Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/19—Cytokines; Lymphokines; Interferons
  • A61K38/20—Interleukins [IL]
  • A61K38/2013—IL-2
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K40/00—Cellular immunotherapy
  • A61K40/10—Cellular immunotherapy characterised by the cell type used
  • A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K40/00—Cellular immunotherapy
  • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
  • A61K40/41—Vertebrate antigens
  • A61K40/42—Cancer antigens
  • A61K40/4271—Melanoma antigens
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K40/00—Cellular immunotherapy
  • A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
  • A61K40/41—Vertebrate antigens
  • A61K40/42—Cancer antigens
  • A61K40/4271—Melanoma antigens
  • A61K40/4273—Glycoprotein 100 [Gp100]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
  • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
  • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
  • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
  • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/06—Animal cells or tissues; Human cells or tissues
  • C12N5/0602—Vertebrate cells
  • C12N5/0634—Cells from the blood or the immune system
  • C12N5/0636—T lymphocytes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
  • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
  • A61K2239/57—Skin; melanoma

Definitions

• the present invention relates to methods of preparing autologous T- lymphocytes and tumor-infiltrating lymphocytes that express interleukin-2 (IL-2) and related compositions and methods of use in the treatment of cancer.
• IL-2 interleukin-2
• the present invention provides a method of preparing autologous T- lymphocytes for re-introduction into a patient having cancer.
• the method comprises:
• PBMCs peripheral blood mononuclear cells
• transducing the PBMCs with a retroviral vector which (a) comprises and expresses a human IL-2 coding sequence operably linked to a retroviral promoter, (b) does not comprise an exogenously introduced gene that enables phenotypic selection, and (c) comprises a viral envelope that efficiently transduces CD8+ T-lymphocytes, whereupon autologous T-lymphocytes are prepared for re-introduction into a patient having cancer.
• a composition comprising T lymphocytes obtained in accordance with the above method is also provided. Seventy-five percent or more of the T-lymphocytes in the composition are CD8+, and the cells do not contain an exogenously introduced gene that enables phenotypic selection.
• the present invention provides a method of treating a patient having cancer.
• the method comprises administering to the patient autologous T-lymphocytes, which have been prepared in accordance with the above method, alone or in further combination with human IL-2 receptor ⁇ -chain, in amount(s) sufficient to treat the patient for cancer.
• the present invention further provides a method of preparing autologous tumor-infiltrating lymphocytes (TILs) for re-introduction into a patient having cancer.
• the method comprises:
• transducing the TILs which have been optionally stimulated with the antigen of the cancer in vitro, with a retroviral vector, which (a) comprises and expresses a human IL-2 coding sequence operably linked to a retroviral promoter, (b) does not contain an exogenously introduced gene that enables phenotypic selection, and (c) comprises a viral envelope that efficiently transduces CD8+ TILs, whereupon autologous TILs are prepared for re-introduction into a patient having cancer.
• a retroviral vector which (a) comprises and expresses a human IL-2 coding sequence operably linked to a retroviral promoter, (b) does not contain an exogenously introduced gene that enables phenotypic selection, and (c) comprises a viral envelope that efficiently transduces CD8+ TILs, whereupon autologous TILs are prepared for re-introduction into a patient having cancer.
