EP1537224A2 - Method for zymotic production of fine chemicals (meta) containing sulphur - Google Patents

Method for zymotic production of fine chemicals (meta) containing sulphur

Info

Publication number
EP1537224A2
EP1537224A2 EP03794944A EP03794944A EP1537224A2 EP 1537224 A2 EP1537224 A2 EP 1537224A2 EP 03794944 A EP03794944 A EP 03794944A EP 03794944 A EP03794944 A EP 03794944A EP 1537224 A2 EP1537224 A2 EP 1537224A2
Authority
EP
European Patent Office
Prior art keywords
coding
gene
meta
sequence
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03794944A
Other languages
German (de)
French (fr)
Inventor
Burkhard Kröger
Oskar Zelder
Corinna Klopprogge
Hartwig Schröder
Stefan HÄFNER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1537224A2 publication Critical patent/EP1537224A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P11/00Preparation of sulfur-containing organic compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/12Methionine; Cysteine; Cystine

Definitions

  • the invention relates to a process for the fermentative production of sulfur-containing
  • Fine chemicals especially L-methionine, using bacteria in which a nucleotide sequence coding for a homoserine-O-acetyl transferase (metA) gene is expressed.
  • metalA homoserine-O-acetyl transferase
  • Sulfur-containing fine chemicals such as methionine, homocysteine, S-adenosylmethionine, glutathione, cysteine, biotin, thiamine, lipoic acid are produced in cells via natural metabolic processes and are used in many branches of industry, including the food, feed, cosmetics and pharmaceutical industry.
  • These substances, collectively referred to as "sulfur-containing fine chemicals" include organic acids, both proteinogenic and non-proteinogenic amino acids, vitamins and cofactors. They are most conveniently produced on a large scale by growing bacteria that have been developed to produce and secrete large quantities of the desired substance. Organisms that are particularly suitable for this purpose are coryne-shaped bacteria, gram-positive non-pathogenic bacteria.
  • Process improvements can include fermentation-related measures, such as stirring and supply of oxygen, or the composition of the nutrient media, such as, for example, the sugar concentration during fermentation, or working up to the product, for example by ion exchange chromatography, or the intrinsic performance properties of the microorganism itself affect.
  • methionine analogues ⁇ -methyl-methionine, ethionine, norleucine, N-acetylnorleucine, S-trifluoromethyl homocysteine, 2-amino-5-heprenoic acid, selenomethionine, methionine sulfoximine, Methoxin, 1-aminocyclopentane carboxylic acid or auxotroph for regulatory metabolites and are sulfur-containing fine chemicals, such as. B. L-methionine.
  • the object of the invention was to provide a new process for the improved fermentative production of sulfur-containing fine chemicals, in particular L-methionine.
  • the above object is achieved by providing a method for the fermentative production of a sulfur-containing fine chemical, comprising the expression in a coryneform bacterium of a heterologous nucleotide sequence which codes for a protein with metA activity.
  • a first object of the invention is a process for the fermentative production of at least one sulfur-containing fine chemical, which comprises the following steps: a) fermentation of a coryneform bacterial culture producing the desired sulfur-containing fine chemical, wherein at least one heterologous nucleotide sequence is expressed in the coryneform bacteria which is for a protein encoded with homoserine O-acetyl transferase (metA) activity; b) accumulation of the sulfur-containing fine chemical in the medium or in the cells of the bacteria, and c) isolation of the sulfur-containing fine chemical, which preferably comprises L-methionine.
  • the above heterologous metA-coding nucleotide sequence for the metA-coding sequence from Corynebacterium glutamicum ATCC 13032 preferably has a sequence homology of less than 100% and preferably of more than 70%.
  • the metA coding sequence is preferably derived from one of the following organisms from List I: list
  • the metA coding sequence used according to the invention preferably comprises a coding sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 , 35, 37, 39, 41, 43 and 45 or a nucleotide sequence homologous thereto, which codes for a protein with metA activity.
  • the metA coding sequence used according to the invention also preferably codes for a protein with metA activity, the protein being an amino acid sequence according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 and 46 or an amino acid sequence homologous thereto, which stands for a protein with metA activity.
  • the coding metA sequence is preferably a DNA or an RNA which can be replicated in coryneform bacteria or which is stably integrated into the chromosome.
  • the method according to the invention is carried out by a) uses a bacterial strain transformed with a plasmid vector which carries at least one copy of the coding metA sequence under the control of regulatory sequences, or b) uses a strain in which the coding metA sequence has been integrated into the chromosome of the bacterium
  • coryneform bacteria are therefore fermented, in which at least one of the genes selected at the same time is selected
  • lysC gene coding for an aspartate kinase b) the gene asd coding for an aspartate semialdehyde dehydrogenase c) the gene gap coding for glyceraldehyde-3-phosphate dehydrogenase, d) the gene pgk coding for 3-phosphoglycerate kinase , e) the pyc gene coding for pyruvate carboxylase, f) the gene tpi coding for triosephosphate isomerase, g) the gene metH coding for methionine synthase, h) the gene metB coding for cystathionine gamma synthase, i) the metC gene coding for the cystathionin gamma-lyase, j) the glyA gene coding for the serine hydroxymethyltransferase, k) the metY gene coding for the O-acetylhom
  • coryneform bacteria are fermented, in which at least one of the genes selected from genes of the above-mentioned group a) to p) is mutated at the same time, so that the corresponding proteins or, to a lesser extent, compared to non-mutated proteins their activity is not influenced by metabolic metabolites and that in particular the production of the fine chemical according to the invention is not impaired.
  • coryneform bacteria are fermented in which at least one of the genes selected from q) the gene coding for the homoserine kinase thrB, r) the gene coding for the threonine dehydratase ilvA, s) that for the ThrC gene encoding threonine synthase thr) t) the ddh gene coding for meso-diaminopimelate D-dehydrogenase u) the pck gene coding for phosphoenolpyruvate carboxykinase, v) the pgi gene coding for glucose-6-phosphate-6-isomerase, w ) the poxB gene coding for the pyruvate oxidase, x) the gene dapA coding for the dihydrodipicolinate synthase, y) the gene dapB coding for the dihydrodipicolinate reduct
  • coryneform bacteria are fermented in which at least one of the genes of the above groups q) to z) is mutated at the same time, so that the enzymatic activity of the corresponding protein is partially or completely reduced.
  • Microorganisms of the type Corynebacterium glutamicum are preferably used in the process according to the invention.
  • the invention further relates to a method for producing an L-methionine-containing animal feed additive from fermentation broths, which comprises the following steps a) cultivation and fermentation of an L-methionine-producing microorganism in a fermentation medium; b) removal of water from the fermentation broth containing L-methionine; c) removal of the biomass formed during the fermentation in an amount of 0 to 100% by weight; and d) drying the fermentation broth obtained according to b) and / or c) in order to obtain the animal feed additive in the desired powder or granule form.
  • the invention also relates to the coding metA sequences isolated for the first time from the above microorganisms, the homoserine-O-acetyl transferase coded therefrom and the functional homologues of these polynucleotides or proteins.
  • Proteins with the activity of homoserine-O-acetyl transferase are proteins that are able to convert homoserine and acetyl-co-enzyme A to O-acetyl-homoserine.
  • the person skilled in the art distinguishes the activity of the homoserine-O-acetyl-transferase from the homoserine-O-succinyl-transferase, which is also called metA in the literature. In the latter enzyme, succinyl-coenzyme A and not acetyl-coenzyme A serves as the substrate for the reaction.
  • sulfur-containing fine chemical encompasses any chemical compound which contains at least one sulfur atom covalently bonded and is accessible by a fermentation process according to the invention.
  • Non-limiting examples of this are methionine, homocysteine, S-adenosylmethionine, in particular methionine. and S-adenosyl methionine.
  • L-methionine In the context of the present invention, the terms “L-methionine”, “methionine”, homocysteine and S-adenosylmethionine also include the corresponding salts, such as, for. B. methionine hydrochloride or methionine sulfate.
  • Polynucleotides generally refers to polyribonucleotides (RNA) and polydeoxyribonucleotides (DNA), which can be unmodified RNA or DNA or modified RNA or DNA.
  • polypeptides are understood to mean peptides or proteins which contain two or more amino acids linked via peptide bonds.
  • metabolic metabolite denotes chemical compounds which occur in the metabolism of organisms as intermediates or end products and which, in addition to their own properties as chemical building blocks, can also have a modulating effect on enzymes and their catalytic activity. It is known from the literature that that such metabolic metabolites can have an inhibitory as well as a stimulating effect on the activity of enzymes (Biochemistry, Stryer, Lubert, 1995 WH Freeman & Company, New York, New York). It is also described in the literature that it is possible through Measures such as mutation of genomic DNA by UV radiation, ionizing radiation or mutagenic substances and subsequent selection for certain phenotypes in organisms to produce those enzymes in which the influence by metabolic metabolites has been changed (Sahm H.
  • the terms “express” or “amplification” or “overexpression” describe the production or increase in the intracellular activity of one or more enzymes in a microorganism that are encoded by the corresponding DNA introduce an organism, replace an existing gene with another gene, increase the number of copies of the gene or genes, use a strong promoter or use a gene which codes for a corresponding enzyme with a high activity and these measures can be combined if necessary.
  • “Functional equivalents” or analogs of the specifically disclosed polypeptides are, within the scope of the present invention, different polypeptides which furthermore have the desired biological activity, such as substrate specificity.
  • “functional equivalents” are understood to mean, in particular, mutants which, in at least one of the sequence positions mentioned above, have a different amino acid than the one specifically mentioned but nevertheless have one of the above-mentioned biological activities.
  • “Functional equivalents” thus include the mutants obtainable by one or more amino acid additions, substitutions, deletions and / or inversions, the changes mentioned being able to occur in any sequence position as long as they lead to a mutant with the property profile according to the invention.
  • Functional equivalence is particularly given when the reactivity patterns between mutant and unchanged polypeptide match qualitatively, i.e. For example, the same substrates can be implemented at different speeds.
  • “Functional equivalents” naturally also include polypeptides that are accessible from other organisms, as well as naturally occurring variants. For example, regions of homologous sequence regions can be determined by sequence comparison and, based on the specific requirements of the invention, equivalent enzymes can be determined.
  • “Functional equivalents” also include fragments, preferably individual domains or sequence motifs, of the polypeptides according to the invention which, for example, have the desired biological function.
  • “Functional equivalents” are also fusion proteins which contain one of the abovementioned polypeptide sequences or functional equivalents derived therefrom and at least one further, functionally different, heterologous sequence in functional N- or C-terminal linkage (ie without mutual substantial functional impairment of the fusion protein parts)
  • heterologous sequences are, for example, signal peptides, enzymes, immunoglobulins, surface antigens, receptors or receptor ligands.
  • “Functional equivalents” encompassed according to the invention are homologs to the specifically disclosed proteins. These have at least 20%, or about 30%, 40%, 50%, preferably at least about 60%, 65%, 70%, or 75%, in particular at least 85%, such as 90%, 95% or 99%, homology to one of the specifically disclosed sequences, calculated according to the algorithm by Pearson and Lipman, Proc. Natl. Acad, Be. (USA) 85 (8), 1988, 2444-2448.
  • homologs of the proteins or polypeptides of the invention can be generated by mutagenesis, e.g. by point mutation or shortening of the protein.
  • the term "homolog” as used here refers to a variant form of the protein which acts as an agonist or antagonist of protein activity.
  • Homologs of the protein of the invention can be obtained by screening combinatorial libraries of mutants, e.g. Shortening mutants can be identified.
  • a varied library of protein variants can be generated by combinatorial mutagenesis at the nucleic acid level, e.g. by enzymatically ligating a mixture of synthetic oligonucleotides.
  • methods that can be used to generate banks of potential homologs from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthesizer, and the synthetic gene can then be ligated into an appropriate expression vector.
  • degenerate gene set makes it possible to provide all sequences in a mixture which encode the desired set of potential protein sequences.
  • Methods for the synthesis of degenerate oligonucleotides are known to the person skilled in the art (eg Narang, SA (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198 : 1056; Ike et al. (1983) Nucleic Acids Res. 11: 477).
  • a bank of coding sequence fragments can be obtained by treating a double-stranded PCR fragment of a coding sequence with a nuclease under conditions under which nicking occurs only about once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form double-stranded DNA , which may include sense / antisense pairs of various nodded products, removing single-stranded sections from newly formed duplexes by treatment with S1 nuclease and ligating the resulting fragment library into an expression vector.
  • An expression bank can be derived by this method, which encodes N-terminal, C-terminal and internal fragments with different sizes of the protein according to the invention.
  • Several techniques are known in the art for screening combinatorial library gene products produced by point mutations or truncation and for screening DNA banks for gene products with a selected property. These techniques can be adapted to the rapid screening of the gene banks which have been generated by combinatorial mutagenesis of homologs according to the invention.
  • the invention also relates to nucleic acid sequences (single and double-stranded DNA and RNA sequences, such as cDNA and mRNA) coding for one of the above metA enzymes and their functional equivalents, which e.g. are also accessible using artificial nucleotide analogs.
  • the invention relates both to isolated nucleic acid molecules which code for polypeptides or proteins or biologically active sections thereof, and to nucleic acid fragments which e.g. can be used for use as hybridization probes or primers for identifying or amplifying coding nucleic acids according to the invention.
  • nucleic acid molecules according to the invention can also contain untranslated sequences from the 3 'and / or 5' end of the coding gene region
  • nucleic acid molecule is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid and, moreover, can be essentially free of other cellular material or culture medium if used by recombinant technology. ken is manufactured, or be free of chemical precursors or other chemicals when it is chemically synthesized.
  • the invention further includes the nucleic acid molecules complementary to the specifically described nucleotide sequences or a section thereof.
  • the nucleotide sequences according to the invention enable the generation of probes and primers which can be used for the identification and / or cloning of homologous sequences in other cell types and organisms.
  • probes or primers usually comprise a nucleotide sequence region which, under stringent conditions, can be attached to at least about 12, preferably at least about 25, e.g. about 40, 50 or 75 successive nucleotides of a sense strand of a nucleic acid sequence according to the invention or a corresponding antisense strand are hybridized.
  • nucleic acid sequences according to the invention are derived from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43 or 45 and differ from them by addition, substitution, insertion or deletion of one or more nucleotides, but continue to code for polypeptides with the desired property profile.
  • These can be polynucleotides that correspond to the above sequences in at least about 50%, 55%, 60%, 65%, 70%, 80% or 90%, preferably in at least about 95%, 96%, 97%, 98% or 99 % of the sequence positions are identical.
  • nucleic acid sequences which comprise so-called silent mutations or which have been changed in accordance with the codon usage of a specific source or host organism, in comparison to a specifically named sequence, as well as naturally occurring variants, such as e.g. Splice variants or allele variants, thereof. Sequences obtainable also by conservative nucleotide substitutions (i.e. the amino acid in question is replaced by an amino acid of the same charge, size, polarity and / or solubility).
  • the invention also relates to the molecules derived from the specifically disclosed nucleic acids by sequence polymorphisms. These genetic polymorphisms can exist between individuals within a population due to natural variation. These natural variations usually cause a variance of 1 to 5% in the nucleotide sequence of a gene. Furthermore, the invention also encompasses nucleic acid sequences which hybridize with the above-mentioned coding sequences or are complementary thereto. These polynucleotides can be found when screening genomic or cDNA libraries and, if appropriate, can be amplified therefrom using suitable primers by means of PCR and then isolated, for example, using suitable probes.
  • polynucleotides according to the invention can also be synthesized chemically.
  • the property of being able to “hybridize” to polynucleotides means the ability of a poly- or oligonucleotide to bind to an almost complementary sequence under stringent conditions, while under these conditions non-specific bindings between non-complementary partners are avoided.
  • the sequences should be closed 70-100%, preferably 90-100%, of complementary nature.
  • the property of complementary sequences to be able to bind specifically to one another is demonstrated, for example, in the Northern or Southern blot technique or in primer binding in PCR or RT-PCR, usually using oligonucleotides from a length of 30 base pairs.
  • metA genes coding for the enzyme homoserine-O-acetyl transferase from the organisms in List I above can be isolated in a manner known per se.
  • E. coli Escherichia coli
  • the creation of gene banks is described in detail in well-known textbooks and manuals. Examples include Winnacker's textbook: Genes and Clones, An Introduction to Genetic Technology (Verlag Chemie, Weinheim, Germany, 1990), or the manual by Sambrook et al .: Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989).
  • a very well-known gene bank is that of the E. coli K-12 strain W3110, which was developed by Kohara et al. (Cell ⁇ O, 495-508 (198)) in ⁇ vectors.
  • cosmids such as the cosmid vector SuperCos I (Wahl et al., 1987, Proceedings of the National Academy of Sciences USA, 84: 2160-2164), but also plasmids, such as pBR322 (BoliVal; Life Sciences, 25, 807-818 (1979)) or pUC9 (Vieira et al., 1982, Gene, 19: 259-268) can be used.
  • E. coli strains that are defective in terms of restriction and recombination are particularly suitable as hosts. An example of this is the DH ⁇ mcr strain, which was described by Grant et al.
  • DNA sequences of organisms coding for the metA genes according to list I above were found.
  • DNA sequences according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43 and 45 found.
  • amino acid sequences of the corresponding proteins were derived from these DNA sequences using the methods described above.
  • SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 and 46 the resulting amino acid sequences of the metA gene products are shown.
  • Coding DNA sequences resulting from the sequences according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 , 37, 39, 41, 43 and 45 resulting from the degeneration of the genetic code are also the subject of the invention.
  • DNA sequences which hybridize with these sequences or sequence parts derived therefrom are the subject of the invention.
  • the person skilled in the art can find instructions for identifying DNA sequences by means of hybridization in the manual "The DIG System Users Guide for Filter Hybridization” by Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in Liebl et al. (International Journal of Systematic Bacteriology (1991) 41: 255-260).
  • PCR polymerase chain reaction
  • Amino acid sequences which are correspondingly derived from SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 , 40, 42, 44 and 46 result are also part of the invention.
  • microorganisms serving as host cells in particular coryneform bacteria, which contain a vector, in particular a pendulum vector or plasmid vector, which carries at least one metA gene according to the invention, or in which a metA gene according to the invention is expressed or amplified.
  • microorganisms can produce sulfur-containing fine chemicals, in particular L-methionine, from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.
  • These are preferably coryneform bacteria, in particular of the genus Corynebacterium. From the genus Corynebacterium, the species Corynebacterium glutamicum should be mentioned in particular, which is known in the art for its ability to produce L-amino acids.
  • suitable strains of coryneform bacteria are those of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum (C. glutamicum), such as Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965
  • C. glutamicum Corynebacterium glutamicum ATCC 13032
  • Corynebacterium acetoglutamicum ATCC 15806 Corynebacterium acetoacidophilum ATCC 13870
  • Corynebacterium thermoaminogenes FERM BP-1539 Corynebacterium melassecola ATCC 17965
  • Brevibacterium flavum ATCC 14067 Brevibacterium lactofermentum ATCC 13869 and Brevibacterium divaricatum ATCC 14020 to name; or strains derived therefrom, such as Corynebacterium glutamicum KFCC10065 Corynebacterium glutamicum ATCC21608
  • the abbreviation KFCC means the Korean Federation of Culture Collection, the abbreviation ATCC the American type strain culture collection, and the abbreviation FERM BP the collection of the National institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Japan ,
  • coryneform bacteria advantageously produce sulfur-containing fine chemicals, in particular L-methionine, after overexpression of a metA gene from List I organisms.
  • the person skilled in the art can take different measures individually or in combination to achieve overexpression.
  • the number of copies of the corresponding genes can be increased, or the promoter and regulatory region or the ribosome binding site located upstream of the structural gene can be mutated.
  • Expression cassettes which are installed upstream of the structural gene act in the same way. Inducible promoters also make it possible to increase expression in the course of fermentative L-methionine production. Expression is also improved by measures to extend the life of the mRNA. Furthermore, preventing the breakdown of the enzyme protein also increases the enzyme activity.
  • the genes or gene constructs can are not present in plasmids with different copy numbers or are integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can be achieved by changing the media composition and culture management.
  • the invention therefore also relates to expression constructs which contain, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide according to the invention; and vectors comprising at least one of these expression constructs.
  • Such constructs according to the invention preferably comprise a promoter 5 'upstream of the respective coding sequence and a terminator sequence 3' downstream and optionally further customary regulatory elements, in each case operatively linked to the coding sequence.
  • An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended in the expression of the coding sequence.
  • sequences which can be linked operatively are activation sequences and Enhancers, etc.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, etc. Suitable regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased.
  • the gene construct can also have a simpler structure, ie no additional regulatory signals are inserted in front of the structural gene and the natural before the promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased.
  • the nucleic acid sequences can be contained in one or more copies in the gene construct.
  • promoters examples include: the promoters, ddh, amy, lysC, dapA, lysA from Corynebacterium glutamicum, but also gram-positive promoters SP02 as described in Bacillus Subtilis and Its Closest Relatives, Sonenshein, Abraham L., Hoch, James A., Losick, Richard; ASM Press, Districtof Columbia, Washington and Patek M. Eikmanns BJ. Patek J. Sahm H. Microbiology.
  • inducible promoters such as, for example, light-inducible and in particular temperature-inducible promoters, such as the P r P r promoter.
  • inducible promoters such as, for example, light-inducible and in particular temperature-inducible promoters, such as the P r P r promoter.
  • all natural promoters with their regulatory sequences can be used.
  • synthetic promoters can also be used advantageously.
  • the regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it.
  • the regulatory elements can advantageously be amplified at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
  • an increase in translation is also possible, for example, by improving the stability of the mRNA.
  • An expression cassette is produced by fusing a suitable promoter, a suitable Shine-Dalgarnow sequence with a metA nucleotide sequence and a suitable termination signal.
  • a suitable promoter for this purpose, common recombination and cloning techniques are used, as described, for example, in Current Protocols in Molecular Biology, 1993, John Wiley & Sons, Incorporated, New York New York, PCR Methods, Gelfand, David H., Innis, Michael A ., Sninsky, John J. 1999, Academic Press, Incorporated, California, San Diego,., PCR Cloning Protocols, Methods in Molecular Biology Ser., Vol. 192, 2nd ed., Humana Press, New Jersey, Totowa. T.
  • the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).
  • vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.
  • metA genes according to the invention were overexpressed, for example, using episomal plasmids.
  • Suitable plasmids are those which are replicated in coryneform bacteria.
  • Numerous known plasmid vectors such as. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1.
  • Other plasmid vectors such as. B.
  • pCLiK5MCS or those based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (US-A 5,158,891) can in can be used in the same way.
  • plasmid vectors are also suitable with the aid of which the method of gene amplification by integration into the chromosome can be used, as described, for example, by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication or amplification of the hom-thrB operon.
  • the complete gene is cloned into a plasmid vector that can replicate in a host (typically E. coli) but not in C. glutamicum.
  • vectors examples include pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Bernard et al., Journal ofMolecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342) in question , The plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation.
  • Enzymes can be influenced in their activity by mutations in the corresponding genes in such a way that there is a partial or complete reduction in the reaction rate of the enzymatic reaction. Examples of such mutations are known to the person skilled in the art (Motoyama H. Yano H. Terasaki Y. Anazawa H. Applied & Environmental Microbiology. 67: 3064-70, 2001, Eikmanns BJ. Eggeling L. Sahm H. Antonie van Leeuwenhoek. 64: 145 -63, 1993-94.)
  • sulfur-containing fine chemicals in particular L-methionine
  • one or more enzymes of the respective biosynthetic pathway, the cysteine pathway, aspartate semialdehyde synthesis, glycolysis, the anaplerotic, the phosphate metabolism, the citric acid cycle or the export of amino acids in addition to expression or amplification of a metA gene according to the invention, one or more enzymes of the respective biosynthetic pathway, the cysteine pathway, aspartate semialdehyde synthesis, glycolysis, the anaplerotic, the phosphate metabolism, the citric acid cycle or the export of amino acids.
  • one or more of the following genes can be amplified for the production of sulfur-containing fine chemicals, in particular L-methionine:
  • the metB gene coding for the cystahionin gamma synthase (EP 1 108790 A2; DNA SEQ NO. 3491), the metC gene coding for the cystahionin gamma lyase (EP 1 108790 A2; DNA SEQ NO. 3061) ) the glyA gene coding for the serine hydroxymethyltransferase (EP 1 108790 A2; DNA-SEQ NO. 1110),
  • sulfur-containing fine chemicals in particular L-methionine
  • the microorganisms produced according to the invention can be cultured continuously or discontinuously in the batch process (batch cultivation) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the production of sulfur-containing fine chemicals, in particular L-methionine.
