EP1539782A2 - A high resolution typing system for pathogenic borrelia - Google Patents

Abstract

MLVA methods for strain discrimination among globally diverse Borrelia isolates including B. burgdorferi, B. afzelii, and B. garinii are disclosed. Ten VNTR loci have been identified from genomic and plasmid sequences of Borrelia strains and primer pairs suitable for amplifying the VNTR by PCR are disclosed. Polymorphisms at these loci were used to resolve genotypes into distinct groups. The resolution of 30 unique genotypes into five to seven distinct groups is demonstrated.. This sub-typing scheme is useful for the epidemiological study of Borrelia and may be applied to the local detection of the pathological causative agent of Lyme Disease.

Description

A HIGH RESOLUTION TYPING SYSTEM FOR PATHOGENIC BORRELIA

CLAIM TO DOMESTIC PRIORITY

[0001] This application claims priority to US Provisional application Serial No. 60/393,497 entitled A High Resolution Typing System For Pathogenic Borrelia filed July 2, 2002, by Paul S. Keim and Jason Farlow, and is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0002] The present invention is generally directed to sub-typing Borrelia spirochetes, the causative agent of Lyme Disease, and is more specifically directed to PCR amplification of variable number tandem repeat sequences (VNTR) with primer pairs designed to bind specifically to certain VNTR identified in Borrelia isolates. Results of the analysis may be compared to results from known Borrelia species to determine the sub-type of the species for epidemiological and diagnostic purposes.

BACKGROUND OF THE INVENTION

[0003] Human Lyme Borreliosis (LB) is the most prevalent arthropod-borne infection in temperate climate zones around the world. LB is caused by members of the Borreliae spirochetes (30, 19). In 1996, more than 16,000 cases of Lyme Borreliosis were reported in North America totaling 100,000 cases in a 14 year period (9, 10).

Borreliae spirochetes are 5 to 25 μm long and 0.2 to 0.5 μm wide (24). These organisms are highly motile, microaerophilic, slow-growing, and fastidious (24). Lyme disease is an inflammatory disorder characterized by the skin lesion erythema migrans and the potential development of neurologic, cardiac, and joint abnormalities (24). The three Borrelia species that frequently cause Lyme disease in humans are Borrelia burgdorferi sensu stricto, Borrelia garinii, and Borrelia afzelii (19, 6). Specific Borrelia species can cause distinct clinical manifestations of Lyme disease. B. burgdorferi can cause arthritis (2, 28). B. garinii is known to cause serious neurological manifestations (2, 28). B. afzelii causes a distinctive skin condition known as aero dermatitis chronica atrophicans (ACA) (27). Each of the three Borrelia species causes characteristic erythema migrans (EM)(2, 28).

[0004] The taxonomy of B. burgdorferi has undergone extensive revision. At present there are 10 species of B. burgdorferi sensu lato characterized and subsequently placed within the B. burgdorferi complex. B. burgdorferi sensu stricto is found primarily in North America and Europe (6, 15, 19, 33). B. garinii, B. afzelii, B. valaisiana, and B. lusitaniae have been isolated throughout Eurasia (33). B. japonica, B. tanukii, and B. turdi are found primarily in Japan (17, 20). B. andersonii and B. bissettii are predominantly distributed in North America (22, 31). Ixodes scapularis, Ixodespacificus, and Ixodes ricinus are the three primary tick reservoirs for B. burgdorferi sensu lato (5). The tick reservoir hosts include numerous small mammal species and birds (1, 18, 26).

[0005] Members of B. burgdorferi sensu lato are genetically diverse. The bacterium possesses the largest number of extra-chromosomal elements, plasmids, of any known bacterial species: nine circular plasmids and 12 linear plasmids (7, 16). Borrelia spp. also has some of the smallest bacterial genomes: -910 Kb. The combined chromosome/plasmid nucleotide content is approximately 1.5 Mb. Although the Borrelia genome mostly evolves in a clonal way (12), OspC gene studies suggest lateral transfer does exist (11, 13, 23). The mechanisms of these genetic exchanges could be due to whole plasmid lateral transfer or more likely to gene transfer agent (11). The molecular mechanisms responsible for this genetic exchange are presently unknown. The Borrelia genome exhibits significant genetic redundancy and carries 161 to 175 paralogous gene families (7). Such families may serve as foci for inter-plasmid homologous recombination. At least one linear plasmid gene is found within each of 107 gene families creating a significant amount of redundancy and an unusually large number of pseudogenes (7). Approximately 90% of Borrelia 's plasmid genes show little similarity to genes of other bacteria (7). It is possible these linear plasmids may be in a phase of rapid evolution and may undergo antigenic variation from immune selection.

[0006] Numerous molecular techniques have recently been used to characterize

Borrelia species including 16S rRNA gene sequence analysis, SDS PAGE, Western blot analysis, pulsed-fϊeld gel electrophoresis (PFGE), plasmid fingerprinting, randomly amplified polymorphic DNA (RAPD) analysis, restriction fragment length polymorphism (RFLP) analysis, fatty acid profile analysis, and serotyping (4, 8, 15, 33). For a more thorough review of the molecular typing methods used in Borrelia characterization see Wang et al, 1999 (33). Although a previous study suggests RAPD analysis is effective for strain discrimination within and among Borrelia species (34), its utility in determining robust evolutionary relationships remains questionable due to the method's reduced capacity to provide reproducible data crucial for cladistic character analysis.

[0007] Previously, most Borrelia analyses have been performed either phenotypically with monoclonal antibodies, DNA sequencing, or small fragment RFLPs. These analyses involved single genes or limited genomic loci, which do not effectively reflect the characteristics of the whole organism. In addition previous studies either were restricted to one species (29) or used a small number of strains (30). A greater resolution and differentiation of species is necessary for sub-typing Borrelia species in order to track sources of infection and ultimately to prevent the spread of disease.

[0008] Simple sequence repeats (SSRs) or variable number tandem repeats

(VNTRs) have been shown to provide a high level of discriminatory power (21). This stems from the significant mutability of repeat copy number. Multiple-locus VNTR analysis (MLVA) has previously shown great discriminatory capacity and accurate estimation of genetic-relationships within bacterial pathogens such as Francisella tularensis and Bacillus anthracis (14, 21).

[0009] Methods and means for determining the genetic differences between Borrelia species with speed, accuracy and with great discriminatory capacity have been sought.

SUMMARY OF THE INVENTION

[0010] The present invention discloses methods and means for detecting and sub- typing Borrelia species by multi-locus analysis of VNTR identified- within the genome of Borrelia burgdorferi. [0011] In an important aspect of the present invention, isolated nucleic acids are presented comprising at least 12, 15, 18 or total consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10. SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18, SEQ ID NO: 19; and SEQ ID NO: 20 and sequences complementary thereto.

[0012] In certain preferred embodiments of the invention, these nucleic acids are immobilized on a solid surface and are useful, for example, in the detection of a Borrelia species in an assay employing probes, including, but not limited to, a nano-detection device.

