EP1546398A2 - Einzelnukleotid-polymorphismen zur diagnose von schizophrenie - Google Patents
Einzelnukleotid-polymorphismen zur diagnose von schizophrenieInfo
- Publication number
- EP1546398A2 EP1546398A2 EP03791659A EP03791659A EP1546398A2 EP 1546398 A2 EP1546398 A2 EP 1546398A2 EP 03791659 A EP03791659 A EP 03791659A EP 03791659 A EP03791659 A EP 03791659A EP 1546398 A2 EP1546398 A2 EP 1546398A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- fragment
- identity ofthe
- ofthe nucleotide
- determining
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Definitions
- Provisional Patent Application 60/406,432 filed 28 August 2002 The present application also claims priority benefit as a continuation-in-part of United States Patent Application 10/230,007, filed August 28, 2002, which claims the benefit ofthe following United States Provisional Application. 60/315,501, filed 28 August 2001. All applications are incorporated herein by reference in their entirety to the extent not inconsistent with the disclosure herein.
- the invention provides methods for determining the genetic risk of developing schizophrenia or for diagnosing schizophrenia.
- the variant form may or may not confer an evolutionary advantage relative to a progenitor form.
- the variant form may be neutral.
- a variant form is lethal and is not transmitted to further generations ofthe organism.
- a variant form confers an evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members ofthe species and effectively becomes the progenitor form.
- both progenitor and variant form(s) survive and co-exist in a species population. This coexistence of multiple forms of a sequence gives rise to polymorphisms.
- a restriction fragment length polymorphism means a variation in DNA sequence that alters the length of a restriction fragment as described in Botstein et al., Am. J. Hum. Genet.
- restriction fragment length polymorphism may create or delete a restriction site, thus changing the length ofthe restriction fragment.
- RFLPs have been widely used in human and animal genetic analyses (see US Pat. No. 5, 856,104, Jan 5, 1999, Chee, et al, WO 90/13668; WO90/11369; Donis-Keller, Cell 51, 319-337 (1987); Lander et al., Genetics 121, 85-99 (1989)).
- a heritable trait can be linked to a particular RFLP, the presence ofthe RFLP in an individual can be used to predict the likelihood that the animal will also exhibit the trait.
- NNTR variable number tandem repeat
- NNTRs have been used in identity and paternity analysis (U.S. Pat. No. 5,075,217; Armour et al., FEBS Lett. 307, 113-115 (1992); Horn et al., WO 91/14003; Jeffreys, EP 370,719), and in a large number of genetic mapping studies.
- Some other polymorphisms take the form of single nucleotide variations between individuals ofthe same species.
- Such polymorphisms are far more frequent than RFLPS, STRs and NNTRs. Although it should be recognized that a single nucleotide polymorphism may also result in a RFLP because a single nucleotide change can also result in the creation or destruction of a restriction enzyme site. Some single nucleotide polymorphisms occur in protein-coding sequences, in which case, one ofthe polymorphic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease. Examples of genes, in winch polymorphisms within coding sequences give rise to genetic disease include beta - globin (sickle cell anemia) and CFTR (cystic fibrosis).
- single nucleotide polymorphisms occur in noncoding regions. Some of these polymorphisms may also result in defective protein expression (e.g., as a result of defective splicing). Other single nucleotide polymorphisms have no phenotypic effects but still may be genetically linked to a phenotypic effect.
- the greater frequency and uniformity of single nucleotide polymorphisms means that there is a greater probability that such a polymorphism will be found in close proximity to a genetic locus of interest than would be the case for other polymorphisms. Also, the different forms of characterized single nucleotide polymorphisms are often easier to distinguish than other types of polymorphism (e.g., by use of assays employing allele-specific hybridization probes or primers). In a disease such as schizophrenia in which multiple gene products play a role in the analysis ofthe disease, SNPs show particular promise as a research tool and they may also be valuable diagnostic tools. Schizophrenia
- Schizophrenia is a devastating neuropsychiatric disorder which affects approximately 1% ofthe population and results in serious disruption in the lives of afflicted individuals and their families.
- Common symptoms include delusions, conceptual disorganizations and visual or auditory hallucinations, as well as changes in affective behavior.
- a number of scales for the rating of symptoms and methods for ascertaining the diagnosis have been developed, including the DSM classification by the American Psychiatric Association (Diagnostic and Statistical Manual of Mental Disorders Third and Fourth Editions), which have attempted to refine the accuracy of clinical diagnosis.
- DSM classification Diagnostic and Statistical Manual of Mental Disorders Third and Fourth Editions
- Clark, A.G. Inference ofhaplotypesfrom PCR-amplified samples ofdiploid populations. Mol Biol Evol, 1990. 7(2): p. 111-22. 5. Clayton, D., A generalization ofthe transmission/disequilibrium test for uncertain- haplotype transmission. Am J Hum Genet, 1999. 65(4): p. 1170-7.
- FAS-PCR Fluorescent allele-specific PCR
- DNA polymerase an extremely heat stable enzyme with proofreading activity. Nucleic Acids Res, 1991. 19(18): p. 4967-73.
- Zhao, L.P., et al Mapping of complex traits by single-nucleotide polymorphisms. Am J Hum Genet, 1998. 63(1): p. 225-40.
- the invention is based on the discovery of a set of schizophrenia related polymorphic markers. These markers are located in the coding region as well as the non-coding region ofthe gene for the G-protein coupled receptor (GPCR) we have designated Seq-40. The coding and relevant non-coding regions of Seq-40 are set forth below. The polymorphisms are in bold type. 1 AGTAGGAATC AGATAGCGAG ATTGATTAAT AATAATACTT ATCACTCTTT
- the invention comprises the first description of polynucleotide fragments derived from the sequence ofthe human G protein coupled receptor Seq-40 gene suitable for the diagnosis of schizophrenia or predicting the likelihood of developing schizoplirenia. The invention further comprises methods of diagnosis and prediction.
- One embodiment ofthe invention encompasses an isolated polynucleotide comprising, consisting of or consisting essentially of between 12 and 200 contiguous nucleotides of SEQ ID NO 1 or its complement including at least one Seq-40 polymorphic site selected from the group consisting ofthe polymorphic sites at positions 194, 601, 1029, 1038, 1074, 2106, 2185, 2359, 2663 and 2796.
- This definition and all other definitions below making use ofthe term between 12 and 200 contiguous nucleotides is meant to include polynucleotides of each and every integer value between 12 and 200 nucleotides in length.
- the invention provides an isolated polynucleotide consisting of between 12 and 200 contiguous nucleotides of SEQ ID NO 1 in which the nucleotide position 1074 is selected from the group of nucleotides A or C.
- the invention provides an isolated polynucleotide consisting of between 12 and 200 contiguous nucleotides of SEQ ID NO 1 in which the nucleotide position 2663 is selected from the group of nucleotides C or G.
- the invention provides an isolated polynucleotide consisting of between 12 and 200 contiguous nucleotides of SEQ ID NO 1 in which the nucleotide position 2769 is selected from the group of nucleotides A or G.
- the segments can be DNA or RNA, and can be double- or single-stranded. Some segments are 10-20 or 10-50 bases long.
- the invention further provides an allele-specific oligonucleotides that hybridizes to a sequence shown in SEQ ID NO: 1, or its complement. These oligonucleotides can be probes or primers.
- the invention further provides a method of analyzing a nucleic acid from an individual.
- the method determines which nucleotides(s) are present at polymorphic sites contained within Seq-40 i.e "Seq-40 polymorphisms" or Seq-40 polymorphic sites".
- the bases at each polymorphic site within SEQ ID NO:l are determined simultaneously in one reaction.
- This type of analysis can be performed on a plurality of individuals who are tested for the presence of a disease phenotype.
- the presence or absence of disease phenotype or propensity for developing a disease state can then be correlated with a base or set of bases present at the polymorphic sites in the individuals tested.
- this determination step is performed in such a way as to determine the identity of Seq-40 polymorphic sites on a single chromosome.
- the present invention therefore further provides a method of diagnosing schizophrenia or determining a predisposition to schizophrenia by determining the presence or absence of a Seq-40 haplotype in a patient by obtaining material from a patient comprising nucleic acid including one or more ofthe nucleotides at position, 194, 601, 1029, 1038, 1074, 2106, 2185, 2359, 2663 and 2796 and determining the Seq-40 haplotype.
- SEQ ID NO:l The DNA sequence of Seq-40 with variation noted at positions 194,
- allele is used herein to refer to variants of a nucleotide sequence.
- Agent acting on schizoplirenia includes any drug or compound known in the art that addresses, reduces or alleviates one or more symptoms of schizophrenia.
- Agents acting on a schizoplirenia includes any drug or a compound modulating the activity or concentration of an enzyme or regulatory molecule involved in a schizophrenia that is known in the art.
- Agents acting on schizophrenia include but are not limited to Thorazine, Mellaril, Modecate, Prolixin, Navane, Stelazine and Haldol, risperidone (Risperdal), clozapine (Clozaril), olanzapine (Zyprexa) and quetiapine (Seroquel).
- response to an agent acting on schizoplirenia refers to drug efficacy, including but not limited to the ability to metabolize a compound, the ability to convert a pro-drug to an active drug, and to the pharmacokinetics (absorption, distribution, elimination) and the pharmacodynamics (receptor-related) of a drug in an individual.
- side effects to an agent acting on schizophrenia refer to adverse effects of therapy resulting from extensions ofthe principal pharmacological action ofthe drug or to idiosyncratic adverse reactions resulting from an interaction of the drug with unique host factors.
- “Side effects to an agent acting on schizophrenia” include, but are not limited to autonomic side effects such as orthostatic hypotension, blurred vision, dry mouth, nasal congestion and constipation. “Side effects to an agent acting on schizophrenia” also include anxiety, sleep disturbances, sexual dysfunction, gastrointestinal disturbances, nausea, diarrhea, orthostasis, dizziness, sedation, hypertension, shock, akinesia (slowed movement), akathisia (restless limbs), and tardive dyskinesia (permanent, irreversible movement disorders.)