  • batch cultivation batch cultivation
  • feed process fed batch
  • repetitive feed process repeated fed batch process
  • sulfur-containing fine chemicals in particular L-methionine.
  • the culture medium to be used has to meet the requirements of the respective strains in a suitable manner. Descriptions of culture media of various microorganisms are contained in the American Society for Bacteriology's “Manual of Methods for General Bacteriology” (Washington DC, USA, 1981).
  • These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.
  • Preferred carbon sources are sugars, such as mono-, di- or polysaccharides.
  • sugars such as mono-, di- or polysaccharides.
  • very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose.
  • Sugar can also be added to the media via complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources.
  • Other possible carbon sources are oils and fats such as e.g. B. Soybean oil. Sunflower oil.
  • Peanut oil and coconut fat fatty acids such as As palmitic acid, stearic acid or linoleic acid, alcohols such as. B. glycerol, methanol or ethanol and organic acids such as. B. acetic acid or lactic acid.
  • fatty acids such as As palmitic acid, stearic acid or linoleic acid
  • alcohols such as. B. glycerol, methanol or ethanol
  • organic acids such as. B. acetic acid or lactic acid.
  • Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds.
  • Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soy flour, soy protein, yeast extract, meat extract and others.
  • the nitrogen sources can be used individually or as a mixture.
  • Inorganic salt compounds that can be contained in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron
  • Inorganic sulfur-containing compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds, such as mercaptans and thiols, can be used as the sulfur source for the production of sulfur-containing fine chemicals, in particular methionine.
  • Phosphoric acid potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • Chelating agents can be added to the medium to keep the metal ions in solution.
  • Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
  • the fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine.
  • growth factors and salts often come from complex media components such as yeast extract, molasses, corn steep liquor and the like. Suitable precursors can also be added to the culture medium.
  • the exact composition of the media connections strongly depends on the respective experiment and is decided individually for each specific case. Information on media optimization is available from the textbook "Applied Microbiol. Physiologe A Practical Approach" (ed. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 9635773).
  • Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.
  • All media components are sterilized either by heat (20 min at 1.5 bar and 121 ° C) or by sterile filtration.
  • the components can be sterilized either together or, if necessary, separately. All media components can be present at the beginning of the cultivation or optionally added continuously or in batches.
  • the temperature of the culture is normally between 15 ° C and 45 ° C, preferably 25 ° C to 40 ° C and can be kept constant or changed during the experiment.
  • the pH of the medium should be in the range from 5 to 8.5, preferably around 7.0.
  • the pH for cultivation can be checked during the cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid.
  • Antschaummitte.l such. B. fatty acid polyglycol esters can be used.
  • suitable selectively acting substances such as, for. B. antibiotics.
  • oxygen or oxygen-containing gas mixtures such as e.g. B. ambient air
  • the temperature of the culture is usually 20 ° C to 45 ° C.
  • the culture is continued until a maximum of the desired product has formed. This goal is usually achieved within 10 hours to 160 hours.
  • the fermentation broths obtained in this way in particular containing L-methionine, usually have a dry matter of 7.5 to 25% by weight. It is also advantageous if the fermentation is carried out with limited sugar at least at the end, but in particular for at least 30% of the fermentation period. This means that the concentration of usable sugar in the fermentation medium is kept to> 0 to 3 g / l or reduced during this time.
  • the fermentation broth is then processed further.
  • the biomass can be wholly or partially separated by methods such as. B. centrifugation, filtration, decanting or a combination of these methods from the fermentation broth or completely left in it.
  • the fermentation broth can then be prepared using known methods, such as, for. B. with the help of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or concentrated.
  • This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.
  • the product-containing broth is subjected to chromatography with a suitable resin after the biomass has been separated off, the desired product or the impurities being wholly or partly retained on the chromatography resin.
  • chromatography steps can be repeated if necessary using the same or different chromatography resins.
  • the person skilled in the art is skilled in the selection of the suitable chromatography resins and their most effective application.
  • the cleaned product can be concentrated by filtration or ultrafiltration and kept at a temperature at which the stability of the product is at a maximum.
  • the identity and purity of the isolated compound (s) can be determined by prior art techniques. These include high-performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin-layer chromatography, NIRS, enzyme tests or microbiological tests. These analysis methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp.
  • FIG. 1 shows the plasmid map for plasmid pClysC
  • FIG. 2 shows the plasmid map for plasmid pCISIysCthr311ile
  • Figure 3 shows the plasmid map for plasmid pC_metA_Cd.
  • KanR Kanamycin resistance gene
  • ask aspartate kinase gene
  • ampicillin resistance and origin of replication of the vector pBR322 with the oligonucleotides p1.3 (SEQ ID NO: 47) and p2.3 (SEQ ID NO: 48) were amplified using the polymerase chain reaction (PCR).
  • the oligonucleotide p1.3 contains in 5'-3 'direction the interfaces for the restriction endonucleases Smal, BamHI, Nhel and Ascl and the oligonucleotide p2.3 (SEQ ID NO: 48) in 5'-3 'direction the interfaces for the restriction endonucleases Xbal, Xhol, Notl and Dral.
  • the PCR reaction was carried out according to the standard method as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the resulting DNA fragment with a size of approximately 2.1 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the blunt ends of the DNA fragment were ligated together using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation set according to standard methods as in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing ampicillin (50 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiKI.
  • a kanamycin resistance cassette was amplified with the oligonucleotides neol (SEQ ID NO: 49) and neo2 (SEQ ID NO: 50).
  • neol (SEQ ID NO: 49): 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-3 *
  • neo2 (SEQ ID NO: 50): 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3 '
  • the oligonucleotide neol in the 5'-3 'direction contains the interfaces for the restriction endonucleases Xbal, Smal, BamHI, Nhel and the oligonucleotide neo2 (SEQ ID NO: 50) in the 5'-3' direction for the restriction endonucleases Ascl and Nhel.
  • the PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the DNA fragment with a size of approximately 1.3 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonucleases Xbal and Ascl (New England Biolabs, Beverly, USA) and then purified again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the vector pCLiKI was also cut with the restriction endonucleases Xbal and Ascl and dephosphorylated with alkaline phosphatase (Röche Diagnostics, Mannheim) according to the manufacturer.
  • the linearized vector (approx. 2.1 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharma, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was prepared using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer ligated the cut PCR fragment and the ligation approach according to standard methods as in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA).
  • plasmid-bearing cells were achieved by plating on LB agar (Lennox, 1955, Virology, 1: 190) containing ampicillin (50 ⁇ g / ml) and kanamycin (20 ⁇ g / ml).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiK2.
  • the vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, an approximately 2.3 kb vector fragment was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiK3.
  • the replication origin pHM1519 was amplified with the oligonucleotides cg1 ((SEQ ID NO: 51) and cg2 (SEQ ID NO: 52).
  • the oligonucleotides contain cg1 (SEQ ID NO: 51) and cg2 (SEQ ID NO: 52) interfaces for the restriction endonuclease Notl.
  • the PCR reaction was carried out according to the standard method as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the resulting DNA fragment with a size of approximately 2.7 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and then purified again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the vector pCLiK3 was also cut with the restriction endonuclease Not1 and dephosphorylated with alkaline phosphatase (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.3 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions with the cut PCR fragment and the ligation approach was performed according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is given the name pCLiK5.
  • HS445 (SEQ ID NO: 53) and HS446 (SEQ ID NO: 54)
  • SEQ ID NO: 53 the two synthetic, largely complementary oligonucleotides
  • HS446 SEQ ID NO: 54
  • the interfaces for the restriction endonucleases Swal, Xhol , Aatl, Apal, Asp718, Mlul, Ndel, Spei, EcoRV, Sall, Clal, BamHI, Xbal and Smal combined by heating to 95 ° C. and slowly cooling to a double-stranded DNA fragment.
  • the vector pCLiK5 was cut with the restriction endonuclease Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 5.0 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions with the synthetic double-stranded DNA fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is called pCLiK5MCS.
  • Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 57.
  • Bacillus subtilis sacB gene (coding for Levan sucrase) was amplified with the oligonucleotides BK1732 and BK1733.
  • the oligonucleotides BK1732 and BK1733 contain interfaces for the restriction endonuclease Notl.
  • the PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the DNA fragment with a size of approximately 1.9 kb obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and then purified again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the vector pCLiK5MCS (produced according to Example 1) was also cut with the restriction endonuclease Not1 and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, an approximately 2.4 kb vector fragment was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning.
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is given the name pCLiK5MCS integrative sacB.
  • Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid pCLiK5MCS integrative sacB is listed as SEQ ID NO: 58.
  • Further vectors which are suitable for the expression or overproduction of metA genes according to the invention can be prepared in an analogous manner.
  • Example 3 Isolation of the lysC gene from the C. glutamicum strain LU1479
  • an allelic exchange of the lysC wild-type gene coding for the enzyme aspartate kinase in C. glutamicum ATCC13032, hereinafter referred to as LU1479, is to be carried out.
  • a nucleotide exchange is to be carried out in the LysC gene so that the amino acid Thr at position 311 in the resulting protein is replaced by the amino acid III.
  • the oligonucleotide primers SEQ ID NO: 59 and SEQ ID NO: 60 were used to amplify lysC using the Pfu-Turbo PCR system (Stratagene USA) according to the manufacturer.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was according to Tauch et al. (199 ⁇ ) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the amplified fragment is flanked at its 5 'end by a Sall restriction cut and at its 3' end by a Mlul restriction cut. Before cloning, the amplified fragment was digested by these two restriction enzymes and purified using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the polynucleotide obtained was cloned integrally via the Sall and Mlul restriction sections into pCLIK5 MCS SacB (hereinafter referred to as pCIS; SEQ ID NO: 58 from Example 2) and transformed into E.coli XL-1 blue.
  • Selection for plasmid-carrying cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 195 ⁇ , Virology, 1: 190).
  • the plasmid was isolated and the expected nucleotide sequence was confirmed by sequencing.
  • the plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al.
  • sequence SEQ ID NO: 61 comprises the following essential sub-areas:
  • CDS complement 2 (393 ⁇ .. ⁇ 3 ⁇ 6)
  • the directed mutagenesis of the lysC gene from C. glutamicum was carried out using the QuickChange Kit (from Stratagene / USA) according to the manufacturer's instructions.
  • the mutagenesis was carried out in the plasmid pCIS lysC, SEQ ID NO: 61.
  • the following oligonucleotide primers were synthesized for the exchange of thr311 after 311ile using the Quickchange method (Stratagene)
  • oligonucleotide primers in the Quickchange reaction leads to an exchange of the nucleotide in position 932 (from C to T) in the lysC gene (see SEQ ID NO: 64) and in the corresponding enzyme to an amino acid substitution in position 311 (Thr-> lle) (see SEQ ID NO: 6 ⁇ ).
  • the resulting amino acid exchange Thr311Ile in the lysC gene was confirmed by sequencing after transformation into E.coli XL1-blue and plasmid preparation.
  • the plasmid was named pCIS lysC thr311 ile and is listed as SEQ ID NO: 66.
  • the corresponding plasmid map is shown in Figure 2.
  • sequence SEQ ID NO: 66 comprises the following essential sub-areas:
  • CDS 1 156..1420
  • CDS complement 2 (393 ⁇ ..63 ⁇ 6)
  • the sacB gene contained in the vector pCIS lysC thr311ile converts sucrose into a toxic product, only those colonies can grow which have deleted the sacB gene by a second homologous recombination step between the wild-type lysC gene and the mutated lysC thr311 ile gene. During the homologous recombination, either the wild-type gene or the mutated gene can be deleted together with the sacB gene. If the sacB gene is removed together with the wild-type gene, a mutant transformant results.
  • the obtained strain LU1479 lysC 311 ile (Example 4) was treated to give an ethionine resistance (cheese, H. Nakayama K.Agr. Biol. Chem. 39 153-106 1975 L-methionine production by methionine analogously -resistant mutants of Corynebacterium glutamicum): An overnight culture in BHI medium (Difco) was washed in citrate buffer (50mM pH ⁇ , ⁇ ) and at 30 ° C for 20 min with N-methyl-nitrosoguanidine (10mg / ml in 50mM Citrate pH5, ⁇ ) treated.
  • the cells were washed nitrosoguanidine (citrate buffer ⁇ OmM pH 5.5) and plated on a medium which was composed of the following components, calculated on 500 ml: 10 g (NH 4 ) 2 SO 4 , 0.5 g KH 2 PO 4 , 0. ⁇ g K 2 HP0 4 , 0.125 g MgS0 4 .7H 2 0, 21 g MOPS, 50 mg CaCl 2 , 15 mg proteocatechuate, 0.5 mg biotin, 1 mg thiamine, 5 g / l D, L-ethionine (Sigma Chemicals Germany), pH 7.0 ,
  • the medium contained O. ⁇ ml of a trace salt solution of: 10g / l FeS0 4 * 7H 2 0, 1g / l MnS0 4 ⁇ 2 0, 0.1 g / l ZnS0 4 * 7H 2 0, 0.02g / l CuSO 4, 0.002g / l
  • Mutagenized cells were applied to plates with the medium described and incubated at 30 ° C. for 3-7 days. Clones obtained were isolated, isolated at least once on the selection medium and then examined for their methionine productivity in a shake flask in medium II (see Example 6
  • Example 6 Preparation of methionine with the LU1479 lysC 311ile ET-16 strain.
  • Example 5 The strains prepared in Example 5 were grown on an agar plate with CM medium for 2 days at 30 ° C.
  • the cells were then scraped off the plate and resuspended in saline.
  • 10 ml of Medium II and 0.5 g of autoclaved CaC0 3 (Riedel de Haen) in a 100 ml Erlenmeyer flask were inoculated with the cell suspension up to an OD ⁇ OOnm of 1.5 and for 72 hours on an orbital shaker at 200 rpm at 30 ° C incubated.
  • Chromosomal DNA from Corynebacterium diphtheriae was obtained from the American Type Strain Culture Collection (ATCC, Atlanta-USA) with the order number 700971 D from the ATCC 700971 strain.
  • oligonucleotide primers SEQ ID NO: 67 and SEQ ID NO: 68 the chromosomal DNA from C. diphtheriae as template and Pfu Turbo Polymerase (from Stratagene), the polymerase chain reaction (PCR) was carried out using standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of approx. 1.4 kb which contains the metA gene including a 5 'non-coding region (promoter region). The amplified fragment is flanked at its ⁇ '-end by an Xhol restriction site and at the 3'-end by a Nel restriction site which was introduced via the oligonucleotide primers.
  • the DNA fragment obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ndel (Röche Diagnostics, Mannheim) and separated by gel electrophoresis. The approximately 1.4 kb DNA fragment was then purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the vector pClik ⁇ MCS SEQ ID NO: 67 hereinafter called pC, was cut with the restriction enzymes Xhol and Ndel (Röche Diagnostics, Mannheim) and an approximately 5 kb fragment after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit isolated.
  • the vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt).
  • the resulting plasmid pC metA_Cd (Corynebacterium diphtheriae) is listed as SEQ ID NO: 69.
  • the corresponding plasmid map is shown in Figure 3.
  • Example 8 Transformation of the LU1479 lysC 311 ile ET-16 strain with the plasmid pC metA_Cd
  • the LU1479 lysC 311 ile ET-16 strain was transformed with the plasmid pC metA_Cd according to the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303).
  • the transformation mixture was plated on CM plates which additionally contained 20 mg / l kanamycin in order to achieve a selection for plasmid-containing cells. Obtained Kan-resistant clones were picked and isolated. The methionine productivity of the clones was examined in a shake flask test (see Example 6).
  • the strain LU1479 lysC 311ile ET-16 pC metA_Cd produced significantly more methionine compared to LU1479 lysC 311ile ET-16.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Fodder In General (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

The invention relates to methods for the zymotic production of fine chemicals, especially L-methionine, containing sulphur using bacteria, wherein a nucleotide sequence coding for a methionine-synthase (methA)-gene is expressed.

Description

VERFAHREN ZUR FERMENTATIVEN HERSTELLUNG SCHWEFELHALTIGER FEINCHEMIKALIEN (META) METHOD FOR THE FERMENTATIVE PRODUCTION OF FINE CHEMICALS CONTAINING SULFUR (META)
Beschreibungdescription
Gegenstand der Erfindung ist ein Verfahren zur fermentativen Herstellung von schwefelhaltigenThe invention relates to a process for the fermentative production of sulfur-containing
Feinchemikalien, insbesondere L-Methionin, unter Verwendung von Bakterien, in denen eine für ein Homoserin-O-Acetyl-Transferase (metA)-Gen kodierende Nukleotidsequenz exprimiertwird.Fine chemicals, especially L-methionine, using bacteria in which a nucleotide sequence coding for a homoserine-O-acetyl transferase (metA) gene is expressed.
Stand der TechnikState of the art
Schwefelhaltige Feinchemikalien, wie zum Beispiel Methionin, Homocystein, S-Adenosyl- Methionin, Glutathion, Cystein, Biotin, Thiamin, Liponsäure werden über natürliche Stoffwechselprozesse in Zellen hergestellt und werden in vielen Industriezweigen verwendet, einschließlich der Nahrungsmittel-, Futtermittel-, Kosmetik- und pharmazeutischen Industrie. Diese Substanzen, die zusammen als "schwefelhaltige Feinchemikalien" bezeichnet werden, umfassen organische Säuren, sowohl proteinogene als auch nicht-proteinogene Aminosäuren, Vitamine und Cofaktoren. Ihre Produktion erfolgt am zweckmäßigsten im Großmaßstab mittels Anzucht von Bakterien, die entwickelt wurden, um große Mengen der jeweils gewünschten Substanz zu produzieren und sezernieren. Für diesen Zweck besonders geeignete Organismen sind coryne- forme Bakterien, gram-positive nicht-pathogene Bakterien.Sulfur-containing fine chemicals such as methionine, homocysteine, S-adenosylmethionine, glutathione, cysteine, biotin, thiamine, lipoic acid are produced in cells via natural metabolic processes and are used in many branches of industry, including the food, feed, cosmetics and pharmaceutical industry. These substances, collectively referred to as "sulfur-containing fine chemicals", include organic acids, both proteinogenic and non-proteinogenic amino acids, vitamins and cofactors. They are most conveniently produced on a large scale by growing bacteria that have been developed to produce and secrete large quantities of the desired substance. Organisms that are particularly suitable for this purpose are coryne-shaped bacteria, gram-positive non-pathogenic bacteria.
Es ist bekannt, dass Aminosäuren durch Fermentation von Stämmen coryneformer Bakterien, insbesondere Corynebacterium glutamicum, hergestellt werden. Wegen der großen Bedeutung wird ständig an der Verbesserung der Herstellverfahren gearbeitet. Verfahrensverbesserungen können fermentationstechnische Maßnahmen, wie zum Beispiel Rührung und Versorgung mit Sauerstoff, oder die Zusammensetzung der Nährmedien, wie zum Beispiel die Zuckerkonzentra- tion während der Fermentation, oder die Aufarbeitung zum Produkt , beispielsweise durch lone- naustauschchromatographie, oder die intrinsischen Leistungseigenschaften des Mikroorganismus selbst betreffen.It is known that amino acids are produced by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of the great importance, work is constantly being carried out to improve the manufacturing processes. Process improvements can include fermentation-related measures, such as stirring and supply of oxygen, or the composition of the nutrient media, such as, for example, the sugar concentration during fermentation, or working up to the product, for example by ion exchange chromatography, or the intrinsic performance properties of the microorganism itself affect.
Über Stammselektion sind eine Reihe von Mutantenstämmen entwickelt worden, die ein Sorti- ment wünschenswerter Verbindungen aus der Reihe der schwefelhaltigen Feinchemikalien produzieren. Zur Verbesserung der Leistungseigenschaften dieser Mikroorganismen hinsichtlich der Produktion eines bestimmten Moleküls werden Methoden der Mutagenese, Selektion und Mutantenauswahl angewendet. Dies ist jedoch ein zeitaufwendiges und schwieriges Verfahren. Auf diese Weise erhält man z.B. Stämme, die resistent gegen Antimetabolite, wie z. B. die Methio- nin-Analoga α-Methyl-Methionin, Ethionin, Norleucin, N-Acetylnorleucin, S- Trifluoromethylhomocystein, 2-Amino-5-heprenoitsäure, Seleno-Methionin, Methioninsulfoximin, Methoxin, 1-Aminocyclopentan-Carboxylsäure oder auxotroph für regulatorisch bedeutsame Metabolite sind und schwefelhaltige Feinchemikalien, wie z. B. L-Methionin, produzieren.Through strain selection, a number of mutant strains have been developed that produce a range of desirable compounds from the range of sulfur-containing fine chemicals. Methods of mutagenesis, selection and mutant selection are used to improve the performance properties of these microorganisms with regard to the production of a particular molecule. However, this is a time consuming and difficult process. In this way you get, for example, strains that are resistant to antimetabolites such. B. the methionine analogues α-methyl-methionine, ethionine, norleucine, N-acetylnorleucine, S-trifluoromethyl homocysteine, 2-amino-5-heprenoic acid, selenomethionine, methionine sulfoximine, Methoxin, 1-aminocyclopentane carboxylic acid or auxotroph for regulatory metabolites and are sulfur-containing fine chemicals, such as. B. L-methionine.
Seit einigen Jahren werden ebenfalls Methoden der rekombinanten DNA-Technik zur Stammverbesserung von L-Aminosäure produzierender Stämme von Corynebacterium eingesetzt, indem man einzelne Aminosäure-Biosynthesegene amplifiziert und die Auswirkung auf die Aminosäure-Produktion untersucht.For several years, methods of recombinant DNA technology have also been used to improve the strains of L-amino acid-producing strains of Corynebacterium by amplifying individual amino acid biosynthesis genes and examining the effect on amino acid production.
Kurze Beschreibung der ErfindungBrief description of the invention
Der Erfindung lag die Aufgabe zugrunde, ein neues Verfahren zur verbesserten fermentativen Herstellung von schwefelhaltige Feinchemikalien, insbesondere L-Methionin, bereitzustellen.The object of the invention was to provide a new process for the improved fermentative production of sulfur-containing fine chemicals, in particular L-methionine.
Gelöst wird obige Aufgabe durch Bereitstellung eines Verfahrens zur fermentativen Herstellung einer schwefelhaltigen Feinchemikalie, umfassend die Expression einer heterologen Nukleotid- sequenz, welche für ein Protein mit metA-Aktivität kodiert, in einem coryneformen Bakterium.The above object is achieved by providing a method for the fermentative production of a sulfur-containing fine chemical, comprising the expression in a coryneform bacterium of a heterologous nucleotide sequence which codes for a protein with metA activity.
Ein erster Gegenstand der Erfindung ist Verfahren zur fermentativen Herstellung wenigstens einer schwefelhaltigen Feinchemikalie, welches folgende Schritte umfasst: a) Fermentation einer die gewünschte schwefelhaltige Feinchemikalie produzierenden coryneformen Bakterienkultur, wobei in den coryneformen Bakterien zumindest eine hetero- loge Nukleotidsequenz exprimiert wird, welche für ein Protein mit Homoserin-O-Acetyl- Transferase (metA) -Aktivität kodiert; b) Anreicherung der schwefelhaltigen Feinchemikalie im Medium oder in den Zellen der Bakterien, und c) Isolieren der schwefelhaltigen Feinchemikalie, welche vorzugsweise L-Methionin umfasst.A first object of the invention is a process for the fermentative production of at least one sulfur-containing fine chemical, which comprises the following steps: a) fermentation of a coryneform bacterial culture producing the desired sulfur-containing fine chemical, wherein at least one heterologous nucleotide sequence is expressed in the coryneform bacteria which is for a protein encoded with homoserine O-acetyl transferase (metA) activity; b) accumulation of the sulfur-containing fine chemical in the medium or in the cells of the bacteria, and c) isolation of the sulfur-containing fine chemical, which preferably comprises L-methionine.