[0013] In another important aspect of the invention, primer pairs comprising a forward and a reverse primer, are presented for amplification of VNTR located in DNA from a Borrelia species. Primer pairs suitable for PCR amplification of VNTR, by MLVA or by multiplex , for example, may be selected from the group consisting of SEQ ID NO 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8 SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16, SEQ ID NO: 17 and 18, and SEQ ID NO: 19 and 20. Certain preferred primer pairs have, in addition, an observable group whereby amplified product may be detected. Such groups may be, for example, a fluorescent group or a radioactive group.

[0014] In yet another important aspect of the invention, a method for detecting a

Borrelia species is presented. The method comprises the steps of:

i. obtaining a DNA sample from said species, ii. amplifying a VNTR marker loci in said DNA with one or more primer pairs; and iii. detecting an amplification product that contains the VNTR sequence. [0015] In another important aspect of the invention, MLVA methods are presented for observing polymorphisms at VNTR loci in DNA from more than one Borrelia species to resolve unique genotypes between the species and to allow sub-typing of the species into distinct groups. These MLVA methods provide a convenient and rapid method for strain discrimination in Borrelia. MLVA may be applied for strain discrimination among globally diverse Borrelia isolates including B. burgdorferi, B. afzelii, and B. garinii.

[0016] In yet another important aspect of the invention, kits are provided for detecting and sub-typing Borrelia species. The kits comprise one or more primer pairs suitable for amplifying VNTR in DNA in a sample of said species and may comprise, in addition, nucleic acids, enzymes, tag polymerase, for example, and buffers suitable for causing amplification by PCR, by MLVA or by multiplex, for example. In certain preferred embodiments of the kit the primers comprise a label whereby amplified VNTR may be detected. In other preferred embodiments of the kit, labeled nucleic acids are provided. Observable labels are preferably fluorescent molecules or radionucleotides.

[0017] A method of sub-typing a Borrelia strain is provided comprising the steps of:

i. obtaining DNA from said strain; ii. amplifying said DNA with one or more primer pairs selected from the goup consisting of SEQ ID NOS : 1 -20; iii. detecting said amplified product; iv. determining the diversity number of said amplified product; and v. comparing said diversity number with the diversity number for a known strain of Borrelia.

BRIEF DESCRIPTION OF THE FIGURES

[0018] Figure 1 illustrates genetic relationships among Borrelia isolates.

Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster analysis based upon allelic differences from ten VNTR markers across 41 5. burgdorferi, B. afzelii, and B, garinii isolates was used to construct this dendogram. Letters to the right of each branch correspond to the individual sample identification (Table 2) followed by Borrelia species designation. The horizontal axis indicates estimated VNTR allelic differences (Allelic differences are a measure of genetic evolutionary distance). Roman numerals indicate arbitrary groupings of species.

[0019] Figure 2 illustrates the correlation between repeat copy number and diversity measures. The B31 B. burgdorferi strain repeat copy number (Table 1) was compared diversity (Pearson coefficient R = 0.62) and total observed allele number (Pearson coefficient R = 0.94) at each marker locus. Crosses (+) indicate the marker's total observed allele number versus repeat copy number at an individual marker locus. Diamonds (♦) indicate the marker's calculated diversity value versus the repeat copy number of an individual marker. Analysis was performed using only data from the eight Borrelia markers with non-complex repeat motifs.

DETAILS OF THE INVENTION

[0020] The present invention discloses the successful application of MLVA for strain discrimination among globally diverse Borrelia isolates including B. burgdorferi, B. afzelii, and B. garinii. Ten VNTR loci have been identified from genomic and plasmid sequences of Borrelia strains (Table 3, Marker locus number BR-Vl to BR-V10) Polymorphisms at these loci were may be used to resolve genotypes into distinct groups. Figure 1 is a dendogram illustrating the resolution of 30 unique genotypes into five to seven distinct groups. This sub-typing scheme is useful for the epidemiological study of Borrelia and may be applied to the local detection of the pathological causative agent of Lyme Disease.

[0021] The following definitions are used herein:

[0022] "Polymerase chain reaction" or "PCR" a technique in which cycles of denaturation, annealing with primer, and extension with DNA polymerase are used to amplify the number of copies of a target DNA sequence by approximately 106 times or more. The polymerase chain reaction process for amplifying nucleic acid is disclosed in US Pat. Nos. 4,683,195 and 4,683,202, which are incorporated herein by reference.

[0023] "Primer" a single-stranded oligonucleotide or DNA fragment which hybridizes with a DNA strand of a locus in such a manner that the 3' terminus of the primer may act as a site of polymerization using a DNA polymerase enzyme.

[0024] "Primer pair" two primers including, primer 1 that hybridizes to a single strand at one end of the DNA sequence to be amplified and primer 2 that hybridizes with the other end on the complementary strand of the DNA sequence to be amplified.

[0025] "Primer site" : the area of the target DNA to which a primer hybridizes.

[0026] "Multiplexing" is a capability to perform simultaneous, multiple determinations in a single assay process and a process to implement such a capability in a process is a "multiplexed assay." Systems containing several loci are called multiplex systems described, for example, in US Patent No. 6,479,235 to Schumm, et al., US Patent No. 6,270,973 to Lewis, et al. and 6,449,562 to Chandler, et al.

[0027] Isolated nucleic acid" is a nucleic acid which may or may not be identical to that of a naturally occurring nucleic acid. When "isolated nucleic acid" is used to describe a primer, the nucleic acid is not identical to the structure of a naturally occurring nucleic acid spanning at least the length of a gene. The primers herein have been designed to bind to sequences flanking VNTR loci in Borrelia species. It is to be understood that primer sequences containing insertions or deletions in these disclosed sequences that do not impair the binding of the primers to these flanking sequences are also intended to be incorporated into the present invention.

[0028] The present invention provides primer pairs for PCR amplification of

VNTR in DNA of Borrelia. The primer pairs comprise a forward primer and a reverse primer. Table 1 illustrates the Borrelia Primer Sequences of the present invention. Table 1. Borrelia Primer Sequence