- complementary or “complement thereof are used herein to refer to the sequences of polynucleotides which is capable of forming Watson & Crick base pairing with another specified polynucleotide throughout the entirety of the complementary region. This term is applied to pairs of polynucleotides based solely upon their sequences and not any particular set of conditions under which the two polynucleotides would actually bind.
- genotype refers the identity ofthe alleles present in an individual or a sample.
- a genotype preferably refers to the description ofthe polymorphic alleles present in an individual or a sample.
- genotyping a sample or an individual for a polymorphic marker consists of determining the specific allele or the specific nucleotide carried by an individual at a polymorphic marker.
- heterozygosity rate is used herein to refer to the incidence of individuals in a population, which are heterozygous at a particular allele.
- heterozygosity rate is on average equal to 2Pa(l-Pa), where Pa is the frequency ofthe least common allele.
- mutation refers to a difference in DNA sequence between or among different genomes or individuals which has a frequency below 1%.
- haplotype refers to the actual combination of alleles on one chromosome.
- a haplotype preferably refers to a combination of polymorphisms found in a given individual and which may be associated with a phenotype.
- polymorphism refers to the occurrence of two or more alternative genomic sequences or alleles between or among different genomes or individuals. “Polymorphic” refers to the condition in which two or more variants of a specific genomic sequence can be found in a population. A “polymorphic site” is the locus at which the variation occurs. Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. Preferred polymorphisms have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 10% or 20% of a selected population. A polymorphic locus may be as small as one base pair.
- Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (NNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu.
- the first identified allelic form is arbitrarily designated as the reference form and other allelic forms are designated as alternative or variant alleles.
- the allelic form occurring most frequently in a selected population is sometimes referred to as the wild type form. Diploid organisms maybe homozygous or heterozygous for allelic forms.
- a biallelic polymorphism has two forms.
- a triallelic polymorphism has three forms.
- a "single nucleotide polymorphism” is a single base pair change.
- a single nucleotide polymorphism occurs at a polymorphic site occupied by a single nucleotide, winch is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences ofthe allele (e.g., sequences that vary in less than 1/100 or 1/1000 members ofthe populations).
- a single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site.
- a transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine.
- a transversion is the replacement of a purine by a pyrimidine or vice versa.
- Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele. It should be noted that a single nucleotide change could result in the destruction or creation of a restriction site. Therefore it is possible that a single nucleotide polymorphism might also present itself as a restriction fragment length polymorphism.
- Single nucleotide polymorphisms SNPs
- SNPs Single nucleotide polymorphisms occur with greater frequency and are spaced more uniformly throughout the genome than other forms of polymorphism.
- SNPs occur at a frequency of roughly 1/1000 base pairs, and are distinguished from rare variations or mutations by a requirement for the least abundant allele to have a frequency of 1% or more (Brookes, 1999). Examples of SNP include:
- Non-synonymous coding region changes which substitute one amino acid for another in the protein product encoded by the gene, 2. Synonymous changes which do alter amino acid coding sequence due to degeneracy ofthe genetic code,
- biaselic polymorphism and “biallelic marker” are used interchangeably herein to refer to a polymorphism having two alleles at a fairly high frequency in the population, preferably a single nucleotide polymorphism.
- a “biallelic marker allele” refers to the nucleotide variants present at a biallelic marker site.
- the frequency ofthe less common allele ofthe biallelic markers ofthe present invention has been validated to be greater than 1%, preferably the frequency is greater than 10%, more preferably the frequency is at least 20% (i.e. heterozygosity rate of at least 0.32), even more preferably the frequency is at least 30% (i.e. heterozygosity rate of at least 0.42).
- a biallelic marker wherein the frequency ofthe less common allele is 30% or more is termed a "high quality biallelic marker.
- Seq-40 polymorphism or "Seq-40 polymorphic site” is used herein to mean a polymorphism or polymorphic site within the gene for Seq-40 disclosed herein. This term would encompass polymorphisms at polymorphic sites within the Seq-40 coding sequence, intronic regions and flanking regions. A "Seq-40 polymorphism” or need not change an amino acid in the Seq-40 protein product in order to have utility.
- Seq-40 polymporphism encompasses single nucleotide polymorphisms, biallelic and otherwise and are the polymorphisms described in Table 1 of this disclosure.
- a Seq-40 single nucleotide polymorphism is a polymorphism which reflects variation at a single nucleotide.
- the term "at least one Seq-40 polymorphic site” means at least one polymorphic site within the Seq-40 gene selected from those detailed in Table 1 of this disclosure.
- oligonucleotides and “polynucleotides” include RNA, DNA, or RNA/DNA hybrid sequences of more than one nucleotide in either single chain or duplex form.
- nucleotide as used herein as an adjective to describe molecules comprising RNA, DNA, or RNA/DNA hybrid sequences of any length in single-stranded or duplex form.
- nucleotide is also used herein as a noun to refer to individual nucleotides or varieties of nucleotides, meaning a molecule, or individual unit in a larger nucleic acid molecule, comprising a purine or pyrimidine, a ribose or deoxyribose sugar moiety, and a phosphate group, or phosphodiester linkage in the case of nucleotides within an oligonucleotide or polynucleotide.
- nucleotide is also used herein to encompass "modified nucleotides" which comprise at least one modifications (a) an alternative linking group, (b) an analogous form of purine, (c) an analogous form of pyrimidine, or (d) an analogous sugar, for examples of analogous linking groups, purine, pyrimidines, and sugars see for example PCT publication No. WO 95/04064.
- the polynucleotides ofthe invention are preferably comprised of greater than 50% conventional deoxyribose nucleotides, and most preferably greater than 90% conventional deoxyribose nucleotides.
- the polynucleotide sequences ofthe invention may be prepared by any known method, including synthetic, recombinant, ex vivo generation, or a combination thereof, as well as utilizing any purification methods known in the art.
- nucleotides in a polynucleotide with respect to the center ofthe polynucleotide are described herein in the following manner.
- the nucleotide at an equal distance from the 3' and 5' ends ofthe polynucleotide is considered to be "at the center" ofthe polynucleotide, and any nucleotide immediately adjacent to the nucleotide at the center, or the nucleotide at the center itself is considered to be "within 1 nucleotide ofthe center.”
- any ofthe five nucleotides positions in the middle ofthe polynucleotide would be considered to be within 2 nucleotides ofthe center, and so on.
- the polymorphism, allele or biallelic marker is "at the center" of a polynucleotide if the difference between the distance from 3' the substituted, inserted, or deleted polynucleotides ofthe polymorphism and the 3' end ofthe polynucleotide, and the distance from the substituted, inserted, or deleted polynucleotides ofthe polymorphism and the 5' end ofthe polynucleotide is zero or one nucleotide.
- the polymorphism is considered to be "within 1 nucleotide of the center.” If the difference is 0 to 5, the polymorphism is considered to be “within 2 nucleotides ofthe center.” If the difference is 0 to 7, the polymorphism is considered to be "within 3 nucleotides ofthe center,” and so on.
- the polymorphism, allele or biallelic marker is "at the center" of a polynucleotide if the difference between the distance from the substituted, inserted, or deleted polynucleotides ofthe polymorphism and the 3' end ofthe polynucleotide, and the distance from the substituted, inserted, or deleted polynucleotides ofthe polymorphism and the 5' end ofthe polynucleotide is zero or one nucleotide.
- the polymorphism is considered to be "within 1 nucleotide of the center.” If the difference is 0 to 5, the polymorphism is considered to be “within 2 nucleotides ofthe center.” If the difference is 0 to 7, the polymorphism is considered to be "within 3 nucleotides ofthe center,” and so on.
- nucleotides in a polynucleotide with respect to the end ofthe polynucleotide are described herein in the following manner.
- a nucleotide is "at the end" of a polynucleotide if it is at either the 5 ' or 3 ' en of the polynucleotide.
- upstream is used herein to refer to a location which, is toward the 5' end ofthe polynucleotide from a specific reference point.
- base paired and “Watson & Crick base paired” are used interchangeably herein to refer to nucleotides which can be hydrogen bonded to one another be virtue of their sequence identities in a manner like that found in double-helical DNA with thymine or uracil residues linked to adenine residues by two hydrogen bonds and cytosine and guanine residues linked by three hydrogen bonds (See Stryer, L., Biochemistry, 4 th edition, 1995).
- isolated is used herein to describe a polynucleotide or polynucleotide vector ofthe invention which has been to some extent separated from other compounds including, but not limited to other nucleic acids, carbohydrates, lipids and proteins (such as the enzymes used in the synthesis ofthe polynucleotide), or the separation of covalently closed polynucleotides from linear polynucleotides.
- a polynucleotide is substantially isolated when at least about 50 %, preferably 60 to 15% of a sample exhibits a single polynucleotide sequence and conformation (linear versus covalently closed).
- a substantially isolated polynucleotide typically comprises about 50 %, preferably 60 to 90% weight/weight of a nucleic acid sample, more usually about 95%, and preferably is over about 99% pure.
- the degree of polynucleotide isolation or homogeneity may be indicated by a number of means well known in the art, such as agarose or polyacrylamide gel electrophoresis of a sample, followed by visualizing a single polynucleotide band upon staining the gel. For certain purposes higher resolution can be provided by using HPLC or other means well known in the art.
- primer refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature.
- the appropriate length of a primer depends on the intended use ofthe primer but typically ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template.
- a primer need not reflect the exact sequence ofthe template but must be sufficiently complementary to hybridize with a template.
- primer site refers to the area ofthe target DNA to which a primer hybridizes.
- primer pair means a set of primers including a 5' upstream primer that hybridizes with the 5' end ofthe DNA sequence to be amplified and a 3', downstream primer that hybridizes with the complement ofthe 3' end ofthe sequence to be amplified.