Vorzugsweise besitzt obige heterologe metA-kodierende Nukleotidsequenz zur metA- kodierenden Sequenz aus Corynebacterium glutamicum ATCC 13032 eine Sequenzhomologie- von weniger als 100% und vorzugsweise von mehr als 70% aufweist. Die metA-kodierende Sequenz ist vorzugsweise aus einem der folgenden Organismen von Liste I abgeleitet: ListeThe above heterologous metA-coding nucleotide sequence for the metA-coding sequence from Corynebacterium glutamicum ATCC 13032 preferably has a sequence homology of less than 100% and preferably of more than 70%. The metA coding sequence is preferably derived from one of the following organisms from List I: list
ATCC: American Type Culture Collection, Rockville, MD, USAATCC: American Type Culture Collection, Rockville, MD, USA
Die erfindungsgemäß eingesetzte metA-kodierende Sequenz umfasst vorzugsweise eine kodierende Sequenz gemäß SEQ ID NO:1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 , 43 und 45 oder eine dazu homologe Nukleotidsequenz, welche für ein Protein mit metA-Aktivität kodiert.The metA coding sequence used according to the invention preferably comprises a coding sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 , 35, 37, 39, 41, 43 and 45 or a nucleotide sequence homologous thereto, which codes for a protein with metA activity.
Die erfindungsgemäß eingesetzte metA-kodierende Sequenz kodiert außerdem vorzugsweise für ein Protein mit metA-Aktivität, wobei das Protein eine Aminosäuresequenz gemäß SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 und 46 oder eine dazu homologe Aminosäuresequenz, welche für ein Protein mit metA-Aktivität steht, umfasst.The metA coding sequence used according to the invention also preferably codes for a protein with metA activity, the protein being an amino acid sequence according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 and 46 or an amino acid sequence homologous thereto, which stands for a protein with metA activity.
Die kodierende metA-Sequenz ist vorzugsweise eine in coryneformen Bakterien replizierbare oder eine stabil in das Chromosom integrierte DNA oder eine RNA.The coding metA sequence is preferably a DNA or an RNA which can be replicated in coryneform bacteria or which is stably integrated into the chromosome.
Gemäß einer bevorzugten Ausführungsform wird das erfindungsgemäße Verfahren durchge- führt, indem man a) einen mit einem Plasmidvektor transformierten Bakterienstamm einsetzt der wenigstens eine Kopie der kodierenden metA-Sequenz unter der Kontrolle regulativer Sequenzen trägt, oder b) einen Stamm einsetzt, in dem die kodierende metA-Sequenz in das Chromosom des Bakteriums integriert wurdeAccording to a preferred embodiment, the method according to the invention is carried out by a) uses a bacterial strain transformed with a plasmid vector which carries at least one copy of the coding metA sequence under the control of regulatory sequences, or b) uses a strain in which the coding metA sequence has been integrated into the chromosome of the bacterium
Es ist weiterhin bevorzugt, die kodierende metA-Sequenz für die Fermentation zu überexprimie- ren.It is further preferred to overexpress the coding metA sequence for the fermentation.
Außerdem kann es wünschenswert sein, Bakterien zu fermentieren, in denen zusätzlich wenigs- tens ein weiteres Gen des Biosyntheseweges der gewünschten schwefelhaltigen Feinchemikalie verstärkt ist; und / oder in denen wenigstens ein Stoffwechselweg zumindest teilweise ausgeschaltet sind, der die Bildung der gewünschten schwefelhaltigen Feinchemikalie verringert.In addition, it may be desirable to ferment bacteria in which at least one further gene of the biosynthetic pathway of the desired sulfur-containing fine chemical is additionally reinforced; and / or in which at least one metabolic pathway is at least partially switched off, which reduces the formation of the desired sulfur-containing fine chemical.
Außerdem kann es wünschenswert sein, Bakterien zu fermentieren, in denen zusätzlich wenigstens ein weiteres Gen des Biosyntheseweges der gewünschten schwefelhaltigen Feinchemikalie durch Stoffwechselmetabolite in seiner Aktivität nicht in unerwünschter Weise beeinflusstwird.In addition, it may be desirable to ferment bacteria in which, in addition, at least one further gene of the biosynthetic pathway of the desired sulfur-containing fine chemical is not undesirably affected by metabolic metabolites in its activity.
Gemäß einer weiteren Ausführungsform des erfindungsgemäßen Verfahrens werden deshalb coryneforme Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene, ausgewählt unterAccording to a further embodiment of the method according to the invention, coryneform bacteria are therefore fermented, in which at least one of the genes selected at the same time is selected
a) dem für eine Aspartatkinase kodierenden Gen lysC, b) dem für eine Aspartat-Semialdehyd-Dehydrogenase kodierenden Gen asd c) dem für die Glycerinaldehyd-3-Phosphat Dehydrogenase kodierenden Gen gap, d) dem für die 3-Phosphoglycerat Kinase kodierenden Gen pgk, e) dem für die Pyruvat Carboxylase kodierenden Gen pyc, f) dem für die Triosephosphat Isomerase kodierenden Gen tpi, g) dem für die Methionin Synthase kodierenden Gen metH, h) dem für die Cystathionin-gamma-Synthase kodierenden Gen metB, i) dem für die Cystathionin-gamma-Lyase kodierenden Gen metC, j) dem für die Serin-Hydroxymethyltransferase kodierenden Gen glyA, k) dem für die O-Acetylhomoserin-Sulfhydrylase kodierenden Gen metY,a) the lysC gene coding for an aspartate kinase, b) the gene asd coding for an aspartate semialdehyde dehydrogenase c) the gene gap coding for glyceraldehyde-3-phosphate dehydrogenase, d) the gene pgk coding for 3-phosphoglycerate kinase , e) the pyc gene coding for pyruvate carboxylase, f) the gene tpi coding for triosephosphate isomerase, g) the gene metH coding for methionine synthase, h) the gene metB coding for cystathionine gamma synthase, i) the metC gene coding for the cystathionin gamma-lyase, j) the glyA gene coding for the serine hydroxymethyltransferase, k) the metY gene coding for the O-acetylhomoserine sulfhydrylase,
I) dem für die Methylen-Tetrahydrofolat-Reduktase kodierenden Gen, metF m) dem für die Phosphoserin-Aminotransferase kodierenden Gen serC n) dem für die Phosphoserin-Phosphatase kodierenden Gen serB, o) dem für die Serine Acetyl-Transferase kodierenden Gen cysE, p) dem für die Homoserin-Dehydrogenase kodierenden Gen hom, überexprimiert ist.I) the gene coding for methylene tetrahydrofolate reductase, metF m) the gene coding for phosphoserine aminotransferase serC n) the gene coding for phosphoserine phosphatase, o) the gene coding for the serine acetyl transferase cysE, p) the gene coding for the homoserine dehydrogenase hom, is overexpressed.
Gemäß einer anderen Ausführungsform des erfindungsgemäßen Verfahrens werden coryneforme Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene ausgewählt unter Genen der oben genannten Gruppe a) bis p) mutiert ist, so dass die korrespondierenden Proteine, verglichen mit nicht mutierten Proteinen, in geringerem Maße oder nicht durch Stoffwech- selmetabolite in ihrer Aktivität beeinflusst werden und dass insbesondere die erfindungsgemäße Produktion der Feinchemikalie nicht beeinträchtigt wird.According to another embodiment of the method according to the invention, coryneform bacteria are fermented, in which at least one of the genes selected from genes of the above-mentioned group a) to p) is mutated at the same time, so that the corresponding proteins or, to a lesser extent, compared to non-mutated proteins their activity is not influenced by metabolic metabolites and that in particular the production of the fine chemical according to the invention is not impaired.
Gemäß einer anderen Ausführungsform des erfindungsgemäßen Verfahrens werden coryneforme Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene, ausgewählt unter q) dem für die Homoserine-Kinase kodierenden Gen thrB, r) dem für die Threonin Dehydratase kodierenden Gen ilvA, s) dem für die Threonin Synthase kodierenden Gen thrC t) dem für die Meso-Diaminopimelat D-Dehydrogenase kodierenden Gen ddh u) dem für die Phosphoenolpyruvat-Carboxykinase kodierenden Gen pck, v) dem für die Glucose-6-Phosphat-6-lsomerase kodierenden Gen pgi, w) dem für die Pyruvat-Oxidase kodierenden Gen poxB, x) dem für die Dihydrodipicolinat Synthase kodiernden Gen dapA, y) dem für die Dihydrodipicolinat Reduktase kodiernden Gen dapB; oder z) dem für die Diaminopicolinat Decarboxylase kodiernden Gen lysA abschwächt ist, insbesondere durch Verringerung der Expressionsrate des korrespondierenden Gens.According to another embodiment of the method according to the invention, coryneform bacteria are fermented in which at least one of the genes selected from q) the gene coding for the homoserine kinase thrB, r) the gene coding for the threonine dehydratase ilvA, s) that for the ThrC gene encoding threonine synthase thr) t) the ddh gene coding for meso-diaminopimelate D-dehydrogenase u) the pck gene coding for phosphoenolpyruvate carboxykinase, v) the pgi gene coding for glucose-6-phosphate-6-isomerase, w ) the poxB gene coding for the pyruvate oxidase, x) the gene dapA coding for the dihydrodipicolinate synthase, y) the gene dapB coding for the dihydrodipicolinate reductase; or z) the gene lysA coding for the diaminopicolinate decarboxylase is weakened, in particular by reducing the expression rate of the corresponding gene.
Gemäß einer anderen Ausführungsform des erfindungsgemäßen Verfahrens werden coryneforme Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene der obigen Gruppen q) bis z) mutiert ist, so dass die enzymatische Aktivität des korrespondierenden Proteins teilwei- se oder vollständig verringert wird.According to another embodiment of the method according to the invention, coryneform bacteria are fermented in which at least one of the genes of the above groups q) to z) is mutated at the same time, so that the enzymatic activity of the corresponding protein is partially or completely reduced.
Vorzugsweise werden in dem erfindungsgemäßen Verfahren Mikroorganismen der Art Corynebacterium glutamicum eingesetzt.Microorganisms of the type Corynebacterium glutamicum are preferably used in the process according to the invention.
Ein weiterer Gegenstand der Erfindung betrifft ein Verfahren zur Herstellung eines L-Methionin- haltigen Tierfuttermittel-Additivs aus Fermentationsbrühen, welches folgende Schritte umfasst a) Kultivierung und Fermentation eines L-Methionin produzierenden Mikroorganismus in einem Fermentationsmedium; b) Entfernung von Wasser aus der L-Methionin haltigen Fermentationsbrühe; c) Entfernung der während der Fermentation gebildeten Biomasse in einer Menge von 0 bis 100 Gew.-%; und d) Trocknung der gemäß b) und/oder c) erhaltenen Fermentationsbrühe, um das Tierfuttermittel-Additiv in der gewünschten Pulver- oder Granulatform zu erhalten.The invention further relates to a method for producing an L-methionine-containing animal feed additive from fermentation broths, which comprises the following steps a) cultivation and fermentation of an L-methionine-producing microorganism in a fermentation medium; b) removal of water from the fermentation broth containing L-methionine; c) removal of the biomass formed during the fermentation in an amount of 0 to 100% by weight; and d) drying the fermentation broth obtained according to b) and / or c) in order to obtain the animal feed additive in the desired powder or granule form.
Gegenstand der Erfindung sind ebenfalls die erstmalig aus obigen Mikroorganismen isolierten kodierenden metA-Sequenzen, die davon kodierten Homoserin-O-Acetyl-Transferase sowie die funktionalen Homologen dieser Polynukleotide bzw. Proteine.The invention also relates to the coding metA sequences isolated for the first time from the above microorganisms, the homoserine-O-acetyl transferase coded therefrom and the functional homologues of these polynucleotides or proteins.
Detaillierte Beschreibung der ErfindungDetailed description of the invention
a) Allgemeine Begriffea) General terms
Als Proteine mit der Aktivität der Homoserin-O-Acetyl-Transferase auch metA (EC 2.3.1.31) genannt, werden solche Proteine beschrieben, die in der Lage sind Homoserin und Acetyl-Co- EnzymA zu O-Acetyl-Homoserin umzusetzen. Der Fachmann unterscheidet die Aktivivät der Homoserin-O-Acetyl-Transferase von der Homoserin-O-Succinyl-Transferase, die in der Literatur aber auch metA genannt wird. In dem letztgenannten Enzym dient Succinyl-Coenzym A und nicht Acetyl- Coenzym A als Substrat der Reaktion. Der Fachmann kann die enzymatische Akti- vivtät von Homoserin-O-Acetyl-Transferase durch Enzymtests nachweisen, Vorschriften dafür können sein: Park SD. Lee JY. Kim Y. Kim JH. Lee HS. Molecules & Cells. 8(3):286-94, 1998.Proteins with the activity of homoserine-O-acetyl transferase, also known as metA (EC 2.3.1.31), are proteins that are able to convert homoserine and acetyl-co-enzyme A to O-acetyl-homoserine. The person skilled in the art distinguishes the activity of the homoserine-O-acetyl-transferase from the homoserine-O-succinyl-transferase, which is also called metA in the literature. In the latter enzyme, succinyl-coenzyme A and not acetyl-coenzyme A serves as the substrate for the reaction. The person skilled in the art can demonstrate the enzymatic activity of homoserine-O-acetyl transferase by means of enzyme tests, rules for this can be: Park SD. Lee JY. Kim Y. Kim JH. Lee HS. Molecules & Cells. 8 (3): 286-94, 1998.
Im Rahmen der vorliegenden Erfindung umfasst der Begriff „schwefelhaltige Feinchemikalie" jegliche chemische Verbindung, die wenigstens ein Schwefelatom kovalent gebunden enthält und durch ein erfindungsgemäßes Fermentationsverfahrens zugänglich ist. Nichtlimitierende Beispiele dafür sind Methionin, Homocystein, S-Adenosyl-Methionin, insbesondere Methio- nin.und S-Adenosyl-Methionin.In the context of the present invention, the term “sulfur-containing fine chemical” encompasses any chemical compound which contains at least one sulfur atom covalently bonded and is accessible by a fermentation process according to the invention. Non-limiting examples of this are methionine, homocysteine, S-adenosylmethionine, in particular methionine. and S-adenosyl methionine.
Im Rahmen der vorliegenden Erfindung umfassen die Begriffe „L-Methionin", „Methionin", Homocystein und S-Adenosylmethionin auch die korrespondierenden Salze, wie z. B. Methionin- Hydrochlorid oder Methionin-Sulfat. "Polynukleotide" bezeichnet im allgemeinen Polyribonukleotide (RNA) und Polydeoxyribonukleo- tide (DNA), wobei es sich um nicht modifizierte RNA oder DNA oder modifizierte RNA oder DNA handeln kann.In the context of the present invention, the terms “L-methionine”, “methionine”, homocysteine and S-adenosylmethionine also include the corresponding salts, such as, for. B. methionine hydrochloride or methionine sulfate. "Polynucleotides" generally refers to polyribonucleotides (RNA) and polydeoxyribonucleotides (DNA), which can be unmodified RNA or DNA or modified RNA or DNA.
Unter "Polypeptiden" versteht man erfindungsgemäß Peptide oder Proteine, die zwei oder mehr über Peptidbindungen verbundene Aminosäuren enthalten.According to the invention, “polypeptides” are understood to mean peptides or proteins which contain two or more amino acids linked via peptide bonds.
Der Begriff „Stoffwechselmetabolit" bezeichnet chemische Verbindungen, die im Stoffwechsel von Organismen als Zwischen- oder auch Endprodukte vorkommen und die neben ihrer Eigen- schaff als chemische Bausteine auch modulierende Wirkung auf Enzyme und ihre katalytische Aktivität haben können. Dabei ist aus der Literatur bekannt, dass solche Stoffwechselmetabolite sowohl hemmend als auch stimulierend auf die Aktvität von Enzymen wirken können (Bioche- mistry, Stryer, Lubert, 1995 W. H. Freeman & Company, New York, New York.). In der Literatur ist auch beschrieben, dass es möglich ist durch Maßnahmen wie Mutation der genomischen DNA durch UV-Strahlung, ionisierender Strahlung oder mutagene Substanzen und nachfolgender Selektion auf bestimmte Phänotypen in Organismen solche Enzyme zu produzieren, in denen die Beeinflussung durch Stoffwechselmetabolite verändert wurde (Sahm H. Eggeling L. de Graaf AA. Biological Chemistry 381(9-10):899-910, 2000; Eikmanns BJ. Eggeling L. Sahm H. Antonievan Leeuwenhoek.64:145-63, 1993-94). Diese veränderten Eigenschaften können auch durch gezielte Maßnahmen erreicht werden. Dabei ist dem Fachmann bekannt, dass in Genen für Enzyme bestimmte Nukleotide der für das Protein kodierenden DNA gezielt verändert werden können, so dass das aus der exprimierten DNA-Sequenz resultierende Protein bestimmte neue Eigenschaften aufweist, so zum Beispiel, dass die modulierende Wirkung von Stoffwechselme- taboliten gegenüber dem nicht veränderten Protein verändert istThe term “metabolic metabolite” denotes chemical compounds which occur in the metabolism of organisms as intermediates or end products and which, in addition to their own properties as chemical building blocks, can also have a modulating effect on enzymes and their catalytic activity. It is known from the literature that that such metabolic metabolites can have an inhibitory as well as a stimulating effect on the activity of enzymes (Biochemistry, Stryer, Lubert, 1995 WH Freeman & Company, New York, New York). It is also described in the literature that it is possible through Measures such as mutation of genomic DNA by UV radiation, ionizing radiation or mutagenic substances and subsequent selection for certain phenotypes in organisms to produce those enzymes in which the influence by metabolic metabolites has been changed (Sahm H. Eggeling L. de Graaf AA. Biological Chemistry 381 (9-10): 899-910, 2000; Eikmanns BJ. Eggeling L. Sahm H. A ntonievan Leeuwenhoek. 64: 145-63, 1993-94). These changed properties can also be achieved through targeted measures. It is known to the person skilled in the art that in genes for enzymes certain nucleotides of the DNA coding for the protein can be changed in a targeted manner, so that the protein resulting from the expressed DNA sequence has certain new properties, for example that the modulating effect of metabolism - taboliten is changed compared to the unchanged protein
Die Begriffe "exprimieren" bzw. "Verstärkung" oder „Überexpression" beschreiben im Kontext der Erfindung die Produktion bzw. Erhöhung der intrazellulären Aktivität eines oder mehrerer Enzyme in einem Mikroorganismus, die durch die entsprechende DNA kodiert werden. Dazu kann man beispielsweise ein Gen in einen Organismus einbringen, ein vorhandenes Gen durch ein anderes Gen ersetzen, die Kopienzahl des Gens bzw. der Gene erhöhen, einen starken Promotor verwenden oder ein Gen verwenden, das für ein entsprechendes Enzym mit einer hohen Aktivität kodiert und man kann gegebenenfalls diese Maßnahmen kombinieren.In the context of the invention, the terms “express” or “amplification” or “overexpression” describe the production or increase in the intracellular activity of one or more enzymes in a microorganism that are encoded by the corresponding DNA introduce an organism, replace an existing gene with another gene, increase the number of copies of the gene or genes, use a strong promoter or use a gene which codes for a corresponding enzyme with a high activity and these measures can be combined if necessary.
b) Erfindungsgemäße metA-Proteineb) metA proteins according to the invention
Erfindungsgemäß mit umfasst sind ebenfalls „funktionale Äquivalente" der konkret offenbarten metA-Enzyme aus Organismen obiger Liste I.Also included according to the invention are “functional equivalents” of those specifically disclosed metA enzymes from organisms listed above I.
„Funktionale Äquivalente" oder Analoga der konkret offenbarten Polypeptide sind im Rahmen der vorliegenden Erfindung davon verschiedene Polypeptide, welche weiterhin die gewünschte biologische Aktivität, wie z.B. Substratspezifität, besitzen."Functional equivalents" or analogs of the specifically disclosed polypeptides are, within the scope of the present invention, different polypeptides which furthermore have the desired biological activity, such as substrate specificity.
Unter "funktionalen Äquivalenten" versteht man erfindungsgemäß insbesondere Mutanten, welche in wenigstens einer der oben genannten Sequenzpositionen eine andere als die konkret genannte Aminosäure aufweisen aber trotzdem eine der oben genannten biologische Aktivitäten besitzen. "Funktionale Äquivalente" umfassen somit die durch eine oder mehrere Aminosäure- Additionen, -Substitutionen, -Deletionen und/oder -Inversionen erhältlichen Mutanten, wobei die genannten Veränderungen in jeglicher Sequenzposition auftreten können, solange sie zu einer Mutante mit dem erfindungsgemäßen Eigenschaftsprofil führen. Funktionale Äquivalenz ist insbesondere auch dann gegeben, wenn die Reaktivitätsmuster zwischen Mutante und unveränder- tem Polypeptid qualitativ übereinstimmen, d.h. beispielsweise gleiche Substrate mit unterschiedlicher Geschwindigkeit umgesetzt werden.According to the invention, “functional equivalents” are understood to mean, in particular, mutants which, in at least one of the sequence positions mentioned above, have a different amino acid than the one specifically mentioned but nevertheless have one of the above-mentioned biological activities. "Functional equivalents" thus include the mutants obtainable by one or more amino acid additions, substitutions, deletions and / or inversions, the changes mentioned being able to occur in any sequence position as long as they lead to a mutant with the property profile according to the invention. Functional equivalence is particularly given when the reactivity patterns between mutant and unchanged polypeptide match qualitatively, i.e. For example, the same substrates can be implemented at different speeds.
"Funktionale Äquivalente" umfassen natürlich auch Polypeptide welche aus anderen Organismen zugänglich sind, sowie natürlich vorkommende Varianten. Beispielsweise lassen sich durch Sequenzvergleich Bereiche homologer Sequenzregionen festlegen und in Anlehnung an die konkreten Vorgaben der Erfindung äquivalente Enzyme ermitteln."Functional equivalents" naturally also include polypeptides that are accessible from other organisms, as well as naturally occurring variants. For example, regions of homologous sequence regions can be determined by sequence comparison and, based on the specific requirements of the invention, equivalent enzymes can be determined.
„Funktionale Äquivalente" umfassen ebenfalls Fragmente, vorzugsweise einzelne Domänen o- der Sequenzmotive, der erfindungsgemäßen Polypeptide, welche z.B. die gewünschte biologi- sehe Funktion aufweisen."Functional equivalents" also include fragments, preferably individual domains or sequence motifs, of the polypeptides according to the invention which, for example, have the desired biological function.
„Funktionale Äquivalente" sind außerdem Fusionsproteine, welche ein der oben genannten Po- lypeptidsequenzen oder davon abgeleitete funktionale Äquivalente und wenigstens eine weitere, davon funktioneil verschiedene, heterologe Sequenz in funktioneller N- oder C-terminaler Ver- knüpfung (d.h. ohne gegenseitigen wesentliche funktioneile Beeinträchtigung der Fusionsproteinteile) aufweisen. Nichtlimitiemde Beispiele für derartige heterologe Sequenzen sind z.B. Sig- nalpeptide, Enzyme, Immunoglobuline, Oberflächenantigene, Rezeptoren oder Rezeptorliganden.“Functional equivalents” are also fusion proteins which contain one of the abovementioned polypeptide sequences or functional equivalents derived therefrom and at least one further, functionally different, heterologous sequence in functional N- or C-terminal linkage (ie without mutual substantial functional impairment of the fusion protein parts) Examples of such heterologous sequences are, for example, signal peptides, enzymes, immunoglobulins, surface antigens, receptors or receptor ligands.
Erfindungsgemäß mit umfasste „funktionale Äquivalente" sind Homologe zu den konkret offenbarten Proteinen. Diese besitzen wenigstens 20%, oder etwa 30%, 40%, 50 %, vorzugsweise wenigstens etwa 60 %, 65%, 70%, oder 75% ins besondere wenigsten 85 %, wie z.B.90%, 95% oder 99%, Homologie zu einer der konkret offenbarten Sequenzen, berechnet nach dem Algorithmus von Pearson und Lipman, Proc. Natl. Acad, Sei. (USA) 85(8), 1988, 2444-2448."Functional equivalents" encompassed according to the invention are homologs to the specifically disclosed proteins. These have at least 20%, or about 30%, 40%, 50%, preferably at least about 60%, 65%, 70%, or 75%, in particular at least 85%, such as 90%, 95% or 99%, homology to one of the specifically disclosed sequences, calculated according to the algorithm by Pearson and Lipman, Proc. Natl. Acad, Be. (USA) 85 (8), 1988, 2444-2448.
