EP1563073A2 - Protein production methods and modified cells for use therein - Google Patents
Protein production methods and modified cells for use thereinInfo
- Publication number
- EP1563073A2 EP1563073A2 EP03739320A EP03739320A EP1563073A2 EP 1563073 A2 EP1563073 A2 EP 1563073A2 EP 03739320 A EP03739320 A EP 03739320A EP 03739320 A EP03739320 A EP 03739320A EP 1563073 A2 EP1563073 A2 EP 1563073A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cell
- bci
- protein
- cells
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0018—Culture media for cell or tissue culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/36—Lipids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/48—Regulators of apoptosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
Definitions
- This invention relates the field of cell biology. More particularly, this invention relates to protein production by eukaryotic cells.
- Proteins produced by eukaryotic cells can have significant therapeutic value. Such proteins may be naturally produced by the eukaryotic cell, or the eukaryotic cell may be manipulated by recombinant molecular biology techniques to produce a heterologous protein. Non-limiting examples of proteins produced, either naturally or by artifice, include erythropoietin, insulin, and factor IX.
- ICA bioreactor run
- necrosis is a form of cell death that is typically due to a traumatic injury or insult to the cell. Shear forces and foaming are probable causes of necrosis in the bioreactor.
- Apoptosis also known as programmed cell death, is a form of cell death where, through a variety of signaling pathways, the cell self-destructs.
- apoptosis stimuli include growth factor withdrawal, the limitation of various nutrients and exposure to toxins.
- the invention provides methods for prolonging cell lifespan as a means for enhancing the cell's production of a protein, regardless of whether that protein is one naturally produced by the cell, or whether that protein is a heterologous protein to the cell.
- the invention provides a method for increasing production of a protein by a cell, comprising increasing expression of an anti-apoptosis gene in the cell, hi certain embodiments, the cell does not express a heterologous cyclin-dependent kinase inhibitor, hi particular embodiments, the cell is a human cell, a murine cell, a hamster cell, an insect cell, or an amphibian cell.
- the invention provides a method for increasing production of a protein by a cell, comprising increasing expression of a Bcl-x ⁇ gene in the cell, wherein the cell does not express a heterologous cyclin-dependent kinase inhibitor.
- the cell is a human cell, a murine cell, a hamster cell, an insect cell, or an amphibian cell.
- the invention provides a method for increasing the production of a heterologous protein by a cell, comprising increasing expression of a Bcl-x ⁇ gene in the cell, wherein the cell does not express a heterologous cyclin-dependent kinase inhibitor.
- the invention provides a cell comprising increased expression of an anti-apoptosis gene and does not express a heterologous cyclin- dependent kinase inhibitor, wherein the cell produced an increased amount of a protein as compared to a cell that does not comprise increased expression of the anti-apoptosis gene.
- the invention provides a cell comprising increased expression of a BCI-X L gene and does not express a heterologous cyclin-dependent kinase inhibitor, wherein the cell produced an increased amount of a protein as compared to a cell that does not comprise increased expression of the BCI-X L gene.
- the invention provides a cell comprising increased expression of an anti-apoptosis gene and a gene encoding a protein of interest, and does not express a heterologous cyclin-dependent kinase inhibitor, wherein the cell produced an increased amount of a protein of interest as compared to a cell that does not comprise increased expression of the anti-apoptosis gene.
- the invention provides a cell comprising increased expression of a BCI-X L gene and a gene encoding a protein of interest, and does not express a heterologous cyclin-dependent kinase inhibitor, wherein the cell produced an increased amount of a protein of interest as compared to a cell that does not comprise increased expression of the BCI-X L gene.
- the invention includes a cell comprising an increased amount of BCI-XL protein, where the cell does not express a heterologous cyclin-dependent kinase inhibitor.
- the cell can be a mammalian, rodent, insect, or amphibian cell, such as a human, murine, or hamster cell (e.g., a Chinese hamster ovary cell).
- the cell can be adapted for growth in suspension or for growth in a medium free of serum (e.g., fetal bovine serum).
- the medium used for culturing the cell, whether free of serum or not, can further contain butyrate (e.g., sodium butyrate) to increase protein yields.
- the BCI-X L protein can be expressed from an expression vector introduced into the cell or made to overexpress the endogenous BCI-X L gene of the cell, e.g., by inducing the endogenous promoter of the gene.
- the BCI-X L protein can be of a species different than that of the cell.
- the human BCI-X L protein can be expressed in Chinese hamster ovary cells to obtain the cells and methods of the invention.
- the cells of the invention are especially useful for robust production of proteins, either already produced by the cell or exogenously produced by introducing of an expression vector encoding the protein (e.g., a secreted protein).
- the cells of the invention are used to express a cloned monoclonal antibody
- the cell can contain one vector that expresses both the heavy and light chain or two vectors, each expressing a heavy or light chain.