Marker

Name Forward sequence Reverse sequence

BR-Vl GTTCAAGATATGGTTAAGGGCAATTTAGATAAAGATC GAAGACTTACATGCCAGTTCATCAAGAGTC

BR-V2 GTATAATGAAGTTAGTGGGCGTTACTCTTGGGTAC GAAACCATAAAACCATCTAAAGATACAAATCATTC

BR-V3 GTTTGTCGTTGCCAAAACTGCTTTCATAATTC GGGATTAAATATGAAAATATATTTAGTTTGTGTGCATTATATCTGC

BR-V4 GTTTCTGCGACTAGGTATGGAACAACTAATAGCTC GCAGTGGGCACAACTACTACTGCAATAATAACTAC

BR-V5 GCAATCCAAAATATTCAAGATCGTATAAAAATGTC GATGATAAAATTTTCAAATGTATATCTTTTTTrAAGAAAGGC

BR-V6 GGATCGATCGTACTGTGCAGCCACAAACGTGCTGCGC GTAGCGTACGTAGCTGCGCGTAGTATTTTTATCGTAGCGCGAGC

BR-V7 GCTTCAAAATGCTGCTTCAATTGCTGGAC GCAAAAACACAAGCTTGCCGGTGAAAC

BR-V8 GATCTAATTCATTAAAAAATTTTGTGAAAGGGGCTTC GATAAATAACTTGCAATATTTCCGCTTAAGGTAGTTTTC

BR-V9 GTCATCTTrAGTGTCTAATrTTAGAATTTrATTAACrmTCTTTGC GTCATGCTTATATCAATGCCCTATGCCTCAAC

BR- V 10 GCTTTTAACGCTAAATTATA A AGAA AAATTATTf CATTTCGGC GTCAAAATTATGCTTCCAAA AGCATTACAATTAA A AA AATC

These primer sequences have herein been assigned SEQ ID NO: as follows:

SEO ID NO Marker Name

SEQ ID NO: 1 BR-Vl Forward primer

SEQ ID NO: 2 BR-Vl Reverse primer

SEQ ID NO: 3 BR-V2 Forward primer

SEQ ID NO: 4 BR-V2 Reverse primer

SEQ ID NO: 5 BR-V3 Forward primer

SEQ ID NO: 6 BR-V3 Reverse primer

SEQ ID NO: 7 BR-V4 Forward primer

SEQ ID NO: 8 BR-V4 Reverse primer

SEQ ID NO: 9 BR-V5 Forward primer

SEQ ID NO: 10 BR-V5 Reverse primer SEQ ID NO: 11 BR-V6 Forward primer

SEQ ID NO: 12 BR-V6 Reverse primer

SEQ ID NO: 13 BR-V7 Forward primer

SEQ ID NO: 14 BR-V7 Reverse primer

SEQ ID NO: 15 BR-V8 Forward primer

SEQ ID NO: 16 BR-V8 Reverse primer

SEQ ID NO: 17 BR-V9 Forward primer

SEQ ID NO: 18 BR-V9 Reverse primer

SEQ ID NO: 19 BR-V10 Forward primer

SEQ ID NO: 20 BR-V10 Reverse primer

[0029] The polynucleotides of the present invention may be prepared by two general methods: (1) they may be synthesized from appropriate nucleotide triphosphates, or (2) they may be isolated from biological sources. Both methods utilize protocols well known in the art. The availability of nucleotide sequence information enables preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis. Synthetic oligonucleotides may be prepared by the phosphoramidite method employed in the Applied Biosystems 38A DNA Synthesizer or similar devices. The resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). Complementary segments thus produced may be annealed such that each segment possesses appropriate cohesive termini for attachment of an adjacent segment. Adjacent segments may be ligated by annealing cohesive termini in the presence of DNA ligase to construct an entire long double- stranded molecule. A synthetic DNA molecule so constructed may then be cloned and amplified in an appropriate vecto

[0030] Methods for using these primer pairs to amplify VNTR loci in Borrelia are disclosed herein. Generally MLVA analyses or multiplex systems known to the art may be employed to detect and sub-type Borrelia. PCR instruments used in these amplification methods are commercially available.

[0031] Kits are herein provided for use with commercially available PCR instruments to detect and sub-type strains of Borrelia. The kits contain one or more primer pairs disclosed hereinabove having SEQ ID NOS 1-20 for amplifying the VNTR in DNA isolated from a Borrelia sample. If the sample is to be multiplexed, the kits may contain a suitable "cocktail" of primer pairs.

[0032] The kits may also contain nucleic acids needed in the amplification process. The nucleic acids may be tagged by a suitable marker, a fluorescent probe or a radioactive molecule. Any tag for marking the nucleic acid after amplification and size separation as by electrophoresis or other separation means is suitable. In certain preferred embodiments of the invention, the primer pairs themselves comprise a suitable marker.

[0033] The kits may also comprise enzymes, taq polymerase, for example and salts and buffers suitable for causing amplification of DNA by PCR. This kits may also comprise suitable containers and bottles for housing these reagents and or convenient use.

[0034] Kits for sub-typing strains of Borrelia comprise, in addition, DNA isolated from known Borrelia strains. This isolated DNA containing VNTR loci may be used as standards in the sub-typing of the species.

EXPERIMENTAL DETAILS

[0035] Genomic analysis. The B. burgdorferi sensu stricto B31 strain genomic sequence was downloaded from the NCBI web page (http://www.ncbi.nlm.nih.gov/cgi- bin Entrez/framik?gi=132&db=Genome) and used to identify potential VNTR loci. Sequences were screened from the 946 Kb genome, the 12 linear plasmids, and the nine circular plasmid of B. burgdorferi. Each sequence was screened for the presence of tandem repeats using the DNAstar software program Genequest (Lasergene, Inc. - Madison, WI). This program locates and displays tandem and non-tandemly repeated arrays. Confirmation of the repeated sequence structure was performed using dot plot similarity analysis in the software program Megalign (Lasergene, Inc. -Madison WI).

[0036] PCR amplification of VNTR loci. MLVA primers were developed around

46 potential VNTR loci using the DNA Star program PrimerSelect. A total of 10 primer sets amplified polymorphic VNTR loci (Table 1) while 36 loci proved monomorphic. Reagents used in the PCR reactions were obtained from Life Technologies. Primers were designed with annealing temperatures from 65°C to 61°C- Individual primer pair annealing temperatures were designed within 2°C of each other. .

[0037] Bacterial thermolysates. Borrelia strains were grown in BSK medium (Sigma) until they reached 10⁷ bacteria/ml. One ml was harvested by centrifugation, washed in PBS and re-suspended in lOOμl of water before heating at 100°C for 20 minutes.

[0038] Automated genotyping. Fluorescently labeled amplicons were sized by polyacrylamide gel electrophoresis (PAGE) in an ABI377 DNA Sequencer. Analysis was accomplished using the Genescan and Genotyper software (14). The PCR product was diluted three-fold and mixed 1 : 1 with equal parts of a 5: 1 formamide:dextran blue dye and size standard prior to electrophoresis. The Bioventures Rox 1000 size standard was used with filter set D.

[0039] Statistical analysis. Pairwise genetic differences among isolates were estimated using a simple matching coefficient. The clustering method used to evaluate genetic relationships was Un- weighted Pair Group Method with Arithmetic mean (UPGMA) in the software PAUP4a (D. Swofford, Sinauer Associates, Inc., Publishers, Sunderland MA) The diversity (D) for each marker was calculated as [1 - ∑(allele frequencies)²] (34).