Homologe der erfindungsgemäßen Proteine oder Polypeptide können durch Mutagenese erzeugt werden, z.B. durch Punktmutation oder Verkürzung des Proteins. Der Begriff "Homolog", wie er hier verwendet wird, betrifft eine Variante Form des Proteins, die als Agonist o- der Antagonist der Protein-Aktivität wirkt.Homologs of the proteins or polypeptides of the invention can be generated by mutagenesis, e.g. by point mutation or shortening of the protein. The term "homolog" as used here refers to a variant form of the protein which acts as an agonist or antagonist of protein activity.
Homologe des erfindungsgemäßen Proteine können durch Screening kombinatorischer Banken von Mutanten, wie z.B. Verkürzungsmutanten, identifiziert werden. Beispielsweise kann eine variegierte Bank von Protein-Varianten durch kombinatorische Mutagenese auf Nukleinsäure- ebene erzeugt werden, wie z.B. durch enzymatisches Ligieren eines Gemisches synthetischer Oligonukleotide. Es gibt eine Vielzahl von Verfahren, die zur Herstellung von Banken potentieller Homologer aus einer degenerierten Oligonukleotidsequenz verwendet werden können. Die chemische Synthese einer degenerierten Gensequenz kann in einem DNA-Syntheseautomaten durchgeführt werden, und das synthetische Gen kann dann in einen geeigneten Expressionsvektor ligiert werden. Die Verwendung eines degenerierten Gensatzes ermöglicht die Bereitstellung sämtlicher Sequenzen in einem Gemisch, die den gewünschten Satz an potentiellen Prote- insequenzen codieren. Verfahren zur Synthese degenerierter Oligonukleotide sind dem Fachmann bekannt (Z.B. Narang, S.A. (1983) Tetrahedron 39:3; Itakura etal. (1984)Annu. Rev. Bio- chem. 53:323; Itakura et al., (1984) Science 198:1056; Ike et al. (1983) Nucleic Acids Res. 11:477).Homologs of the protein of the invention can be obtained by screening combinatorial libraries of mutants, e.g. Shortening mutants can be identified. For example, a varied library of protein variants can be generated by combinatorial mutagenesis at the nucleic acid level, e.g. by enzymatically ligating a mixture of synthetic oligonucleotides. There are a variety of methods that can be used to generate banks of potential homologs from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthesizer, and the synthetic gene can then be ligated into an appropriate expression vector. The use of a degenerate gene set makes it possible to provide all sequences in a mixture which encode the desired set of potential protein sequences. Methods for the synthesis of degenerate oligonucleotides are known to the person skilled in the art (eg Narang, SA (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198 : 1056; Ike et al. (1983) Nucleic Acids Res. 11: 477).
Zusätzlich können Banken von Fragmenten des Protein-Codons verwendet werden, um eine variegierte Population von Protein-Fragmenten zum Screening und zur anschließenden Selektion von Homologen eines erfindungsgemäßen Proteins zu erzeugen. Bei einer Ausführungsform kann eine Bank von kodierenden Sequenzfragmenten durch Behandeln eines doppelsträngigen PCR-Fragmentes einer kodierenden Sequenz mit einer Nuklease unter Bedingungen, unter de- nen ein Nicking nur etwa einmal pro Molekül erfolgt, Denaturieren der doppelsträngigen DNA, Renaturieren der DNA unter Bildung doppelsträngiger DNA, die Sense-/Antisense-Paare von verschiedenen genickten Produkten umfassen kann, Entfernen einzelsträngiger Abschnitte aus neu gebildeten Duplices durch Behandlung mit S1-Nuclease und Ligieren der resultierenden Fragmentbank in einen Expressionsvektor erzeugt werden. Durch dieses Verfahren kann eine Expressionsbank hergeleitet werden, die N-terminale, C-terminale und interne Fragmente mit verschiedenen Größen des erfidungsgemäßen Proteins kodiert. Im Stand der Technik sind mehrere Techniken zum Screening von Genprodukten kombinatorischer Banken, die durch Punktmutationen oder Verkürzung hergestellt worden sind, und zum Screening von DNA-Banken auf Genprodukte mit einer ausgewählten Eigenschaft bekannt. Die- se Techniken lassen sich an das schnelle Screening der Genbanken anpassen, die durch kombinatorische Mutagenese erfindungsgemäßer Homologer erzeugt worden sind. Die am häufigsten verwendeten Techniken zum Screening großer Genbanken, die einer Analyse mit hohem Durchsatz unterliegen, umfassen das Klonieren der Genbank in replizierbare Expressionsvektoren, Transformieren der geeigneten Zellen mit der resultierenden Vektorenbank und Exprimieren der kombinatorischen Gene unter Bedingungen, unter denen der Nachweis der gewünschten Aktivität die Isolation des Vektors, der das Gen codiert, dessen Produkt nachgewiesen wurde, erleichtert. Recursive-Ensemble-Mutagenese (REM), eine Technik, die die Häufigkeit funktionel- ler Mutanten in den Banken vergrößert, kann in Kombination mit den Screeningtests verwendet werden, um Homologe zu identifizieren (Arkin und Yourvan (1992) PNAS 89:7811-7815; Delgra- ve et al. (1993) Protein Engineering 6(3):327-331In addition, banks of fragments of the protein codon can be used to generate a varied population of protein fragments for screening and for the subsequent selection of homologues of a protein according to the invention. In one embodiment, a bank of coding sequence fragments can be obtained by treating a double-stranded PCR fragment of a coding sequence with a nuclease under conditions under which nicking occurs only about once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form double-stranded DNA , which may include sense / antisense pairs of various nodded products, removing single-stranded sections from newly formed duplexes by treatment with S1 nuclease and ligating the resulting fragment library into an expression vector. An expression bank can be derived by this method, which encodes N-terminal, C-terminal and internal fragments with different sizes of the protein according to the invention. Several techniques are known in the art for screening combinatorial library gene products produced by point mutations or truncation and for screening DNA banks for gene products with a selected property. These techniques can be adapted to the rapid screening of the gene banks which have been generated by combinatorial mutagenesis of homologs according to the invention. The most commonly used techniques for screening large libraries that are subject to high throughput analysis include cloning the library into replicable expression vectors, transforming the appropriate cells with the resulting vector library, and expressing the combinatorial genes under conditions under which the detection of the desired activity isolation of the vector encoding the gene whose product has been detected is facilitated. Recursive ensemble mutagenesis (REM), a technique that increases the frequency of functional mutants in banks, can be used in combination with the screening tests to identify homologues (Arkin and Yourvan (1992) PNAS 89: 7811-7815 ; Delgrave et al. (1993) Protein Engineering 6 (3): 327-331
c) Erfindungsgemäße Polvnukleotidec) Polnucleotides according to the invention
Gegenstand der Erfindung sind ebenso Nukleinsäuresequenzen (einzel- und doppelsträngige DNA- und RNA-Sequenzen, wie z.B. cDNA und mRNA), kodierend für eines der obigen metA- Enzyme und deren funktionalen Äquivalenten, welche z.B. auch unter Verwendung künstlicher Nukleotidanaloga zugänglich sind.The invention also relates to nucleic acid sequences (single and double-stranded DNA and RNA sequences, such as cDNA and mRNA) coding for one of the above metA enzymes and their functional equivalents, which e.g. are also accessible using artificial nucleotide analogs.
Die Erfindung betrifft sowohl isolierte Nukleinsäuremoleküle, welche für erfindungsgemäße Po- lypeptide bzw. Proteine oder biologisch aktive Abschnitte davon kodieren, sowie Nukleinsäure- fragmente, die z.B. zur Verwendung als Hybridisierungssonden oder Primer zur Identifizierung oder Amplifizierung von erfindungsgemäßer kodierenden Nukleinsäuren verwendet werden können.The invention relates both to isolated nucleic acid molecules which code for polypeptides or proteins or biologically active sections thereof, and to nucleic acid fragments which e.g. can be used for use as hybridization probes or primers for identifying or amplifying coding nucleic acids according to the invention.
Die erfindungsgemäßen Nukleinsäuremoleküle können zudem untranslatierte Sequenzen vom 3'- und/oder 5'-Ende des kodierenden Genbereichs enthaltenThe nucleic acid molecules according to the invention can also contain untranslated sequences from the 3 'and / or 5' end of the coding gene region
Ein "isoliertes" Nukleinsäuremolekül wird von anderen Nukleinsäuremolekülen abgetrennt, die in der natürlichen Quelle der Nukleinsäure zugegen sind und kann überdies im wesentlichen frei von anderem zellulären Material oder Kulturmedium sein, wenn es durch rekombinante Techni- ken hergestellt wird, oder frei von chemischen Vorstufen oder anderen Chemikalien sein, wenn es chemisch synthetisiert wird.An "isolated" nucleic acid molecule is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid and, moreover, can be essentially free of other cellular material or culture medium if used by recombinant technology. ken is manufactured, or be free of chemical precursors or other chemicals when it is chemically synthesized.
Die Erfindung umfasst weiterhin die zu den konkret beschriebenen Nukleotidsequenzen kom- plementären Nukleinsäuremoleküle oder einen Abschnitt davon.The invention further includes the nucleic acid molecules complementary to the specifically described nucleotide sequences or a section thereof.
Die erfindungsgemäß Nukleotidsequenzen ermöglichen die Erzeugung von Sonden und Primern, die zur Identifizierung und/oder Klonierung von homologer Sequenzen in anderen Zelltypen und Organismen verwendbar sind. Solche Sonden bzw. Primer umfassen gewöhnlich einen Nukleotidsequenzbereich, der unter stringenten Bedingungen an mindestens etwa 12, vorzugsweise mindestens etwa 25, wie z.B. etwa 40, 50 oder 75 aufeinanderfolgende Nukleotide eines Sense-Stranges einer erfindungsgemäßen Nukleinsäuresequenz oder eines entsprechenden Antisense-Stranges hybridisiert.The nucleotide sequences according to the invention enable the generation of probes and primers which can be used for the identification and / or cloning of homologous sequences in other cell types and organisms. Such probes or primers usually comprise a nucleotide sequence region which, under stringent conditions, can be attached to at least about 12, preferably at least about 25, e.g. about 40, 50 or 75 successive nucleotides of a sense strand of a nucleic acid sequence according to the invention or a corresponding antisense strand are hybridized.
Weitere erfindungsgemäße Nukleinsäuresequenzen sind abgeleitet von SEQ ID NO:1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43 oder 45 und unterscheiden sich davon durch Addition, Substitution, Insertion oderDeletion einzelner oder mehrerer Nukleotide, kodieren aber weiterhin für Polypeptide mit dem gewünschten Eigenschaftsprofil. Dies können Polynukleotide sein, die zu obigen Sequenzen in mindestens etwa 50%, 55%, 60%, 65%, 70%, 80% oder 90%, vorzugsweise in mindestens etwa 95%, 96%, 97%, 98% oder 99% der Sequenzpositionen identisch sind.Further nucleic acid sequences according to the invention are derived from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43 or 45 and differ from them by addition, substitution, insertion or deletion of one or more nucleotides, but continue to code for polypeptides with the desired property profile. These can be polynucleotides that correspond to the above sequences in at least about 50%, 55%, 60%, 65%, 70%, 80% or 90%, preferably in at least about 95%, 96%, 97%, 98% or 99 % of the sequence positions are identical.
Erfindungsgemäß umfasst sind auch solche Nukleinsäuresequenzen, die sogenannte stumme Mutationen umfassen oder entsprechend der Codon-Nutzung eins speziellen Ursprungs- oder Wirtsorganismus, im Vergleich zu einer konkret genannten Sequenz verändert sind, ebenso wie natürlich vorkommende Varianten, wie z.B. Spleißvarianten oder Allelvarianten, davon. Gegenstand sind ebenso durch konservative Nukleotidsubstutionen (d.h. die betreffende Aminosäure wird durch eine Aminosäure gleicher Ladung, Größe, Polarität und/oder Löslichkeit ersetzt) erhältliche Sequenzen.Also included according to the invention are those nucleic acid sequences which comprise so-called silent mutations or which have been changed in accordance with the codon usage of a specific source or host organism, in comparison to a specifically named sequence, as well as naturally occurring variants, such as e.g. Splice variants or allele variants, thereof. Sequences obtainable also by conservative nucleotide substitutions (i.e. the amino acid in question is replaced by an amino acid of the same charge, size, polarity and / or solubility).
Gegenstand der Erfindung sind auch die durch Sequenzpolymorphismen von den konkret offenbarten Nukleinsäuren abgeleiteten Moleküle. Diese genetischen Polymorphismen können zwischen Individuen innerhalb einer Population aufgrund der natürlichen Variation existieren. Diese natürlichen Variationen bewirken üblicherweise eine Varianz von 1 bis 5 % in der Nukleotidse- quenz eines Gens. Weiterhin umfasst die Erfindung auch Nukleinsäuresequenzen, welchen mit oben genannten kodierenden Sequenzen hybridisieren oder dazu komplementär sind. Diese Polynukleotide lassen sich bei Durchmusterung von genomischen odercDNA-Banken auffinden und gegebenenfalls daraus mit geeigneten Primern mittels PCR vermehren und anschließend beispielsweise mit geeigneten Sonden isolieren. Eine weitere Möglichkeit bietet die Transformation geeigneter Mikroorganismen mit erfindungsgemäßen Polynukleotiden oder Vektoren, die Vermehrung der Mikroorganismen und damit der Polynukleotide und deren anschließende Isolierung. Darüber hinaus können erfindungsgemäße Polynukleotide auch auf chemischem Wege synthetisiert werden.The invention also relates to the molecules derived from the specifically disclosed nucleic acids by sequence polymorphisms. These genetic polymorphisms can exist between individuals within a population due to natural variation. These natural variations usually cause a variance of 1 to 5% in the nucleotide sequence of a gene. Furthermore, the invention also encompasses nucleic acid sequences which hybridize with the above-mentioned coding sequences or are complementary thereto. These polynucleotides can be found when screening genomic or cDNA libraries and, if appropriate, can be amplified therefrom using suitable primers by means of PCR and then isolated, for example, using suitable probes. Another possibility offers the transformation of suitable microorganisms with polynucleotides or vectors according to the invention, the multiplication of the microorganisms and thus the polynucleotides and their subsequent isolation. In addition, polynucleotides according to the invention can also be synthesized chemically.
Unter der Eigenschaft, an Polynukleotide „hybridisieren" zu können, versteht man die Fähigkeit eines Poly- oder Oligonukleotids unter stringenten Bedingungen an eine nahezu komplementäre Sequenz zu binden, während unter diesen Bedingungen unspezifische Bindungen zwischen nicht-komplementären Partnern unterbleiben. Dazu sollten die Sequenzen zu 70-100%, vor- zugsweise zu 90-100%, komplementär sein. Die Eigenschaft komplementärer Sequenzen, spezifisch aneinander binden zu können, macht man sich beispielsweise in der Northern- oder Sou- thern-Blot-Technik oder bei der Primerbindung in PCR oder RT-PCR zunutze. Üblicherweise werden dazu Oligonukleotide ab einer Länge von 30 Basenpaaren eingesetzt. Unterstringenten Bedingungen versteht man beispielsweise in der Northem-Blot-Technik die Verwendung einer 50 - 70 °C, vorzugsweise 60 - 65 °C warmen Waschlösung, beispielsweise 0,1 x SSC-Puffer mit 0,1% SDS (20x SSC: 3M NaCI, 0,3M Na-Citrat, pH 7,0) zur Elution unspezifisch hybridisierter cDNA-Sonden oder Oligonukleotide. Dabei bleiben, wie oben erwähnt, nur in hohem Maße komplementäre Nukleinsäuren aneinander gebunden. Die Einstellung stringenter Bedingungen ist dem Fachmann bekannt und istz:B. in Ausubel etal., Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. beschrieben.The property of being able to “hybridize” to polynucleotides means the ability of a poly- or oligonucleotide to bind to an almost complementary sequence under stringent conditions, while under these conditions non-specific bindings between non-complementary partners are avoided. For this purpose, the sequences should be closed 70-100%, preferably 90-100%, of complementary nature. The property of complementary sequences to be able to bind specifically to one another is demonstrated, for example, in the Northern or Southern blot technique or in primer binding in PCR or RT-PCR, usually using oligonucleotides from a length of 30 base pairs. Under stringency conditions, for example in Northem blot technology, is the use of a 50-70 ° C, preferably 60-65 ° C warm washing solution, for example 0 , 1 x SSC buffer with 0.1% SDS (20x SSC: 3M NaCl, 0.3M Na citrate, pH 7.0) for the non-specific hybridis elution ized cDNA probes or oligonucleotides. As mentioned above, only highly complementary nucleic acids remain bound to one another. The setting of stringent conditions is known to the person skilled in the art and is: B. in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. described.
d) Isolierung der kodierenden metA-Gened) isolation of the coding metA genes
Die für das Enzym Homoserin-O-Acetyl-Transferase codierenden metA-Gene aus den Organis- men obiger Liste I sind in an sich bekannter Weise isolierbar.The metA genes coding for the enzyme homoserine-O-acetyl transferase from the organisms in List I above can be isolated in a manner known per se.
Zur Isolierung der metA-Gene oder auch anderer Gene der Organismen aus obiger Liste I wird zunächst eine Genbank dieses Organsimus in Escherichia coli (E. coli) angelegt. Das Anlegen von Genbanken ist in allgemein bekannten Lehrbüchern und Handbüchern ausführlich beschrie- ben. Als Beispiel seien das Lehrbuch von Winnacker: Gene und Klone, Eine Einführung in die Gentechnologie (Verlag Chemie, Weinheim, Deutschland, 1990), oder das Handbuch von Sambrook et al.: Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) genannt. Eine sehr bekannte Genbank ist die des E. coli K-12 Stammes W3110, die von Kohara et al. (CellδO, 495-508 (198)) in λ-Vektoren angelegt wurde.To isolate the metA genes or other genes of the organisms from List I above, a gene bank of this organism is first created in Escherichia coli (E. coli). The creation of gene banks is described in detail in well-known textbooks and manuals. Examples include Winnacker's textbook: Genes and Clones, An Introduction to Genetic Technology (Verlag Chemie, Weinheim, Germany, 1990), or the manual by Sambrook et al .: Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989). A very well-known gene bank is that of the E. coli K-12 strain W3110, which was developed by Kohara et al. (CellδO, 495-508 (198)) in λ vectors.
Zur Herstellung einer Genbank von Organismen der Liste I in E. coli können Cosmide, wie der Cosmidvektor SuperCos I (Wahl et al., 1987, Proceedings of the National Academy of Sciences USA, 84: 2160-2164), aber auch Plasmide, wie pBR322 (BoliVal; Life Sciences, 25, 807-818 (1979)) oder pUC9 (Vieira et al., 1982, Gene, 19: 259-268), verwendet werden. Als Wirte eignen sich besonders solche E. coli Stämme, die restriktions- und rekombinationsdefekt sind. Ein Bei- spiel hierfür ist der Stamm DHδαmcr, der von Grant et al. (Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) beschrieben wurde. Die mit Hilfe von Cosmiden Monierten langen DNA-Fragmente können anschließend wiederum in gängige, für die Sequenzierung geeignete Vektoren subkloniert und anschließend sequenziert werden, so wie es z. B. bei Sanger et al. (proceedings of the National Academy of Sciences of the United States of America, 74: 5463-5467, 1977) beschrieben ist.To produce a gene bank of List I organisms in E. coli, cosmids such as the cosmid vector SuperCos I (Wahl et al., 1987, Proceedings of the National Academy of Sciences USA, 84: 2160-2164), but also plasmids, such as pBR322 (BoliVal; Life Sciences, 25, 807-818 (1979)) or pUC9 (Vieira et al., 1982, Gene, 19: 259-268) can be used. E. coli strains that are defective in terms of restriction and recombination are particularly suitable as hosts. An example of this is the DHδαmcr strain, which was described by Grant et al. (Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649). The long DNA fragments cloned with the help of cosmids can then be subcloned again into common vectors suitable for sequencing and then sequenced, as described, for. B. Sanger et al. (proceedings of the National Academy of Sciences of the United States of America, 74: 5463-5467, 1977).
Die erhaltenen DNA-Sequenzen können dann mit bekannten Algorithmen bzw. Sequenzanalyse- Programmen, wie z. B. dem von Staden (Nucleic Acids Research 14,217-232(1986)), dem von Marck (Nucleic Acids Research 16, 1829-1836 (1988)) oder dem GCG-Programm von Butler (Methods ofBiochemical Analysis 39, 74-97 (1998)), untersucht werden.The DNA sequences obtained can then with known algorithms or sequence analysis programs such. B. von Staden (Nucleic Acids Research 14, 217-232 (1986)), that of Marck (Nucleic Acids Research 16, 1829-1836 (1988)) or the GCG program by Butler (Methods of Biochemical Analysis 39, 74-97 ( 1998)).
Die für die metA-Gene kodierenden DNA-Sequenzen von Organismen gemäß obiger Liste I wurde gefunden. Insbesondere wurden DNA-Sequenzen gemäß SEQ ID NO:1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43 und 45 gefunden. Weiterhin wurden aus diesen vorliegenden DNA-Sequenzen mit den oben beschriebenen Methoden die Aminosäuresequenzen der entsprechenden Proteine abgeleitet. Durch SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 und 46 sind die sich ergebenden Aminosäuresequenzen der metA-Genprodukte dargestellt.The DNA sequences of organisms coding for the metA genes according to list I above were found. In particular, DNA sequences according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43 and 45 found. Furthermore, the amino acid sequences of the corresponding proteins were derived from these DNA sequences using the methods described above. By SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 and 46 the resulting amino acid sequences of the metA gene products are shown.
Kodierende DNA-Sequenzen, die sich aus den Sequenzen gemäß SEQ ID NO:1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43 und 45 durch die Degeneration des genetischen Kodes ergeben, sind ebenfalls Gegenstand der Erfindung. In gleicherweise sind DNA-Sequenzen, die mit diesen Sequenzen oder davon abgeleiteten Sequenzteilen hybridisieren, Gegenstand der Erfindung. Anleitungen zur Identifizierung von DNA-Sequenzen mittels Hybridisierung findet der Fachmann unter anderem im Handbuch "The DIG System Users Guide für Filter Hybridization" der Firma Boehringer Mannheim GmbH (Mannheim, Deutschland, 1993) und bei Liebl et al. (International Journal of Systematic Bacteriology (1991 ) 41 : 255-260). Anleitungen zur Amplifikation von DNA- Sequenzen mit Hilfe der Polymerase-Kettenreaktion (PCR) findet der Fachmann unter anderem im Handbuch von Gait: Oligonukleotide synthesis: A Practical Approach (IRL Press, Ox- ford, UK, 1984) und bei Newton und Graham: PCR (Spektrum Akademischer Verlag, Heidelberg, Deutschland, 1994).Coding DNA sequences resulting from the sequences according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 , 37, 39, 41, 43 and 45 resulting from the degeneration of the genetic code are also the subject of the invention. In the same way, DNA sequences which hybridize with these sequences or sequence parts derived therefrom are the subject of the invention. The person skilled in the art can find instructions for identifying DNA sequences by means of hybridization in the manual "The DIG System Users Guide for Filter Hybridization" by Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in Liebl et al. (International Journal of Systematic Bacteriology (1991) 41: 255-260). The person skilled in the art can find instructions for the amplification of DNA sequences with the aid of the polymerase chain reaction (PCR) in the Gait handbook: Oligonucleotide synthesis: A Practical Approach (IRL Press, Oxford, UK, 1984) and in Newton and Graham: PCR (Spektrum Akademischer Verlag, Heidelberg, Germany, 1994).
Weiterhin ist bekannt, dass Änderungen am N- und/oder C- Terminus eines Proteins dessen Funktion nicht wesentlich beeinträchtigen oder sogar stabilisieren können. Angaben hierzu findet der Fachmann unter anderem bei Ben-Bassat et al. (Journal of Bacteriology 169: 751-757 (1987)), bei O'Regan etal. (Gene 77: 237-251 (1989), bei Sahin-Toth etal. (Protein Sciences 3: 240-247 (1994)), bei Hochuli et al. (Biontechnology 6: 1321-1325 (1988)) und in bekannten Lehrbüchern der Genetik und Molekularbiologie.It is also known that changes to the N- and / or C-terminus of a protein do not significantly impair or even stabilize its function. The person skilled in the art can find information on this from Ben-Bassat et al. (Journal of Bacteriology 169: 751-757 (1987)), O'Regan et al. (Gene 77: 237-251 (1989), in Sahin-Toth et al. (Protein Sciences 3: 240-247 (1994)), in Hochuli et al. (Biontechnology 6: 1321-1325 (1988)) and in known textbooks of genetics and molecular biology.