- the invention further includes a method of producing a polypeptide by culturing a cell of the invention and purifying the polypeptide from the cell culture.
- Fig. 1 A is a schematic representation of the BCI-X L -neo plasmid, a non-limiting vector of the invention.
- the expression of BCI-X L in this vector is driven by the CMV immediate-early promoter and the neomycin gene provides the selection marker (for resistance in the presence of G418).
- Figs. 2A and 2B are schematic representations of growth curves showing viable cell density (VCD) over time (Fig. 2A) and percentage viabilities (% viability) over time (Fig. 2B) for five out often non-limiting Bcl-x ⁇ transfected Chinese Hamster Ovary (CHO) DG44 cells and two controls (i.e., the untransfected DG44 host and the DG44 transfected with empty vector).
- VCD viable cell density
- % viability percentage viability
- Figs. 3 A and 3B are schematic representations of growth curves showing DG44/
- BCI-X L clone #3 a non-limiting clone of the invention, and two controls (i.e., the untransfected DG44 CHO host and the DG44 CHO cells transfected with empty vector) cultured in the absence of G418 as measured by viable cell density (VCD) over time shown (Fig. 3A) and percentage viability (% viability) (Fig. 3B).
- VCD viable cell density
- Fig. 4 is a bar graph showing caspase-3 activity, as measured daily for twelve days, in a non-limiting BCI-X L transfected cells of the invention, DG44/ BCI-X L #3 (black bars), DG44 CHO cells transfected with empty vector (medium gray bars), and untransfected DG44 CHO cells (light gray bars).
- Fig. 5 is a representation of a Western blotting analysis probing cell lysates of the following non-limiting cells of the invention: DG44/ BCI-XL #3 cells (left lane), DG44/ BCI-X L #8 cells (middle lane), and DG44 CHO cells transfected with empty vector (right lane) with a murine monoclonal antibody that specifically binds to human BCI-X L protein.
- Figs. 6 A and 6B are schematic representations of growth curves showing viable cell density (VCD) over time (Fig. 6A) and percentage viabilities (% viability) over time (Fig. 6B) for the following non-limiting cells of the invention: DG44/ BCI-X L #3 (black circles), DG44/ Bcl-x L #8 (blue triangles), and the untransfected DG44 host (open circles).
- Fig. 7 A is a schematic representation of the BCI-X L -zeo plasmid, a non-limiting vector of the invention. The expression of Bcl-xL in this vector is driven by the CMV immediate-early promoter and the zeocin gene provides the selection marker (for resistance in the presence of zeocin).
- Fig. 7B is a schematic representation of a flow cytometry histogram showing expression of AQC2 by parent 100AB-37 cells (grey [green] line) and the pool of Bcl- X L transfected 1 OOAB-37 cells (bold black [blue] line) as determined by staining with an antibody that specifically binds to AQC2 .
- the control black line was DG44 host cells stained with the same anti-AQC2 antibody
- Figs. 8 A and 8B are schematic representations of growth curves showing viable cell density (VCD) over time (Fig. 8A) and percentage viabilities (% viability) over time (Fig. 8B) for the following non-limiting cells of the invention: 1 OOAB-37/ BCI-X L isolate #11 (purple diamonds), 1 OOAB-37/ Bcl-x L isolate #21 (black triangles), 1 OOAB- 37/ BCI-X L isolate #25 (red circles), and 100AB-37 parent (blue circles).
- VCD viable cell density
- Fig. 8A percentage viabilities
- % viability percentage viability
- Fig. 9 is a line graph showing the AQC2 titer from for the following non- limiting cells of the invention: 1 OOAB-37/ BCI-X L isolate #11 (purple diamonds), 100AB-37/ Bcl-x L isolate #21 (black triangles), 100AB-37/ Bcl-x L isolate #25 (red circles), and 100AB-37 parent (blue circles).
- the lOOAB-37/ BCI-X L isolates demonstrated significantly higher titers and up to 80% increase in throughput cultured in spinner flasks.
- 11 is a line graph showing the AQC2 titer from the following non-limiting cells of the invention: 100AB-37 parent run 1 (open triangles), 100AB-37 parent run 2 (open squares), 100AB-37/ Bcl-x L isolate #21, run 1 (black triangles), and lOOAB-37/ BCI-X L isolate #21, run 2 (red squares) in 2 liter model bioreactors.
- Figs. 12A and 12B are schematic representations of growth curves showing viable cell density (VCD) over time (Fig. 12 A) and percentage viabilities (% viability) over time (Fig. 12B) for the following non-limiting cells of the invention: 100AB- 37/21.15 BCI-X L (green squares) and 37.32 ⁇ BCI-X (open diamonds) cultured in spinners in chemically defined growth media (CDM).