• a composition comprising TILs obtained in accordance with the above method is also provided. Seventy-five percent or more of the TILs are CD8+, and the cells do not contain an exogenously introduced gene that enables phenotypic selection.
• the present invention provides another method of treating a patient having cancer.
• the method comprises administering to the patient autologous TILs, which have been prepared in accordance with the above method, alone or in further combination with human IL-2 receptor ⁇ -chain, in amount(s) sufficient to treat the patient for cancer.
• the present invention is predicated on the discovery that anti-tumor T- lymphocytes can be genetically modified to make their proliferation IL-2-independent without malignant transformation and/or immortalization.
• the T-lymphocytes are particularly valuable in the adoptive immunotherapeutic treatment of cancer patients.
• the present invention provides a method of preparing autologous T- lymphocytes or autologous TILs for re-introduction into a patient having cancer.
• the method comprises obtaining autologous T-lymphocytes or TILs from the patient. While any suitable source of T-lymphocytes can be used, PBMCs are a preferred source. Suitable sources of T-lymphocytes, such as PBMCs, and TILs can be isolated from the patient in accordance with methods known in the art.
• the patient, from whom the T-lymphocytes are obtained has been immunized with an antigen of the cancer in accordance with methods known in the art (see, e.g., Rosenberg et al., Nat.
• the prior immunization of the patient with an antigen of the cancer is optional.
• the antigen of the cancer is one that induces a strong immune response against the cancer in the patient.
• the cancer is melanoma
• the patient is immunized with gplOO, more preferably amino acids 209-217 of gplOO, and most preferably amino acids 209-217 of gplOO with a methionine substitution at position 210, referred to herein as 209-2M peptide.
• Her- 2 Neu is a preferred antigen for immunization of a patient to be treated for breast cancer.
• the patient has prostate cancer
• the patient is immunized with prostate-specific antigen (PSA).
• PSA prostate-specific antigen
• a patient with colon cancer is preferably immunized with carcinoembryonic antigen (CEA).
• CEA carcinoembryonic antigen
• the cells are stimulated with the antigen of the cancer in vitro.
• the in vitro stimulation of the TILs with the antigen of cancer is optional.
• the cells can be stimulated in vitro with the antigen of the cancer to be treated by any suitable manner. A preferred manner is exemplified in the Examples set forth herein.
• the antigen used to stimulate the cells in vitro is the same antigen used to immunize the patient.
• Stimulate “stimulated,” and “stimulation” are all used to refer to the phenomenon of the T-cell receptor complex binding to a stimulus, such as a specific stimulus, e.g., a cancer antigen, or a non-specific stimulus, e.g., an anti-CD3 antibody (OKT3, for example, which is available from Orthoclone, Ortho-biotech, Raritan, NJ) or phytohemagglutinin (PHA), which results in cellular proliferation and the manifestation of anti-tumor activity.
• a stimulus such as a specific stimulus, e.g., a cancer antigen, or a non-specific stimulus, e.g., an anti-CD3 antibody (OKT3, for example, which is available from Orthoclone, Ortho-biotech, Raritan, NJ) or phytohemagglutinin (PHA), which results in cellular proliferation and the manifestation of anti-tumor activity.
• a stimulus such as a specific stimulus, e.g., a cancer antigen,
• the cells are transduced with a retroviral vector, which comprises and expresses a human IL-2 coding sequence operably linked to a retroviral promoter, i.e., the retroviral 5' long terminal repeat (LTR) promoter, and which comprises a viral envelope that efficiently transduces CD8+ T-lymphocytes.
• a retroviral promoter i.e., the retroviral 5' long terminal repeat (LTR) promoter
• LTR long terminal repeat
• the coding sequence of a human IL-2 is available (see, e.g., Liu et al., J. Immunol. 167: 6356-6365 (2001)).