Aminosäuresequenzen, die sich in entsprechender Weise aus den SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44 und 46 ergeben, sind ebenfalls Bestandteil der Erfindung.Amino acid sequences which are correspondingly derived from SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 , 40, 42, 44 and 46 result are also part of the invention.
e) Erfindungsgemäß verwendete Wirtszellene) Host cells used according to the invention
Weitere Gegenstände der Erfindung betreffen als Wirtszelle dienende Mikroorgansismen, insbesondere coryneforme Bakterien, die einen Vektor, insbesondere Pendelvektor oder Plasmidvek- tor, der wenigstens ein metA-Gen gerfindungsgemäßer Definition trägt, enthalten oder in denen ein erfindungsgemäßes metA-Gen exprimiert bzw. verstärkt ist.Further objects of the invention relate to microorganisms serving as host cells, in particular coryneform bacteria, which contain a vector, in particular a pendulum vector or plasmid vector, which carries at least one metA gene according to the invention, or in which a metA gene according to the invention is expressed or amplified.
Diese Mikroorganismen können schwefelhaltige Feinchemikalien, insbesondere L-Methionin, aus Glucose, Saccharose, Lactose, Fructose, Maltose, Melasse, Stärke, Cellulose oder aus Gly- cerin und Ethanol herstellen. Vorzugsweise sind dies coryneforme Bakterien, insbesondere der Gattung Corynebacterium. Aus der Gattung Corynebacterium ist insbesondere die Art Corynebacterium glutamicum zu nennen, die in der Fachwelt für ihre Fähigkeit bekannt ist, L- Aminosäuren zu produzieren.These microorganisms can produce sulfur-containing fine chemicals, in particular L-methionine, from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. These are preferably coryneform bacteria, in particular of the genus Corynebacterium. From the genus Corynebacterium, the species Corynebacterium glutamicum should be mentioned in particular, which is known in the art for its ability to produce L-amino acids.
Als Beispiele für geeignete Stämme coryneformer Bakterien sind solche der Gattung Corynebacterium, insbesondere der Art Corynebacterium glutamicum (C. glutamicum), wie Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965Examples of suitable strains of coryneform bacteria are those of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum (C. glutamicum), such as Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965
oder der Gattung Brevibacterium, wieor the genus Brevibacterium, such as
Brevibacterium flavum ATCC 14067 Brevibacterium lactofermentum ATCC 13869 und Brevibacterium divaricatum ATCC 14020 zu nennen; oder davon abgeleitete Stämme, wie Corynebacterium glutamicum KFCC10065 Corynebacterium glutamicum ATCC21608Brevibacterium flavum ATCC 14067 Brevibacterium lactofermentum ATCC 13869 and Brevibacterium divaricatum ATCC 14020 to name; or strains derived therefrom, such as Corynebacterium glutamicum KFCC10065 Corynebacterium glutamicum ATCC21608
welche ebenfalls die gewünschte Feinchemikalie oder deren Vorstufe(n) produzieren. Mit der Abkürzung KFCC ist die Korean Federation of Culture Collection gemeint, mit der Abkürzung ATCC die American type strain culture collection, mit der Abkürzung FERM BP die Sammlung des National institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Japan bezeichnet.which also produce the desired fine chemical or its precursor (s). The abbreviation KFCC means the Korean Federation of Culture Collection, the abbreviation ATCC the American type strain culture collection, and the abbreviation FERM BP the collection of the National institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Japan ,
f) Durchführung der erfindungsgemäßen Fermentationf) carrying out the fermentation according to the invention
Erfindungsgemäß wurde festgestellt, dass coryneforme Bakterien nach Überexpression eines metA-Gens aus Organismen der Liste I in vorteilhafter Weise schwefelhaltige Feinchemikalien, insbesondere L-Methionin, produzieren.According to the invention, it was found that coryneform bacteria advantageously produce sulfur-containing fine chemicals, in particular L-methionine, after overexpression of a metA gene from List I organisms.
Zur Erzielung einer Überexpression kann der Fachmann unterschiedliche Maßnahmen einzeln oder in Kombination ergreifen. So kann die Kopienzahl der entsprechenden Gene erhöht wer- den, öderes kann die Promotor- und Regulationsregion oder die Ribosomenbindungsstelle, die sich stromaufwärts des Strukturgens befindet, mutiert werden. In gleicherweise wirken Expressionskassetten, die stromaufwärts des Strukturgens eingebaut werden. Durch induzierbare Promotoren ist es zusätzlich möglich, die Expression im Verlaufe der fermentativen L-Methionin- Produktion zu steigern. Durch Maßnahmen zur Verlängerung der Lebensdauer der mRNA wird ebenfalls die Expression verbessert. Weiterhin wird durch Verhinderung des Abbaus des Enzymproteins ebenfalls die Enzymaktivität verstärkt. Die Gene oder Genkonstrukte können ent- weder in Plasmiden mit unterschiedlicher Kopienzahl vorliegen oder im Chromosom integriert und amplifiziert sein. Alternativ kann weiterhin eine Überexpression der betreffenden Gene durch Veränderung der Medienzusammensetzung und Kulturführung erreicht werden.The person skilled in the art can take different measures individually or in combination to achieve overexpression. The number of copies of the corresponding genes can be increased, or the promoter and regulatory region or the ribosome binding site located upstream of the structural gene can be mutated. Expression cassettes which are installed upstream of the structural gene act in the same way. Inducible promoters also make it possible to increase expression in the course of fermentative L-methionine production. Expression is also improved by measures to extend the life of the mRNA. Furthermore, preventing the breakdown of the enzyme protein also increases the enzyme activity. The genes or gene constructs can are not present in plasmids with different copy numbers or are integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can be achieved by changing the media composition and culture management.
Anleitungen hierzu findet der Fachmann unter anderem bei Martin et al. (Biontechnology 5, 137- 146 (1987)), bei Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya und Morinaga (Bio/Technology 6, 428-430 (1988)), bei Eikmanns etal. (Gene 102, 93-98 (1991)), in der Europäischen Patentschrift 0472869, im US Patent 4,601 , 893, bei Schwarzer und Pühler (Biotechno- logy9, 84-87 (1991), bei Remscheid et al. (Applied and Environmental Microbiology60,126-132 (1994), bei LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in der Patentanmeldung WO 96/15246, bei Malumbres et al. (Gene 134, 15-24 (1993)), in der japanischen Offenle- gungsschrift JP-A-10-229891, bei Jensen und Hammer (Biotechnology and Bioengineering 58..191-195 (1998)), bei Makrides (Microbiological Reviews 60 : 512-538 (1996) und in bekannten Lehrbüchern der Genetik und Molekularbiologie.Instructions for this can be found by Martin et al. (Biontechnology 5, 137-146 (1987)), Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio / Technology 6, 428-430 (1988)), from Eikmanns et al. (Gene 102, 93-98 (1991)), in European Patent 0472869, in US Patent 4,601, 893, by Schwarzer and Pühler (Biotechnology 9, 84-87 (1991), by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994), in LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in patent application WO 96/15246, in Malumbres et al. (Gene 134, 15-24 (1993 )), in Japanese laid-open publication JP-A-10-229891, by Jensen and Hammer (Biotechnology and Bioengineering 58..191-195 (1998)), by Makrides (Microbiological Reviews 60: 512-538 (1996) and in well-known textbooks of genetics and molecular biology.
Gegenstand der Erfindung sind deshalb auch Expressionskonstrukte, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen eine für ein erfindungsgemäßes Poly- peptid kodierende Nukleinsäuresequenz; sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte. Vorzugsweise umfassen solche erfindungsgemäßen Konstrukte 5'- stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz. Unter einer „operativen Verknüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann. Beispiele für operativ verknüpfbare Sequenzen sind Aktivrieungssequenzen sowie Enhancer und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z.B. beschrieben in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).The invention therefore also relates to expression constructs which contain, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide according to the invention; and vectors comprising at least one of these expression constructs. Such constructs according to the invention preferably comprise a promoter 5 'upstream of the respective coding sequence and a terminator sequence 3' downstream and optionally further customary regulatory elements, in each case operatively linked to the coding sequence. An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended in the expression of the coding sequence. Examples of sequences which can be linked operatively are activation sequences and Enhancers, etc. Other regulatory elements include selectable markers, amplification signals, origins of replication, etc. Suitable regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu den artifiziellen Regulationssequenzen kann die natürliche Regulationssequenz vor dem eigentlichen Strukturgen noch vorhanden sein. Durch genetische Veränderung kann diese natürliche Regulation gegebenenfalls ausgeschaltet und die Expression der Gene erhöht oder erniedrigt werden. Das Genkonstrukt kann aber auch einfacher aufgebaut sein, das heißt es werden keine zusätzlichen Regulationssignale vor das Strukturgen insertiert und der natürli- ehe Promotor mit seiner Regulation wird nicht entfernt. Statt dessen wird die natürliche Regulationssequenz so mutiert, dass keine Regulation mehr erfolgt und die Genexpression gesteigert oder verringert wird. Die Nukleinsäuresequenzen können in einer oder mehreren Kopien im Genkonstrukt enthalten sein.In addition to the artificial regulatory sequences, the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased. However, the gene construct can also have a simpler structure, ie no additional regulatory signals are inserted in front of the structural gene and the natural before the promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased. The nucleic acid sequences can be contained in one or more copies in the gene construct.
Beispiele für brauchbare Promotoren sind: die Promotoren, ddh, amy, lysC, dapA, lysA aus Corynebacterium glutamicum, aber auch gram-positiven Promotoren SP02 wie sie in Bacillus Sub- tilis and Its Closest Relatives, Sonenshein, Abraham L.,Hoch, James A., Losick, Richard; ASM Press, Districtof Columbia, Washington und Patek M. Eikmanns BJ. Patek J. Sahm H. Microbio- logy. 142 1297-309, 1996 beschrieben sind, oder aber auch cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac- , Ipp-lac-, laclq-, T7-, T5-, T3-, gal-, tre-, ara-, SP6-, λ-PR- oder im λ-PL-Promotor, die vorteilhafterweise in gram-negativen Bakterien Anwendung finden. Bevorzugt ist auch die Verwendung induzierbarer Promotoren, wie z.B. licht- und insbesondere temperaturinduztierbarer Promotoren, wie der PrPrPromotor. Prinzipiell können alle natürlichen Promotoren mit ihren Regula- tionssequenzen verwendet werden. Darüber hinaus können auch synthetische Promotoren vorteilhaft verwendet werden.Examples of usable promoters are: the promoters, ddh, amy, lysC, dapA, lysA from Corynebacterium glutamicum, but also gram-positive promoters SP02 as described in Bacillus Subtilis and Its Closest Relatives, Sonenshein, Abraham L., Hoch, James A., Losick, Richard; ASM Press, Districtof Columbia, Washington and Patek M. Eikmanns BJ. Patek J. Sahm H. Microbiology. 142 1297-309, 1996, or also cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3 -, gal-, tre-, ara-, SP6-, λ-PR or in the λ-PL promoter, which are advantageously used in gram-negative bacteria. It is also preferred to use inducible promoters, such as, for example, light-inducible and in particular temperature-inducible promoters, such as the P r P r promoter. In principle, all natural promoters with their regulatory sequences can be used. In addition, synthetic promoters can also be used advantageously.
Die genannten regulatorischen Sequenzen sollen die gezielte Expression der Nukleinsäuresequenzen ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.The regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Expression positiv beeinflussen und dadurch erhöhen oder erniedrigen. So kann eine Verstärkung der regulato- rischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.The regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it. Thus, the regulatory elements can advantageously be amplified at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors, einer geeigneten Shine-Dalgarnow-Sequenz mit einer metA-Nukleotidsequenz sowie einem geeigneten Terminationssignal. Dazu verwendet man gängige Rekombinations- und Klonie- rungstechniken, wie sie beispielsweise in Current Protocols in Molecular Biology, 1993, John Wiley & Sons, Incorporated, New York New York, PCR Methods, Gelfand, David H., Innis, Mi- chael A., Sninsky, John J. 1999, Academic Press, Incorporated, California, San Diego, ., PCR Cloning Protocols, Methods in Molecular Biology Ser., Vol. 192, 2nd ed., Humana Press, New Jersey, Totowa. T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al., Current Protocols in Molecular Biolo- gy, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.An expression cassette is produced by fusing a suitable promoter, a suitable Shine-Dalgarnow sequence with a metA nucleotide sequence and a suitable termination signal. For this purpose, common recombination and cloning techniques are used, as described, for example, in Current Protocols in Molecular Biology, 1993, John Wiley & Sons, Incorporated, New York New York, PCR Methods, Gelfand, David H., Innis, Michael A ., Sninsky, John J. 1999, Academic Press, Incorporated, California, San Diego,., PCR Cloning Protocols, Methods in Molecular Biology Ser., Vol. 192, 2nd ed., Humana Press, New Jersey, Totowa. T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus vorteilhafterweise in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amster- dam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannten Vektoren, wie beispielsweise Phagen, Transposons, IS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985). In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.
Zur Verstärkung wurden erfindungsgemäße metA-Gene beispielhaft mit Hilfe von episomalen Plasmiden überexprimiert. Als Plasmide eignen sich solche, die in coryneformen Bakterien repliziert werden. Zahlreiche bekannte Plasmidvektoren, wie z. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102: 93-98 (1991)) oder pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) beruhen auf den kryptischen Plasmiden pHM1519, pBL1 oder pGA1. Andere Plasmidvektoren, wie z. B. pCLiK5MCS, oder solche, die auf pCG4 (US-A 4,489,160) oder pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) oder pAG1 (US-A 5,158,891) beruhen, können in gleicher weise verwendet werden.For amplification, metA genes according to the invention were overexpressed, for example, using episomal plasmids. Suitable plasmids are those which are replicated in coryneform bacteria. Numerous known plasmid vectors, such as. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA1. Other plasmid vectors, such as. B. pCLiK5MCS, or those based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (US-A 5,158,891) can in can be used in the same way.
Weiterhin eignen sich auch solche Plasmidvektoren mit Hilfe derer man das Verfahren der Ge- namplifikation durch Integration in das Chromosom anwenden kann, so wie es beispielsweise von Remscheid et al. (Applied and Environmental Microbiology 60,126-132 (1994)) zur Duplikation bzw. Amplifikation des hom-thrB-Operons beschrieben wurde. Bei dieser Methode wird das vollständige Gen in einen Plasmidvektor kloniert, der in einem Wirt (typischerweise E. coli), nicht aber in C. glutamicum replizieren kann. Als Vektoren kommen beispielsweise pSUP301 (Simon et al., Bio/ Technology 1 ,784-791 (1983)), pK18mob oder pK19mob (Schäfer et al., Gene 145,69-73 (1994)), Bernard et al., Journal ofMolecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991 , Journal of Bacteriology 173: 4510--4516) oder pBGS8 (Spratt et al.,1986, Gene 41 : 337-342) in Frage. Der Plasmidvektor, der das zu amplifizierende Gen enthält, wird anschließend durch Transformation in den gewünschten Stamm von C. glutamicum überführt. Methoden zur Transformation sind beispielsweise beiThierbach etal. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican und Shivnan (Biotechnology7, 1067-1070 (1989)) und Tauch et al. (FEMS Microbiological Letters 123,343-347 (1994)) beschrieben.Furthermore, such plasmid vectors are also suitable with the aid of which the method of gene amplification by integration into the chromosome can be used, as described, for example, by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication or amplification of the hom-thrB operon. In this method, the complete gene is cloned into a plasmid vector that can replicate in a host (typically E. coli) but not in C. glutamicum. Examples of vectors are pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Bernard et al., Journal ofMolecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342) in question , The plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation. Methods for transformation are, for example, in Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican and Shivnan (Biotechnology7, 1067-1070 (1989)) and Tauch et al. (FEMS Microbiological Letters 123, 343-347 (1994)).
Enzyme können durch Mutationen in den korrespondierenden Genen derart in ihrer Aktivität beeinflußt werden, dass es zu einer teilweisen oder vollständigen Verringerung der Reaktionsgeschwindigkeit der enzymatischen Reaktion kommt. Beispiele für solche Mutationen sind dem Fachmann bekannt (Motoyama H. Yano H. Terasaki Y. Anazawa H. Applied & Environmental Microbiology.67:3064-70, 2001 , Eikmanns BJ. Eggeling L. Sahm H. Antonie van Leeuwenhoek. 64:145-63, 1993-94.)Enzymes can be influenced in their activity by mutations in the corresponding genes in such a way that there is a partial or complete reduction in the reaction rate of the enzymatic reaction. Examples of such mutations are known to the person skilled in the art (Motoyama H. Yano H. Terasaki Y. Anazawa H. Applied & Environmental Microbiology. 67: 3064-70, 2001, Eikmanns BJ. Eggeling L. Sahm H. Antonie van Leeuwenhoek. 64: 145 -63, 1993-94.)
Zusätzlich kann es für die Produktion von schwefelhaltige Feinchemikalien, insbesondere L- Methionin, vorteilhaft sein, neben einer Expression bzw. Verstärkung eines erfindungsgemäßen metA-Gen eines oder mehrere Enzyme des jeweiligen Biosyntheseweges, des Cystein- Stoffwechselwegs, der Aspartatsemialdehyd-Synthese, der Glykolyse, der Anaplerotik, des Pen- tose-Phosphat-Stoffwechsels, des Zitronensäure-Zyklus oder des Aminosäure-Exports zu verstärken.In addition, it may be advantageous for the production of sulfur-containing fine chemicals, in particular L-methionine, in addition to expression or amplification of a metA gene according to the invention, one or more enzymes of the respective biosynthetic pathway, the cysteine pathway, aspartate semialdehyde synthesis, glycolysis, the anaplerotic, the phosphate metabolism, the citric acid cycle or the export of amino acids.
So kann für die Herstellung von schwefelhaltige Feinchemikalien, insbesondere L-Methionin, eines oder mehrere der folgenden Gene verstärkt sein:For example, one or more of the following genes can be amplified for the production of sulfur-containing fine chemicals, in particular L-methionine:
- das für eine Aspartatkinase kodierende Gen lysC (EP 1 108 790 A2; DNA-SEQ NO. 281), -das für eine Aspartat-Semialdehyd Dehydrogenase kodierende Gen asd (EP 1 108 790 A2; DNA-SEQ NO. 282),the gene encoding an aspartate kinase lysC (EP 1 108 790 A2; DNA SEQ NO. 281), the gene encoding an aspartate semialdehyde dehydrogenase asd (EP 1 108 790 A2; DNA SEQ NO. 282),
- das für die Glycerinaldehyd-3-Phosphat Dehydrogenase kodierende Gen gap (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086),the gene gap coding for glyceraldehyde-3-phosphate dehydrogenase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086),
- das für die 3-Phosphoglycerat Kinase kodierende Gen pgk (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086),the gene pgk coding for the 3-phosphoglycerate kinase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086),
- das für die Pyruvat Carboxylase kodierende Gen pyc (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), - das für die Triosephosphat Isomerase kodierende Gen tpi (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086),- the pyc gene coding for pyruvate carboxylase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), - the gene tpi (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086) coding for triosephosphate isomerase,
- das für die Methionin Synthase kodierende Gen metH (EP 1 108 790 A2),the metH gene coding for methionine synthase (EP 1 108 790 A2),
- das für die Cystahionin-gamma-Synthase kodierende Gen metB (EP 1 108790 A2; DNA-SEQ NO. 3491), - das für die Cystahionin-gamma-Lyase kodierende Gen metC (EP 1 108790 A2; DNA-SEQ NO. 3061), - das für die Serin-Hydroxymethyltransferase kodierende Gen glyA (EP 1 108790 A2; DNA-SEQ NO. 1110),the metB gene coding for the cystahionin gamma synthase (EP 1 108790 A2; DNA SEQ NO. 3491), the metC gene coding for the cystahionin gamma lyase (EP 1 108790 A2; DNA SEQ NO. 3061) ) the glyA gene coding for the serine hydroxymethyltransferase (EP 1 108790 A2; DNA-SEQ NO. 1110),
- das für die O-Acetylhomoserin-Sulfhydrylase kodierende Gen metY (EP 1 108790 A2; DNA- SEQ NO. 726), - das für die Methylentetrahydrofolat-Reduktase kodierende Gen metF (EP 1 108790 A2; DNA- SEQ NO. 2379),- the metY gene coding for O-acetylhomoserine sulfhydrylase (EP 1 108790 A2; DNA SEQ NO. 726), - the metF gene coding for methylene tetrahydrofolate reductase (EP 1 108790 A2; DNA SEQ NO. 2379),
- das für die Phosphoserin-Aminotransferase kodierende Gen serC (EP 1 108 790 A2; DNA- SEQ NO. 928)the serC gene coding for phosphoserine aminotransferase (EP 1 108 790 A2; DNA SEQ NO. 928)
- eines für die Phosphoserin-Phosphatase kodierende Gen serB (EP 1 108790 A2; DNA-SEQ NO. 334, DNA-SEQ NO. 467, DNA-SEQ NO. 2767)- a gene coding for the phosphoserine phosphatase serB (EP 1 108790 A2; DNA-SEQ NO. 334, DNA-SEQ NO. 467, DNA-SEQ NO. 2767)
- das für die Serine Acetyl-Transferase kodierende Gen cysE (EP 1 108790 A2; DNA-SEQ NO. 2818)- The gene coding for the serine acetyl transferase cysE (EP 1 108790 A2; DNA-SEQ NO. 2818)
- das für eine Homoserin-Dehydrogenase kodierende Gen hom (EP 1 108 790 A2; DNA-SEQ NO. 1306)- The gene hom coding for a homoserine dehydrogenase (EP 1 108 790 A2; DNA-SEQ NO. 1306)
So kann für die Herstellung von schwefelhaltige Feinchemikalien, insbesondere L-Methionin, in coryneformen Bakterien, vorteilhaft sein, gleichzeitig wenigstens eines der nachfolgenden Gene zu mutieren, so dass die korrespondierenden Proteine, verglichen mit nicht mutierten Proteinen, in geringerem Maße oder nicht durch einen Stoffwechselmetaboliten in ihrer Aktivität beeinflusst werden:For example, for the production of sulfur-containing fine chemicals, in particular L-methionine, in coryneform bacteria, it can be advantageous to mutate at least one of the following genes at the same time, so that the corresponding proteins, to a lesser extent or not by a metabolic metabolite, compared to non-mutated proteins be influenced in their activity:
- das für eine Aspartatkinase kodierende Gen lysC (EP 1 108 790 A2; DNA-SEQ NO. 281),the gene coding for an aspartate kinase lysC (EP 1 108 790 A2; DNA-SEQ NO. 281),
- das für die Pyruvat Carboxylase kodierende Gen pyc (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), - das für die Methionin Synthase kodierende Gen metH (EP 1 108 790 A2),the pyc gene coding for the pyruvate carboxylase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), the gene metH coding for the methionine synthase (EP 1 108 790 A2),
- das für die Cystahionin-gamma-Synthase kodierende Gen metB (EP 1 108790 A2; DNA-SEQ NO. 3491),the metB gene coding for cystahionin gamma synthase (EP 1 108790 A2; DNA SEQ NO. 3491),
- das für die Cystahionin-gamma-Lyase kodierende Gen metC (EP 1 108790 A2; DNA-SEQ NO. 3061), - das für die Serin-Hydroxymethyltransferase kodierende Gen glyA (EP 1 108790 A2; DNA-SEQ NO. 1110),- the gene coding for the cystahionin-gamma-lyase (EP 1 108790 A2; DNA-SEQ NO. 3061), - the gene coding for the serine hydroxymethyltransferase glyA (EP 1 108790 A2; DNA-SEQ NO. 1110),
- das für die O-Acetylhomoserin-Sulfhydrylase kodierende Gen metY (EP 1 108790 A2; DNA- SEQ NO. 726),the metY gene coding for the O-acetylhomoserine sulfhydrylase (EP 1 108790 A2; DNA SEQ NO. 726),
- das für die Methylentetrahydrofolat-Reduktase kodierende Gen metF (EP 1 108790 A2; DNA- SEQ NO. 2379),the metF gene coding for methylene tetrahydrofolate reductase (EP 1 108790 A2; DNA SEQ NO. 2379),
- das für die Phosphoserin-Aminotransferase kodierende Gen serC (EP 1 108 790 A2; DNA- SEQ NO. 928)the serC gene coding for phosphoserine aminotransferase (EP 1 108 790 A2; DNA) SEQ NO. 928)
- eines für die Phosphoserin-Phosphatase kodierende Gen serB (EP 1 108790 A2; DNA-SEQ NO. 334, DNA-SEQ NO. 467, DNA-SEQ NO. 2767)- a gene coding for the phosphoserine phosphatase serB (EP 1 108790 A2; DNA-SEQ NO. 334, DNA-SEQ NO. 467, DNA-SEQ NO. 2767)
- das für die Serine Acetyl-Transferase kodierende Gen cysE (EP 1 108790 A2; DNA-SEQ NO. 2818)- The gene coding for the serine acetyl transferase cysE (EP 1 108790 A2; DNA-SEQ NO. 2818)
- das für eine Homoserin-Dehydrogenase kodierende Gen hom (EP 1 108 790 A2; DNA-SEQ NO. 1306)- The gene hom coding for a homoserine dehydrogenase (EP 1 108 790 A2; DNA-SEQ NO. 1306)
Weiterhin kann es für die Produktion von schwefelhaltige Feinchemikalien, insbesondere L- Methionin, vorteilhaft sein, zusätzlich zur Expression bzw. Verstärkung eines der erfindungsgemäßen metA-Gene eines oder mehrere der folgenden Gene abzuschwächen, insbesondere deren Expression zu verringern, oder auszuschalten:Furthermore, for the production of sulfur-containing fine chemicals, in particular L-methionine, it may be advantageous, in addition to the expression or amplification of one of the metA genes according to the invention, to weaken one or more of the following genes, in particular to reduce their expression or to switch them off:
- das für die Homoserine-Kinase kodierende Gen thrB (EP 1 108790 A2; DNA-SEQ NO. 3453) - das für die Threonin Dehydratase kodierende Gen ilvA (EP 1 108 790 A2; DNA-SEQ NO.the thrB gene coding for homoserine kinase (EP 1 108790 A2; DNA-SEQ NO. 3453) - the ilvA gene coding for threonine dehydratase (EP 1 108 790 A2; DNA-SEQ NO.