- VCD viable cell density
- Fig. 12A percentage viabilities
- CDM chemically defined growth media
- Fig. 13 is a line graph showing the AQC2 titer from the following non-limiting cells of the invention: 100AB-37/21.15 BCI-X L (green squares; lead Bcl-X L -expressing subclone) and 37.32 ⁇ BCI-X L (open diamonds; lead subclone of parent) cultured in spinners in chemically defined growth media (CDM).
- CDM chemically defined growth media
- Fig. 14 is a bar graph showing caspase-3 activity, as measured daily for twelve days, in the following non-limiting cells of the invention: 21.15 BCI-X L (red bars; lead Bcl-XL-expressing subclone) and 37.32 ⁇ BCI-X L (gray bars; lead subclone of parent).
- Fig. 15 is a bar graph showing the amount of AQC2 secretion by the following non-limiting cells of the invention: 100AB-37 parent cells, 100AB-37.32 ⁇ BC1-X L cells (lead subclone of parent), 100AB-37-21 Bcl-x L cells, and lOOAB-37-21.15 Bcl-x cells (lead BCI-X L expressing subclone) in the absence (white bars) or presence (black bars) of 2 mM sodium butyrate in shaker flasks.
- Fig. 16 is a bar graph of percent viability for the following non-limiting cells of the invention: 100AB-37 parent cells, 100AB-37.32 ⁇ Bcl-x L cells (lead subclone of parent), 100AB-37.21 Bcl-x L cells, and lOOAB-37-21.15 Bcl-x L cells (lead Bcl-x L expressing subclone) in the absence (white bars) or presence (red bars) of 2 mM sodium butyrate in shaker flasks.
- 17 is a bar graph showing caspase-3 activity in the following non-limiting cells of the invention: lOOAB-37 parent cells, 100AB-37.32 ⁇ Bcl-x L cells (lead subclone of parent), lOOAB-37-21 Bcl-x L cells, and lOOAB-37-21.15 Bcl-x L cells (lead BCI-X L expressing subclone) in the absence (blue bars) or presence (red bars) of 2 mM sodium butyrate in shaker flasks.
- the present invention stems from the inventors' unexpected discovery that when an anti-apoptosis gene (e.g., Bcl-x£) is expressed in a cell, that cell produces more protein. Surprisingly, cells co-expressing the anti-apoptosis gene and a second protein (e.g., a heterologous protein) do not show an increase in the number of viable cells.
- an anti-apoptosis gene e.g., Bcl-x£
- a second protein e.g., a heterologous protein
- the invention allows for methods to increase protein production by a cell, both in vitro (i.e., in tissue culture) and in vivo.
- anti-apoptosis gene the gene encoding the Bcl-2 protein or the gene encoding the BCI-X L protein (or other nucleic acid (e.g., cDNA or mRNA) encoding Bcl-2 protein or BCI-X L protein, respectively), regardless of what species the genes are from.
- the BCI-X L gene may be from a human (GenBank Accession No. Z23115 or L20121 ; Boise et al., Cell 74(4): 597-608,1993).
- Other non-limiting BCI-XL anti-apoptosis genes of the invention include the feline BCI-X L gene (GenBank Accession No.
- the cell is a human cell, a murine cell, a hamster cell, an insect cell, or an amphibian cell.
- the invention provides a method for increasing the production of a heterologous protein by a cell, comprising increasing expression of an anti- apoptosis gene in the cell. In some embodiments, wherein the cell does not express a heterologous cyclin-dependent kinase inhibitor.
- increasing the expression is meant that the expression level of an anti-apoptosis gene in a cell is increased as compared to the expression level in the starting cell.
- any expression of a protein encoded by the anti-apoptosis gene is increasing the expression of that anti-apoptosis gene.
- the parent cell naturally expresses some level of protein encoded by the anti-apoptosis gene
- “increasing the expression” of the apoptosis gene results in an increased level of protein as compared to the level expressed by the parent cell.
- by “expressing” or “expression” is meant that the anti-apoptosis gene is transcribed and/or translated in the cell to produce a protein.
- the human Bcl-x ⁇ gene is expressed in a murine cell, that murine cell produces human BCI-X L protein.
- a cell in accordance with the invention, is induced to increase production of a protein by increasing the expression of an anti-apoptosis gene in that cell, the protein the cell is increasing production of is not encoded by the anti-apoptosis gene.
- the native Bcl- X L gene is expressed in a murine cell, then, in accordance with the invention, the murine cell that expresses an increased level of its native murine BCI-X L protein also increases production of a non-Bcl-XL protein.
- a protein of the invention can be any protein except for the protein encoded by the anti-apoptosis gene expressed in that cell.
- the protein can be a secreted protein, a transmembrane protein, or an intracellular protein.
- proteins include antibodies, hormones (e.g., follicle-stimulating hormone), insulin, nuclear proteins, ribosomal proteins, erythropoietin, cytokines (e.g., interleukin-2 or ⁇ -interferon), and blood factors (e.g., Factor IX).