• a coding sequence such as that which encodes human IL-2
• a retroviral promoter is within the ordinary skill in the art. See, e.g., Sambrook and Russell, Molecular Cloning, 3rd Ed., SCHL Press (2001). If it is desired to increase the expression of IL-2, the retroviral promoter can be replaced with a stronger promoter, such as the cytomegaloviral (CMV) promoter, such as in the context of a CMMP retroviral construct (Klein et al., J. Exp. Med. 191 : 1699-1709 (2000)).
• CMV cytomegaloviral
• the retroviral vector must comprise a viral envelope that efficiently transduces CD8+ T-lymphocytes.
• a preferred viral envelope is that of gibbon ape leukemia virus (GALV), which can be provided by the packaging cell line PG13.
• GLV gibbon ape leukemia virus
• the retroviral vector can be packaged in the cell line PA317.
• Transduction of cells with retroviral vectors is within the skill in the art. See, e.g., Sambrook (2001), supra.
• the culture of PBMCs, TILs and transduced PBMCs and TILs is also within the skill in the art. See, e.g., the Examples herein.
• IL-2-transduced PBMC self-regulate their growth by down-regulation of the expression of the transduced IL-2 gene.
• IL- 2-transduced CD8+ TILs can secrete IL-2 upon tumor antigen stimulation, can proliferate in the absence of exogenous IL-2 after the destruction of autologous tumor cells, without the help of CD4+ cells, and can self-select for their growth in the absence of added IL-2.
• the retroviral vector can further comprise and express a human IL-2 receptor ⁇ -chain (otherwise referred to as CD25 or Tac) coding sequence.
• a human IL-2 receptor ⁇ -chain is available (see, e.g., Waldmann, T. of Biol. Chem. 266: 2681-2684 (1991)).
• the coding sequence of a human IL-2 receptor ⁇ -chain can be operably linked to a retroviral promoter as described above.
• a separate vector comprising and expressing a human IL-2 receptor ⁇ -chain coding sequence can be introduced into the cell.
• any suitable vector can be used and any suitable vector can be operably linked to the IL-2 receptor ⁇ -chain coding sequence as appropriate for the vector of choice, desirably the vector does not adversely affect the efficient transduction of CD8+ T- lymphocytes with the retroviral vector comprising and expressing a human IL-2 and does not adversely effect the expression of IL-2 therein.
• the vector is a retroviral vector, such as GALV, and the IL-2 receptor ⁇ -chain coding sequence is operably linked to a retroviral promoter.
• the present invention further provides a composition comprising T-lymphocytes or TILs obtained in accordance with the above methods.
• T-lymphocytes or TILs obtained in accordance with the above methods.
• 75% or more of the T-lymphocytes or TILs are CD8+
• the cells do not contain an exogenously introduced gene that enables phenotypic selection
• the composition is suitable for re-introduction into the patient from whom the T-lymphocytes were obtained.
• the composition can contain various other components as known in the pharmaceutical arts. See, e.g., Remington's Pharmaceutical Sciences, 17th ed., (Mack Publishing Company, Philadelphia, PA: 1985).
• the present invention provides a method of treating a patient having cancer.
• the method comprises administering to the patient autologous T-lymphocytes or TILs, which have been prepared in accordance with the above methods.
• the autologous T-lymphocytes or TILs can be administered by any suitable route as known in the art.
• the T-lymphocytes or TILs preferably are administered intravenously, although the T-lymphocytes or TILs can be administered intra-arterially.
• 3 x 10 11 autologous T-lymphocytes or TILs are administered as a single dose. If necessary, a second dose can be administered after about 6-8 weeks.
• the method can further comprise the administration of human IL-2 receptor ⁇ -chain, whether encoded in the vector encoding human IL-2, or encoded in a separate vector for introduction into the T-lymphocytes or TILs.