2328)2328)
- das für die Threonin Synthase kodierende Gen thrC (EP 1 108790 A2; DNA-SEQ NO. 3486)the thrC gene coding for the threonine synthase (EP 1 108790 A2; DNA-SEQ NO. 3486)
- das für die Meso-Diaminopimelat D-Dehydrogenase kodierende Gen ddh (EP 1 108 790 A2; DNA-SEQ NO. 3494) - das für die Phosphoenolpyruvat-Carboxykinase kodierende Gen pck (EP 1 108790 A2; DNA- SEQ NO. 3157)- the gene ddh coding for the mesodiaminopimelate D-dehydrogenase (EP 1 108 790 A2; DNA-SEQ NO. 3494) - the gene pck coding for the phosphoenolpyruvate carboxykinase (EP 1 108790 A2; DNA-SEQ NO. 3157)
- das für die Glucose-6-Phosphat-6-lsomerase kodierende Gen pgi (EP 1 108 790 A2; DNA- SEQ NO. 950)- The pgi gene coding for glucose-6-phosphate-6-isomerase (EP 1 108 790 A2; DNA-SEQ NO. 950)
- das für die Pyruvat-Oxidase kodierende Gen poxB (EP 1 108 790 A2; DNA-SEQ NO. 2873) - das für die Dihydrodipicolinat Synthase kodiernde Gen dapA (EP 1 108790 A2; DNA-SEQ NO.- the poxB gene coding for pyruvate oxidase (EP 1 108 790 A2; DNA-SEQ NO. 2873) - the gene dapA coding for dihydrodipicolinate synthase (EP 1 108790 A2; DNA-SEQ NO.
3476)3476)
- das für die Dihydrodipicolinat Reduktase kodiernde Gen dapB (EP 1 108 790 A2; DNA-SEQ NO. 3477)- the gene coding for the dihydrodipicolinate reductase dapB (EP 1 108 790 A2; DNA-SEQ NO. 3477)
- das für die Diaminopicolinat Decarboxylase kodiernde Gen lysA (EP 1 108790 A2; DNA-SEQ NO. 3451)- The gene coding for the diaminopicolinate decarboxylase lysA (EP 1 108790 A2; DNA-SEQ NO. 3451)
Weiterhin kann es für die Produktion von schwefelhaltige Feinchemikalien, insbesondere L- Methionin, vorteilhaft sein, zusätzlich zur Expression bzw. Verstärkung eines der erfindungsgemäßen metA-Gene in Coryneformen Bakterien gleichzeitig wenigstens eines der folgenden Ge- ne so zu mutieren, dass die enzymatische Aktivität des korrespondierenden Proteins teilweise oder vollständig verringert wird: - das für die Homoserine-Kinase kodierende Gen thrB (EP 1 108790 A2; DNA-SEQ NO. 3453)Furthermore, it may be advantageous for the production of sulfur-containing fine chemicals, in particular L-methionine, to mutate at least one of the following genes simultaneously in addition to the expression or amplification of one of the metA genes according to the invention in coryneform bacteria so that the enzymatic activity of the corresponding protein is partially or completely reduced: the gene coding for the homoserine kinase thrB (EP 1 108790 A2; DNA-SEQ NO. 3453)
- das für die Threonin Dehydratase kodierende Gen ilvA (EP 1 108 790 A2; DNA-SEQ NO. 2328) - das für die Threonin Synthase kodierende Gen thrC (EP 1 108790 A2; DNA-SEQ NO. 3486)- the gene encoding the threonine dehydratase ilvA (EP 1 108 790 A2; DNA-SEQ NO. 2328) - the gene encoding the threonine synthase thrC (EP 1 108790 A2; DNA-SEQ NO. 3486)
- das für die Meso-Diaminopimelat D-Dehydrogenase kodierende Gen ddh (EP 1 108 790 A2; DNA-SEQ NO. 3494)- The ddh gene coding for the mesodiaminopimelate D-dehydrogenase (EP 1 108 790 A2; DNA-SEQ NO. 3494)
- das für die Phosphoenolpyruvat-Carboxykinase kodierende Gen pck (EP 1 108790 A2; DNA- SEQ NO. 3157) - das für die Glucose-6-Phosphat-6-lsomerase kodierende Gen pgi (EP 1 108 790 A2; DNA- SEQ NO. 950)- the gene pck coding for the phosphoenolpyruvate carboxykinase (EP 1 108790 A2; DNA-SEQ NO. 3157) - the gene pgi coding for the glucose-6-phosphate-6-isomerase (EP 1 108 790 A2; DNA-SEQ NO . 950)
- das für die Pyruvat-Oxidase kodierende Gen poxB (EP 1 108 790 A2; DNA-SEQ NO. 2873)- The poxB gene coding for pyruvate oxidase (EP 1 108 790 A2; DNA-SEQ NO. 2873)
- das für die Dihydrodipicolinat Synthase kodiernde Gen dapA(EP 1 108790 A2; DNA-SEQ NO. 3476) - das für die Dihydrodipicolinat Reduktase kodiernde Gen dapB (EP 1 108 790 A2; DNA-SEQ NO. 3477)- the gene dapA coding for the dihydrodipicolinate synthase (EP 1 108790 A2; DNA-SEQ NO. 3476) - the gene dapB coding for the dihydrodipicolinate reductase (EP 1 108 790 A2; DNA-SEQ NO. 3477)
- das für die Diaminopicolinat Decarboxylase kodiernde Gen lysA (EP 1 108790 A2; DNA-SEQ NO. 3451)- The gene coding for the diaminopicolinate decarboxylase lysA (EP 1 108790 A2; DNA-SEQ NO. 3451)
Weiterhin kann es für die Produktion von schwefelhaltige Feinchemikalien, insbesondere L- Methionin, vorteilhaft sein, neben der Expression bzw. Verstärkung eines erfindungsgemäßen metA-Gens unerwünschte Nebenreaktionen auszuschalten (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).Furthermore, for the production of sulfur-containing fine chemicals, in particular L-methionine, it can be advantageous to switch off undesired side reactions in addition to the expression or amplification of a metA gene according to the invention (Nakayama: "Breeding of Amino Acid Producing Microorganisms", in: Overproduction of Microbial Products , Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).
Die erfindungsgemäß hergestellten Mikroorganismen können kontinuierlich oder diskontinuierlich im batch- Verfahren (Satzkultivierung) oder im fed batch (Zulaufverfahren) oder repeated fed batch Verfahren (repetitives Zulaufverfahren) zur Produktion von schwefelhaltige Feinchemikalien, insbesondere L-Methionin, kultiviert werden. Eine Zusammenfassung über bekannte Kulti- ierungsmethoden ist im Lehrbuch von Chmiel (Bioprozeßtechnik 1. Einführung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991 )) oder im Lehrbuch von Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)) zu finden.The microorganisms produced according to the invention can be cultured continuously or discontinuously in the batch process (batch cultivation) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the production of sulfur-containing fine chemicals, in particular L-methionine. A summary of known cultivation methods can be found in the textbook by Chmiel (bioprocess technology 1st introduction to bioprocess engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994) ) to find.
Das zu verwendende Kulturmedium hat in geeigneter Weise den Ansprüchen der jeweiligen Stämme zu genügen. Beschreibungen von Kulturmedien verschiedener Mikroorganismen sind im Handbuch "Manual of Methods für General Bacteriology" der American Society für Bacteriology (Washington D. C, USA, 1981) enthalten.The culture medium to be used has to meet the requirements of the respective strains in a suitable manner. Descriptions of culture media of various microorganisms are contained in the American Society for Bacteriology's "Manual of Methods for General Bacteriology" (Washington DC, USA, 1981).
Diese erfindungsgemäß einsetzbaren Medien umfassen gewöhnlich eine oder mehrerenKoh- lenstoffquellen, Stickstoffquellen, anorganische Salze, Vitamine und/oder Spurenelemente.These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.
Bevorzugte Kohlenstoffquellen sind Zucker, wie Mono-, Di- oder Polysaccharide. Sehr gute Kohlenstoffquellen sind beispielsweise Glucose, Fructose, Mannose, Galactose, Ribose, Sorbose, Ribulose, Lactose, Maltose, Saccharose, Raffinose, Stärke oder Cellulose. Man kann Zucker auch über komplexe Verbindungen, wie Melassen, oder andere Nebenprodukte der Zucker- Raffinierung zu den Medien geben. Es kann auch vorteilhaft sein, Gemische verschiedener Kohlenstoffquellen zuzugeben. Andere mögliche Kohlenstoffquellen sind Öle und Fette wie z. B. Sojaöl. Sonnenblumenöl. Erdnußöl und Kokosfett, Fettsäuren wie z. B. Palmitinsäure, Stearinsäure oder Linolsäure, Alkohole wie z. B. Glycerin, Methanol oder Ethanol und organische Säu- ren wie z. B. Essigsäure oder Milchsäure.Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Examples of very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugar can also be added to the media via complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources. Other possible carbon sources are oils and fats such as e.g. B. Soybean oil. Sunflower oil. Peanut oil and coconut fat, fatty acids such as As palmitic acid, stearic acid or linoleic acid, alcohols such as. B. glycerol, methanol or ethanol and organic acids such as. B. acetic acid or lactic acid.
Stickstoffquellen sind gewöhnlich organische oder anorganische Stickstoffverbindungen oder Materialien, die diese Verbindungen enthalten. Beispielhafte Stickstoffquellen umfassen Ammoniak-Gas oder Ammoniumsalze, wie Ammoniumsulfat, Ammoniumchlorid, Ammoniumphosphat, Ammoniumcarbonat oder Ammoniumnitrat, Nitrate, Harnstoff, Aminosäuren oder komplexe Stickstoffquellen, wie Maisquellwasser, Sojamehl, Sojaprotein, Hefeextrakt, Fleischextrakt und andere. Die Stickstoffquellen können einzeln oder als Mischung verwendet werden.Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds. Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soy flour, soy protein, yeast extract, meat extract and others. The nitrogen sources can be used individually or as a mixture.
Anorganische Salzverbindungen, die in den Medien enthalten sein können, umfassen die Chlo- rid-, Phosphor- oder Sulfatsalze von Calcium, Magnesium, Natrium, Kobalt, Molybdän, Kalium, Mangan, Zink, Kupfer und EisenInorganic salt compounds that can be contained in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron
Als Schwefelquelle für die Herstellung von schwefelhaltigen Feinchemikalien, insbesondere von Methionin, können anorganische schwefelhaltige Verbindungen wie beispielsweise Sulfate, Sulfi- te, Dithionite, Tetrathionate, Thiosulfate, Sulfide aber auch organische Schwefelverbindungen, wie Mercaptane und Thiole, verwendet werden.Inorganic sulfur-containing compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds, such as mercaptans and thiols, can be used as the sulfur source for the production of sulfur-containing fine chemicals, in particular methionine.
Als Phosphorquelle können Phosphorsäure, Kaliumdihydrogenphosphat oder Dikaliumhydro- genphosphat oder die entsprechenden Natrium haltigen Salze verwendet werden.Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
Chelatbildner können zum Medium gegeben werden, um die Metallionen in Lösung zu halten. Besonders geeignete Chelatbildner umfassen Dihydroxyphenole, wie Catechol oder Protocate- chuat, oder organische Säuren, wie Citronensäure.Chelating agents can be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
Die erfindungsgemäß eingesetzten Fermentationsmedien enthalten üblicherweise auch andere Wachstumsfaktoren, wie Vitamine oder Wachstumsförderer, zu denen beispielsweise Biotin, Riboflavin, Thiamin, Folsäure, Nikotinsäure, Panthothenat und Pyridoxin gehören. Wachstumsfaktoren und Salze stammen häufig von komplexen Medienkomponenten, wie Hefeextrakt, Melassen, Maisquellwasser und dergleichen. Dem Kulturmedium können überdies geeignete Vorstufen zugesetzt werden. Die genaue Zusammensetzung der Medienverbindungen hängt stark vom jeweiligen Experiment ab und wird für jeden spezifischen Fall individuell entschieden. Information über die Medienoptimierung ist erhältlich aus dem Lehrbuch "Applied Microbiol. Physiologe A Practical Approach" (Hrsg. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) S. 53-73, ISBN 0 19 9635773). Wachstumsmedien lassen sich auch von kommerziellen Anbietern beziehen, wie Standard 1 (Merck) oder BHI (Brain heart infusion, DIFCO) und dergleichen.The fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine. Growth factors and salts often come from complex media components such as yeast extract, molasses, corn steep liquor and the like. Suitable precursors can also be added to the culture medium. The exact composition of the media connections strongly depends on the respective experiment and is decided individually for each specific case. Information on media optimization is available from the textbook "Applied Microbiol. Physiologe A Practical Approach" (ed. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 9635773). Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.
Sämtliche Medienkomponenten werden, entweder durch Hitze (20 min bei 1,5 bar und 121 °C) oder durch Sterilfiltration, sterilisiert. Die Komponenten können entweder zusammen oder nötigenfalls getrennt sterilisiert werden. Sämtliche Medienkomponenten können zu Beginn der Anzucht zugegen sein oder wahlfrei kontinuierlich oder chargenweise hinzugegeben werden.All media components are sterilized either by heat (20 min at 1.5 bar and 121 ° C) or by sterile filtration. The components can be sterilized either together or, if necessary, separately. All media components can be present at the beginning of the cultivation or optionally added continuously or in batches.
Die Temperatur der Kultur liegt normalerweise zwischen 15°C und 45°C, vorzugsweise bei 25°C bis 40°C und kann während des Experimentes konstant gehalten oder verändert werden. Der pH-Wert des Mediums sollte im Bereich von 5 bis 8,5, vorzugsweise um 7,0 liegen. Der pH-Wert für die Anzucht läßt sich während der Anzucht durch Zugabe von basische Verbindungen wie Natriumhydroxid, Kaliumhydroxid, Ammoniak bzw. Ammoniakwasser oder saure Verbindungen wie Phosphorsäure oder Schwefelsäure kontrollieren. Zur Kontrolle der Schaumentwicklung können Antischaummitte.l wie z. B. Fettsäurepolyglykolester, eingesetzt werden. Zur Aufrechterhaltung der Stabilität von Plasmiden können dem Medium geeignete selektiv wirkende Stoffe, wie z. B. Antibiotika, hinzugefügt werden. Um aerobe Bedingungen aufrechtzuerhalten, werden Sauerstoff oder Sauerstoff haltige Gasmischungen, wie z. B. Umgebungsluft, in die Kultur eingetragen. Die Temperatur der Kultur liegt normalerweise bei 20°C bis 45°C. Die Kultur wird solange fortgesetzt, bis sich ein Maximum des gewünschten Produktes gebildet hat. Dieses Ziel wird normalerweise innerhalb von 10 Stunden bis 160 Stunden erreicht.The temperature of the culture is normally between 15 ° C and 45 ° C, preferably 25 ° C to 40 ° C and can be kept constant or changed during the experiment. The pH of the medium should be in the range from 5 to 8.5, preferably around 7.0. The pH for cultivation can be checked during the cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid. To check the development of foam, Antschaummitte.l such. B. fatty acid polyglycol esters can be used. In order to maintain the stability of plasmids, suitable selectively acting substances, such as, for. B. antibiotics. In order to maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as e.g. B. ambient air, entered in the culture. The temperature of the culture is usually 20 ° C to 45 ° C. The culture is continued until a maximum of the desired product has formed. This goal is usually achieved within 10 hours to 160 hours.
Die so erhaltenen, insbesondere L-Methionin enthaltenden, Fermentationsbrühen haben üblicherweise eine Trockenmasse von 7,5 bis 25 Gew.-%. Vorteilhaft ist außerdem auch, wenn die Fermentation zumindest am Ende, insbesondere jedoch über mindestens 30% der Fermentationsdauer zuckerlimitiert gefahren wird. Das heißt, dass während dieser Zeit die Konzentration an verwertbarem Zucker im Fermentationsmedium auf >0 bis 3 g/l gehalten, beziehungsweise abgesenkt wird.The fermentation broths obtained in this way, in particular containing L-methionine, usually have a dry matter of 7.5 to 25% by weight. It is also advantageous if the fermentation is carried out with limited sugar at least at the end, but in particular for at least 30% of the fermentation period. This means that the concentration of usable sugar in the fermentation medium is kept to> 0 to 3 g / l or reduced during this time.
Die Fermentationsbrühe wird anschließend weiterverarbeitet. Je nach Anforderung kann die Biomasse ganz oder teilweise durch Separationsmethoden, wie z. B. Zentrifugation, Filtration, Dekantieren oder einer Kombination dieser Methoden aus der Fermentationsbrühe entfernt oder vollständig in ihr belassen werden.The fermentation broth is then processed further. Depending on the requirements, the biomass can be wholly or partially separated by methods such as. B. centrifugation, filtration, decanting or a combination of these methods from the fermentation broth or completely left in it.
Anschließend kann die Fermentationsbrühe mit bekannten Methoden, wie z. B. mit Hilfe eines Rotationsverdampfers, Dünnschichtverdampfers, Fallfilmverdampfers, durch Umkehrosmose, oder durch Nanofiltration, eingedickt beziehungsweise aufkonzentriert werden. Diese aufkon- zentrierte Fermentationsbrühe kann anschließend durch Gefriertrocknung, Sprühtrocknung, Sprühgranulation oder durch anderweitige Verfahren aufgearbeitet werden.The fermentation broth can then be prepared using known methods, such as, for. B. with the help of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or concentrated. This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.
Es ist aber auch möglich die schwefelhaltigen Feinchemikalien, insbesonder L-Methionin, weiter aufzureinigen. Hierzu wird die produkthaltige Brühe nach dem Abtrennen der Biomasse einer Chromatographie mit einem geeigneten Harz unterworfen, wobei das gewünschte Produkt oder die Verunreinigungen ganz oder teilweise auf dem Chromatographieharz zurückgehalten werden. Diese Chromatographieschritte können nötigenfalls wiederholt werden, wobei die gleichen oder andere Chromatographieharze verwendet werden. Der Fachmann ist in der Auswahl der geeigneten Chromatographieharze und ihrer wirksamsten Anwendung bewandert. Das gereinig- te Produkt kann durch Filtration oder Ultrafiltration konzentriert und bei einer Temperatur aufbewahrt werden, bei der die Stabilität des Produktes maximal ist.However, it is also possible to further purify the sulfur-containing fine chemicals, especially L-methionine. For this purpose, the product-containing broth is subjected to chromatography with a suitable resin after the biomass has been separated off, the desired product or the impurities being wholly or partly retained on the chromatography resin. These chromatography steps can be repeated if necessary using the same or different chromatography resins. The person skilled in the art is skilled in the selection of the suitable chromatography resins and their most effective application. The cleaned product can be concentrated by filtration or ultrafiltration and kept at a temperature at which the stability of the product is at a maximum.
Die Identität und Reinheit der isolierten Verbindung(en) kann durch Techniken des Standes der Technik bestimmt werden. Diese umfassen Hochleistungs-Flüssigkeitschromatographie (HPLC), spektroskopische Verfahren, Färbeverfahren, Dünnschichtchromatographie, NIRS, Enzymtest oder mikrobiologische Tests. Diese Analyseverfahren sind zusammengefaßt in: Patek et al. (1994) Appl. Environ. Microbiol. 60:133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; und Schmidt etal. (1998) Bioprocess Engineer. 19:67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Bd. A27, VCH: Weinheim, S. 89-90, S.521-540, S. 540-547, S.559-566, 575- 581 und S. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistryand Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Bioche- mistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Bd. 17.The identity and purity of the isolated compound (s) can be determined by prior art techniques. These include high-performance liquid chromatography (HPLC), spectroscopic methods, staining methods, thin-layer chromatography, NIRS, enzyme tests or microbiological tests. These analysis methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp. 559-566, 575-581 and pp. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in Bioche- mistry in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17.
Die Erfindung wird nun anhand der folgenden nicht-limitierenden Beispiele und unter Bezugnahme auf beiliegende Figuren näher beschrieben. Dabei zeigtThe invention will now be described in more detail using the following non-limiting examples and with reference to the accompanying figures. It shows
Figur 1 die Plasmidkarte zu Plasmid pClysC; Figur 2 die Plasmidkarte zu Plasmid pCISIysCthr311ile; Figur 3 die Plasmidkarte zu Plasmid pC_metA_Cd.1 shows the plasmid map for plasmid pClysC; FIG. 2 shows the plasmid map for plasmid pCISIysCthr311ile; Figure 3 shows the plasmid map for plasmid pC_metA_Cd.
Restriktionsschnittstellen mit der entsprechenden Positionsangabe in Klammern sind in den Plasmidkarten angegeben. Wesentliche Sequenzabschnitte sind fettgedruckt beschrieben. KanR steht für Kanamycin-Restistenzgen; ask steht für Aspartatkinasegen.Restriction interfaces with the corresponding position in brackets are shown in the plasmid maps. Significant sequence sections are described in bold. KanR stands for Kanamycin resistance gene; ask stands for aspartate kinase gene.
Beispiel 1: Konstruktion von pCLiK5MCSExample 1: Construction of pCLiK5MCS
Zunächst wurden Ampicillinresistenz und Replikationsursprung des Vektors pBR322 mit den Oligonukleotiden p1.3 (SEQ ID NO:47) und p2.3 (SEQ ID NO:48) mit Hilfe der Polymerase- Kettenreaktion (PCR) amplifiziert.First, ampicillin resistance and origin of replication of the vector pBR322 with the oligonucleotides p1.3 (SEQ ID NO: 47) and p2.3 (SEQ ID NO: 48) were amplified using the polymerase chain reaction (PCR).
p1.3 (SEQ ID O:47)p1.3 (SEQ ID O: 47)
5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACAG-3'5'-CCCGGGATCCGCTAGCGGCGCGCCGGCCGGCCCGGTGTGAAATACCGCACAG-3 '
p2.3 (SEQ ID NO:48) 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTCG-3'p2.3 (SEQ ID NO: 48) 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTCG-3 '
Neben den zu pBR322 komplementären Sequenzen, enthält das Oligonukleotid p1.3 (SEQ ID NO:47) in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Smal, BamHI, Nhel und Ascl und das Oligonukleotid p2.3 (SEQ ID NO:48) in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Xbal, Xhol, Notl und Dral. Die PCR Reaktion wurde nach Stan- dardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,1 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Die stumpfen Enden des DNA-Fragmentes wurden mit dem Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers miteinander ligiert und der Ligationsan- satz nach Standardmethoden wie in Sambrook etal. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.In addition to the sequences complementary to pBR322, the oligonucleotide p1.3 (SEQ ID NO: 47) contains in 5'-3 'direction the interfaces for the restriction endonucleases Smal, BamHI, Nhel and Ascl and the oligonucleotide p2.3 (SEQ ID NO: 48) in 5'-3 'direction the interfaces for the restriction endonucleases Xbal, Xhol, Notl and Dral. The PCR reaction was carried out according to the standard method as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA). The resulting DNA fragment with a size of approximately 2.1 kb was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The blunt ends of the DNA fragment were ligated together using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation set according to standard methods as in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing ampicillin (50 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiKI .The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is named pCLiKI.