[0040] VNTR marker identification and diversity. Analysis of the genomic sequence of B. burgdorferi type strain B31 revealed 225 genomic sequence motifs that potentially represent VNTR loci. An additional 167 potential VNTR loci were identified among the plasmid sequences of B. burgdorferi (type strain B31 46 repeated sequence motifs were chosen from these for MLVA analysis. MLVA revealed that 36 were monomorphic and only ten proved to be polymorphic loci (Table 3) among 41 globally diverse B. burgdorferi, B. afzelii, and B. garinii strains (Table 2). However, all loci did not support PCR amplification. A total of 19 isolates failed to yield PCR products across markers BR-V4, 6, 8, and 10 (Table 4). Sixteen of these 19 failures occurred within plasmid-based loci (Table 4).

Table 2. Borrelia Strain Information

Strain ID Borrelia species Country Source Provided by

ESP1 burgdorferi Spain /. Ricinus R.C. Johnson

S0N328 burgdorferi USA California I. Paciβcus M. Janda

IP2 burgdorferi France (Tours) Human CSF G. Baranton

SON2110 burgdorferi USA California /. paciβcus M. Janda

HB19 burgdorferi USA Connecticut Human blood A. Barbour

IP1 burgdorferi France (Poitiers) Human CSF G. Baranton

B31 burgdorferi USA New York I. scapularis ATCC3₅210

ZS7 burgdorferi Germany I. ricinus L. Gem

20006 burgdorferi France I. ricinus J.F. Anderson

VEERY burgdorferi USA Connecticut Veery bird R.T. Marconi

MEN115 burgdorferi USA California /. paciflcus M. Janda

CA19 burgdorferi USA California I. paciβcus T. Schwan

19535 burgdorferi USA New York Peromyscuc leucopus J.F. Anderson

MIL burgdorferi Slovakia 1. ricinus A. Livesley

Cat Flea burgdorferi USA Texas Ctenocephalidesfelis D. Ralph

21305 burgdorferi USA Connecticut Peromyscuc leucopus J.F. Anderson

NY186 burgdorferi USA New York Human skin R.T. Marconi

DK7 burgdorferi Denmark Human skin M. Theisen

297 burgdorferi USA Connecticut Human CSF R.C. Johnson

26816 burgdorferi USA Rhode Island Microtus pennsylvanicus J.F. Anderson

SON188 burgdorferi USA California I. paciβcus M. Janda

IP3 burgdorferi France (Pau) Human CSF G. Baranton

Z136 burgdorferi Germany /. ricinus A. Vogt UU-588.y i41 «

35B808 burgdorferi Germany /. ricinus A. Schbnberg

NE56 burgdorferi Switzerland I. ricinus L. Gem

27985 burgdorferi USA Shelter Island I. scapularis J.F. Anderson

L5 burgdorferi Austria Human skin G. Stanek

DK3 afzelii Denmark Human skin R.C. Johnson

BR53 afzelii Czeck Republic Aedes vexans Z. Hubalek

ECM1 afzelii Sweden Human skin (EM) S. Bergstrom R.T. Marconi

Jl afzelii Japan persulcatus

B023 afzelii Germany Human skin (ECM) A. Vogt

VS461 afzelii Switzerland I. ricinus O. Peter

DK8 afzelii Denmark Human skin R. C. Johnson

PBI garinii Germany Human CSF C. odner

VSDA garinii Switzerland Human CSF O. Peter

N34 garinii Germany /. ricinus J. Ackerman

20047 garinii France I. ricinus J.F. Anderson

HFOX garinii Japan Fox (heart) E. Isogai

PBR garinii Germany Human CSF B. Wilske

FAR03 garinii Sweden Seabird S. BergstrOm

[0041] The ultimate utility of VNTR loci lies in their diversity. The present invention discloses the use of marker diversity using both allele number and frequency to sub-type Borrelia species. The allele number observed ranged from two (BR-V7) to nine alleles (BR-V8) (Table 3). The larger the repeat array in the B31 strain, the greater the VNTR diversity (R=0.62) and number of alleles (R=0.94) among globally diverse strains (Figure 2). For example, marker BR-V8 has a repeat copy number of 8.3, in the B31 type strain, and exhibits 9 alleles (Table 3). In contrast, marker BR-V9 with a copy number of only three exhibits only three alleles in our study (Table 3). Repeat motifs were obgserved ranging from two base pairs for BR-V3 to 21 base pairs for BR-V8 (Table 3). Minimum array size observed across all alleles ranged from one (BR-V10) to 29 (BR- V3) (Table 3). Diversity index values (D) ranged from 0.1 to 0.89 with an overall average diversity index value of 0.51 (Table 3). VNTR markers that exhibit high diversity values such as BR-V8 (D=0.89) possess great discriminatory capacity for identifying genetically similar strains. Less diverse markers such as BR-V9 (D = 0.10) (Table 3), may be applied with greater utility in species identification and the analysis of evolutionary relationships. This demonstrated ability to predict VNTR diversity based upon array size allows the guided selection of marker loci.

Table 3. VNTR Marker Attributes

Genome/Plas Smallest

Marker Repeat mid Repeat Size Borrelia s. Array Largest Array Number of Diversity ^b

Locus Motif Coordinate" (nucleotides) Array Size Size Size Alleles D

BR-Vl Complex array CH-844,650 CX ^C 6 0.74 ^'

BR-V2 TAAAT CH-590,955 5 5 8 11 4 0.67

BR-V3 TA LP17-10,530 2 5 22 29 4 0.14

BR-V4 Complex array LP28-2-28.142 C ^d 8 0.55

BR-V5 AAG CH-456,964 3 4 2 4 3 0.63

BR-V6 TGA CH-720,032 3 4 1 3 3 0.51

BR-V7 TGC CH-690,090 3 4 13 14 2 0.1

BR-V8 * LP17-13.155 21 8.3 6 14 9 0.89

BR-V9 TTC LP28-3-4,235 3 4 3 4 3 0.1 AATATTAA

BR-V10 ATA LP54-20,145 11 5.5 1 9 7 0.75

Average = 4.9 0.51

^a = CH indicates chromosome locus, LP indicates linear plasmid locus D = 1 - sum(allele frequency)2 ^c = CX indicates the complex nature of the repeat motif and consequently makes accurate array size calculation difficult. The B31 sequence at this locus consists of four tandem repeats. For example, a 32 base pair motif repeated 2.2 times is listed here in the form (32 x 2.2). Other arrays that contribute to the complexity observed at this locus include the following: (32 x 3.2) + (32 x 2.0) + (41 x 2.0) 0 ^d = (86 x 2.2) + (32 x 4.0) + (32 x 2.6)