• human IL-2 receptor ⁇ -chain whether encoded in the vector encoding human IL-2, or encoded in a separate vector for introduction into the T-lymphocytes or TILs.
• HBSS Hanks' balanced salt solution
• BioWhittaker Phenol red-free Hanks' balanced salt solution
• RPMI 1640 with L-Glutamine BioWhittaker) HEPES, 1 M, pFI 7.0, stock (BioWhittaker) 2-Mercaptoethanol, 5.5 x 10 "2 M in D-PBS, stock (Gibco BRL) Penicillin G sodium (10,000 units/ml), streptomycin (10,000 mg/ml) stock (BioWhittaker). Omit if patient is allergic to Penicillin.
• Gentamycin 50 mg/ml stock (BioFluids). Omit if patient is allergic to Gentamycin. Ciprofloxacin (Cipro 1% solution, Bayer). Omit if patient is allergic to Ciprofloxacin. Fungizone (250mcg/ml stock; Biofluids). Omit if patient is allergic to Fungizone.
• Aim V serum free lymphocyte growth medium (Gibco) 0.9% sodium chloride, USP (Baxter) Human Serum, type AB (Valley Biomedical) Human PBMCs Human albumin (Plasbumin-25, Bayer)) Recombinant human IL-2 (IO 6 CU/ml) (Cetus Oncology Div, Chiron * )
• OKT3 (Ortho-anti-CD3) (Orthoclone) g209-2M peptide 1.0 mg/ml stock (Multiple Peptide Systems)
• LSM Lymphocyte separation medium
• This example describes the construction of a retroviral vector comprising and expressing a human IL-2 coding sequence.
• the retroviral plasmid IL-2-IRES-eGFP see, e.g., Liu et al., J.
• This example describes the generation of gplOO-specific, melanoma- reactive, clonal lymphocytes retrovirally transduced with an exogenous IL-2 gene.
• CM Complete medium
• HEPES RPMI 1640 with 25 mM HEPES, pH 7.0, 1 mM Glutamine, 50 U/ml penicillin, 50 micrograms/ml streptomycin, 2xl0 "5 M 2-mercaptoethanol, and 10% human AB serum.
• PBMCs from patients are obtained 3-4 weeks after 209-2M immunization by leukopheresis. PBMCs are enriched by centrifugation on lymphocytes medium (LSM), washed two times with HBSS and cryopreserved at 1 x 10 cells/vial in one ml of human serum (Biowhittaker) with 10% dimethyl sulfoxide (DMSO). PBMCs from normal donors are prepared in a similar fashion.
• LSM lymphocytes medium
• DMSO dimethyl sulfoxide
• PBMCs are transferred directly into CM. PBMCs are washed twice v/ith CM, and an aliquot is counted. PBMCs (1.5 x 10 6 /ml) are plated in each of 4 wells of a 24-well tissue culture plate in 2 ml of CM. 209- 2M peptide is diluted 1 : 1 ,000 from stock to a final concentration of 1.0 ⁇ g/ml (approximately 1.0 icromolar). Plates are incubated at 37°C in 5% CO 2 .
• IL-2 is added to each well to 50 CU/ml final concentration.
• IU/ml IL-2 IU/ml IL-2. If cell density increases above 2x10 cells/ml, cells are split to half of the density and each new well is fed with 1 ml of CM plus 50 CU/ml IL-2.
• Retronectin-coated wells of a 6-well tissue culture plate Retronectin is coated as follows: 2 mis of 1 X PBS containing 50 ⁇ g/ml Retronectin is placed in each well of the 6-well plate at 4 °C overnight or at room temperature for 2 hours. Wells are blocked with 2 mis of 1% BSA in 1 X PBS at room temperature for 30 minutes and washed once with 2 mis of 1 X PBS containing 2.5% HEPES, pH 7.0 (v/v). PBMCs/TILs (2 x 10°) cell pellet is resuspended with 8 mis of the SBIL-2 retroviral supernatant, and this cell- virus mixture is applied to the Retronectin-coated plate.
• Cells are exposed to retroviral vector at 37 °C for 6 hours, harvested by centrifugation at 1,000 x g for 10 minutes at 4 °C, and resuspended again in 8 mis of fresh retroviral supernatant and left in the original Retronectin- coated wells overnight at 37 °C. The same transduction procedure is repeated twice on day 7 (total of 4 retroviral exposures in 2 consecutive days). At the end of transduction, cells are washed with CM and resuspended in a cell density of 0.5 x 10 6 /ml in CM supplemented with 50 CU/ml IL-2.
• PBMCs PBMCs are plated per well of a flat-bottom 96-well tissue culture plate with 1 x 10 5 target cells.
• target cells Typically, six different target cells are tested: T2 cells pulsed with 1.0 ⁇ M G280, T2 pulsed with 1.0 ⁇ M G209, two HLA-mismatched melanoma cell lines, and two HLA-A2- matched melanoma cell lines.