Ausgehend vom Plasmid pWLTI (Liebl et al., 1992) als Template für eine PCR Reaktion wurde mit den Oligonukleotiden neol (SEQ ID NO:49) und neo2 (SEQ ID NO:50) eine Kanamycin- Resistenzcassette amplifiziert.Starting from the plasmid pWLTI (Liebl et al., 1992) as a template for a PCR reaction, a kanamycin resistance cassette was amplified with the oligonucleotides neol (SEQ ID NO: 49) and neo2 (SEQ ID NO: 50).
neol (SEQ ID NO:49): 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-3* neol (SEQ ID NO: 49): 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-3 *
neo2 (SEQ ID NO:50): 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3'neo2 (SEQ ID NO: 50): 5'-GAGAGGCGCGCCGCTAGCGTGGGCGAAGAACTCCAGCA-3 '
Neben den zu pWLTI komplementären Sequenzen, enthält das Oligonukleotid neol in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Xbal, Smal, BamHI, Nhel und das Oligonukleotid neo2 (SEQ ID NO:50) in 5'-3' Richtung die Schnittstellen für die Restriktionsendonukleasen Ascl und Nhel. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 1 ,3 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (A- mersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit den Restriktionsendonukleasen Xbal und Ascl (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiKI wurde ebenfalls mit den Restriktionsendonukleasen Xbal und Ascl geschnitten und mit alkalischer Phosphatase (Röche Diagnostics, Mannheim) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2, 1 kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharma- cia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrie- ben(1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Ampicillin (50μg/ml) und Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.In addition to the sequences complementary to pWLTI, the oligonucleotide neol in the 5'-3 'direction contains the interfaces for the restriction endonucleases Xbal, Smal, BamHI, Nhel and the oligonucleotide neo2 (SEQ ID NO: 50) in the 5'-3' direction for the restriction endonucleases Ascl and Nhel. The PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA). The DNA fragment with a size of approximately 1.3 kb was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The DNA fragment was cut with the restriction endonucleases Xbal and Ascl (New England Biolabs, Beverly, USA) and then purified again with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The vector pCLiKI was also cut with the restriction endonucleases Xbal and Ascl and dephosphorylated with alkaline phosphatase (Röche Diagnostics, Mannheim) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.1 kb) was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharma, Freiburg) according to the manufacturer's instructions. This vector fragment was prepared using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer ligated the cut PCR fragment and the ligation approach according to standard methods as in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar (Lennox, 1955, Virology, 1: 190) containing ampicillin (50 μg / ml) and kanamycin (20 μg / ml).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK2.The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is named pCLiK2.
Der Vektor pCLiK2 wurde mit der Restriktionsendonuklease Dral (New England Biolabs, Beverly, USA) geschnitten. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde ein ca. 2,3 kb großes Vektorfragment mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers religiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben (1989)), in kompetente E.coli XL- 1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Viro- logy, 1:190) erreicht.The vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, an approximately 2.3 kb vector fragment was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK3.The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is named pCLiK3.
Ausgehend vom Plasmid pWLQ2 (Liebl et al., 1992) als Template für eine PCR Reaktion wurde mit den Oligonukleotiden cg1 ((SEQ ID NO:51) und cg2 (SEQ ID NO:52) der Replikation- sursprung pHM1519 amplifiziert.Starting from the plasmid pWLQ2 (Liebl et al., 1992) as a template for a PCR reaction, the replication origin pHM1519 was amplified with the oligonucleotides cg1 ((SEQ ID NO: 51) and cg2 (SEQ ID NO: 52).
cg1 (SEQ ID NO:51):cg1 (SEQ ID NO: 51):
5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-3'5'-GAGAGGGCGGCCGCGCAAAGTCCCGCTTCGTGAA-3 '
cg2 (SEQ ID NO:52):cg2 (SEQ ID NO: 52):
5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3'5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3 '
Neben den zu pWLQ2 komplementären Sequenzen, enthalten die Oligonukleotide cg1 (SEQ ID NO:51 ) und cg2 (SEQ ID NO:52) Schnittstellen für die Restriktionsendonuklease Notl. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 2,7 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit der Restriktionsendonuklease Notl (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Der Vektor pCLiK3 wurde ebenfalls mit der Restriktionsendonuklease Notl geschnitten und mit alkalischer Phosphatase (Röche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 2,3kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor- Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach An- gaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.In addition to the sequences complementary to pWLQ2, the oligonucleotides contain cg1 (SEQ ID NO: 51) and cg2 (SEQ ID NO: 52) interfaces for the restriction endonuclease Notl. The PCR reaction was carried out according to the standard method as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA). The resulting DNA fragment with a size of approximately 2.7 kb was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and then purified again with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The vector pCLiK3 was also cut with the restriction endonuclease Not1 and dephosphorylated with alkaline phosphatase (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.3 kb) was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions with the cut PCR fragment and the ligation approach was performed according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5.The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is given the name pCLiK5.
Für die Erweiterung von pCLikδ um eine „multiple cloning site" (MCS) wurden die beide synthetischen, weitestgehend komplementären Oligonukleotide HS445 ((SEQ ID NO:53) und HS446 (SEQ ID NO:54), die Schnittstellen für die Restriktionsendonukleasen Swal, Xhol, Aatl, Apal, Asp718, Mlul, Ndel, Spei, EcoRV, Sall, Clal, BamHI, Xbal und Smal enthalten, durch gemeinsames erhitzen auf 95°C und langsames abkühlen zu einem doppelsträngigen DNA-Fragment vereinigt.For the expansion of pCLikδ by a “multiple cloning site” (MCS), the two synthetic, largely complementary oligonucleotides HS445 ((SEQ ID NO: 53) and HS446 (SEQ ID NO: 54), the interfaces for the restriction endonucleases Swal, Xhol , Aatl, Apal, Asp718, Mlul, Ndel, Spei, EcoRV, Sall, Clal, BamHI, Xbal and Smal, combined by heating to 95 ° C. and slowly cooling to a double-stranded DNA fragment.
HS445 (SEQ ID NO:53):HS445 (SEQ ID NO: 53):
5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATATGACTAG TTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCTGCGTTAATTAACAATTGGGATCC TCTAGACCCGGGATTTAAAT-3' HS446 (SEQ ID NO:54):5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATATGACTAG TTCGGACCTAGGGATATCGTCGACATCGATGCTCTTCTGCGTTAATTAACAATTGGGATCC TCTAGACCCGGGATTTAAAT-3 ' HS446 (SEQ ID NO: 54):
5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAGCATCGA TGTCGACGATATCCCTAGGTCCGAACTAGTCATATGACGCGTGGTACCGGGCCCGACGTC AGGCCTCTCGAGATTTAAAT-3'5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAGCATCGA TGTCGACGATATCCCTAGGTCCGAACTAGTCATATGACGCGTGGTACCGGGCCCGACGTC AGGCCTCTCGAGATTTAAAT-3 '
Der Vektor pCLiK5 wurde mit den Restriktionsendonuklease Xhol und BamHI (New England Biolabs, Beverly, USA) geschnitten und mit alkalischer Phosphatase (I (Röche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde der linearisierte Vektor (ca. 5,0 kb) mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem synthetischen Doppelsträngigen DNA- Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.The vector pCLiK5 was cut with the restriction endonuclease Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 5.0 kb) was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions with the synthetic double-stranded DNA fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5MCS.The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is called pCLiK5MCS.
Sequenzierungsreaktionen wurden nach Sangeret al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weiterstadt).
Das entstandene Plasmid pCLiK5MCS ist als SEQ ID NO: 57 aufgeführt.The resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 57.
Beispiel 2: Konstruktion von pCLiK5MCS integrativ sacBExample 2: Construction of pCLiK5MCS integrative sacB
Ausgehend vom Plasmid pK19mob (Schäfer etal., Gene 145,69-73(1994)) als Template für eine PCR Reaktion wurde mit den Oligonukleotiden BK1732 und BK1733 das Bacillus subtilis sacB Gen (kodierend für Levan Sucrase) amplifiziert.Starting from the plasmid pK19mob (Schäfer et al., Gene 145, 69-73 (1994)) as a template for a PCR reaction, the Bacillus subtilis sacB gene (coding for Levan sucrase) was amplified with the oligonucleotides BK1732 and BK1733.
BK1732 (SEQ ID NO:55):BK1732 (SEQ ID NO: 55):
5'-GAGAGCGGCCGCCGATCCTTTTTAACCCATCAC-3' BK1733 (SEQ ID NO:56): 5'-AGGAGCGGCCGCCATCGGCATTTTCTTTTGCG-3'5'-GAGAGCGGCCGCCGATCCTTTTTAACCCATCAC-3 ' BK1733 (SEQ ID NO: 56): 5'-AGGAGCGGCCGCCATCGGCATTTTCTTTTGCG-3 '
Neben den zu pEK19mobsac komplementären Sequenzen, enthalten die Oligonukleotide BK1732 und BK1733 Schnittstellen für die Restriktionsendonuklease Notl. Die PCR Reaktion wurde nach Standardmethode wie Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) mit PfuTurbo Polymerase (Stratagene, La Jolla, USA) durchgeführt. Das erhaltene DNA Fragment mit einer Größe von ungefähr 1 ,9 kb wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Das DNA-Fragment wurde mit der Restriktionsendonuklease Notl (New England Biolabs, Beverly, USA) geschnitten und im Anschluß daran erneut mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt.In addition to the sequences complementary to pEK19mobsac, the oligonucleotides BK1732 and BK1733 contain interfaces for the restriction endonuclease Notl. The PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA). The DNA fragment with a size of approximately 1.9 kb obtained was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. The DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and then purified again with the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
Der Vektor pCLiK5MCS (hergestellt gemäß Beispiel 1 ) wurde ebenfalls mit der Restriktionsendonuklease Notl geschnitten und mit alkalischer Phosphatase (I (Röche Diagnostics, Mannheim)) nach Angaben des Herstellers dephosphoryliert. Nach Elektrophorese in einem 0,8%igen Agarosegel wurde ein ungefähr 2,4 kb großes Vektorfragment mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Dieses Vektor-Fragment wurde mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers mit dem geschnittenen PCR Fragment ligiert und der Ligationsansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben^ 989)), in kompetente E.coli XL-1 Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.The vector pCLiK5MCS (produced according to Example 1) was also cut with the restriction endonuclease Not1 and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, an approximately 2.4 kb vector fragment was isolated using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described ^ 989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Plasmid-DNA eines individuellen Klons wurde mit dem Qiaprep Spin Miniprep Kit (Qiagen, Hilden) nach Angaben des Herstellers isoliert und über Restriktionsverdaus überprüft. Das so erhaltene Plasmid erhält den Namen pCLiK5MCS integrativ sacB.The plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion. The plasmid obtained in this way is given the name pCLiK5MCS integrative sacB.
Sequenzierungsreaktionen wurden nach Sangeret al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weiterstadt).
Das entstandene Plasmid pCLiK5MCS integrativ sacB ist als SEQ ID NO: 58 aufgeführt. Weitere Vektoren die zurerfindungsgemäßen Expression oder Überproduktion von metA-Genen geeignet sind, können in analoger Weise herstellt werden.The resulting plasmid pCLiK5MCS integrative sacB is listed as SEQ ID NO: 58. Further vectors which are suitable for the expression or overproduction of metA genes according to the invention can be prepared in an analogous manner.
Beispiel 3: Isolierung des lysC Gens aus dem C. glutamicum Stamm LU1479Example 3: Isolation of the lysC gene from the C. glutamicum strain LU1479
Im ersten Schritt der Stammkonstruktion soll ein allelischer Austausch des lysC Wildtypgens, kodierend für das Enzym Aspartatkinase, in C. glutamicum ATCC13032, im folgenden LU1479 genannt, durchgeführt werden. Dabei soll im LysC Gen ein Nukleotidaustausch durchgeführt werden, so dass im resultierenden Protein die Aminosäure Thr an der Position 311 durch die Aminosäure lle ausgetauscht ist.In the first step of the strain construction, an allelic exchange of the lysC wild-type gene coding for the enzyme aspartate kinase in C. glutamicum ATCC13032, hereinafter referred to as LU1479, is to be carried out. A nucleotide exchange is to be carried out in the LysC gene so that the amino acid Thr at position 311 in the resulting protein is replaced by the amino acid III.
Ausgehend von der chromosomalen DNA aus LU1479 als Template für eine PCR Reaktion wurde mit den Oligonukleotidprimem SEQ ID NO:59 und SEQ ID NO:60 lysC mit Hilfe des Pfu- Turbo PCR Systems (Stratagene USA) nach Angaben des Herstellers amplifiziert. Chromosomale DNA aus C. glutamicum ATCC 13032 wurde nach Tauch etal. (199δ) Plasmid 33:168- 179 oder Eikmanns et al. (1994) Microbiology 140:1817-1828 präpariert. Das amplifizierte Fragment wird an seinem 5'-Ende von einem Sall Restriktionsschnitt und an seinem 3'-Ende von einem Mlul Restriktionsschnitt flankiert. Vor der Klonierung wurde das amplifizierte Fragment durch diese beiden Restriktionsenzyme verdaut und mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aufgereinigt.Based on the chromosomal DNA from LU1479 as a template for a PCR reaction, the oligonucleotide primers SEQ ID NO: 59 and SEQ ID NO: 60 were used to amplify lysC using the Pfu-Turbo PCR system (Stratagene USA) according to the manufacturer. Chromosomal DNA from C. glutamicum ATCC 13032 was according to Tauch et al. (199δ) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. The amplified fragment is flanked at its 5 'end by a Sall restriction cut and at its 3' end by a Mlul restriction cut. Before cloning, the amplified fragment was digested by these two restriction enzymes and purified using GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
SEQ ID NO:59SEQ ID NO: 59
5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC -3'5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC -3 '
SEQ ID NO:60 δ'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3'SEQ ID NO: 60 δ'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3 '
Das erhaltenen Polynukleotid wurde über die Sall und Mlul Restriktionsschnitte in pCLIK5 MCS integrativ SacB (im folgenden pCIS genannt; SEQ ID NO: 58 aus Beispiel 2) kloniert und in E.coli XL-1 blue transformiert. Eine Selektion auf Plasmid-tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml)-haltigen LB Agar (Lennox, 195δ, Virology, 1:190) erreicht. Das Plasmid wurden isoliert und durch Sequenzierung die erwartete Nukleotidsequenz bestätigt. Die Präparation der Plasmid-DNA wurde nach Methoden und mit Materialien der Firma Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74:5463-6467 durchgeführt. Die Sequenzier- reaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet. Das erhaltene Plasmid pCIS lysC ist als SEQ ID NO:61 aufgeführt. Die entsprechende Plasmidkarte ist in Figur 1 dargestellt.The polynucleotide obtained was cloned integrally via the Sall and Mlul restriction sections into pCLIK5 MCS SacB (hereinafter referred to as pCIS; SEQ ID NO: 58 from Example 2) and transformed into E.coli XL-1 blue. Selection for plasmid-carrying cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 195δ, Virology, 1: 190). The plasmid was isolated and the expected nucleotide sequence was confirmed by sequencing. The plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-6467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weiterstadt). The plasmid pCIS lysC obtained is listed as SEQ ID NO: 61. The corresponding plasmid map is shown in Figure 1.
Die Sequenz SEQ ID NO:61 umfasst die folgenden wesentlichen Teilbereiche:The sequence SEQ ID NO: 61 comprises the following essential sub-areas:
LOCUS pCISMysC 5860 bp DNA circular FEATURES Location/QualifiersLOCUS pCISMysC 5860 bp DNA circular FEATURES Location / Qualifiers
CDS1) 1δδ..1420CDS 1) 1δδ..1420
/vntifkey="4" /label=iysC/ vntifkey = "4" / label = iysC
CDS complement2)(393δ..δ3δ6)CDS complement 2) (393δ..δ3δ6)
/vntifkey="4"/ Vntifkey = "4"
/label=sacB\(Bacillus\subtilis) Promoter complement(δ3δ7..δ819) /vntifkey="30"/ label = sacB \ (Bacillus \ subtilis) Promoter complement (δ3δ7..δ819) / vntifkey = "30"
/label=Promotor\sacB C_region complement(3913..3934) /vntifkey="2"/ label = promoter \ sacB C_region complement (3913..3934) / vntifkey = "2"
/label=sacB\downstreambereich CDS 1974..2766/ label = sacB \ downstream area CDS 1974..2766
/vntifkey="4" /label=Kan\R CDS complement(3032..3892)/ vntifkey = "4" / label = Kan \ R CDS complement (3032..3892)
/vntifkey="4" /label=Ori\-EC\(pMB)/ vntifkey = "4" / label = Ori \ -EC \ (pMB)
1) kodierende Sequenz 1) coding sequence
2) auf Komplementärstrang 2) on complementary strand
Beispiel 4: Mutagenese des lysC Gens aus C. glutamicumExample 4: Mutagenesis of the lysC gene from C. glutamicum
Die gerichtete Mutagenese des lysC Gens aus C. glutamicum (Beispiel 3) wurde mit dem QuickChange Kit (Fa. Stratagene/USA) nach Angaben des Herstellers durchgeführt. Die Mutagenese wurde im Plasmid pCIS lysC, SEQ ID NO:61 durchgeführt. Für den Austausch von thr311 nach 311ile mit Hilfe der Quickchange Methode (Stratagene) wurden folgende Oligo- nukleotidprimer synthetisiertThe directed mutagenesis of the lysC gene from C. glutamicum (Example 3) was carried out using the QuickChange Kit (from Stratagene / USA) according to the manufacturer's instructions. The mutagenesis was carried out in the plasmid pCIS lysC, SEQ ID NO: 61. The following oligonucleotide primers were synthesized for the exchange of thr311 after 311ile using the Quickchange method (Stratagene)
SEQ ID NO:62 δ'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG -3' SEQ ID NO:63 δ'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG -3'SEQ ID NO: 62 δ'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG -3 ' SEQ ID NO: 63 δ'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG -3 '
Der Einsatz dieser Oligonukleotidprimer in der Quickchange Reaktion führt in dem lysC Gen zu einem Austausch des Nukleotids in Position 932 (von C nach T) (vgl. SEQ ID NO:64) und im korrespondierenden Enzym zu einem Aminosäuresubstitution in Position 311 (Thr->lle) (vgl. SEQ ID NO:6δ). Der resultierende Aminosäureaustausch Thr311 lle im lysC Gen wurde nach Transformation in E.coli XL1-blue und Plasmidpräparation durch Sequenzierung bestätigt. Das Plasmid erhielt die Bezeichnung pCIS lysC thr311 ile und ist als SEQ ID NO:66 aufgeführt. Die entsprechende Plasmidkarte ist in Figur 2 dargestellt.The use of these oligonucleotide primers in the Quickchange reaction leads to an exchange of the nucleotide in position 932 (from C to T) in the lysC gene (see SEQ ID NO: 64) and in the corresponding enzyme to an amino acid substitution in position 311 (Thr-> lle) (see SEQ ID NO: 6δ). The resulting amino acid exchange Thr311Ile in the lysC gene was confirmed by sequencing after transformation into E.coli XL1-blue and plasmid preparation. The plasmid was named pCIS lysC thr311 ile and is listed as SEQ ID NO: 66. The corresponding plasmid map is shown in Figure 2.
Die Sequenz SEQ ID NO:66 umfasst die folgenden wesentlichen Teilbereiche:The sequence SEQ ID NO: 66 comprises the following essential sub-areas:
LOCUS pCIS\lysC\thr311 ile 5860 bp DNA circular FEATURES Location/QualifiersLOCUS pCIS \ lysC \ thr311 ile 5860 bp DNA circular FEATURES Location / Qualifiers
CDS1) 156..1420CDS 1) 156..1420
/vntifkey="4" /labe ysC/ vntifkey = "4" / labe ysC
CDS complement2)(393δ..63δ6)CDS complement 2) (393δ..63δ6)
/vntifkey="4"/ Vntifkey = "4"
/label=sacB\(Bacillus\subtilis) Promoter complement(δ357..δ819) /vntifkey="30"/ label = sacB \ (Bacillus \ subtilis) Promoter complement (δ357..δ819) / vntifkey = "30"
/label=Promotor\sacB C_region complement(3913..3934) /vntifkey="2"/ label = promoter \ sacB C_region complement (3913..3934) / vntifkey = "2"
/label=sacB\downstreambereich CDS 1974..2766/ label = sacB \ downstream area CDS 1974..2766
/vntifkey="4" /label=Kan\R CDS complement(3032..3892)/ vntifkey = "4" / label = Kan \ R CDS complement (3032..3892)
/vntifkey="4" /label=Ori\-EC\(pMB)/ vntifkey = "4" / label = Ori \ -EC \ (pMB)
1) kodierende Sequenz 1) coding sequence
2) auf Komplementärstrang Das Plasmid pCIS lysC thr311ile wurde in C. glutamicum LU1479 mittels Elektroporation wie bei Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303 beschrieben, transformiert. Modifikationen des Protokolls sind in DE-A-10046870 beschrieben. Die chromosomale Anordnung des lysC-Lokus einzelner Transformanten wurde mit Standardmethoden durch Southemblot und Hybridisierung, wie in Sambrook et al. (1989), Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben, überprüft. Dadurch wurde sichergestellt, dass es sich bei den Transformanten um solche handelt, die das transformierte Plasmid durch homologe Rekombination am lysC-Lokus integriert haben. Nach Wachstum solcher Kolonien über Nacht in Medien, die kein Antibiotikum enthielten, wurden die Zellen auf ein Saccharose-CM-Agarmedium (10% Saccharose) ausplattiert und bei 30CC für 24 Stunden inkubiert. 2) on complementary strand The plasmid pCIS lysC thr311ile was electroporated into C. glutamicum LU1479 as described in Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303. Modifications to the protocol are described in DE-A-10046870. The chromosomal arrangement of the lysC locus of individual transformants was determined using standard methods by Southemblot and hybridization, as described in Sambrook et al. (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor. This ensured that the transformants are those which have integrated the transformed plasmid by homologous recombination at the lysC locus. After growth of such colonies overnight in media containing no antibiotic, the cells were plated on a sucrose CM agar medium (10% sucrose) and incubated at 30 ° C. for 24 hours.
Da das im Vektor pCIS lysC thr311ile enthaltende sacB Gen Saccharose in ein toxisches Produkt umwandelt, können nur solche Kolonien anwachsen, die das sacB Gen durch einen zweiten homologen Rekombinationsschritt zwischen dem Wildtyp lysC Gen und dem mutierten Gen lysC thr311 ile deletiert haben. Während der homologen Rekombination kann entweder das Wild- typ Gen oder das mutierte Gen zusammen mit dem sacB Gen deletiert werden. Wenn das sacB Gen zusammen mit dem Wildtyp Gen entfernt wird, resultiert eine mutierte Transformante.Since the sacB gene contained in the vector pCIS lysC thr311ile converts sucrose into a toxic product, only those colonies can grow which have deleted the sacB gene by a second homologous recombination step between the wild-type lysC gene and the mutated lysC thr311 ile gene. During the homologous recombination, either the wild-type gene or the mutated gene can be deleted together with the sacB gene. If the sacB gene is removed together with the wild-type gene, a mutant transformant results.