* indicates the 21 bp repeat TAATTAATATGTGATATAAAA [0042] Genetic Relationships among isolates. Ten VNTR marker loci were used to calculate genetic distances among the Borrelia strains. UPGMA analysis then revealed 30 distinct genotypes among the 41 Borrelia isolates with five unique subdivisions evident within these affiliations (Figure 1). No fixed allelic differences were present between these clusters (Table 4), therefore cluster formation is due to overall allelic frequency. Cluster I, II, III, and IV include only B. burgdorferi sensu stricto isolates (Figure 1). All B. burgdorferi strains revealed unique marker allele-size combinations, with the exception of B. burgdorferi strains L5, IP1 , IP2, IP3, Cat flea and B31 which were identical at all marker loci (Figure 1). Isolates B31 and Cat flea were isolated in North America, while strains IP1, IP2, and IP3 are human CSF isolates from France (Table 2). A total of 19 of the 27 B. burgdorferi sensu stricto strains grouped within cluster IV (Figure 1). MLVA revealed substantial discrimination between B. afzelii and B. garinii evident in cluster V (Figure 1). This cluster included seven B. afzelii strains and seven B. garinii strains (Figure 1). All seven B. afzelii strains assembled within the single sub-group of cluster V-1 (Figure 1). B. afzelii isolates B023 and BR53 showed 100% marker identity as did isolates Jl, ECM1, DK3, DK8, and VS461 (Figure 1). Six unique genotypes are evident among the B. garinii isolates with strains Far03 and VSDA showing 100% marker identity (Figure 1). Although the Japanese B. garinii strain (HFOX ) loosely clustered within the B. afzelii subgroup (Figure 1), this strain exhibits only a single B. afzelii-specific chromosomal allelic state (Table 4). The HFOX isolate also exhibits a B. burgdorferi-specific plasmidic allele and a unique allele specific to this

• isolate alone (Table 4). The loose affiliation of HFOX with B. afzelii (cluster V-1, Figure

1) does not appear robust. This affiliation is not contradictory to the identity of HFOX in this un-rooted tree, as HFOX is more closely related to the B. garinii isolates than to the B. afzelii isolates. Overall, the phylogenetic relationships observed in this study are in general agreement with previous 16S rRNA sequence analysis (31) with the Borrelia MLVA system developed here providing greater capability for individual strain discrimination.

Table 4. Borrelia Alleles Marker Loci Strain ID BR-Vl BR-V2 BR-V3 BR-V4 BR-V5 BR-V6 BR-V7 BR-V8 BR-V9 BR-VIO

SON188 706 173 144 522 1 16 89 206 300 201 476

NY186 800 178 144 522 1 16 89 206 321 204 476

MIL 750 173 144 697 1 16 89 206 404 204 465

MEM15 800 178 144 697 1 16 89 206 384 204 465

LS 800 178 144 697 1 16 89 206 321 204 509

IP1 800 178 144 697 1 16 89 206 321 204 509

IP2 800 178 144 697 1 16 89 206 321 204 509

ESP1 750 173 150 697 1 19 89 206 342 204 454

IP3 800 178 144 697 1 16 89 206 321 204 509

DK7 800 178 144 697 1 19 89 206 279 204 465

Cat Flea 800 178 144 697 1 16 89 206 321 204 509

19535 800 178 144 697 1 16 * 206 321 204 465

20006 750 178 144 697 1 19 89 206 363 204 454

B31 800 178 144 697 1 16 89 206 321 204 509

SON2110 750 183 144 638 1 16 89 204 300 204 476

SON328 750 173 144 638 1 19 .86 206 363 204 542

CA19 750 173 144 522 1 16 86 204 285 204 454

297 750 173 144 802 1 16 86 206 454 204 465

21305 750 178 144 835 1 16 * 206 404 204 *

VEERY 750 178 144 * 1 19 89 206 321 204 520

27985 800 178 144 697 1 16 89 206 300 204 465

ZS7 800 178 144 642 1 19 89 206 300 204 454

HB19 750 178 144 608 1 16 89 206 300 207 465

35B808 800 173 144 697 1 19 89 206 300 204 465

Z136 706 173 144 697 1 16 89 206 384 204 608

26816 800 178 144 697 1 16 89 ^' 206 342 204 509

NE56 750 183 154 697 1 19 89 206 363 204 454 B023 750 168 144 697 113 68 206 * 204 465

Jl 706 168 144 697 113 68 206 * 204 465

ECM1 706 168 144 697 113 * 206 * 204 *

DK3 706 168 144 697 113 68 206 300 204 465

DK8 706 168 144 697 113 68 206 * 204 465

BR53 750 168 144 697 113 68 206 * 204 *

VS461 706 168 144 697 113 68 206 * 204 465

20047 655 168 144 697 113 89 206 321 204 509

N34 655 168 142 697 113 89 206 342 204 465

FAR03 692 168 144 731 113 89 206 * 204 465

VSDA 692 168 144 * 113 89 206 * 204 465

PBI 655 168 144 638 113 89 206 363 204 *

PBR 692 168 .144 697 113 89 206 * 204 465

HFOX 467 168 144 802 113 68 206 * 204 465

*Missing data due to lack of PCR amplification

Scores indicate allele sizes in base pairs.

[0043] The diversity within the three species is dramatically different and suggests phylogenetic relationships and evolutionary history. For example, we observed that four out of the five clusters contain only B. burgdorferi sensu stricto members. These four groups have great diversity, especially when contrasted with the B. afzelii (group V- 1, Figure 1) and B. garinii (V-2, Figure 1) cluster. The cohesiveness of these two latter species into one group argues for a more recent common evolutionary derivation, perhaps from a B. burgdorferi sensu stricto ancestor. Certainly their lack of diversity is due to either a recent origin or a common and pronounced genetic bottleneck. [0044] A more subtle diversity trend is observed within B. burgdorferi sensu stricto when North America and European strains are compared (Fig. 2). We observed greater genetic diversity among the 15 North American samples (mean genetic distance = 0.46) versus that among 12 European samples (mean genetic distance = 0.41). Perhaps due to a relatively small sample size this trend is not statistically significant (t = 0.009) but it is consistent with previous evolutionary models postulating a founder effect as North American B. burgdorferi sensu stricto moved to the Old World (15, 23). However, diversity within B. burgdorferi sensu stricto could likewise be affected by lateral transfer of genetic material from other species. In previous studies, four diverse isolates (NE56, 20006, Z136, ESPl) were shown to have obtained the ospC gene from other species (23). Hence genetic mixing via lateral transfer may provide an additional mechanism for evolutionary change.

[0045] The characterization of molecular diversity with MLVA analysis to the strain-typing of B. burgdorferi, afzelii, and garinii, suggests this method can be harnessed for the rapid discrimination and identification of remaining major Borrelia species and allow for further phylogenetic and epidemiological analysis of this genetically diverse organism.

EXAMPLES

EXAMPLE 1 [0046] This example illustrates PCR amplification of the ten variable loci from 41

Borrelia isolates.

[0047] 2mM MgCl₂, IX PCR buffer, O.lmM dNTPs, lμM Rl 10, R6G, or Tamra phosphoramide fluorescent labeled dUTPs (Perkin Elmer Biosystems), 0.5 units of Taq polymerase, 1.0 μL template DNA, 0.5 μM forward primer, 0.5 μM reverse primer were combined in filtered sterile water to a volume of 12.5 μL. The reaction mixtures were incubated at 94°C for 5 minutes in the PCR instrument (a commercially available thermocycler) and then cycled at 94°C for 30 seconds, 61°C or 56°C for 30 seconds, 72°C for 30 seconds and 94°C for 30 seconds for 35 cycles, with a final incubation of 72°C for 5 minutes.