• supernatants are harvested and IFN- ⁇ is quantified by ELIS A capture assay.
• PBMCs Active bulk cultures are cloned by limiting dilution in 96-well U- bottom plates. Briefly, allogeneic PBMCs are prepared. PBMCs are obtained by thawing frozen leukopheresis vials from normal donors as described above. PBMCs are thawed directly into CM, washed twice, resuspended in CM, and then irradiated (34 Gy, Nordion gammacell 1000 Csl37 irradiator). Enough cloning reagents for 25 plates are mixed together: 500 ml of CM, 1.25 x 10 8 PBMCs, 30 ng/ml OKT3, and 50 CU/ml IL-2.
• Responder CTL for cloning are prepared by removing an aliquot of PBMCs from the most active bulk culture well, counting the cell number, washing the cells in CM, and resuspending.
• To 100 ml of the cloning reagent mixture are added 1,000 viable responder cells from bulk culture. These are mixed well and plated in 5 U-bottom plates (2 viable cells/well) using a repeating multichannel pipette.
• To the remaining 400 ml of cloning reagent mixture are added 1,200 viable cells. These are mixed well and plated in 20 U-bottom plates (0.6 viable cells/well) using a repeating multichannel pipette.
• the final components are listed below:
• one well receives an HLA-A2 matched tumor and the otlier well receives an HLA mismatched tumor.
• Cells are washed by spinning the plates, flicking the contents out of the wells, and applying 150 ⁇ l of fresh media to each well. After a 24 hr coincubation period, the supernatants are harvested and IFN- ⁇ secretion is quantified by ELISA. Wells with the highest antigen-specific IFN- ⁇ secretion are identified for further analyses of transduced IL-2 gene by PCR.
• T3 primer is specific for retroviral sequences and IL-2 primer 2 contains the sequence of the 3' end of the IL-2 gene. Only transduced IL-2 gene will be amplified. Clones that are positive for the transduced IL-2 gene will be chosen for further expansion by REP.
• REP Rapid Expansion Protocol
• PBMCs are thawed, washed twice, resuspended in CM and irradiated (34 Gy) as described above.
• PBMC and OKT3 are added to CM, mixed well, and aliquots are transferred to tissue culture flasks. Viable cells are added last. Flasks are incubated upright at 37 °C in 5 % CO 2 .
• IL-2 is added to 50 CU/ml.
• Cells are assayed for peptide specificity and tumor recognition by coincubation assay and ELISA. If cell density is greater than 1 x 10 6 /ml, ceils are split into additional flasks or transferred to Baxter 3 liter culture bags. IL-2 is added to 50 CU/ml. Fungizone is added to 1.25 mcg/ml and 1 ml/1 Cipro is added. [0043] On day 9, the most active clones are tested for their viability after IL-2 withdrawal. Cells (2 x IO 5 ) from each clone are washed with CM twice, resuspended in 200 ⁇ l CM and plated in wells of 96-well flat-bottom plate.
• the final product is prepared for patient infusion.
• the contents (cells and media) of flasks are transferred to 250 ml centrifuge tubes, while cells in Baxter culture bags are usually harvested using a Baxter/Fenwal continuous centrifuge cell harvester system. Aliquots will be taken from representative bags and pooled for a gram test. Cells will be spun to pellet (1,000 rpm, 15min, R/T) and combined in a single tube, then washed by resuspension in 0.9% sodium chloride followed by centrifugation, and finally resuspended in 45-150 ml of 0.9% sodium chloride. Human albumin (25%) is added to a final concentration of 2.5%. Aliquots are removed for cell count and viability testing by trypan blue exclusion, and for quality control testing. The final product is then infused intravenously as soon as possible.
• J0047J This example describes the generation of melanoma-reactive, IL-2- transduced TILs.
• TILs cultures derived from tumor fragments and/or digests are set up according to the procedures described in Example 2.
• TILs are transduced with SBIL-2 retroviral vector with or without REP, depending on their growth rates.