- the protein can be a native protein to the cell, or can be a heterologous protein to the cell.
- native protein is meant a protein encoded by a nucleic acid molecule that naturally occurs in the cell.
- a human protein is one that is native to that cell.
- the AQC2 antibody preferably comprises the same heavy and/or light chain sequences as the antibody produced by one of the following hybridoma cell lines, all of which have been deposited with the American Type Culture Collection (Manassas, Virginia, USA) in accordance with the Budapest Treaty: mAQC2 (ATCC Accession No. PTA3273, deposited April 18, 2001); hAQC2 (ATCC Accession No. PTA3275, deposited April 18, 2001); haAQC2 (ATCC Accession No. PTA3356, deposited May 4, 2001); and hsAQC2 (ATCC Accession No. PTA3274, deposited April 18, 2001). These antibodies are described in PCT Publication No. WO02/083854.
- the invention encompasses the increased production of an antibody by a cell, including a hybridoma cell.
- a hybridoma cell comprises a nucleic acid molecule encoding a particular monoclonal antibody
- improved production of that monoclonal antibody by that cell can be achieved, in accordance with the invention, by expression of an anti-apoptosis gene in that hybridoma cell.
- the cell expressing an anti-apoptosis gene does not express a heterologous cyclin-dependent kinase inhibitor (i.e., a cyclin- dependent kinase inhibitor encoded by a nucleic acid molecule that does not naturally occur in the cell).
- a heterologous cyclin-dependent kinase inhibitor i.e., a cyclin- dependent kinase inhibitor encoded by a nucleic acid molecule that does not naturally occur in the cell.
- the heterologous cylin-dependent kinase inhibitor is p27.
- the heterologous cylin-dependent kinase inhibitor is p21.
- a new cell line is generated which has increased expression of an anti-apoptosis gene.
- an anti-apoptosis gene As described below, one such non-limiting cell line, Chinese Hamster Ovary cells, was generated. The anti-apoptosis human gene, BCI-X L , was expressed in these cells, generating a stable BCI-X L expressing cell line.
- the anti-apoptosis gene can also be turned on in a cell that has the gene, but does not express a protein encoded by the gene.
- a human cell comprises a human Bcl-x ⁇ gene, but that does not express human BCI-X L , can be induced to express human BCI-X L .
- Such a human cell is included within the scope of the invention.
- the BCI-X L expressing CHO cell may be used to produce increased amounts of a hamster protein.
- a nucleic acid molecule encoding a heterologous protein e.g., encoding human ⁇ - interferon
- the invention provides a cell comprising increased expression of an anti-apoptosis gene and that does not express a heterologous cyclin dependent kinase inhibitor, wherein the cell produces an increased amount of a protein as compared to a cell that does comprise increased expression the anti-apoptosis gene.
- an anti-apoptosis gene is increased in a cell already producing a protein of interest.
- a murine BCI-X L gene may be expressed in a human ⁇ -islet cell (i.e., that already produces human insulin), such that the cell produces more insulin.
- an anti-apoptosis gene may be expressed in a cell already expressing a heterologous protein (e.g., a CHO cell expressing human ⁇ - interferon), such that the cell having increased expression of an anti-apoptosis gene produces more heterologous protein than the cell that does not have an increased expression of the anti-apoptosis gene.
- the invention provides a cell comprising increased expression of an anti-apoptosis gene and a gene encoding a protein of interest, and does not express a heterologous cyclin-dependent kinase inhibitor, wherein the cell produced an increased amount of a protein of interest as compared to a cell that does not comprise increased expression of the anti-apoptosis gene.
- the Bcl-xi gene was isolated by using oligonucleotides designed to anneal to the 5' and 3' ends of the open reading frame (ORF) based on the sequence of Bcl-xL provided in Boise L.H. et al., Cell 74: 597-608: 1993 (also see GenBank Accession No. Z23115).
- sequences of the oligonucleotides used are as follows: 5* PCR primer 5'-GCCCrCG GATGTCTCAGAGCAACCGG-3' (SEQ ID NO: 1), where the italicized sequence is an added linker region with XhoI site; and 3'PCR primer 5'-GCCrC ⁇ 4G ⁇ TCATTTCCGACTGAAGAGTG -3'(SEQ ID NO: 2), where the italicized sequence is an added linker region with an Xbal site
- the BCI-X L gene was generated using the polymerase chain reaction (PCR; using PfuTurbo DNA polymerase, Cat# 600250, commercially available from Stratagene) from Human Brain, whole Marathon-ReadyTM cDNA (Clontech Laboratories, Palo Alto, CA).
- the expression vector, expression vector pcDNA3.1 (+) (commercially available form Promega, Madison, WI), was digested with Xhol and Xbal, and the Bcl- X PCR fragment was ligated into the linearized vector. This resulted in the plasmid pBcl-X L -neo schematically depicted in Fig. 1 A.