- probe or “hybridization probe” denotes a defined nucleic acid segment (or nucleotide analog segment, e.g., polynucleotide as defined herein) which can be used to identify a specific polynucleotide sequence present in samples, said nucleic acid segment comprising a nucleotide sequence complementary ofthe specific polynucleotide sequence to be identified by hybridization.
- probes or “hybridization probes' are nucleic acids capable of binding in a base-specific manner to a complementary strand of nucleic acid. Such probes include peptide nucleic acids, as described in Nielsen et al., Science 254, 1497-1500 (1991).
- Hybridizations are usually performed under "stringent conditions", for example, at a salt concentration of no more than 1M and a temperature of at least 25° C.
- stringent conditions for example, at a salt concentration of no more than 1M and a temperature of at least 25° C.
- 5X SSPE 750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4
- a temperature of 25°-30° C. are suitable for allele-specific probe hybridizations.
- this particular buffer composition is offered as an example, one skilled in the art, could easily substitute other compositions of equal suitability.
- the term "sequencing” as used herein, means a process for determining the order of nucleotides in a nucleic acid. A variety of methods for sequencing nucleic acids are well known in the art.
- Such sequencing methods include the Sanger method of dideoxy-mediated chain termination as described, for example, in Sanger et al., Proc. Natl. Acad. Sci. 74:5463 (1977), which is incorporated herein by reference (see, also, "DNA Sequencing” in Sambrook et al. (eds.), Molecular Cloning: A Laboratory Manual (Second Edition), Plainview, N.Y.: Cold Spring Harbor Laboratory Press (1989), which is incorporated herein by reference).
- a variety of polymerases including the Klenow fragment of E. coli DNA polymerase I; Sequenase TM (T7 DNA polymerase); Taq DNA polymerase and Amplitaq can be used in enzymatic sequencing methods.
- schizophrenia refers has its conventional meaning, e.g., a mental disorder characterized by the constellation of symptoms described in the DSM-III-R.
- trait and “phenotype” are used interchangeably herein and refer to any visible, detectable or otherwise measurable property of an organism such as symptoms of, or susceptibility to a disease for example.
- the terms “trait” or “phenotype” are used herein to refer to symptoms of, or susceptibility to schizophrenia; or to refer to an individual's response to an agent acting on schizophrenia; or to refer to symptoms of, or susceptibility to side effects to an agent acting on schizophrenia.
- Polymorphisms of the Invention The nucleotide and amino acid sequence ofthe Seq-40 cDNA has been disclosed previously in US Patent Application No 09/714449 and in WO 01/36473 both of which are herein incorporated by reference Seq-40 is a novel GPCR with sequence homology closest to the aminergic/cholinergic branch ofthe GPCR superfamily, although it does not have the hallmarks of a biogenic amine receptor.
- Seq-40 RNA is expressed in limbic regions ofthe brain, more specifically, cortex, piriform cortex, hippocampus, hypothalamus, substantia nigra pars compacta, lateral septum, bed nucleus of stria terminalis, thalamus, ventral tegmental, interpeduncular nucleus, dorsal raphe, medial geniculate, Islands of Calleja, choroid plexus, and subthalamus.
- the chromosomal location ofthe gene encoding Seq-40 was determined using the Stanford G3 Radiation Hybrid Panel (Research Genetics, Inc., Huntsville, AL). This panel contains 83 radiation hybrid clones ofthe entire human genome created by the Stanford Human Genome Center. PCR primers were designed from the sequence in SEQ ID NO: 1 to determine which lanes gave a PCR product. Lanes were scored for the presence or absence ofthe expected PCR product and the results submitted to the Stanford Human Genome Center via e-mail for analysis. This analysis places Seq- 40 on chromosome 6, most nearly linked to Stanford marker SHGC-1836 (the average fragment size being 4.0 Mb), with a LOD score of 11.84 (any score above 3.0 is considered highly significant). This marker lies at position 6q21. Cao et al., (1997), using linkage analysis in two independent data sets, have shown region 6ql3-6q26 as very suggestive as containing a schizophrenia susceptibility locus.
- the Seq-40 single nucleotide polymorphism at position 194 of SEQ ID NO.T is designated SI
- the Seq-40 single nucleotide polymorphism at position 601 of SEQ ID NO:l is designated S2
- the Seq-40 single nucleotide polymorphism at position 1029 of SEQ ID NO:l is designated S3
- the Seq-40 single nucleotide polymorphism at position 1038 of SEQ ID NO:l is designated S4
- the Seq- 40 single nucleotide polymorphism at position 1074 of SEQ ID NO:l is designated S5
- the Seq-40 single nucleotide polymorphism at position 2106 of SEQ ID NO:l is designated S6
- the Seq-40 single nucleotide polymorphism at position 2185 of SEQ ID NO:l is designated S7
- the Seq-40 single nucleotide polymorphism at position 2359 of SEQ ID NO:l is designated S8, the Seq-40 single nucleo
- the first type of analysis is sometimes referred to as de novo identification.
- the second type of analysis is determining which form(s) of an identified polymorphism are present in individuals under test.
- the first type of analysis compares target sequences in different individuals to identify points of variation, i.e., polymorphic sites.
- points of variation i.e., polymorphic sites.
- Example 1 De-Novo Identification of Polymorphisms of the Invention Materials and Methods DNA Samples DNA samples were obtained from anonymous blood samples. DNA was prepared using the QiaAmp DNA blood mini kit (Qiagen). The samples are referred to as the Population Control Western Michigan samples and labeled CON01.
- Seq40 genomic sequence was identified through BLAST analysis ofthe Celera human genome database using the previously disclosed Seq40 sequence.
- One entry, GA_46747285 was identified through the search as containing approximately 9.8 kb of human genomic sequence including the coding information for Seq40.
- Primers were designed to amplify approx. 3 kb of genomic sequence, including the Seq40 coding region as well as approx. 1 kb upstream and 0.5 kb downstream, corresponding to nucleotides 2946 to 6024 of GA_46747285.
- This sequence, designated Seq40SNP.seq was amplified from human genomic DNA using primers PSK100 and PSK105 (SEQ ID NOS: 3 and 4 respectively).
- PSK100 5'AGTAGGAATCAGATAGCGAGATTG (NT 2946 to 2969 in GA_46747285.
- PSK105 5'ACTGAATAATGTAACACAGGGCTC reverse complement of NT 6002- 6025 in GA_46747285.
- PCR was performed using AmpliTaq Gold (Perkin Elmer) in a 50 ⁇ l reaction according to the manufacturer's instructions, using a Stratagene Robocycler.
- the cycling program was as follows: 1 cycle of 94°C for 10 min then 50 cycles at 95°C for 30 sec, then 55°C for 1 min and then 68°C for 5 min, followed by 1 cycle at 68°C for 10 min.
- the PCR products were purified using MultiScreen-PCR Filter Plates (MiUipore).
- the PCR reaction was loaded onto the plate and the plate was placed on top ofthe MultiScreen manifold (MiUipore) and a vacuum of 24 inches Hg was applied for 5-10 minutes.
- the plate was removed from the manifold and 50 ⁇ l of H 0 was added to each well.
- the plate was placed on a plate mixer and shook vigorously for 5 minutes.
- the purified PCR product was recovered from each well and placed into a new 96 well reaction plate.
- PCR fragments were sequenced directly using an ABI377 fluorescence-based sequencer (Perkin Elmer/ Applied Biosystems Division, PE/ABD, Foster City, CA) and the ABI BigDyeTM Terminator Cycle Sequencing Ready Reaction kit with Taq FSTM polymerase.
- Each cycle-sequencing reaction contained 9.6 ⁇ l of H 2 0, 8.4 ⁇ l of BigDye Terminator mix (8 ⁇ l of Big Dye Terminator and 0.4 ⁇ l of DMSO), 1 ⁇ l DNA ( ⁇ 0.5 ⁇ g), and 1 ⁇ l primer (25 ng/ ⁇ l) and was performed in a Perkin-Elmer 9600.
- Cycle-sequencing was performed using an initial denaturation at 98°C for 1 min, followed by 50 cycles: 96°C for 30 sec, annealing at 50°C for 30 sec, and extension at 60°C for 4 min. Extension products were purified using AGTC ® gel filtration block (Edge BiosSystems, Gaithersburg, MD). Each reaction product was loaded by pipette onto the column, which was then centrifuged in a swinging bucket centrifuge (Sorvall model RT6000B tabletop centrifuge) at 750 x g for 2 min at room temperature.
- swinging bucket centrifuge Sorvall model RT6000B tabletop centrifuge
- the PCR products were purified and sequenced with the following primers (SEQ ID NOS: 3 through 8)
- KAS 38 AGCCAGCACAGCCCCAAAGCC KAS439 TCTATGACGATGGGCTGGAGG KAS4 1 ATAGACGAAGTTCAGGATACC
- the chromotograms were analyzed with the computer program POLYPHRED, which compares the sequence ofthe 72 individuals and indicates differences in the sequence. A total often SNPs were identified. A summary ofthe results is shown in Table 2 below.
- SNPs Five SNPs are in the 5' flanking region, two in the coding region and three in the 3' flanking region. The locations ofthe SNPs are at nucleotide 194, 601, 1029,
- the frequency ofthe rare allele for each SNP is 38, 43, 7.5, 20, 8.9, 5.6, 4.9, 19, 18, 39 percent respectively. It should be noted that these frequencies might change if a different or larger population was used.
- both ofthe SNPs in the coding region changes an amino acid and would be amenable to antibody based diagnostics.
- Antibodies that specifically bind to variant gene products but not to corresponding prototypical gene products are contemplated.
- Antibodies can be made by injecting mice or other animals with the variant gene product or synthetic peptide fragments thereof. Monoclonal antibodies are screened as are described, for example, in Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988); Goding, Monoclonal antibodies, Principles and Practice (2d ed.) Academic Press, New York (1986). Monoclonal antibodies are tested for specific immunoreactivity with a variant gene product and lack of immunoreactivity to the corresponding prototypical gene product. These antibodies are useful in diagnostic assays for detection ofthe variant form, or as an active ingredient in a pharmaceutical composition.