• a rapidly growing TILs culture is transduced without REP, whereas a slowly growing TILs culture needs a "transduction REP" to stimulate TILs for transduction.
• All SBIL-2-transduced TILs will undergo a REP to be expanded to the therapeutic number (treatment REP) before they are infused to autologous patients.
• Retronectin is coated as follows: 2 mis of 1 x PBS containing 50 ⁇ g/ml retronectin are placed in each well of a 24-well plate at 4 °C overnight or at room temperature for 2 hours. Wells are blocked with 2 mis of 1% human albumin in 1 x PBS at room temperature for 30 minutes, and washed once with 2 mis of 1 x PBS containing 2.5% HEPES, pH 7.0 (v/v).
• SBIL-2 retroviral supernatant (2 ml) will be applied to each Retronectin- coated well and incubated at 32 °C for 2 hours followed by 4-16 hours at 4 °C. Retroviral supernatant will be removed and 0.5 to 1 x IO 6 TILs in CM supplemented with 1,000 CU/ml IL-2 will be applied onto Retronectin and retroviral vector-coated wells. The culture is incubated at 37 °C, 5% CO 2 in an incubator overnight. This procedure is repeated daily for four days by transferring the TILs from previous transduction wells to wells freshly coated with SBIL-2 retroviral vector. At the end of transduction, cells are washed and maintained in CM supplemented with 1,000 CU/ml IL-2.
• TILs are stimulated with OKT3 (ORTHOCLONE OKT3®, obtained from commercial sources), irradiated allogeneic feeder cells and IL-2. All components are mixed together in a tissue culture flask, then TILs are added.
• OKT3 ORTHOCLONE OKT3®, obtained from commercial sources
• Allogeneic PBMCs are from frozen vials obtained from harvested
• PBMCs PBMCs.
• PBMCs are thawed, washed and resuspended in CM, and irradiated. Irradiation of allogeneic cells is performed in an MS Nordion Gammacell 1000, Model 38.3 irradiator, using 5000 rads from a Csl37 source. Testing includes a control culture flask containing only irradiated cells, to verify that they have not proliferated.
• IL-2 is added to 1 ,000 CU/ml.
• Retronectin is coated as follows: 2 mis of 1 x PBS containing 50 ⁇ g/ml Retronectin is placed in each well of a 6-well plate at 4 °C overnight or at room temperature for 2 hours. Wells are blocked with 2 mis of 1% human albumin in 1 x PBS at room temperature for 30 minutes and washed once with 2 mis of 1 x PBS containing 2.5% HEPES, pH 7.0 (v/v).
• SBIL-2 retroviral supernatant (8 ml) is applied to each Retronectin-coated well and incubated at 32 °C for 2 hours followed by 4-24 hours at 4 °C. Retroviral supernatant is removed and 1 x IO 6 TIL cells in CM-supplemented with 1,000 CU/ml IL-2 are applied onto Retronectin and retroviral vector-coated wells. The culture is incubated at 37 °C, 5% CO 2 overnight. This procedure is repeated on day 8 by transferring the TILs culture from previous transduction wells to the wells freshly coated with SBIL-2 retroviral vector. On day 9, cells are washed and maintained in CM supplemented with IL-2 in a new tissue culture flask. If the cell density increases above 2 x IO 6 cells/ml, cells are split to half of the density and fed with an equal volume of CM plus 1,000 CU/ml IL-2.
• GLV Gibbon Ape Leukemia Virus envelope gene-PCR and S + /L ' assays for replication-competent retro virus (RCR):
• SBIL-2-transduced TILs are sent to National Gene Vector Laboratory
• NSVL replication-competent retrovirus
• RCR replication-competent retrovirus
• Anti-melanoma activity assay for the SBIL-2-transduced and untransduced TIL cells [0056] Briefly, 1 x 10 5 effector cells per well of a flat-bottom 96-well tissue culture plate are coincubated with 1 x 10 5 target cells. Typically, 6 to 8 different target cells are tested, including T2 cells pulsed with 1.0 ⁇ g/ml gpl00:280-288 or gpl00:209-217 peptide or MART 1 :27-35 peptide, two HLA-mismatched melanoma cell lines and two HLA-A2 matched melanoma cell lines, and patients' autologous tumor cell lines or frozen tumor cells.
• Genomic DNA PCR is used to detect the transduced genetic material.