- the pBcl-X L -neo plasmid was used to transfect CHO-DG44 host cells using electroporation according to standard techniques (see, e.g., Ausubel et al., Current
- CHO cells are commercially available from the ATCC.
- CHO-DG44 cells as described in Urlaub, et al., Cell 33:405-412, 1983.
- the empty pcDNA3.1(+) vector was also transfected into CHO cells. After electroporation, the cells were grown for forty-eight hours in G418-free media, and then selected in the presence of 400 ug/ml G418 (neomycin). The living, adherent cells were selected while the dead, non-adherent cells were removed when the media was changed. After approximately two weeks, stable isolates were selected.
- Percentage viabilities for clones #2, 3, and 5 remained high on day 6 at 95, 96, and 87% respectively, whereas viabilities for DG44 (i.e., untransfected host) and DG44 vector alone (i.e., host cells transfected with empty vector) controls had fallen to 59 and 54% respectively.
- viabilities for clones #2, 3, and 5 were at 76, 79, and 81% respectively, whereas viabilities for DG44/neo (i.e., host cells transfected with empty vector) and DG44 controls (i.e., untransfected host) were at 46 and 14% respectively.
- the integral cell area is defined as the area under a growth profile curve representing the total number of live cells during the course of a culture run.
- DG44/ BCI-X L isolates and control transfected with empty vector alongside the untransfected control were cultured in the absence of G418.
- growth curves representing viable cell density (VCD) over time and percentage viability (% viability) over time were monitored.
- DG44/ BCI-X L clone #3 one exemplary DG44/ Bcl-x L isolate maintained both a higher and prolonged peak cell density of 4 x 10 6 cells/ml up to day 8.
- percent viability was at 90% on day 10 compared to 25% in the vector control (Fig. 3B), and the ICA (approximately 30 x 10 6 cells/ml for a 11-12 day run) was up to three fold higher than the DG44 host. This characteristic was stable up to at least 7 passages for isolates #2, 3, and 5, but not for #8 (see below).
- Caspase proteins cleave proteins after aspartic acid. It is known that the 3 or 4 amino acids prior to aspartic acid confer specificity. This allows the use of four amino acid labeled peptides to be used as substrates for caspases.
- the peptide substrate used had the amino acid sequence DEVD, with the D (i.e., the aspartic acid residues) labeled with a fluorimetric marker AMC (cat #P-411 , BIOMOL
- the marker fluoresces once cleavage has occurred. Thus, without cleavage, little or no signal was observed.
- Caspase-3 proteolytic activity was determined from lysates of CHO cells cultured as described in Example II daily for twelve days. Fluorescence of AMC from samples compared to samples treated with non-cleavable analogue DEVD-CHO (BIOMOL cat#P-410), allowed determination of the increase in caspase-3 activity.
- DG44/ BCI-X L #3 (a non-limiting Bcl-XL-transfected CHO cell generated according to Examples I and II) showed a delayed onset of peak caspase-3 proteolytic activity as compared to empty vector control cells (i.e., DG44 CHO cells transfected with empty vector) and DG44 CHO control cells (i.e., untransfected cells).
- empty vector control cells i.e., DG44 CHO cells transfected with empty vector
- DG44 CHO control cells i.e., untransfected cells.
- onset of peak caspase-3 proteolytic activity in DG44/ BCI-X L #3 occurred on day 11, with minimal activity exhibited on other days.
- the DG44 host alone exhibited over two fold higher peak activity as early as day 5, while the DG44/vector alone control showed close to peak activity starting on day 8 (see Fig. 4).
- BCI-XL was clearly expressed in DG44/ BCI-X L #3.
- no BCI-X L was expressed by either DG44/ BCI-X L #8 (middle lane, Fig. 5) or DG44 CHO cells transfected with empty vector (right lane, Fig. 5). The results were the same from isolates grown either in the presence or absence of G418 selection.
- DG44/ BCI-X L #8 when DG44/ BCI-X L #8 was grown in the absence of G418 for selection, it showed no enhanced survival as compared to untransfected DG44 CHO control cells. To do this, DG44/ BCI-X L #8 was released from G418 selection and evaluated against DG44/ BCI-X L #3 and the DG44 host control. Growth curves representing viable cell densities (VCD) over time and the percentage viabilities (% viability) were assessed as described in Example I. Although DG44/ BCI-X L #8 was G418 resistant with an improved ICA of approximately 50%, when the same cells were cultured in the absence of selection, the increase in ICA was not significant (see Fig. 6A). Moreover, the percent viability over time was not improved and in fact fared worse than the control (see Fig. 6B).
- Example II a second construct was generated as described above in Example I, but with the zeocin resistance gene. Briefly, the BCI-XL PCR fragment (see Example I) was cloned into the Xho ⁇ and Xbal sites of expression vector pcDN A3.1/Zeo (+) (Promega, Madison, WI), where expression is driven by the CMV immediate-early promoter and the zeocin gene provides selection marker, to yield final plasmid pBcl-X L - zeo. A schematic representation of this plasmid is depicted in Fig. 7 A.