- Polymorphisms are detected in a target nucleic acid from an individual being analyzed.
- genomic DNA virtually any biological sample (other than pure red blood cells) is suitable.
- tissue samples include whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair.
- tissue sample For assay of cDNA or mRNA, the tissue sample must be obtained from an organ in which the target nucleic acid is expressed.
- LCR ligase chain reaction
- NASBA nucleic acid based sequence amplification
- Allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al, Nature 324, 163-166 (1986); Dattagupta, EP 235,726, Saiki, WO 89/11548.
- Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals.
- Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one ofthe alleles.
- Some probes are designed to hybridize to a segment of target DNA such that the polymorphic site aligns with a central position (e.g., in a 15 mer at the 7 position; in a 16 er, at either the 8 or 9 position) ofthe probe. This design of probe achieves good discrimination in hybridization between different allelic forms.
- probes are characterized in that they preferably comprise between 8 and 50 nucleotides, and in that they are sufficiently complementary to a sequence comprising a polymo ⁇ hic marker ofthe present invention to hybridize thereto and preferably sufficiently specific to be able to discriminate the targeted sequence for only one nucleotide variation.
- the GC content in .the probes ofthe invention usually ranges between 10 and 75 %, preferably between 35 and 60 %, and more preferably between 40 and 55 %.
- the length of these probes can range from 10, 15, 20, or 30 to at least 100 nucleotides, preferably from 10 to 50, more preferably from 18 to 35 nucleotides.
- a particularly preferred probe is 25 nucleotides; in length.
- the polymorphic marker is within 4 nucleotides ofthe center ofthe polynucleotide probe. In particularly preferred probes the polymorphic marker is at the center of said polynucleotide. Shorter probes may lack specificity for a target nucleic acid sequence and generally require cooler temperatures to form sufficiently stable hybrid complexes, with the template. Longer probes are expensive to produce and can sometimes self-hybridize to form hairpin structures. Methods for the synthesis of oligonucleotide probes have been described above and can be applied to the probes of the present invention. Preferably the probes ofthe present invention are labeled or immobilized on a solid support. Labels and solid supports are well known in the art.
- Detection probes are generally nucleic acid sequences or uncharged nucleic acid analogs such as, for example peptide nucleic acids which are disclosed in International Patent Application WO 92/20702, morpholino analogs which are described in U.S. Patents Numbered 5,185,444; 5,034,506 and 5,142,047.
- the probe may have to be rendered
- non-extendable in that additional dNTPs cannot be added to the probe.
- nucleic acid probes can be rendered non-extendable by modifying the 3' end ofthe probe such that the hydroxyl group is no longer capable of participating in elongation.
- the 3' end of the probe can be functionalized with the capture or detection label to thereby consume or otherwise block the hydroxyl group.
- the 3' hydroxyl group simply can be cleaved, replaced or modified,
- the probes ofthe present invention are useful for a number of purposes. They can be used in Southern hybridization to genomic DNA or Northern hybridization to mRNA. The probes can also be used to detect PCR amplification products. By assaying the hybridization to an allele. Specific probe, one can detect the presence or absence of a biallelic marker allele in a given sample.
- Allele-specific probes are often used in pairs, one member of a pair showing a perfect match to a reference form of a target sequence and the other member showing a perfect match to a variant form. Several pairs of probes can then be immobilized on the same support for simultaneous analysis of multiple polymorphisms within the same target sequence.
- An allele-specific primer hybridizes to a site on target DNA overlapping a polymo ⁇ hism and only primes amplification of an allelic form to which the primer exhibits perfect complementarity. See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is used in conjunction with a second primer which hybridizes at a distal site. Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymo ⁇ hic site and the other of which exhibits perfect complementarily to a distal site. The single-base mismatch prevents amplification and no detectable product is formed.
- the method works best when the mismatch is included in the 3'-most position ofthe oligonucleotide aligned with the polymo ⁇ hism because this position is most destabilizing to elongation from the primer. See, e.g., WO 93/22456.
- the invention contemplates such primers with distal mismatches as well as primers which because of chosen conditions form unstable base pairing and thus prime inefficiently.
- the direct analysis ofthe sequence of polymo ⁇ hisms ofthe present invention can be accomplished using either the dideoxy chain termination method or the Maxam Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988). It should be recognized that the field of DNA sequencing has advanced considerably in the past several years and that the invention contemplates such advances. Most notably, within the past decade there has been increasing reliance on automated DNA sequence analysis.
- Denaturing Gradient Gel Electrophoresis Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, (W.H. Freeman and Co, New York, 1992), Chapter 7.
- Alleles of target sequences can be differentiated using single-strand conformation polymo ⁇ hism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al, Proc. Nat. Acad. Sci. 86, 2766-2770 (1989).
- Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products.
- Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence.
- the different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence difference between alleles of target sequences.
- Taq-ManTM 5' nuclease assay.
- the Taq-Man assay takes advantage ofthe 5' nuclease activity of Taq DNA polymerase to digest a DNA probe annealed specifically to the accumulating amplification product.
- Taq-Man probes are labeled with a donor-acceptor dye pair that interacts via fluorescence energy transfer.
- DASH Dynamic AUele-Specific hybridization
- Hybaid microtiter plates
- Affymetrix Single-stringency DNA-chip hybridization
- Hybridization assays based on oligonucleotide arrays rely on the differences in hybridization stability of short oligonucleotides to perfectly matched and mismatched target sequence variants. Efficient access to polymo ⁇ hism information is obtained through a basic structure comprising high-density arrays of oligonucleotide probes attached to a solid support (the chip) at selected positions. Each DNA chip can contain thousands to millions of individual synthetic DNA probes arranged in a grid-like pattern and miniaturized to the size of a dime.
- Chips of various formats for use in detecting biallelic polymo ⁇ hisms can be produced on a customized basis by Affymetrix (GeneChipTM), Hyseq (HyChip and HyGnostics), and Protogene Laboratories. In general, these methods employ arrays of oligonucleotide probes that are complementary to target nucleic acid sequence segments from an individual which, target sequences include a polymo ⁇ hic marker.
- EP785280 describes a tiling strategy for the detection of single nucleotide polymo ⁇ hisms.
- arrays may generally be "tiled” for a large number of specific polymo ⁇ hisms.
- tilting is generally meant the synthesis of a defined set of oligonucleotide probes which is made up of a sequence complementary to the target sequence of interest, as well as preselected variations of that sequence, e.g., substitution of one or more given positions with one or more members ofthe basis set of monomers, i.e. nucleotides. Tiling strategies are further described in PCT application No. WO 95/11995.
- arrays are tiled for a number of specific, identified biallelic marker sequences.
- the array is tiled to include a number of detection blocks, each detection block being specific for a specific biallelic marker or a set of biallelic markers.
- a detection block may be tiled to include a number of probes, which span the sequence segment that includes a specific polymo ⁇ hism. To ensure probes that are complementary to each allele, the probes are synthesized in pairs differing at the biallelic marker. In addition to the probes differing at the polymo ⁇ hic base, monosubstituted probes are also generally tiled within the detection block.
- These monosubstituted probes have bases at and up to a certain number of bases in either direction from the polymo ⁇ hism, substituted with the remaining nucleotides (selected from A, T, G, C and IT).
- the probes in a tiled detection block will include substitutions ofthe sequence positions up to and including those that are 5 bases away from the biallelic marker.
- the monosubstituted probes provide internal controls for the tiled array, to distinguish actual hybridization from artefactual crosshybridization. Upon completion of hybridization with the target sequence and washing ofthe array, the array is scanned to determine the position on the array to which the target sequence hybridizes.
- hybridization data from the scanned array is then analyzed to identify which allele or alleles ofthe biallelic marker are present in the sample.
- Hybridization and scanning may be carried out as described in PCT application No. WO 92/10092 and WO 95/11995 and US patent No. 5,424,186.
- the chips may comprise an array of nucleic acid sequences of fragments of about 15 nucleotides in length, i further embodiments, the chip may comprise an array including at least one ofthe sequences selected from the group consisting of an isolated polynucleotide comprising between 6-800 contiguous nucleotides of SEQ ID No. 1 and the sequences complementary thereto, or a fragment thereof at least about 8 consecutive nucleotides, preferably 10, 15, 20, more preferably 25, 30, 40, 47, or 50 consecutive nucleotides, including at least one polymo ⁇ hic site. h some embodiments, the chip may comprise an array of at least 2, 3, 4, 5, 6, 7, 8 or more of these polynucleotides ofthe invention. Solid supports and polynucleotides of the present invention attached to solid supports are further described in 1.
- Fluorescent Allele- Specific PCR uses allele specific primers which differ by a single 3' nucleotide which is an exact match to the allele to be detected (Howard et al. 1999). Thus, two primers designed to match exactly each allele of a biallelic SNP are used with a single, common, reverse primer to detect each ofthe allele specific primers. This uses to advantage the observation that if the 3' nucleotide ofthe PCR amplification primer does not match exactly, then amplification will not be successful.
- each allele specific primer is tagged with a different fluorescent primer to allow their discrimination when analyzed by gel or capillary electrophoresis using an automated DNA Analysis System such as the PE Biosystems Models 310/373/377 or 3700.
- SNPs also can be genotyped rapidly and efficiently using techniques that make use of thermal denaturation differences due to differences in DNA base composition.
- allele specific primers are designed as above to detect biallelic SNP with the exception that to one primer is added a 5' GC tail of 26 bases (Germer and Higuichi, 1999).
- a fluorescent dye that binds preferentially to dsDNA e.g., SYBR Green 1
- SYBR Green 1 is added to the tube and then the thermal denaturation profile ofthe dsDNA product of PCR amplification is determined.
- Samples homozygous for the SNP amplified by the GC tailed primer will denature at the high end ofthe temperature scale, while samples homozygous for the SN amplified by the non-GC tagged primer will denature at the low end ofthe temperature scale. Heterozygous samples will show two peaks in the thermal denaturation profile.