• a cell pellet of IO 5 cells (100,000) is resuspended in 1,000 ⁇ l of QuickExtractTM DNA extraction solution 1.0. Ten microliters of this solution containing 1,000-cell- equivalent DNA are subjected to PCR reaction containing IL-2 Primer 1 (5'GGAGGCCTGGATCCATGTACAGGATGCAACTCCT 3' [SEQ ID NO: l]) and Primer 1 7 (5'CTTCTTGGGCATGTAAAACT 3' [SEQ ID NO: 2]). The PCR products are fractionated on a 2% agarose gel. The presence of a 221 -bp fragment, not present in untransduced cells, is defined as positive. [0058] The transduced IL-2 gene expression is evaluated by RT-PCR.
• Transduced cells (1 x IO 6 ) are used for RNA extraction using STRATA GENE absolutely RNATM RT-PCR Miniprep Kit.
• the total RNA is subjected to first-strand cDNA ynthesis by Amersham Pharmacia Biotech Kit.
• the first-srcand cDNA is subjected io CR reaction containing Primer 16 (:7GTCAGCGGGGGTCTTTCATT3 ; [SEQ ID NO: 31) and Primer 2 (5'GGGrCGACGGATCCTCAAGTTAGTGTTGAGATGA3' [SEQ ID NO: 4]).
• the PCR products are fractionated on a 1% agarose gel.
• the presence of an 885-bp fragment, not present in untransduced cells, is defined as positive for SBIL-2 vector- derived IL-2 mRNA transcript.
• SBIL-2-transduced TILs are expanded using a single REP, then re- tested for activity and specificity according to the protocol as described above. Eight days prior to cell harvest and re-infusion, an aliquot of cells is removed for counting and re-assay. Cells are assayed for peptide specificity and tumor recognition by coincubation assay and ELISA as described above. If cell density is greater than 1 x 10 6 /ml, cells are split into additional flasks or transferred to Baxter 3 liter culture bags. IL-2 is added to 1,000 CU/ml. Fungizone is added to 1.25mcg/ml and Cipro is added to 5-10 mcg/ml. On day 11, IL-2 is added to REP flasks at 1,000 CU/ml. Cell cultures are split as needed.
• cells are harvested and either prepared for additional REP cycles or cryopreserved. If cells have grown to sufficient numbers for patient treatment, a sample is collected from each flask for microbiology tests 2-3 days before the beginning of TIL therapy (the test takes 2 days). IL-2 is added to 1 ,000 CU/ml on day 14 and every 3 days until the final product is prepared for infusion.
• the final product is prepared for patient infusion.
• the contents (cells and media) of flasks are transferred to 250 ml centrifuge tubes, while cells in Baxter culture bags are usually harvested using a Baxter/Fenwal continuous centrifuge cell harvester system. Aliquots are taken from representative bags and pooled for a gram test. Cells are spun to pellet (1 ,000 rpm, 15 min, R T) and combined in a single tube, then washed by resuspension in 0.9% sodium chloride, followed by centrifugation, and finally resuspended in 45-400 ml of 0.9% sodium chloride. Human albumin (25%) is added to a final concentration of 2.5%. Aliquots are removed for cell count and viability testing by trypan blue exclusion, and for quality control testing. The final product is infused intravenously as soon as possible.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Epidemiology (AREA)
• Biochemistry (AREA)
• Genetics & Genomics (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Immunology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Molecular Biology (AREA)
• Medicinal Chemistry (AREA)
• Hematology (AREA)
• Pharmacology & Pharmacy (AREA)
• Cell Biology (AREA)
• Microbiology (AREA)
• General Engineering & Computer Science (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Applications Claiming Priority (1)

Publications (2)

Family

ID=32105950

Family Applications (1)

Country Status (4)

Families Citing this family (2)

Family Cites Families (2)

• 2002
  • 2002-10-15 AU AU2002353822A patent/AU2002353822B2/en not_active Ceased
  • 2002-10-15 EP EP02789213A patent/EP1558085A4/de not_active Ceased
  • 2002-10-15 CA CA2501087A patent/CA2501087C/en not_active Expired - Fee Related
  • 2002-10-15 WO PCT/US2002/033243 patent/WO2004034789A1/en not_active Ceased

Non-Patent Citations (13)

Also Published As

Similar Documents

Legal Events