EXAMPLE 2

[0048] This example illustrates the amplicon produced during the amplification of VNTR locus BR-Vl with primer pairs SEQ ID NO: 1 and SEQ ID NO: 2.

GGCTTAGTTTTGAGTTTGAGGAGGAGTAGGTTTGTCGAAAAATATTGATG

ATATAAAAATGAAGATGGCAAAAAAGTTAAGATTATTAAGTTGAAAAAGAA GGTAGTAAAAATTGTAACATATAATGATTTAAGCGTTAAAAATGATTCAAAT AGCTTTGTTGATTTGCATAATAACAGCAATAAGGCTGAATATTCGCAAAGTA G AGAC AATAG AACTGGCGGGTATTC AC AAAATAGGGAC AATAGAGCTGGTG GATATTCACAAAATAGGGACAATAGAGCTGGTGGATATTCCCAAAACAGAGA CAACAGAACTGGTGGGTATTCACAAAACAGAGACAACAGAACTGGTGGGTA TTCACAAAACAGAGACAACAGAACTGGTGGGTATTCACAAAATAGGGATAAT AGAGGTGGATATTCACAAGGCAGAGACAACAGAACTGGTGGATATTCACAA AGCAGGGACAATAGAACTGGTGGATATTC ACAAAAC AGGGAC AATAGAACT GGTGGATATTCACAAAACAGAGACAATAGAACTGGTGGATATTCACAAAACA GAGATAACAGAACTGGTGGATATTCACAAAACAGAGACAGCTTATCCTTTCA ATATCAAGGTTCAGTAAAGAAAACATATGTTGCCAAAAATAATTCTCAAAAT AAATATACTACTACTTCTATGTCTTTTAGAAGACTTATAAAAACTAAAGTTCC CGCTATTGTTAGCAGCACACCTGCAGCGGATTC

EXAMPLE 3

[0049] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V2 with primer pairs SEQ ID NO: 3 and SEQ ID NO: 4.

GTATAATGAAGTTAGTGGGCGTTACTCTTGGGTAAAAAGAAAGTAAATTT AATTTAAAATTAGTTTTAAATTAAATTAAATTAAATTAAATGAGGAGAATGA TTTGTATCTTTAGATGGTTTTATGGTTTC

EXAMPLE 4 [0050] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V3 with primer pairs SEQ ID NO: 5 and SEQ ID NO: 6.

GTTTGTCGTTGCCAAAACTGCTTTCATAATTCACTCACCTACTATATATAT

ATTTTAACATAAATCAAAGCCAAATATCGGAACATTTCCTTCAAAATCTCATA

AAGCAGATATAATGCACACAAACTAAATATATTTTCATATTTAATCC EXAMPLE 5

[0051] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V4 with primer pairs SEQ ID NO: 7 and SEQ ID NO: 8.

GTTTCTGCGACTAGGGTATGGAACAACTAATAGCTCAAGATTTATCAAAA AATATTATCACAATGAACTTACATATAGAGATTTAGAAAATTTAGAAAAGCA ATTTGGCATAAAGTTTGACAATCTTGTTACTAAGATTGATACTGTTAAAAGTG AACTTACTACTAAGATTGATAATGTAGAAAAGAATTTACAAAAGGATATATC CAACTTAGACGTTAAGATTGATACTGTTAAAAGTGAACTTACTACTAAGATTG ATAACGTAGAAAAGAATTTACAAAAGGATATATCCAACTTAGACGTTAAGAT TGATACTGTTAAAAGTGAACTACTACTAAGATTGATA ACGT AGAAAAGAAT TTAGATACTAAGATTGATAACGTAGAAAAGAATTTAGATACTAAGATTGATA ACGTAGAAAAGAATTTAGATACTAAGATTGATAACGTAGAAAAGAATTTGCA AAAAGATATGTTTAGTTTGGAACAAAGGCTAGAAATAAAGCTGGAAGCCAAT AACAAACTTCTTTTGGAAAAGCTGGAAGCCAATAACAAACTTCTTTTGGAAA AGCTGGAAGCC AATAGCAAAGTTCTTTTGGAAAAGCTAGAAGCCAATAACAA AGTTTCTTCAGAAAAGCTTAAAGTCAGCAACAGAAGTAGTTATTATTGCAG TAGTAGTTGTGCCCACTGC

EXAMPLE 6 [0052] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V5 with primer pairs SEQ ID NO: 9 and SEQ ID NO: 10.

GCAATCCAAAATATTCAAGATCGTATAAAAATGTATATCAAAAAAGAAGA

AGAAGAGCCCACAAATTTTAAAAACCCCTTTCTTAAAAAAAGATATACA

TTTGAAAATTTTATC

EXAMPLE 7

[0053] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V6 with primer pairs SEQ ID NO: 11 and SEQ ID NO: 12.

GTTCAAGATATGGTTAAGGGCAATTTAGATAAAGATTATGCTCTTGATGAT GATGAAAATACTCTTGATGAACTTGGCATGTTAAGTCTTC EXAMPLE 8

[0054] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V7 with primer pairs SEQ ID NO: 13 and SEQ ID NO: 14.

GCTTCAAAATGCTGCTTCAATTGCTGGACTTTTATTAACAACAGAATGTGC AATCACAGATATTAAAGAAGAGAAAAATACTTCTGGTGGTGGTGGTTATCCT

ATGGACCCAGGAATGGGAATGATGTAAATTAAAGTTTCACCGGCAAGCTTG

TGTTTTTGC

EXAMPLE 9

[0055] This example illustrates the amplicon produced during the amplification of VNTR locus BR-V8 with primer pairs SEQ ID NO 15 and SEQ ID NO 16.

GATCTAATTCATTAAAAATTTTGTGAAAGGGGCTTCATAGGTAGAGATT

AAAGTAATTAATATGTGATATAAAATAATTAATATGTGATATAAAATAATTA ATATGTGATATAAAATAATTAATATGTGATATAAAATAATTAATATGTGATAT AAAATAATTAATATGTGATATAAAATAATTAATATGTGATATAAAATAATTA ATATGTGATATAAAATAATTAAAAGGAAGTTTGTATGAAAAAATAGCATTT CATATTCAAAAGGTGGTGTTGGGAAAACTACCTTAAGCGGAAATATTGCA AGTTATTTATC

EXAMPLE 10 [0056] This example illustrates the amplicon produced during the amplification of VNTR locus BR-V9 with primer pairs SEQ ID NO 17 and SEQ ID NO 18.