- the pBcl-X L -zeo plasmid was used to transfect (by electroporation) the cell line 1 OOAB-37, which is a DG44 CHO cell previously transfected with a nucleic acid molecule encoding the monoclonal antibody, AQC2.
- the 1 OOAB-37 parent secretes the AQC2 monoclonal antibody with a specific productivity (s.p.) of 10 pg cell _1 day "1 .
- the 1 OOAB-37 cells transfected with the Bcl-X L -zeo plasmid were cultured in the presence of 600 ug/ml zeocin.
- productivity was higher for Bcl-X L -transfected cells, at 150 ⁇ g/ml for the 100AB-37/ Bcl-x L pool (2.24 x 10 6 /ml cells) compared to 105 ⁇ g/ml for the non-modified parent line (2.1 xlO 6 cells/ml).
- the titer of the secreted AQC2 was assayed by protein A-HPLC binding on the eight 100AB-37/ BCI-X L isolates evaluated as described above. As many as five out of the eight isolates examined had improved titer ranging from 306 to 434 ⁇ g/ml (see below) compared to the parent control of 236 ⁇ g/ml on day 12 of culture. As shown in Fig. 9, protein A titer data from clones 11, 21, and 25 shown previously to maintain higher % viabilities (see Figs. 8 A and 8B) indicated significant enhancement in productivity.
- 1 OOAB-37/ Bcl-x L isolates 11, 21, and 25 produced titers of 368, 441, and 522 ug/ml respectively compared to 288 ug/ml from the parent (% viability 62%).
- the increase in throughput (i.e., titer) of clones ranged from 28% for isolate #11 to as high as 81% for top isolate #21.
- the specific productivity was also enhanced in the lOOAB-37/ BCI-X L isolates (12 to 14 pg cell _1 day-l compared to 9 pg cell ' ay "1 ).
- Protein A titer data on day 14 was as shown below in Table II.
- Example V Further Characterization of the Bcl-x ⁇ _, Transfected Cell Line Secreting a Heterologous Protein Since lOOAB-37.21/ BCI-X L isolate, #21 was not verified as being clonal, both this isolate along with ⁇ BCI-X L 1 OOAB-37 were further subcloned, with the ⁇ BCI-X L 1 OOAB-37 isolate being a subclone of the untransfected parent 1 OOAB-37 cell line. This was done because the comparison of the most desirable subclone from each cell line would provide a more strict comparison between BCI-X L and ⁇ BCI-X L cell lines. To do this, an equivalent number of subclones was screened for each cell line.
- the CDM environment with markedly reduced protein content is more likely to predispose cells to apoptosis (Moore A. et al., Cytotechnology 17:1-11, 1995 and Zhangi et ah, Biotech Bioeng. 64:108-119, 1999).
- BCI-XL expression may provide a cell line that maintains robustness even under such media conditions.
- Protein A titer data on day 14 was as shown below in Table III.
- lead subclone 1 OOAB-37/21.15 Bcl-x L produced dramatically higher titers and up to 89% increase in throughput compared to lead subclone 37.32 ⁇ BCI-X L , even when cultured in chemically defined growth media (CDM).
- CDM chemically defined growth media
- caspase-3 was dramatically suppressed to control levels throughout the production run of clone 21.15 BCI-X L , whereas activity in 37.32 increased almost 10 fold of that of 21.15 on day 14 (see Fig. 14). That the BCI-X L expressing 21.15 BCI-X L cells exhibited minimal caspase-3 activity throughout the production run in CDM, demonstrated active suppression of apoptosis. The data clearly indicated significant delay in apoptosis in a cell line that overexpresses BCI-XL-
- caspase 3 activity a marker for apoptosis, was measured in the cells.
- Fig. 17 a significant delay in apoptosis was observed in cell lines overexpresing BCI-X L .