- DASH dynamic allele-specific hybridization
- thermal denaturation curves Howell et al., 1999.
- a pair of PCR primers is used to amplify the genomic region in the DNA sample containing the SNP.
- One of these primers is biotinylated to allow subsequent binding ofthe biotinylated product strand to strepavidin-coated microtiter plates while the non-biotinylated strand is washed away with alkali.
- An oligoucleotide probe which is an exact match for one allele is hybridized to the immobilized PCR product at low temperature.
- a dsDNA intercalating dye e.g., SYBR Green 1.
- SYBR Green 1 a dsDNA intercalating dye
- the thermal denaturation profile then allows the test to distinguish the single base mismatch between the biallelic SNP due to the difference in melting temperature.
- Other methods for SNP genotyping and their application to the detection of SNP in the Seq- 40 gene can be envisaged by one skilled in the art.
- the polymo ⁇ hisms ofthe present invention can also be used to develop diagnostics tests capable of identifying individuals who are at increased risk of developing schizophrenia or suffers from schizophrenia.
- the diagnostic teclmiques of the present invention may employ a variety of methodologies to determine whether a test subject has a polymo ⁇ hic marker pattern associated with an increased risk of developing schizoplirenia or whether the individual suffers from schizophrenia coincident with carrying a particular mutation, including methods which enable the analysis of individual chromosomes for haplotyping, such as family studies, single sperm DNA analysis or somatic hybrids.
- the present invention therefore further provides a method of diagnosing a schizophrenia or determining a predisposition to schizophrenia by determining the presence or absence of a Seq-40 haplotype in a patient by obtaining material comprising nucleic acid including the polymo ⁇ hic sites at position, 194, 601, 1029, 1038, 1074, 2106, 2185, 2359, 2663 and 2796 of SEQ ID NO:l from the patient; enzymatically amplifying the nucleic acid using pairs of oligonucleotide primers complementary to nucleotide sequences flanking any of the polymo ⁇ hic sites at position, 194, 601, 1029, 1038, 1074, 2106, 2185, 2359, 2663 and 2796 of SEQ ID NO: 1 to produce amplified products containing any ofthe polymo ⁇ hic
- an amplified product can be sequenced directly or subcloned into a vector prior to sequence analysis.
- Commercially available sequencing kits including the Sequenase TM kit from Amersham Life Science (Arlington Heights, 111.) can be used to sequence an amplified product in the methods ofthe invention.
- Automated sequence analysis also can be useful, and automated sequencing instruments such as the Prism 377 DNA Sequencer or the 373 DNA Sequencer are commercially available, for example, from Applied Biosystems (Foster City, Calif; see, also, Frazier et al., Electrophoresis 17:1550-1552 (1996), which is inco ⁇ orated herein by reference). Both copies in a diploid genome give rise to sequence the haplotypic composition of an individual can thus be inferred from direct sequence analysis.
- single chromosomes can be studied independently, for example, by asymmetric PCR amplification (see Newton et al., Nucleic Acids Res., 17:2503-2516, 1989; Wu et al., Proc. Natl Acad Sci. USA, 86:2757, 1989) or by isolation of single chromosome by limit dilution followed by PCR amplification (see Ruano et al., Proc. Natl Acad. Sci. USA, 87:6296-6300, 1990). Further, a sample may be haplotyped for sufficiently close polymo ⁇ hic markers by double PCR amplification of specific alleles (Sarkar, G. and Sommer S.S., Biotechniques, 1991).
- the present invention provides diagnostic methods to determine whether an individual is at risk of developing schizophrenia or suffers from schizophrenia coincident with a mutation or a polymo ⁇ hism in ofthe present invention.
- the present invention also provides methods to determine whether an individual is likely to respond positively to an agent acting on schizophrenia disorder or whether an individual is at risk of developing an adverse side effect to an agent acting on schizophrenia
- These methods involve obtaining a nucleic acid sample from the individual and, determining, whether the nucleic acid sample contains at least one allele or at least one polymo ⁇ hic haplotype, indicative of a risk of developing the trait or indicative that the individual expresses the trait as a result of possessing trait-causing allele.
- PCR amplification is conducted on the nucleic acid sample to amplify regions in which polymo ⁇ hisms associated with a detectable phenotype have been identified.
- the amplification products are sequenced to determine whether the individual possesses one or more polymo ⁇ hisms associated with a detectable phenotype.
- the primers used to generate amplification products may comprise the primers listed in Table 4.
- the nucleic acid sample is subjected to microsequencing reactions as described above to determine whether the individual possesses one or more polymo ⁇ hisms associated with a detectable phenotype resulting from a mutation or a polymo ⁇ hism. in a candidate gene.
- the primers used in the microsequencing reactions may include the primers listed in Table 4.
- the nucleic acid sample is contacted with one or more allele specific oligonucleotide probes which specifically hybridize to one or more candidate gene alleles associated with a detectable phenotype.
- the probes used in the hybridization assay may include the probes listed in Table 4
- the identity ofthe nucleotide present at, at least one, biallelic marker selected from the group consisting the polymo ⁇ hic sites at position, 194, 601, 1029, 1038, 1074, 2106, 2185, 2359, 2663 and 2796 of SEQ ID NO:l, is determined and the detectable trait is schizophrenia.
- kits comprising at least one allele-specific oligonucleotide as described above.
- a kit may contain an antibody to the relevant epitope.
- the kits contain one or more pairs of allele-specific oligonucleotides hybridizing to different forms of a polymo ⁇ hism.
- the allele-specific oligonucleotides are provided immobilized to a substrate.
- the same substrate can comprise allele-specific oligonucleotide probes for detecting both ofthe polymo ⁇ hisms described.
- kits include, for example, restriction enzymes, reverse-transcriptase or polymerase, the substrate nucleoside triphosphates, means used to label (for example, an avidinenzyme conjugate and enzyme substrate and chromogen if the label is biotin), and the appropriate buffers for reverse transcription, PCR, or hybridization reactions.
- the kit also contains instructions for carrying out the methods
- Analysis of said Seq-40 polymo ⁇ hism for the pm ose of prognosis or diagnosis may be performed by one of any techniques capable of accurately detecting SNP including but not limited to allele-specific hybridization on filters, allele- specific PCR, PCR plus restriction enzyme digest (RFLP-PCR), denaturing capillary electrophoresis, primer extension and time-of-flight mass spectrometry, and the 5' nuclease (Taq-Man) assay.
- Preferred teclmiques for SNP genotyping should allow large scale, automated analysis which do not require extensive optimization for each SNP analyzed.
- the polymo ⁇ hic markers may be used in parametric and non-parametric linkage analysis methods.
- the polymo ⁇ hic markers ofthe present invention are used to identify genes associated with schizoplirenia or other disorders using association studies such as the case control method, an approach which does not require the use of affected families and which permits the identification of genes associated with complex and sporadic traits.
- Linkage analysis is based upon establishing a correlation between the transmission of genetic markers and that of a specific trait throughout generations within a family.
- the aim of linkage analysis is to detect marker loci that show cosegregation with a trait of interest in pedigrees. Parametric methods
- loci When data are available from successive generations there is the opportunity to study the degree of linkage between pairs of loci.
- Estimates ofthe recombination fraction enable loci to be ordered and placed onto a genetic map. With loci that are genetic markers, a genetic map can be established, and then the strength of linkage between markers and traits can be calculated and used to indicate the relative positions of markers and genes affecting those traits.
- the classical method for linkage analysis is the logarithm of odds (lod) score method (see Morton N.E., AmJHum. Genet, 7:277-318, 1955; Ott J., Analysis of Human Genetic Linkage, John Hopkins University Press, Baltimore, 1991). Calculation of lod scores requires specification ofthe mode of inheritance for the disease (parametric method).
- Linkage analysis has been successfully applied to map simple genetic traits that show clear Mendelian inheritance patterns and which have a high penetrance (i.e., the ratio between the number of trait positive carriers of allele and the total number of a carriers in the population).
- parametric linkage analysis suffers from a variety of drawbacks. First, it is limited by its reliance on the choice of a genetic model suitable for each studied trait. Furthermore, as already mentioned, the resolution attainable using linkage analysis is limited, and complementary studies are required to refine the analysis ofthe typical 2Mb to 20Mb regions initially identified through linkage analysis. In addition, parametric linkage analysis approaches have proven difficult when applied to complex genetic traits, such as those due to the combined action of multiple genes and/or environmental factors.
- non-parametric methods for linkage analysis are that they do not require specification ofthe mode of inheritance for the disease, they tend to be more useful for the analysis of complex traits.
- non-parametric methods one tries to prove that the inheritance pattern of a chromosomal region is not consistent with random Mendelian segregation by showing that affected relatives inherit identical copies ofthe region more often than expected by chance. Affected relatives should show excess "allele sharing" even in the presence of incomplete penetrance and polygenic inheritance.
- the degree of agreement at a marker locus in two individuals can be measured either by the number of alleles identical by state (IBS) or by the number of alleles identical by descent (IBD).
- the polymo ⁇ hic markers ofthe present invention may be used in both parametric and non-parametric linkage analysis. Preferably polymo ⁇ hic markers may be used in non-parametric methods which allow the mapping of genes involved in complex traits.
- the polymo ⁇ hic markers ofthe present invention may be used in both IBD-and IBS- methods to map genes affecting a complex trait. In such studies, taking advantage of the high density of polymo ⁇ hic markers, several adjacent polymo ⁇ hic marker loci may be pooled to achieve the efficiency attained by multi-allelic markers (Zhao et al., Am. J Hum. Genet., 63:225-240, 1998).
- the present invention comprises methods for identifying polymo ⁇ hic markers that are associated with a detectable trait using the polymo ⁇ hic markers ofthe present invention.
- the present invention comprises methods to detect an association between a polymo ⁇ hic marker allele or a polymo ⁇ hic marker haplotype and a trait.
- the invention comprises methods to identify a trait causing allele in linkage disequilibrium with any polymo ⁇ hic marker allele ofthe present invention.