GTCATCTTTAGTGTCTAATTTTAGAATTTTATTAACTTTTTCTTTGCTAAA

TTTAAAATGCTCTAAGTAAAGCAAATTAGAGAAATTTAAAGGATCATTTTTA GCTATTAACAAGGAAGTGTTTTTTACTAAAGTTAAGTATATCGGATTAGCTAA AATTTCTTCTTCTTCGGGTTGAGGCATAGGGCATTGATATAAGCATGAC

EXAMPLE 11

[0057] This example illustrates the amplicon produced during the amplification of

VNTR locus BR-V10 with primer pairs SEQ ID NO 19 and SEQ ID NO 20. GCTTTTAACGCTAAATTATAAAGAAAAATTATTTCATTTCGGCAGGTTTAA

ATATTTATAATTTTATCTAAATTTTTAGTTATCAATTTAAGTTTATTGTAATTA ATAATTGTTTAAAAGTTTTTGTCTTTTGTGCTGATTTTGCTAAAAATTCTTTTT TGCCTTGAATTTAGGCTAAATCAATATTAAATCAATATTAAATAAATATTAAA TAAATATTAAATAAATATTAAATAAATATTAAATAAATATTTAAAACAATTA AATTTTTATATTAAAAAATGCAAATTTTTGTAAAAAATATAAAATTAATATTC AATCTTTTAAAGATTTTGAAAAATTTTTTTTAAAGTTTATTTTTTTGGAAAATA TTATTGATATGATTTATAATTTAATTTTTATTATTTTACCACTAAGGAGTCTAT TATGAAAAACAGATTTTTTCTATATTTTTGTTCTTCAAACTTTGATTTTTTTAA T TGTAATGCTTTTGGAAGCATAATTTTGAC

[0058] While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

REFERENCES

1. Anderson, J. F. 1991. Epizoology of Lyme borreliosis. Scand. J. Infect. Dis. Suppl. 77:23-34.

2. Balmelli, T., and J. C. Piffaretti. 1995. Association between different clinical manifestations of Lyme disease and different species of Borrelia burgdorferi sensu lato. Res. Microbiol. 146:329-340.

3. Barbour, A. G., and D. Fish. 1993. The biological and social phenomenon of Lyme disease. Science 260:1610-1616.

4. Belfaiza, D., D. Postic, E. Bellenger, G. Baranton, and LS. Girons. 1993

Genomic fingerprinting of Borrelia burgdorferi sensu lato by pulsed-field gel electrophoresis. J. Clin. Microbiol. 31:2873-2877

5. Burgdorfer, W., J. F. Anderson, L. Gern, R. S. Lane, J. Piesman, and A. Spielman. 1991. Relationship of Borrelia burgdorferi to its arthropod vectors. Scand. J. Infect. Dis. Suppl. 77:35-40.

6. Busch, U., C. Hizo-Teufel, R. Boehmer, V. Fingerle, H. Nitschko, B. Wilske, and V. Preac-Mursic. 1996. Three species of Borrelia burgdorferi sensu lato (B. burgdorferi sensu stricto, B. afzelii, and B. garinii) identified from cerebrospinal fluid isolates by pulsed-field gel electrophoresis and PCR. J. Clin. Microbiol. 34:1072-1078. 7. Casjens S, N. Palmer R. van Vugt, .M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R.J. Dodson, D. Haft, E., Hickey, M. Gwinn, O. White, and CM. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol

Microbiol. 35:490-516.

8. Casjens S., M. Delange, H.L. Ley 3^rd, P. Rosa, and W. M. Huang, 1995 Linear chromosomes of Lyme disease agent spirochetes: genetic diversity and conservation of gene order. J. Bacteriol. 177:2769-2780

9. Centers for Disease Control and Prevention. 1997. Lyme disease — United

States, 1996. Morbid. Mortal. Weekly Rep. 46:531-535.

10. Centers for Disease Control and Prevention. 1999. Availability of Lyme disease vaccine. Morbid. Mortal. Weekly Rep. 48:35-36, 41.10.

11. Dykhuizen D.E., and G. Baranton. 2001. The implications of a low rate of horizontal transfer in Borrelia. Trends Microbiol. 9:344-50.

12. Dykhuizen, D. E., D. S. Polin, J. J. Dunn, B. Wilske, V. Preac-Mursic, R. J. Dattwyler, and B. J. Luft. 1993. Borrelia burgdorferi is clonal: implications for taxonomy and vaccine development. Proc. Natl. Acad. Sci.

USA 90: 10163-10167. 13. Eggers C.H., B.J. Kimmel J.L. Bono, A.F. Elias, P. Rosa, and D.S. Samuels. 2001. Transduction by phiBB-1, a bacteriophage of Borrelia burgdorferi. ] Bacteriol. 183:4771-8

14. Farlow J, K-L.Smith, J. Wong, M. Abrams, M. Lytle, and P. Keim. Francisella tularensis Strain Typing Using Multiple-Locus, Variable-

Number Tandem Repeat Analysis. J Clin Microbiol. 2001 39:3186-92.

15. Foretz, M., D. Postic, and G. Baranton. 1997 Phylogenetic analysis of Borrelia burgdorferi sensu stricto by arbitraririly primed PCR and pulsed- field gel electrophoresis Int. J. System. Bacteriol. 47:11-18

16. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R.

Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586.

17. Fukunaga, M., A. Hamase, K. Okada, and M. Nakao. 1996. Borrelia tanukii sp. nov. and Borrelia turdae sp. nov. found from ixodid ticks in Japan: rapid species identification by 16S rRNA gene-targeted PCR analysis. Microbiol. Immunol. 40:877-881. 18. Gern, L., A. Estrada-Pena, F. Frandsen, J. S. Gray, T. G. Jaenson, F. Jongejan, O. Kahl, E. Korenberg, R. Mehl, and P. A. Nuttall. 1998. Euro-pean reservoir hosts of Borrelia burgdorferi sensu lato. Zentbl. Bakteriol. 287:196-204.

19. Hubalek, Z., and J. Halouzka. 1997. Distribution of Borrelia burgdorferi sensu lato genomic groups in Europe, a review. Eur. J. Epidemiol. 13:951- 957.

20. Kawabata, H., T. Masuzawa, and Y. Yanagihara. 1993. Genomic analysis of Borrelia japonica sp. nov. isolated from Ixodes ovatus in Japan. Microbiol. Immunol. 37:841-848.

21. Keim P., L.B. Price A.M. Klevytska, K.L. Smith, J.M. Schupp, R. Okinaka, P.J. Jackson, and M.E. Hugh-Jones. 2000. Multiple-locus variable- number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J Bacteriol May; 1 2:2928-36.

22. Marconi, R. T., D. Liveris, and I. Schwartz. 1995. Identification of novel

. insertion elements, restriction fragment length polymorphism patterns, and discontinuous ^'23 S rRNA in Lyme disease spirochetes: phylogenetic analyses of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates. J. Clin. Microbiol. 33:2427-2414.

23. Marti Ras., N., D. Postic, M. Foretz, and G. Baranton. 1997 Borelia burgdorferi sensu stricto, a bacterial species "made in the USA"? Int. J. System. Bacteriol. 47: 1112-1117

24. Murray, P.R., E.J. Baron, M.A. Pfaller, F.C. Tenover, and R.H. Yolken. 1999. Manual of Clinical Microbiology. 7^th edition. ASM Press, Washington D.C.