- Caspase activity in #21 and 21.15 BCI-X L cells was not completely suppressed in the presence of 2 mM butyrate, but was significantly diminished compared to 1 OOAB-37 and 37.32 ⁇ BCI-X L , which exhibited 4 fold greater activity (Fig. 17).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US39173802P | 2002-06-26 | 2002-06-26 | |
US391738P | 2002-06-26 | ||
US44049803P | 2003-01-16 | 2003-01-16 | |
US440498P | 2003-01-16 | ||
PCT/US2003/020207 WO2004003151A2 (en) | 2002-06-26 | 2003-06-26 | Protein production methods and modified cells for use therein |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1563073A2 true EP1563073A2 (en) | 2005-08-17 |
EP1563073A4 EP1563073A4 (en) | 2007-09-19 |
Family
ID=30003205
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP03739320A Withdrawn EP1563073A4 (en) | 2002-06-26 | 2003-06-26 | Protein production methods and modified cells for use therein |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1563073A4 (en) |
JP (2) | JP2006503555A (en) |
AU (2) | AU2003245702A1 (en) |
CA (1) | CA2491212A1 (en) |
WO (1) | WO2004003151A2 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100454016B1 (en) * | 2002-01-05 | 2004-10-26 | 한국과학기술원 | Novel DHFR-deficient CHO cell line transfected with anti-apoptotic gene, method for preparation thereof and method for production of target proteins using the same |
US7531327B2 (en) * | 2004-07-23 | 2009-05-12 | Immunomedics, Inc. | Methods and compositions for increasing longevity and protein yield from a cell culture |
EP2209891A1 (en) * | 2007-11-13 | 2010-07-28 | Boehringer Ingelheim Pharma GmbH & Co. KG | Improving the secretory capacity in host cells |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1348758A1 (en) * | 2002-03-28 | 2003-10-01 | Boehringer Ingelheim Pharma GmbH & Co.KG | Host cells having improved cell survival properties and methods to generate such cells |
EP1468079A1 (en) * | 2002-01-05 | 2004-10-20 | Korea Advanced Institute of Science and Technology | Dhfr-deficient cho cell line transfected with an anti-apoptotic gene, method for preparation thereof, and method for producing target protein using the same |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU6163196A (en) * | 1995-06-07 | 1996-12-30 | Smithkline Beecham Corporation | Method for obtaining receptor agonist antibodies |
US6218181B1 (en) * | 1998-03-18 | 2001-04-17 | The Salk Institute For Biological Studies | Retroviral packaging cell line |
-
2003
- 2003-06-26 WO PCT/US2003/020207 patent/WO2004003151A2/en active Search and Examination
- 2003-06-26 CA CA002491212A patent/CA2491212A1/en not_active Abandoned
- 2003-06-26 EP EP03739320A patent/EP1563073A4/en not_active Withdrawn
- 2003-06-26 JP JP2004517898A patent/JP2006503555A/en not_active Withdrawn
- 2003-06-26 AU AU2003245702A patent/AU2003245702A1/en not_active Abandoned
-
2010
- 2010-03-29 AU AU2010201256A patent/AU2010201256A1/en not_active Abandoned
- 2010-10-15 JP JP2010233087A patent/JP2011004771A/en not_active Ceased
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1468079A1 (en) * | 2002-01-05 | 2004-10-20 | Korea Advanced Institute of Science and Technology | Dhfr-deficient cho cell line transfected with an anti-apoptotic gene, method for preparation thereof, and method for producing target protein using the same |
EP1348758A1 (en) * | 2002-03-28 | 2003-10-01 | Boehringer Ingelheim Pharma GmbH & Co.KG | Host cells having improved cell survival properties and methods to generate such cells |
Non-Patent Citations (13)
Title |
---|
CHIANG GISELA G ET AL: "Bcl-x(L) mediates increased production of humanized monoclonal antibodies in chinese hamster ovary cells" BIOTECHNOLOGY AND BIOENGINEERING, vol. 91, no. 7, September 2005 (2005-09), pages 779-792, XP002446137 ISSN: 0006-3592 * |
FIGUEROA B ET AL: "A COMPARISON OF THE PROPERTIES OF A BCL-XL VARIANT TO THE WILD-TYPE ANTI-APOPTOSIS INHIBITOR IN MAMMALIAN CELL CULTURES" METABOLIC ENGINEERING, ACADEMIC PRESS,, US, vol. 5, no. 4, October 2003 (2003-10), pages 230-245, XP008064154 ISSN: 1096-7176 * |
FUSSENEGGER M ET AL: "CONTROLLED PROLIFERATION BY MULTIGENE METABOLIC ENGINEERING ENHANCES THE PRODUCTIVITY OF CHINESE HAMSTER OVARY CELLS" NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 16, no. 5, May 1998 (1998-05), pages 468-472, XP001093788 ISSN: 1087-0156 * |
FUSSENEGGER M. ET AL: "Regulated overexpression of the survival factor bcl-2 in CHO cells increases viable cell density in batch culture and decreases DNA release in extended fixed-bed cultivation" CYTOTECHNOLOGY, vol. 32, no. 1, 1 January 2000 (2000-01-01), pages 45-61, XP002326419 KLUWER ACADEMIC PUBLISHERS, DORDRECHT, NL * |
