense and antisense strands siRNA were introduced as synthetic oligonucleotides using the Xbal or BamHI and Kpn restriction sites respectively.

SiRNA meaning:

5 'CTAGCCCCGCAAGCTGACCCTGAAGTTCATT 3' (SEQ ID NO.10) Anti-sense SiRNA:

5 'GATCCATGAACTTCAGGGTCAGCTTGCTTTTGGTACCTAGACCC 3' (SEQ ID NO.11)

This vector will be used in the following examples.

COS-7 mammalian cells were transfected in two stages. The first transfection was carried out with

1 μg of siRNA expression vectors (plox siRNA, psiRNAlox or plox) and 2 μg of a vector expressing CRE recombinase or the corresponding empty vector. Twenty-four hours after this first transfection, the cells were transfected with 500 ng of an expression vector CMV-d2GFP (Clontech). A Western blot was carried out in accordance with Example 1.

2) results.

Figure 5 shows that GFP is undetectable during a two-stage transfection during which the siRNA was able to form twenty-four hours before the transfection of the GFP expression vector.

EXAMPLE 3.

1) Methods. HeLa 1002 cells (cell line derived from HeLa cells having an integrated transgene encoding doxocyclin-inducible GFP) were transfected with 300 ng of CMV read or CMV-RFP expression vectors, with 8 μg of vector expressing CRE recombinase or the corresponding empty vector and with 4 μg of siRNA expression vectors (plox siRNA, psiRNAlox or plox). Seventy-two hours after transfection, the cells were treated for twenty-four to seventy-two hours with Doxocycline (1 μg / ml) before observation under an Axiovert fluorescence microscope.

2) Results.

FIG. 6 shows the activity of siRNA on the expression of a GFP marker gene integrated into the genome of the cell line and inducible by doxocycline. The expression of the marker is observed in approximately 30% of the cells twenty-four hours after induction (FIG. 6A) and in 60% of the cells forty-eight hours after induction (FIG. 6B). Similar proportions are observed in transfection control cells (RFP positive) transfected with the empty vector plox (FIGS. 6A and 6B). Regardless of the expression of the CRE protein, no expression of the target protein GFP is observed in cells transfected with the psiRNA lox vector constitutively expressing siRNA. In the absence of CRE, among the cells transfected with the plox vector siRNA the proportion of GFP positive cells is approximately 30% one day after induction and approximately 65% two days after induction; but this proportion is less than 5% in the presence of CRE. EXAMPLE 4.

1) Methods.

A plox siRNA expression vector directed against p53 (plox siRNA p53) was constructed according to the method presented in Example 2. The sense and antisense siRNA sequences used are the following: Sense SiRNA:

5 'GCATGAACCGGAGGCCCATT 3' (SEQ ID NO.12) Anti-sense SiRNA: 5 'GATCCATGGGCCTCCGGTTCATGC 3' (SEQ ID NO.13)

U20S cells were transfected either with the empty plox vector or with a plox siRNA expression vector directed against the p53 gene (plox siRNA p53). Stable clones are established using the neomycin selection marker. These stable clones are then transfected either with a vector expressing CRE recombinase or with the corresponding empty vector pMC, then selected using a different selection marker (hygromycin). The expression of P53 was checked four weeks later by Western blot.

2) Results.

FIG. 7 shows three examples of clones transfected with the plox siRNA p53 vector exhibiting CRE-dependent p53 inhibition. No inhibition is observed in the ploxsiRNAp53 clones having been transfected with the empty vector pMC, as well as in the clones stably transfected with the empty vector plox. Figure 7 shows stably transfected cell lines in which a target endogenous gene is inhibited.

EXAMPLE 5.

1) Methods. The MCK-nlslacZ construct contains the sequence coding for nuclear β-galactosidase under the control of the muscle creatine kinase promoter. The use of such an expression vector makes it possible to mark the nuclei of the transfected muscle fibers. The other expression vectors used are: the CRE expression vector or the corresponding empty vector, the plox expression vector, the plox siRNA expression vector.

Five to ten week old actin-GFP transgenic mice (Ikawa et al.) Are anesthetized with 300 μl of 0.05% xyalazine-1.7% ketamine in 0.9% NaCl. After incision of the skin, 8 μg of DNA containing 3 μg of CRE expression vectors and / or siRNA and 2 μg of MCK- nlslacZ, are injected into the tibialis anterior muscle (TA) using '' 1 ml syringe fitted with a 27 gauge needle. Caliper electrode plates (Q-biogen, France) are immediately applied to each side of the muscle and a series of eight electrical pulses (2 Hz, 20 ms each ) is delivered using a standard square signal electroporator (ECM 830, Q-biogen). The electrical contact is ensured by the application of a conductive gel.

Twelve days after the injection, the TA muscles are dissected and fixed with 4% paraformaldehyde in buffer

PBS (Phosphate Bu saline iron) then incubated for two - three hours in 5-bromo-4-chloro-indol-β-galactoside 0.4 mg / ml, K3Fe (CN) 6 4 M, K4Fe (CN) 6 4 mM and 2mM MgC12, PBS at 37 ° C for lacZ staining. The positive LacZ regions are then dissected under a microscope. The fluorescence and phase contrast images are obtained using a Zeiss confocal microscope (LSM510, Zeiss). 2) Results.

Figure 8 shows that the combination of the CRE expressing plasmid and the siRNA GFP plox vector induces a marked decrease in GFP expression in the transfected fibers (the arrow indicates the positive LacZ nuclei). Expression of CRE in the presence of the plox control vector, as well as transfection of the ploxsiRNA vector in the absence of CRE, do not affect the expression of GFP in the transfected fibers. FIG. 8 shows that the expression of siRNA induced by CRE can decrease the expression of a gene in vivo.

Claims

1) Method of expression of RNAi in cells comprising: - the introduction into eukaryotic cells of a nucleic acid molecule comprising the sense and antisense sequences of RNAi placed under the control of a transcription promoter unique, said sense and antisense sequences being separated by a DNA sequence comprising a sequence for stopping said transcription, said DNA sequence being flanked at each of its ends by a lox site,

2) Method according to claim 1, characterized in that said nucleic acid molecule comprises from 5 'to 3', a transcription promoter compatible with said cells, the sense sequence of RNAi, a first lox site, a sequence DNA comprising a transcription terminator, the second lox site and the antisense sequence of RNAi.

3) Method according to one of claims 1 or 2, characterized in that said nucleic acid molecule is a plasmid.

4) Method according to any one of claims 1 to 3, characterized in that the transfected cells are mammalian cells.

5) Method according to any one of the preceding claims, characterized in that the DNA sequence separating the sense and antisense sequences of the RNAi and comprising the transcription terminator is advantageously a gene for resistance to an antibiotic, such as neomycin .

6) Method according to any one of the preceding claims, characterized in that the cells are also transfected with a nucleic acid molecule comprising a regulatory sequence and the cre gene.

7) A nucleic acid molecule as defined in any one of claims 1 to 5.

8) A cell or a cell line transfected with a nucleic acid molecule according to claim 7.

9) A composition, especially a pharmaceutical composition comprising as active substance at least one nucleic acid molecule according to claim 7 or a cell or cell line according to claim 8, optionally combined in the composition with a compatible excipient.