- association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families. Association studies are extremely valuable as they permit the analysis of sporadic or multifactor traits. Moreover, association studies represent a powerful method for fine-scale mapping enabling much finer mapping of trait causing alleles than linkage studies. Studies based on pedigrees often only narrow the location ofthe trait causing allele. Association studies using the polymo ⁇ hic markers ofthe present invention can therefore be used to refine the location of a trait causing allele in a candidate region identified by Linkage Analysis methods. Polymo ⁇ hic markers ofthe present invention can be used to demonstrate that a particular gene is associated with a trait. Such uses are specifically contemplated in the present invention and claims.
- the general strategy to perform association studies using polymo ⁇ hic markers is to scan two groups of individuals (case-control populations) in order to measure and statistically compare the allele frequencies ofthe polymo ⁇ hic markers ofthe present invention in both groups.
- a statistically significant association with a trait is identified for at least one or more ofthe analyzed polymo ⁇ hic markers, one can assume that: either the associated allele is directly responsible for causing the trait (the associated allele is the trait causing allele), or more likely the associated allele is in linkage disequilibrium with the trait causing allele.
- the specific characteristics ofthe associated allele with respect to the candidate gene function usually gives further insight into the relationship between the associated allele and the trait (causal or in linkage disequilibrium). If the evidence indicates that the associated allele within the candidate gene is most probably not the trait causing allele but is in linkage disequilibrium with the real trait causing allele, then the trait causing allele can be found by sequencing the vicinity ofthe associated marker.
- Haplotype analysis As described above, when a chromosome carrying a disease allele first appears in a population as a result of either mutation or migration, the mutant allele necessarily resides on a chromosome having a set of linked markers: the ancestral haplotype. This haplotype can be tracked through populations and its statistical association with a given trait can be analyzed.
- haplotype association study allows one to define the frequency and the type ofthe ancestral carrier haplotype.
- a haplotype analysis is important in that it increases the statistical power of an analysis involving individual markers.
- the frequency ofthe possible haplotypes based on various combinations ofthe identified polymo ⁇ hic markers of the invention is determined.
- the haplotype frequency is then compared for distinct populations of trait positive and control individuals.
- the number of trait positive individuals, which should be, subjected to this analysis to obtain statistically significant results usually ranges between 30 and 300, with a preferred number of individuals ranging between 50 and 150.
- the same considerations apply to the number of unaffected individuals (or random control) used in the study.
- the results of this first analysis provide haplotype frequencies in case-control populations, for each evaluated haplotype frequency a p-value and an odd ratio are calculated. If a statistically significant association is found the relative risk for an individual carrying the given haplotype of being affected with the trait under study can be approximated.
- Interaction analysis The polymo ⁇ hic markers ofthe present invention may also be used to identify patterns of polymo ⁇ hic markers associated with detectable traits resulting from polygenic interactions. The analysis of genetic interaction between alleles at unlinked loci requires individual genotyping using the techniques described herein. The analysis of allelic interaction among a selected set of polymo ⁇ hic markers with appropriate level of statistical significance can be considered as a haplotype analysis.
- Interaction analysis consists in stratifying the case-control populations with respect to a given haplotype for the first loci and performing a haplotype analysis with the second loci with each subpopulation.
- Allelic frequencies ofthe polymo ⁇ hic markers in a population can be determined using one ofthe methods described above or any genotyping procedure suitable for this intended pu ⁇ ose.
- Genotyping pooled samples or individual samples can determine the frequency of a polymo ⁇ hic marker allele in a population.
- One way to reduce the number of genotypings required is to use pooled samples.
- a major obstacle in using pooled samples is in terms of accuracy and reproducibility for determining accurate DNA concentrations in setting up the pools. Genotyping individual samples provides higher sensitivity, reproducibility and accuracy and; is the preferred method used in the present invention.
- each individual is genotyped separately and simple gene counting is applied to determine the frequency of an allele of a polymo ⁇ hic marker or of a genotype in a given population. Determining the frequencv of a haplotype in a population
- the gametic phase of haplotypes is unknown when diploid individuals are heterozygous at more than one locus. Using genealogical information in families gametic phase can sometimes be inferred (Perlin et al., Am. J Hum. Genet, 55:777-787, 1994). When no genealogical information is available different strategies may be used.
- single chromosomes can be studied independently, for example, by asymmetric PCR amplification (see Newton et al., Nucleic Acids Res., 17:2503-2516, 1989; Wu et al., Proc. Natl Acad Sci. USA, 86:2757, 1989) or by isolation of single chromosome by limit dilution followed by PCR amplification (see Ruano et al., Proc.
- the principle is to start filling a preliminary list of haplotypes present in the sample by examining unambiguous individuals, that is, the complete homozygotes and the single-site heterozygotes. Then other individuals in the same sample are screened for the possible occurrence of previously recognized haplotypes. For each positive identification the complementary haplotype is added to the list of recognized haplotypes, until the phase information for aU individuals is either resolved or identified as unresolved.
- This method assigns a single haplotype to each multiheterozygous individual, whereas several haplotypes are possible when there are more than one heterozygous site.
- EM expectation- maximization
- Linkage disequihbrium is the non-random association of alleles at two or more loci and represents a powerful tool for mapping genes involved in disease traits (see
- Polymo ⁇ hic markers because they are densely spaced in the human genome and can be genotyped in more numerous numbers than other types of genetic markers (such as RFLP or VNTR markers), are particularly useful in genetic analysis based on linkage disequilibrium.
- the polymo ⁇ hic markers ofthe present invention maybe used in any linkage disequilibrium analysis method known in the art.
- a disease mutation when first introduced into a population (by a new mutation or the immigration of a mutation carrier), it necessarily resides on a single chromosome and thus on a single "background” or “ancestral” haplotype of linked markers. Consequently, there is complete disequilibrium between these markers and the disease mutation: one finds the disease mutation only in the presence of a specific set of marker alleles. Through subsequent generations recombinations occur between the disease mutation and these marker polymo ⁇ hisms, and the disequilibrium gradually dissipates. The pace of this dissipation is a function ofthe recombination frequency, so the markers closest to the disease gene will manifest higher levels of disequilibrium than those further away.
- the pattern or curve of disequilibrium, between disease and marker loci is expected to exhibit a maximum that occurs at the disease locus. Consequently, the amount of linkage disequilibrium between a disease allele and closely linked genetic markers may yield valuable information regarding the location ofthe disease gene.
- fine-scale mapping of a disease locus it is useful to have some knowledge ofthe patterns of linkage disequilibrium that exist between markers in the studied region. As mentioned above the mapping resolution achieved through the analysis of linkage disequilibrium is much higher than that of linkage studies. The high density of polymo ⁇ hic markers combined with linkage disequilibrium analysis provides powerful tools for fine-scale mapping.
- any marker in linkage disequilibrium with a first marker associated with a trait will be associated with the trait. Therefore, once an association has been demonstrated between a given polymo ⁇ hic marker and a trait, the discovery of additional polymo ⁇ hic markers associated with this trait is of great interest in order to increase the density of polymo ⁇ hic markers in this particular region. The causal gene or mutation will be found in the vicinity ofthe marker or set of markers showing the highest correlation with the trait.
- Identification of additional markers in linkage disequilibrium with a given marker involves: (a) amplifying a genomic fragment comprising a first polymo ⁇ hic marker from a plurality of individuals; (b) identifying of second polymo ⁇ hic markers in the genomic region harboring said first polymo ⁇ hic marker; (c) conducting a linkage disequilibrium analysis between said first polymo ⁇ hic marker and second polymo ⁇ hic markers; and (d) selecting said second polymo ⁇ hic markers as being in linkage disequilibrium with said first marker. Subcombinations comprising steps (b) and (c) are also contemplated.
- Case-control populations can be genotyped for polymo ⁇ hic markers to identify associations that narrowly locate a trait causing allele. As any marker in linkage disequilibrium with one given marker associated with a trait will be associated with the trait. Linkage disequilibrium allows the relative frequencies in case-control populations of a limited number of genetic polymo ⁇ hisms (specifically polymo ⁇ hic markers) to be analyzed as an alternative to screening all possible functional polymo ⁇ hisms in order to find trait-causing alleles. Association studies compare the frequency of marker alleles in unrelated case-control populations, and represent powerful tools for the dissection of complex traits. Case-control populations (inclusion criteria)
- Population-based association studies do not concern familial inheritance but compare the prevalence of a particular genetic marker, or a set of markers, in case- control populations. They are case-control studies based on comparison of unrelated case (affected or trait positive) individuals and unrelated control (unaffected or trait negative or random) individuals.
- the control group is composed of unaffected or trait negative individuals.
- the control group is ethnically matched to the case population.
- the control group is preferably matched to the case-population for the main known confusion factor for the trait under study (for example age-matched for an age-dependent trait).
- individuals in the two samples are paired in such a way that they are expected to differ only in their disease status, hi the following "trait positive population", "case population” and "affected population” are used interchangeably.
- a major step in the choice of case-control populations is the clinical definition of a given trait or phenotype.
- Any genetic trait may be analyzed by the association method proposed here by carefully selecting the individuals to be included in the trait positive and trait negative phenotypic groups.
- Four criteria are often useful: clinical phenotype, age at onset, family history and severity.
- the selection procedure for continuous or quantitative traits involves selecting individuals at opposite ends ofthe phenotype distribution ofthe trait under study, so as to include in these trait positive and trait negative populations individuals with non-overlapping phenotypes.
- case-control populations consist of phenotypically homogeneous populations.
- Trait positive and trait negative populations consist of phenotypically uniform populations of individuals representing each between 1 and 98%, preferably between 1 and 80%), more preferably between 1 and 50%, and more preferably between 1 and 30%, most preferably between 1 and 20% ofthe total population under study, and selected among individuals exhibiting non-overlapping phenotypes.
- the selection of those drastically different but relatively uniform phenotypes enables efficient comparisons in association studies and the possible detection of marked differences at the genetic level, provided that the sample sizes ofthe populations under study are significant enough.