GOSWAMI J ET AL: "Apoptosis in batch cultures of Chinese hamster ovary cells" BIOTECHNOLOGY AND BIOENGINEERING, WILEY & SONS, HOBOKEN, NJ, US, vol. 62, no. 6, 20 March 1999 (1999-03-20), pages 632-640, XP002326418 ISSN: 0006-3592 * |
JOEL CHARBONNEAU ET AL: "Protection of hybridoma cells against apoptosis by a loop domain-deficient Bcl-xL protein" CYTOTECHNOLOGY, KLUWER ACADEMIC PUBLISHERS, DO, vol. 37, no. 1, 1 September 2001 (2001-09-01), pages 41-47, XP019236711 ISSN: 1573-0778 * |
JUNG D. ET AL: "Inducible expression of Bcl-XL restricts apoptosis resistance to the antibody secretion phase in hybridoma cultures" BIOTECHNOLOGY AND BIOENGINEERING, vol. 79, no. 2, 21 May 2002 (2002-05-21), - 20 July 2002 (2002-07-20) pages 180-187, * |
KIM N S ET AL: "Overexpression of bcl-2 inhibits sodium butyrate-induced apoptosis in Chinese hamster ovary cells resulting in enhanced humanized antibody production" BIOTECHNOLOGY AND BIOENGINEERING - COMBINATORIAL CHEMISTRY, WILEY, NEW YORK, NY, US, vol. 71, no. 3, 2000, pages 184-193, XP002208594 * |
MASTRANGELO A J ET AL: "Part II. Overexpression of bcl-2 family members enhances survival of mammalian cells in response to various culture insults" BIOTECHNOLOGY AND BIOENGINEERING, WILEY & SONS, HOBOKEN, NJ, US, vol. 67, no. 5, 5 March 2000 (2000-03-05), pages 555-564, XP002326420 ISSN: 0006-3592 * |
MASTRANGELO ALISON J ET AL: "Part I. Bcl-2 and bcl-xL limit apoptosis upon infection with alphavirus vectors" BIOTECHNOLOGY AND BIOENGINEERING, WILEY & SONS, HOBOKEN, NJ, US, vol. 67, no. 5, 5 March 2000 (2000-03-05), pages 544-554, XP002217633 ISSN: 0006-3592 * |
MEENTS H ET AL: "Impact of coexpression and coamplification of sICAM and antiapoptosis determinants bcl-2/bcl-x(L) on productivity, cell survival, and mitochondria number in CHO-DG44 grown in suspension and serum-free media" BIOTECHNOLOGY AND BIOENGINEERING, WILEY & SONS, HOBOKEN, NJ, US, vol. 80, no. 6, 20 December 2002 (2002-12-20), pages 706-716, XP002251640 ISSN: 0006-3592 * |
See also references of WO2004003151A2 * |
ZANGHI JAMES A ET AL: "Serum protects protein-free competent Chinese hamster ovary cells against apoptosis induced by nutrient deprivation in batch culture" BIOTECHNOLOGY AND BIOENGINEERING, vol. 64, no. 1, 5 July 1999 (1999-07-05), pages 108-119, XP002446136 ISSN: 0006-3592 * |
Also Published As
Publication number | Publication date |
---|---|
EP1563073A4 (en) | 2007-09-19 |
AU2003245702A1 (en) | 2004-01-19 |
WO2004003151A2 (en) | 2004-01-08 |
CA2491212A1 (en) | 2004-01-08 |
WO2004003151A3 (en) | 2005-06-23 |
AU2010201256A1 (en) | 2010-04-22 |
JP2011004771A (en) | 2011-01-13 |
JP2006503555A (en) | 2006-02-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1254216B1 (en) | Improved galactosylation of recombinant glycoproteins | |
EP2300600B1 (en) | Methods for improving viability and productivity in cell culture | |
CA2480684C (en) | Host cells having improved cell survival properties and methods to generate such cells | |
EP2707488B1 (en) | Enhancement of protein production yield mediated by a fast shuttling cdc42 gtpase | |
EP2010565A1 (en) | Method for recombinant protein production in cho cells | |
US9340592B2 (en) | CHO/CERT cell lines | |
AU2010201256A1 (en) | Protein Production Methods and Modified Cells for Use Therein | |
Lee et al. | Development of apoptosis‐resistant dihydrofolate reductase‐deficient Chinese hamster ovary cell line | |
KR20090112725A (en) | Improvement of cell growth | |
US20030219871A1 (en) | Host cells having improved cell survival properties and methods to generate such cells | |
AU744484B2 (en) | Method for increasing secretion of proteins in eukaryotic host cells | |
WO2001059075A9 (en) | Improved sialylation of glycoproteins | |
KR101452286B1 (en) | Method for culturing cell expressing gdf5 as single clone in serum free medium with mtx and zeocin | |
EP4330383A1 (en) | Hypersialylating cells | |
TWI304094B (en) | Use of aminoglycoside resistance gene | |
JP2012125197A (en) | Method for producing protein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20050118 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
DAX | Request for extension of the european patent (deleted) | ||
REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1081989 Country of ref document: HK |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 20070822 |
|
17Q | First examination report despatched |
Effective date: 20071213 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
18W | Application withdrawn |
Effective date: 20101014 |
|
REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1081989 Country of ref document: HK |