25. Nadelman, R. B., and G. P. Wormser. 1998. Lyme borreliosis. Lancet

352:557-565.

26. Nicholls, T. H., and S. M. Callister. 1996. Lyme disease spirochetes in ticks collected from birds in mid-western United States. J. Med. Entomol. 33:379-384.

27. Ohlenbusch, A., F. R. Matuschka, D. Richter, H. J. Christen, R. Thomssen, A. Spielman, and H. Eiffert. 1996. Etiology of the acrodermatitis chronica atrophicans lesion in Lyme disease. J. Infect. Dis. 174:421-423.

28. Peter, O., A.G. Bretz, D. Postic, and E. Dayer. 1997. Association of distinct species of Borrelia burgdorferi sensu lato with neuroborreliosis in Switzerland. Clin. Microbiol. Infect. 3:423-411.

29. Picken, R. N., F. Strle, M. M. Picken, E. Ruzic-Sabljic, V. Maraspin, S.

Lotric-Furlan, and J. Cimperman. 1998. Identification of three species of Borrelia burgdorferi sensu lato (B. burgdorferi sensu stricto, B. garinii, and B. afzelii) among isolates from acrodermatitis chronica atrophicans lesions. J. Investig. Dermatol. 110:211-214.

30. Postic D., N.M. Ras, R.S. Lane, P. Humair, M.M. Wittenbrink, G. Baranton. 1999 Common ancestry of Borrelia burgdorferi sensu lato strains from North America and Europe. J. Clin. Microbiol. 37:3010-3012

31. Postic, D., N. M. Ras, R. S. Lane, M. Hendson, and G. Baranton. 1998. Expanded Diversity among California Borrelia isolates and description of Borrelia bissettii sp. nov. (formerly Borrelia group DN127). J. Clin. Microbiol. 36:3497-3504.

32. Schmid, G. P. 1985. The global distribution of Lyme disease. Rev. Infect.

Dis. 7:41-50.

33. Wang, G., A. van Dam, I. Schwartz, and J. Dankert. 1999. Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical Implications. Clin. Micr. Rev. 12:633-653.

34. Weir, B.S. 1990. Genetic Data Anlysis. Sinauer Associates, Inc.

Sunderland, MA. USA.

Claims

WE CLAIM:

1. An isolated nucleic acid comprising at least 12 consecutive nucleotides of a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10. SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18, SEQ ID NO: 19; and SEQ ID NO: 20.

2. The isolated nucleic acid of claim 1, wherein the nucleic acid comprises at least 15 consecutive nucleotides of the nucleotide sequence.

3. The isolated nucleic acid of Claim 1 , wherein the nucleic acid comprises at least 18 consecutive nucleotides of the nucleotide sequence.

4. The isolated nucleic acid of claim 1 , wherein the nucleic acid comprises a nucleotide sequence selected from SEQ ID NO: 1, complementary sequence of SEQ ID NO 1, SEQ ID NO: 2, complementary sequence of SEQ ID NO 2, SEQ ID NO: 3; complementary sequence of SEQ ID NO. 3, SEQ ID NO:

4, complementary sequence of SEQ ID NO: 4, SEQ ID NO: 5, complementary sequence of SEQ ID NO: 5, SEQ ID NO: 6, complementary sequence of SEQ ID NO. 6, SEQ ID NO: 7, complementary sequence of SEQ ID NO 7, SEQ ID NO: 8, complementary sequence of SEQ ID NO. 8, SEQ ID NO: 9; complementary sequence of SEQ ID NO: 9, SEQ ID NO: 10, complementary sequence of SEQ ID

NO. 10, SEQ ID NO: 11 , complementary sequence of SEQ ID NO. 11 , SEQ ID NO: 12, complementary sequence of SEQ ID NO: 12, SEQ ID NO.:13, complementary sequence of SEQ ID NO. 13, SEQ ID NO: 14, complementary sequence of SEQ ID NO: 14, SEQ ID NO: 15, complementary sequence of SEQ ID NO: 15 SEQ ID NO: 16, complementary sequence of SEQ ID NO: 16, SEQ ID NO: 17, complementary sequence of SEQ ID NO: 17, SEQ ID NO:18, complementary sequence of SEQ ID NO: 18, SEQ ID NO: 19, complementary sequence of SEQ ID NO: 19 SEQ ID NO: 20 and the complementary sequence of SEQ ID NO: 20.

5. The nucleic acid of Claim 4 immobilized on a solid surface.

6. A pair of forward and reverse primers for amplification of VNTR located in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 1 and said reverse primer having SEQ ID NO. 2.

7. A pair of forward and reverse primers for amplification of VNTR located in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 3 and said reverse primer having SEQ ID NO. 4.

8. A pair of forward and reverse primers for amplification of VNTR located in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 5 and said reverse primer having SEQ ID NO. 6.

9. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 7 and said reverse primer having SEQ ID NO 8.

10. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID NO 9 and said reverse primer having SEQ ID NO. 10.

11. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID No 11 and said reverse primer having SEQ ID NO 12.

12. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 13 and said reverse primer having SEQ ID NO. 14.

13. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID NO.15 and said reverse primer having SEQ ID NO. VI 6.

14. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID NO. 17 and said reverse primer having SEQ ID NO. V 18.

15. A pair of forward and reverse primers for amplification of VNTR in DNA isolated from Borrelia species, said forward primer having SEQ ID

NO.19 and said reverse primer having SEQ ID NO 20.

16. A pair of forward and reverse primers of Claims 6-15 wherein a member of said pair comprises an observable marker.

17. The pair of Claim 16 wherein said marker is a fluorescent label or a radioactive group.

18. A pair of forward and reverse primers of Claims 6- 17 as PCR primers in the detection of a Borrelia species.

19. A method for detecting a Borrelia species comprising the steps of: i. obtaining a DNA sample from said species, ii. amplifying a VNTR marker loci in said DNA with a primer pair of Claims 6-17; and iii. detecting an amplification product that contains the VNTR sequence.

20. A kit for the detection of a Borrelia species comprising a primer pair of Claims 6-17.

21. The kit of Claim 20 comprising in addition nucleic acids, enzymes and buffers suitable for causing amplification of VNTR in DNA from said species in a PCR instrument.

22. A kit for detecting a Borrelia species comprising: i . one or more primer pairs of Claim 6-15; ii. nucleic acids having an observable marker; iii. a transcriptase; arid iv. buffers and salts suitable for causing polymerization of VNTR in DNA from said Borrelia species in a PCR instrument.

23. The kit of Claim 22 for multiplexing DNA from a Borrelia species wherein said kit comprises mixtures of said primer pairs.

24. A method of sub-typing a Borrelia strain comprising the steps of: i. obtaining DNA from said strain; ii. amplifying said DNA with one or more primer pairs selected from Claim 6-17; iii. detecting said amplified product; iv. determining the diversity number of said amplified product; and v. comparing said diversity number with the diversity number for a known strain of Borrelia.