- typical examples of inclusion criteria include a CNS disorder or the evaluation ofthe response to a drag acting on a CNS disorder or side effects to treatment with drugs acting on a CNS disorder.
- Suitable examples of association studies using polymo ⁇ hic markers including the polymo ⁇ hic markers ofthe present invention are studies involving the following populations:
- the TaqMan® assay method involves designing two probes, one that contains the more common allele (allele 1) and another probe that contains the least common allele (allele 2).
- the two probes contain different fluorescent reporter dyes (FAM and NIC), which are used to differentiate the two alleles, and a nonflurescent quencher dye.
- FAM and NIC fluorescent reporter dyes
- Forward and reverse primers are designed flanking the probe to give a PCR product between 75 and 150 bp. The two probes and the primers are added to the D ⁇ A in a PCR assay.
- the probe for allele 1 will hybridize to the PCR product, the reporter dye will be cleaved by the 5' nuclease activity of Taq DNA polymerase, and there will be an increase fluorescence of that reporter dye. If the DNA sample is homozygous for allele 2 there will be an increase fluorescence ofthe reporter dye attached to the allele 2 probe. If the sample is heterozygous for allele 1 and 2 there will be an increase fluorescence in both reporter dyes. Following the PCR reaction the fluorescence is read on an ABI PRISM 7700 Sequence Dectector.
- Primers and Taqman® MGB probes for each SNP were designed using the software Primer Express version 1.5 (Applied Biosystems).
- Table 4 list all the primers and probes for each SNP. The table indicates which probe contains the allele 1 SNP or the allele 2 SNP. For SNPs #1,2 and 7 the probes are designed for the sense strand and for SNPs #3 and 4 the probes are for the antisense (complementary) strand, h Table 4, the SNP nucleotide is in bold type and underlined. All (allele 1) indicates the probe contains the SNP for the more common allele and A12 (allele 2) indicates the probe contains the SNP for the rare allele. F is the forward primer and R is the reverse.
- the primers were resuspended in H 2 0 at a final concentration of 100 ⁇ M.
- the PCR reaction was done in 10 ⁇ l consisting ofthe following: 5 ⁇ l of 2X TaqMan® Universal PCR Master Mix, 200 nM of each probe, 900 nM ofthe forward and reverse primers, and H 0 to 10 ⁇ l.
- the 10 ⁇ l was added to the dried down DNA samples.
- the following controls were done on each plate, 8 no template controls, 8 allele 1 controls and 8 allele 2 controls.
- the allele 1 and 2 controls contained 25 ng of DNA from the ConOl described in Example 1.
- the plates were placed on a Titer Plate Shaker and shaken vigorously for 5 minutes then briefly spun at 1000 ⁇ m.
- Thermal cycling was performed in a 9600 cycler (Applied Biosystems) with the following thermal cycling conditions: 50°C for 2 min--->95 0 C for 10 min— >35 cycles of 92°C for 15 sec, 60°C for 1 min.
- the fluorescent signal was detected using an ABI PRISM 7700 Sequence Detector (Applied Biosystems) following the manufactures instructions for an endpoint plate read. The data was analyzed with the SDS software version 1.7 (Applied Biosystems). Results
- S2-S4-S6, S2-S4-S8, S 1 -S2-S4-S8 and S1-S2-S4-S6 have p-values equals to 0.0014, 0.0018, 0.0012 and 0.0016 that are slightly above the Bonferroni adjusted threshold, 0.001.
- the individual haplotype significance results are presented below in Table 5.
- haplotype G-C is present in an affected population significantly more than in the control population.
- the individual significance level of the G-C haplotype observation is 0.00021.
- haplotype A-C is present in an affected population significantly more than in the control population.
- the individual significance level of the A-C haplotype observation is 0.00213.
- haplotype G-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-G haplotype observation is 0.0112.
- haplotype A-G are present in an affected population significantly more than in the control population and the haplotype A-A significantly less in the affected population than in the control population.
- the individual significance level ofthe A-A haplotype observation is 0.02233 and the A-G haplotype observation is 0.03211.
- haplotype G-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-G haplotype observation is 0.02546.
- haplotype G-A is present in an affected population significantly less than in the control population.
- the individual significance level of the G-A haplotype observation is 0.03099.
- haplotype G-C-G is present in an affected population significantly less than in the control population.
- the individual significance level of the G-C-G haplotype observation is 0.00046.
- haplotype G-C-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-C-G haplotype observation is 0.00103.
- haplotype A-C-G is present in an affected population significantly more than in the control population.
- the individual significance level of the A-C-G haplotype observation is 0.00176.
- haplotype A-G-C is present in an affected population significantly more than in the control population.
- the individual significance level of the A-G-C haplotype observation is 0.00223.
- haplotype A-C-G is present in an affected population significantly more than in the control population.
- the individual significance level of the A-C-G haplotype observation is 0.00261.
- haplotype G-C-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-C-G haplotype observation is 0.01527.
- haplotype A-G-A is present in an affected population significantly less than in the control population.
- the individual significance level of the A-G-A haplotype observation is 0.02358.
- haplotype G-G-C is present in an affected population significantly more than in the control population.
- the individual significance level of the G-G-C haplotype observation is 0.03015.
- haplotype G-G-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-G-G haplotype observation is 0.03034.
- haplotype G-G-G is present in an affected population significantly more than in the control population.
- the individual significance level of the G-G-G haplotype observation is 0.03077.
- haplotype G-G-A is present in an affected population significantly less than in the control population.
- the individual significance level of the G-G-A haplotype observation is 0.03113.
- SNP SI S4 and S6 of gene Seq-40 there are 6 potential haplotypes.
- haplotype A-G-A is present in an affected population significantly less than in the control population.
- the individual significance level of the A-G-A haplotype observation is 0.033.
- haplotype G-C-T is present in an affected population significantly more than in the control population.
- the individual significance level of the G-C-T haplotype observation is 0.03317.
- haplotype A-G-G is present in an affected population significantly more than in the control population.
- the individual significance level of the A-G-G haplotype observation is 0.03812.
- haplotype G-C-G-G is present in an affected population significantly more than in the control population.
- the individual significance level ofthe G-C-G-G haplotype observation is 0.00076.
- haplotype A-G-C-G is present in an affected population significantly more than in the control population.
- the individual significance level ofthe A-G-C-G haplotype observation is 0.00237.
- haplotype G-C-G-T and haplotype G-C-G-G are present in an affected population significantly more than in the control population.
- the individual significance level ofthe G-C-G-T haplotype observation is 0.01911 and of of the G-C-G-G haplotype observation is 0.02861.
- haplotype A-G-G-A is present in an affected population significantly less than in the control population.
- the individual significance level ofthe A-G-G-A haplotype observation is 0.03061.
- haplotype A-C-G-T is present in an affected population significantly more than in the control population.
- the individual significance level ofthe A-C-G-T haplotype observation is 0.03114.
- haplotype A-G-C-G is present in an affected population significantly more than in the control population.
- the individual significance level ofthe A-G-C-G haplotype observation is 0.03114.
- the polymo ⁇ hic markers ofthe present invention may further be used in TDT (transmission/disequilibrium test). TDT tests for both linkage and association and is not affected by population stratification. TDT requires data for affected individuals and their parents or data from unaffected sibs instead of from parents (see Spielman. S. et al., Am. J Hum. Genet, 52:506-516,1993; Schaid D.J. et al., Genet. Epidemiol,13:423-450, 1996, Spielman. S. and Ewens W.J., Am. JHum. Genet, 62:450-458,1998).
- This method employs a family-based experimental design to avoid potential pitfalls due to mismatching of case and control groups or admixture of subpopulations consisting of different racial or ethnic groups.
- theoretical analyses indicate that this approach may be much more powerful than traditional linkage-based approaches for detecting alleles of relatively small effect such those conferring a 2-fold or 4-fold increase in disease risk.
- the TDT approach in general requires genotype data from parents and an affected child to examine whether there is any excess/under transmission of any haplotype. Transmitted haplotypes can be considered as cases and non-transmitted haplotypes can be considered as controls.
- the computer program TRANSMIT (Clayton, 99) can be used to conduct the analysis.
- any method known in the art to test whether a trait and a genotype show a statistically significant correlation may be used to correlate a trait with the polymo ⁇ hisms ofthe invention.
- haplotype frequencies can be estimated from the multilocus genotypic data. Any method known to person skilled in the art can be used to estimate haplotype frequencies (see Lange K., Mathematical and Statistical Methods for Genetic Analysis, Springer, New York, 1997; Weir, B.S., Genetic data Analysis I: Methods for Discrete population genetic Data, Sinauer Assoc, Inc., Sunderland, MA USA, 1996).
- maximum-likelihood haplotype frequencies are computed using an Expectation-Maximization (EM) algorithm (see Dempster et al., J R.
- EM algorithm is a generalized iterative maximum likelihood approach to estimation and is briefly described below.
- phenotypes will refer to multi-locus genotypes with unknown phase.
- Genotypes will refer to known-phase multi-locus genotypes.
- a stop criterion can be that the maximum difference between haplotype frequencies between two iterations is less than IO "7 . These values can be adjusted according to the desired precision of estimations.
- the Expectation step consists in calculating the genotypes frequencies by the following equation:
- Equation 3 where genotype / occurs in phenotype j, and where h k and h / , constitute genotype i. Each probability is derived according to equation 1, and equation 2 described above. Then the Maximisation step simply estimates another set of haplotype frequencies given the genotypes frequencies. This approach is also known as the gene- counting method (Smith, Ann. Hum. Genet, 21:254-276, 1957).
- da is an indicator variable which count the number of time haplotype t in genotype i. It takes the values of 0, 1 or 2. To ensure that the estimation finally obtained is the maximum-likelihood estimation several values of departures are required. The estimations obtained are compared and if they are different the estimations leading to the best likelihood are kept. 3. Methods to calculate linkage disequilibrium between markers A number of methods can be used to calculate linkage disequilibrium between any two genetic positions, in practice linkage disequilibrium is measured by applying a statistical association test to haplotype data taken from a population.
- n2 ⁇ phenotype (a,/a ⁇ , a j /b,)
- n3 ⁇ phenotype (a/h,, a/a,)
- n4 Z phenotype (a/b,, a/b,) and N is the number of individuals in the sample.
- This formula allows linkage disequilibrium between alleles to be estimated when only genotype, and not haplotype, data are available.
- Another means of calculating the linkage disequilibrium between markers is as follows. For a couple of polymo ⁇ hic markers, M ⁇ (a t b andJk ⁇ (a , fitting the Hardy- Weinberg equilibrium, one can estimate the four possible haplotype frequencies in a given population according to the approach described above.
- pr(a, . ) is the probability of allele a ⁇
- pr(a,) is the probability of allele a j
- pr(h ⁇ plotype (a 1 ⁇ a ⁇ )) is estimated as in Equation 3 above.
- Linkage disequilibrium, among a set of polymo ⁇ hic markers having an adequate heterozygosity rate can be determined by genotyping between 50 and 1000 unrelated individuals, preferably between 75 and 200, more preferably around 100. 4. Testing for association
- Methods for determining the statistical significance of a correlation between a phenotype and a genotype may be determined by any statistical test known in the art and with any accepted tlireshold of statistical significance being required.
- the application of particular methods and thresholds of significance are well with in the skill ofthe ordinary practitioner ofthe art.
- Testing for association is performed by determining the frequency of a polymo ⁇ hic marker allele in case and control populations and comparing these frequencies with a statistical test to determine if their is a statistically significant difference in frequency which would indicate a correlation between the trait and the polymo ⁇ hic marker allele under study.
- a haplotype analysis is performed by estimating the frequencies of all possible haplotypes for a given set of polymo ⁇ hic markers in case and control populations, and comparing these frequencies with a statistical test to determine if their is a statistically significant correlation between the haplotype and the phenotype (trait) under study.
- Any statistical tool useful to test for a statistically significant association between a genotype and a phenotype may be used.
- the statistical test employed is a chi-square test with one degree of freedom. A P-value is calculated (the P-value is the probability that a statistic as large or larger than the observed one would occur by chance). Statistical significance
- the p value related to a polymo ⁇ hic marker association is preferably about 1 x 10 " or less, more preferably about 1 x IO "4 or less, for a single polymo ⁇ hic marker analysis and about 1 x 10 "3 or less, still more preferably 1 x IO "6 or less and most preferably of about 1 x 10 " or less, for a haplotype analysis involving several markers.
- genotyping data from case-control individuals are pooled and randomized with respect to the trait phenotype.
- Each individual genotyping data is randomly allocated to two groups, which contain the same number of individuals as the case-control populations used to compile the data obtained in the first stage.
- a second stage haplotype analysis is preferably run on these artificial groups, preferably for the markers included in the haplotype ofthe first stage analysis showing the highest relative risk coefficient. This experiment is reiterated preferably at least between 100 and 10000 times. The repeated iterations allow the determination ofthe percentage of obtained haplotypes with a significant p-value level. Assessment of statistical association
- a risk factor in genetic epidemiology the risk factor is the presence or the absence of a certain allele or haplotype at marker loci
- F+ is the frequency ofthe exposure to the risk factor in cases and F ⁇ is the frequency ofthe exposure to the risk factor in controls.
- F+ and F " ⁇ are calculated using the allelic or haplotype frequencies ofthe study and further depend on the underlying genetic model (dominant, recessive, additive).
- AR Attributable risk
- AR is the risk attributable to a polymo ⁇ hic marker allele or a polymo ⁇ hic marker haplotype.
- PE is the frequency of exposure to an allele or a haplotype within the population at large; and RR is the relative risk which is approximated with the odds ratio when the trait under study has a relatively low incidence in the general population.
- the Seq-40 gene can be scanned for mutations by comparing the sequences of a selected number of trait positive and trait negative individuals.
- functional regions such as exons and splice sites, promoters and other regulatory regions ofthe candidate gene are scanned for mutations.
- trait positive individuals carry the haplotype or allele shown to be associated with the trait and trait negative individuals do not carry the haplotype or allele associated with the trait.
- the mutation detection procedure is essentially similar to that used for polymo ⁇ hic site identification.
- the method used to detect such mutations generally comprises the following steps: (a) amplification of a region ofthe Seq-40 gene comprising a polymo ⁇ hic marker or a group of polymo ⁇ hic markers associated with the trait from DNA samples of trait positive patients and trait negative controls; (b) sequencing ofthe amplified region; (c) comparison of DNA sequences from trait-positive patients and trait-negative controls; and (d) determination of mutations specific to trait-positive patients. Subcombinations which comprise steps (b) and (c) are specifically contemplated.
- candidate polymo ⁇ hisms be then verified by screening a larger population of cases and controls by means of any genotyping procedure such as those described herein, preferably using a microsequencing technique in an individual test format. Polymo ⁇ hisms are considered as candidate mutations when present in cases and controls at frequencies compatible with the expected association results.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US40643202P | 2002-08-28 | 2002-08-28 | |
| US406432P | 2002-08-28 | ||
| US230007 | 2002-08-28 | ||
| US10/230,007 US20030170667A1 (en) | 2001-08-28 | 2002-08-28 | Single nucleotide polymorphisms diagnostic for schizophrenia |
| PCT/US2003/024799 WO2004020580A2 (en) | 2002-08-28 | 2003-08-26 | Single nucleotide polymorphisms diagnostic for schizophrenia |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1546398A2 true EP1546398A2 (de) | 2005-06-29 |
| EP1546398A4 EP1546398A4 (de) | 2006-10-18 |
Family
ID=31980950
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03791659A Withdrawn EP1546398A4 (de) | 2002-08-28 | 2003-08-26 | Einzelnukleotid-polymorphismen zur diagnose von schizophrenie |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1546398A4 (de) |
| JP (1) | JP2005537010A (de) |
| AU (1) | AU2003261460A1 (de) |
| WO (1) | WO2004020580A2 (de) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006023719A2 (en) * | 2004-08-20 | 2006-03-02 | Enh Research Institute | Identification of snp’s associated with schizophrenia, schizoaffective disorder and bipolar disorder |
| US7932042B1 (en) | 2010-10-13 | 2011-04-26 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the olanzapine poor response predictor genetic signature |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU784543B2 (en) * | 1999-11-16 | 2006-04-27 | Pharmacia & Upjohn Company | Novel G protein-coupled receptors |
| EP1364013A1 (de) * | 2001-02-14 | 2003-11-26 | PHARMACIA & UPJOHN COMPANY | G-protein gekoppelter rezeptor |
| WO2003020980A2 (en) * | 2001-08-28 | 2003-03-13 | Pharmacia & Upjohn Company | Single nucleotide polymorphisms diagnostic for schizophrenia |
-
2003
- 2003-08-26 AU AU2003261460A patent/AU2003261460A1/en not_active Abandoned
- 2003-08-26 JP JP2004532878A patent/JP2005537010A/ja not_active Withdrawn
- 2003-08-26 WO PCT/US2003/024799 patent/WO2004020580A2/en not_active Ceased
- 2003-08-26 EP EP03791659A patent/EP1546398A4/de not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| WO2004020580A3 (en) | 2005-04-14 |
| WO2004020580A2 (en) | 2004-03-11 |
| AU2003261460A1 (en) | 2004-03-19 |
| EP1546398A4 (de) | 2006-10-18 |
| JP2005537010A (ja) | 2005-12-08 |
| WO2004020580A8 (en) | 2004-07-08 |
| AU2003261460A8 (en) | 2004-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6525185B1 (en) | Polymorphisms associated with hypertension | |
| US20040005584A1 (en) | Biallelic markers for use in constructing a high density disequilibrium map of the human genome | |
| US6869762B1 (en) | Crohn's disease-related polymorphisms | |
| CA2395240A1 (en) | Biallelic markers derived from genomic regions carrying genes involved in central nervous system disorders | |
| CA2324866A1 (en) | Biallelic markers for use in constructing a high density disequilibrium map of the human genome | |
| US20030170667A1 (en) | Single nucleotide polymorphisms diagnostic for schizophrenia | |
| US20030224365A1 (en) | Single nucleotide polymorphisms diagnostic for schizophrenia | |
| US20040115699A1 (en) | Single nucleotide polymorphisms diagnostic for schizophrenia | |
| EP1276899A2 (de) | Ibd-verwandte polymorphismen | |
| WO2004020580A2 (en) | Single nucleotide polymorphisms diagnostic for schizophrenia | |
| CA2565804A1 (en) | Haplotype markers and methods of using the same to determine response to treatment | |
| EP1307590A1 (de) | POLYMORPHISMEN FüR DIE DIAGNOSTIK DES TGF-BETA1 PROMOTERS | |
| AU2002338451A1 (en) | Single nucleotide polymorphisms diagnostic for schizophrenia | |
| US20040170992A1 (en) | Diagnostic polymorphisms of tgf-beta1 promoter | |
| US20030170679A1 (en) | Single nucleotide polymorphisms in GH-1 | |
| US20090305246A1 (en) | Schizophrenia associated genes and markers | |
| US20040076975A1 (en) | Methods for assessing the risk of non-insulin-dependent diabetes mellitus based on allelic variations in the 5'-flanking region of the insulin gene and body fat | |
| JP2005524383A (ja) | 統合失調症の診断に用いる一塩基多型 | |
| CA2454159A1 (en) | Methods for assessing the risk of obesity based on allelic variations in the 5'-flanking region of the insulin gene | |
| WO2002022881A1 (en) | Endothelin-1 promoter polymorphism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| 17P | Request for examination filed |
Effective date: 20051014 |
|
| RBV | Designated contracting states (corrected) |
Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20060919 |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: PHARMACIA & UPJOHN COMPANY LLC |
|
| 17Q | First examination report despatched |
Effective date: 20070212 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070823 |