Anwachsende Kolonien wurden gepickt, und auf eine Kanamycin-sensitiven Phänotyp hin untersucht. Klone mit deletiertem SacB Gen müssen gleichzeitg Kanamycin-sensitives Wachstums- verhalten zeigen. Solche Kan-sensitiven Klone wurde im einem Schüttelkolben auf ihre Lysin- Produktivität hin untersucht (siehe Beispiel 6). Zum Vergleich wurde der nichtbehandelte Stamm LU 1479 angezogen. Klone mit einer gegenüber der Kontrolle erhöhten Lysin-Produktion wurden selektiert, chromosomale DNA wurde gewonnen und der entsprechende Bereich des lysC Gens wurde durch eine PCR-Reaktion amplifiziert und sequenziert. Ein solcher Klon mit der Eigen- schaff erhöhter Lysin-Synthese und nachgewiesener Mutation in lysC an der Stelle 932 wurde mit LU1479 lysC 311ile bezeichnet).Growing colonies were picked and examined for a kanamycin sensitive phenotype. Clones with a deleted SacB gene must simultaneously show kanamycin-sensitive growth behavior. Such Kan-sensitive clones were examined for their lysine productivity in a shake flask (see Example 6). The untreated LU 1479 strain was grown for comparison. Clones with an increased lysine production compared to the control were selected, chromosomal DNA was obtained and the corresponding region of the lysC gene was amplified and sequenced by a PCR reaction. Such a clone with the property of increased lysine synthesis and proven mutation in lysC at position 932 was designated LU1479 lysC 311ile).
Beispiel 5: Herstellung Ethionin-resistenter C. glutamicum StämmeExample 5: Production of C. glutamicum strains resistant to ethionine
Im zweiten Schritt der Stammkonstruktion wurde der erhaltene Stamm LU1479 lysC 311 ile (Beispiel 4) behandelt, um eine Ethionin-Resistenz (Käse, H. Nakayama K.Agr. Biol. Chem.39 153- 106 1975 L-methionine production by methionine analog-resistant mutants of Corynebacterium glutamicum) zu induzieren: Eine Übernachtkultur in BHI-Medium (Difco) wurde in Citratpuffer (50mM pH δ,δ) gewaschen und bei 30°C für 20 min mit N-Methyl-nitrosoguanidin (10mg/ml in 50mM Citrat pH5,δ) behandelt. Nach der Behandlung mit dem chemischen Mutagen N-Methyl- nitrosoguanidin wurden die Zellen gewaschen (Citratpuffer δOmM pH 5,5) und auf ein Medium plattiert, das aus folgenden Komponenten, berechnet auf 500ml, zusammengesetzt war: 10g (NH4)2SO4, 0.5g KH2PO4, 0.δg K2HP04, 0.125g MgS04.7H20, 21g MOPS, 50mg CaCI2, 15mg Proteokatechuat, 0,5mg Biotin, 1mg Thiamin, 5g/l D,L-Ethionin (Sigma Chemicals Deutschland), pH 7,0. Außerdem enthielt das Medium O.δml einer Spurensalzlösung aus: 10g/l FeS04*7H20, 1g/l MnS04Η20, 0.1 g/l ZnS04*7H20, 0.02g/l CuSO4,0.002g/l NiCI2*6H2O, Alle Salze wurden in 0,1 M HCI gelöst. Das fertig zusammengestellte Medium wurde sterilfiltriert und nach Zugabe von 40ml steriler 50% Glucoselösung, mit flüssigem sterilem Agar in einer Endkonzentration von 1,5% Agar versetzt und in Kulturschalen ausgegossen.In the second step of the strain construction, the obtained strain LU1479 lysC 311 ile (Example 4) was treated to give an ethionine resistance (cheese, H. Nakayama K.Agr. Biol. Chem. 39 153-106 1975 L-methionine production by methionine analogously -resistant mutants of Corynebacterium glutamicum): An overnight culture in BHI medium (Difco) was washed in citrate buffer (50mM pH δ, δ) and at 30 ° C for 20 min with N-methyl-nitrosoguanidine (10mg / ml in 50mM Citrate pH5, δ) treated. After treatment with the chemical mutagen N-methyl The cells were washed nitrosoguanidine (citrate buffer δOmM pH 5.5) and plated on a medium which was composed of the following components, calculated on 500 ml: 10 g (NH 4 ) 2 SO 4 , 0.5 g KH 2 PO 4 , 0.δg K 2 HP0 4 , 0.125 g MgS0 4 .7H 2 0, 21 g MOPS, 50 mg CaCl 2 , 15 mg proteocatechuate, 0.5 mg biotin, 1 mg thiamine, 5 g / l D, L-ethionine (Sigma Chemicals Germany), pH 7.0 , In addition, the medium contained O.δml of a trace salt solution of: 10g / l FeS0 4 * 7H 2 0, 1g / l MnS0 4 Η 2 0, 0.1 g / l ZnS0 4 * 7H 2 0, 0.02g / l CuSO 4, 0.002g / l NiCI 2 * 6H 2 O, all salts were dissolved in 0.1 M HCl. The completely assembled medium was sterile filtered and, after adding 40 ml of sterile 50% glucose solution, mixed with liquid sterile agar in a final concentration of 1.5% agar and poured out into culture dishes.
Auf Platten mit dem beschriebenen Medium wurden mutagenisierte Zellen aufgebracht und 3-7 Tage bei 30°C inkubiert. Erhaltene Klone wurden isoliert, mindestens einmal auf dem Selektionsmedium vereinzelt und dann auf ihre Methionin-Produktivität in einem Schüttelkolben in Medium II untersucht (siehe Beispiel 6Mutagenized cells were applied to plates with the medium described and incubated at 30 ° C. for 3-7 days. Clones obtained were isolated, isolated at least once on the selection medium and then examined for their methionine productivity in a shake flask in medium II (see Example 6
Beispiel 6: Herstellung von Methionin mit dem Stamm LU1479 lysC 311ile ET-16.Example 6: Preparation of methionine with the LU1479 lysC 311ile ET-16 strain.
Die in Beispiel 5 hergestellten Stämme wurden auf einer Agar-Platte mit CM-Medium für 2 Tag bei 30°C angezogen.The strains prepared in Example 5 were grown on an agar plate with CM medium for 2 days at 30 ° C.
CM-Agar:CM agar:
10,0 g/l D-Glucose, 2,5 g/l NaCI, 2,0 g/l Harnstoff, 10,0 g/l Bacto Pepton (Difco), 5,0 g/l Yeast Extract (Difco), 5,0 g/l Beef Extract (Difco), 22,0 g/l Agar (Difco), autoklaviert (20 min., 121 °C)10.0 g / l D-glucose, 2.5 g / l NaCI, 2.0 g / l urea, 10.0 g / l Bacto Peptone (Difco), 5.0 g / l Yeast Extract (Difco), 5.0 g / l beef extract (Difco), 22.0 g / l agar (Difco), autoclaved (20 min., 121 ° C)
Anschließend wurden die Zellen von der Platte abgekratzt und in Saline resuspendiert. Für die Hauptkultur wurden 10 ml Medium II und 0,5 g autoklaviertes CaC03 (Riedel de Haen) in einem 100 ml Erlenmeyerkolben mit der Zellsuspension bis zu einer ODδOOnm von 1 ,5 beimpft und für 72h auf einem Orbitalschüttler mit 200 Upm bei 30°C inkubiert.The cells were then scraped off the plate and resuspended in saline. For the main culture, 10 ml of Medium II and 0.5 g of autoclaved CaC0 3 (Riedel de Haen) in a 100 ml Erlenmeyer flask were inoculated with the cell suspension up to an ODδOOnm of 1.5 and for 72 hours on an orbital shaker at 200 rpm at 30 ° C incubated.
Medium II:Medium II:
40g/l Saccharose40g / l sucrose
60g/l Melasse (auf 100% Zuckergehalt berechnet)60g / l molasses (calculated on 100% sugar content)
10g/l (NH4)2S04 10g / l (NH 4 ) 2 S0 4
0.4g/l MgS04*7H200.4g / l MgS0 4 * 7H 2 0
0.6g/l KH2P04 0.3mg/l ThiaminΗCI0.6g / l KH 2 P0 4 0.3mg / l thiamineΗCI
1 mg/l Biotin (aus einer 1 mg/ml steril filtrierten Stammlösung die mit NH OH auf pH1 mg / l biotin (from a 1 mg / ml sterile filtered stock solution which is adjusted to pH with NH OH
8,0 eingestellt wurde) 2mg/l FeSO4 2mg/l MnSO4 mit NH4OH auf pH 7,8 eingestellt, autoklaviert (121 °C, 20 min). Zusätzlich wird Vitamin B12 (Hydroxycobalamin Sigma Chemicals) aus einer Stammlösung (200 μg/ml, steril filtriert) bis zu einer Endkonzentration von 100 μg/l zugegeben8.0 was adjusted) 2mg / l FeSO 4 2mg / l MnSO 4 adjusted to pH 7.8 with NH 4 OH, autoclaved (121 ° C, 20 min). In addition, vitamin B12 (hydroxycobalamin Sigma Chemicals) from a stock solution (200 μg / ml, sterile filtered) is added to a final concentration of 100 μg / l
Gebildetes Methionin, sowie andere Aminosäuren in der Kulturbrühe wurde mit Hilfe der Aminosäuresäure-Bestimmungsmethode von Agilent auf einer Agilent 1100 Series LC System HPLC. Eine Derivatisierung vor der Säulentrennung mit Ortho-Phthalaldehyd erlaubte die Quantifizierung der gebildeten Aminosäuren. Die Auftrennung des Aminosäuregemisch fand auf einer Hypersil AA-Säule (Agilent) statt.Methionine, as well as other amino acids in the culture broth, was determined using Agilent's amino acid determination method on an Agilent 1100 Series LC System HPLC. A derivatization with ortho-phthalaldehyde before the column separation allowed the quantification of the amino acids formed. The amino acid mixture was separated on a Hypersil AA column (Agilent).
Solche Klone wurden isoliert, deren Methionin-Produktivität mindestens doppelt so hoch war, wie die des Ausgangsstamm LU1479 lysC 311 ile. Ein solcher Klon wurde für die weiteren Versuche eingesetzt und bekam die Bezeichnung LU1479 lysC 311ile ET-16.Such clones were isolated whose methionine productivity was at least twice as high as that of the parent strain LU1479 lysC 311 ile. Such a clone was used for the further experiments and was named LU1479 lysC 311ile ET-16.
Beispiel 7: Klonierung von metA aus Corynebacterium diphtheriae und Klonierung in das Plasmid pC metA_CdExample 7: Cloning of metA from Corynebacterium diphtheriae and cloning into the plasmid pC metA_Cd
Chromosomale DNA von Corynebacterium diphtheriae wurde von der American Type Strain Culture Collection (ATCC, Atlanta-USA) mit der Bestellnummer 700971 D aus dem Stamm ATCC 700971 bezogen.Chromosomal DNA from Corynebacterium diphtheriae was obtained from the American Type Strain Culture Collection (ATCC, Atlanta-USA) with the order number 700971 D from the ATCC 700971 strain.
Mit den Oligonukleotidprimer SEQ ID NO: 67 und SEQ ID NO:68, derchromosomalen DNA aus C. diphtheriae als Template und Pfu Turbo Polymerase (Fa. Stratagene) wurde mit Hilfe der Po- lymerase-Kettenreaktion (PCR) nach Standardmethoden wie Innis etal. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press ein DNA Fragment von ca. 1 ,4 kb ampli- fiziert, welches das metA Gen inklusive eines nichtkodierenden 5'-Bereiches (Promotorregion) enthält. Das amplifizierte Fragment ist an seinem δ'-Ende von einer Xhol-Restriktionsschnittstelle und am 3'-Ende von einer Ndel- Restriktionsschnittstelle flankiert, welche über die Oligonukleotidprimer eingeführt wurden.With the oligonucleotide primers SEQ ID NO: 67 and SEQ ID NO: 68, the chromosomal DNA from C. diphtheriae as template and Pfu Turbo Polymerase (from Stratagene), the polymerase chain reaction (PCR) was carried out using standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of approx. 1.4 kb which contains the metA gene including a 5 'non-coding region (promoter region). The amplified fragment is flanked at its δ'-end by an Xhol restriction site and at the 3'-end by a Nel restriction site which was introduced via the oligonucleotide primers.
SEQ ID NO:67 5'-GAGACTCGAGGTTGGCTGGTCATCATAGG -3' undSEQ ID NO: 67 5'-GAGACTCGAGGTTGGCTGGTCATCATAGG -3 'and
SEQ ID NO:68 δ'-GAAGAGAGCATATGTCAGCGCTCTAGTTTGGTTC -3'SEQ ID NO: 68 δ'-GAAGAGAGCATATGTCAGCGCTCTAGTTTGGTTC -3 '
Das erhaltene DNA Fragment wurde mit dem GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) nach Angaben des Herstellers gereinigt. Im Anschluß daran wurde es mit den Restriktionsenzymen Xhol und Ndel (Röche Diagnostics, Mannheim) gespalten und gelelektrophoretisch aufgetrennt. Anschließend wurde das ca. 1 ,4 kb große DNA Frag- ment mit GFX™PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) aus der Agarose aufgereinigt.The DNA fragment obtained was purified using the GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ndel (Röche Diagnostics, Mannheim) and separated by gel electrophoresis. The approximately 1.4 kb DNA fragment was then purified from the agarose using GFX ™ PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
Der Vektor pClikδMCS SEQ ID NO: 67, im folgenden pC genannt, wurde mit den Restriktionsenzymen Xhol und Ndel (Röche Diagnostics, Mannheim) geschnitten und ein ca. 5 kb großes Fragment nach elektrophoretischer Auftrennung mit GFX™PCR, DNA and Gel Band Purification Kit isoliert.The vector pClikδMCS SEQ ID NO: 67, hereinafter called pC, was cut with the restriction enzymes Xhol and Ndel (Röche Diagnostics, Mannheim) and an approximately 5 kb fragment after electrophoretic separation with GFX ™ PCR, DNA and Gel Band Purification Kit isolated.
Das Vektorfragment wurde zusammen mit dem PCR-Fragment mit Hilfe des Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) nach Angaben des Herstellers ligiert und der Ligation- sansatz nach Standardmethoden wie in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, beschrieben(1989)), in kompetente E.coli XL-1Blue (Stratagene, La Jolla, USA) transformiert. Eine Selektion auf Plasmid tragende Zellen wurde durch das Ausplattieren auf Kanamycin (20μg/ml) haltigen LB Agar (Lennox, 1955, Virology, 1:190) erreicht.The vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 μg / ml) (Lennox, 1955, Virology, 1: 190).
Die Präparation der Plasmid DNA wurde nach Methoden und mit Materialien der Fa. Quiagen durchgeführt. Sequenzierungsreaktionen wurden nach Sanger etal. (1977) Proceedings of the National Academy of Sciences USA 74:5463-5467 durchgeführt. Die Sequenzierreaktionen wurden mittels ABI Prism 377 (PE Applied Biosystems, Weiterstadt) aufgetrennt und ausgewertet.The plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Weiterstadt).
Das entstandene Plasmid pC metA_Cd (Corynebacterium diphtheriae) ist als SEQ ID NO:69 aufgeführt. Die entsprechende Plasmidkarte ist in Figur 3 dargestellt.The resulting plasmid pC metA_Cd (Corynebacterium diphtheriae) is listed as SEQ ID NO: 69. The corresponding plasmid map is shown in Figure 3.
LOCUS pC_metA_Cd 6472 bp DNA circular FEATURES Location/Qualifiers CDS 313..1416LOCUS pC_metA_Cd 6472 bp DNA circular FEATURES Location / Qualifiers CDS 313..1416
/vntifkey="4" /label=metA\Corynebacterium\diphtheriae CDS 1838..2629/ Vntifkey = "4" / label = metA \ Corynebacterium \ diphtheriae CDS 1838..2629
/vntifkey="4"/ Vntifkey = "4"
/label=Kan\R CDS 4910..6031/ label = Kan \ R CDS 4910..6031
/vntifkey="4"/ Vntifkey = "4"
/label=Rep\Protein CDS 3902..4576/ label = Rep \ Protein CDS 3902..4576
/vntifkey="4" /label=ORF\1/ vntifkey = "4" / label = ORF \ 1
CDS complement(2896..37δ6)CDS complement (2896..37δ6)
/vntifkey="4"/ Vntifkey = "4"
/label=Ori\-EC\(pMB)/ Label = Ori \ -EC \ (pMB)
Beispiel 8: Transformation des Stammes LU1479 lysC 311 ile ET-16 mit dem Plasmid pC metA_CdExample 8: Transformation of the LU1479 lysC 311 ile ET-16 strain with the plasmid pC metA_Cd
Der Stamm LU1479 lysC 311 ile ET-16 wurde mit dem Plasmid pC metA_Cd nach der beschriebenen Methode (Liebl, et al. (1989) FEMS Microbiology Letters 53:299-303) transformiert. Die Transformationsmischung wurde auf CM-Platten plattiert, die zusätzlich 20mg/l Kanamycin enthielten, um eine Selektion auf Plasmid-haltige Zellen zu erreichen. Erhaltene Kan-resistente Klone wurden gepickt und vereinzelt. Die Methionin-Produktivität der Klone wurde in einem Schüttelkolbenversuch (s. Beispiel 6) untersucht. Der Stamm LU1479 lysC 311ile ET-16 pC metA_Cd produzierte im Vergleich zu LU1479 lysC 311ile ET-16 signifikant mehr Methionin. The LU1479 lysC 311 ile ET-16 strain was transformed with the plasmid pC metA_Cd according to the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303). The transformation mixture was plated on CM plates which additionally contained 20 mg / l kanamycin in order to achieve a selection for plasmid-containing cells. Obtained Kan-resistant clones were picked and isolated. The methionine productivity of the clones was examined in a shake flask test (see Example 6). The strain LU1479 lysC 311ile ET-16 pC metA_Cd produced significantly more methionine compared to LU1479 lysC 311ile ET-16.

Claims

Patentansprüche claims
Verfahren zur fermentativen Herstellung wenigstens einer schwefelhaltigen Feinchemikalie, welches folgende Schritte umfasst: a) Fermentation einer die gewünschte schwefelhaltige Feinchemikalie produzierenden coryneformen Bakterienkultur, wobei in den coryneformen Bakterien zumindest eine heterologe Nukleotidsequenz exprimiert wird, welche für ein Protein mit Homoserin-O-Acetyl-Transferase (metA)-Aktivität kodiert; b) Anreicherung der schwefelhaltigen Feinchemikalie im Medium oder in den Zellen der Bakterien, und c) Isolieren der schwefelhaltigen Feinchemikalie.Process for the fermentative production of at least one sulfur-containing fine chemical, which comprises the following steps: a) fermentation of a coryneform bacterial culture producing the desired sulfur-containing fine chemical, wherein at least one heterologous nucleotide sequence is expressed in the coryneform bacteria which is for a protein with homoserine-O-acetyl-transferase encodes (metA) activity; b) accumulation of the sulfur-containing fine chemical in the medium or in the cells of the bacteria, and c) isolation of the sulfur-containing fine chemical.
2. Verfahren nach Anspruch 1 , wobei die schwefelhaltige Feinchemikalie L-Methionin umfasst.2. The method of claim 1, wherein the sulfur-containing fine chemical comprises L-methionine.
Verfahren nach einem der vorhergehenden Ansprüche, wobei die heterologe metA- kodierende Nukleotidsequenz zur metA-kodierenden Sequenz aus Corynebacterium glutamicum ATCC 13032 eine Sequenzhomologie vom weniger als 100% aufweist.Method according to one of the preceding claims, wherein the heterologous metA-coding nucleotide sequence for the metA-coding sequence from Corynebacterium glutamicum ATCC 13032 has a sequence homology of less than 100%.
Verfahren nach Anspruch 3, wobei die metA-kodierende Sequenz aus einem der folgenden Organismen abgeleitet ist:The method of claim 3, wherein the metA coding sequence is derived from one of the following organisms:
Verfahren nach einem der vorhergehenden Ansprüche, wobei die metA-kodierende Sequenz eine kodierende Sequenz gemäß SEQ ID N0:1, 3, 5, Method according to one of the preceding claims, wherein the metA coding sequence is a coding sequence according to SEQ ID N0: 1, 3, 5,
7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, und 45 oder eine dazu homologe Nukleotidsequenz, welche für ein Protein mit metA-Aktivität kodiert, umfasst.7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, and 45 or a nucleotide sequence homologous thereto which is for a protein encoded with metA activity.
Verfahren nach einem der vorhergehenden Ansprüche, wobei die metA-kodierende Sequenz für ein Protein mit metA-Aktivität kodiert, wobei das Protein eine Aminosäuresequenz gemäß SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44,und 46 oder eine dazu homologe Aminosäuresequenz, welche für ein Protein mit metA-Aktivität steht, umfasst.Method according to one of the preceding claims, wherein the metA coding sequence codes for a protein with metA activity, the protein having an amino acid sequence according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, and 46 or an amino acid sequence homologous thereto, which stands for a protein with metA activity.
Verfahren nach einem der vorhergehenden Ansprüche, wobei die kodierende metA- Sequenz eine in coryneformen Bakterien replizierbare oder eine stabil in das Chromosom intregrierte DNA oder eine RNA ist.Method according to one of the preceding claims, wherein the coding metA sequence is a replicable in coryneform bacteria or a DNA or an RNA stably integrated into the chromosome.
8. Verfahren gemäß Anspruch 7, wobei man8. The method according to claim 7, wherein one
a) einen mit einem Plasmidvektor transformierten Bakterienstamm einsetzt der wenigstens eine Kopie der kodierenden metA-Sequenz unter der Kontrolle regulativer Sequenzen trägt, oder b) einen Stamm einsetzt, in dem die kodierende metA-Sequenz in das Chromosom des Bakteriums integriert wurdea) uses a bacterial strain transformed with a plasmid vector which carries at least one copy of the coding metA sequence under the control of regulatory sequences, or b) uses a strain in which the coding metA sequence has been integrated into the chromosome of the bacterium
9. Verfahren nach einem der vorhergehenden Ansprüche, wobei die kodierende metA- Sequenz überexprimiert wird.9. The method according to any one of the preceding claims, wherein the coding metA sequence is overexpressed.
10. Verfahren gemäß einem der vorhergehenden Ansprüche, wobei man Bakterien fermentiert, in denen zusätzlich wenigstens ein weiteres Gen des Biosyntheseweges der gewünschten schwefelhaltigen Feinchemikalie verstärkt ist oder derart mutiert ist, dass es durch Stoffwechselmetabolite nicht in seiner Aktivität beeinflusst wird. 10. The method according to any one of the preceding claims, wherein bacteria are fermented, in which at least one further gene of the biosynthetic pathway of the desired sulfur-containing fine chemical is reinforced or mutated in such a way that its activity is not influenced by metabolic metabolites.
11. Verfahren gemäß einem der vorhergehenden Ansprüche, wobei man Bakterien fermentiert, in denen wenigstens ein Stoffwechselweg zumindest teilweise ausgeschaltet ist, der die Bildung der gewünschten schwefelhaltigen Feinchemikalie verringert.11. The method according to any one of the preceding claims, wherein bacteria are fermented in which at least one metabolic pathway is at least partially switched off, which reduces the formation of the desired sulfur-containing fine chemical.
12. Verfahren gemäß einem der vorhergehenden Ansprüche, wobei man coryneforme Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene, ausgewählt unter12. The method according to any one of the preceding claims, wherein fermenting coryneform bacteria, in which at least one of the genes selected at the same time
a) dem für eine Aspartatkinase kodierenden Gen lysC, b) dem für die Glycerinaldehyd-3-Phosphat Dehydrogenase kodierenden Gen gap, c) dem für die 3-Phosphoglycerat Kinase kodierenden Gen pgk, d) dem für die Pyruvat Carboxylase kodierenden Gen pyc, e) dem für die Triosephosphat Isomerase kodierenden Gen tpi, f) dem für die Methylentetrahydrofolat Reduktase kodierenden Gen metF, g) dem für die Cystahionin-gamma-Synthase kodierenden Gen metB, h) dem für die Cystahionin-gamma-Lyase kodierenden Gen metC, i) dem für die Serin-Hydroxymethyltransferase kodierenden Gen glyA, j) dem für die O-Acetylhomoserin-Sulfhydrylase kodierenden Gen metY, k) dem für die Vitamin B12 abhängige Methionin-Synthase kodierenden Gen metH,a) the lysC gene coding for an aspartate kinase, b) the gap gene coding for the glyceraldehyde-3-phosphate dehydrogenase, c) the pgk gene coding for the 3-phosphoglycerate kinase, d) the pyc gene coding for the pyruvate carboxylase, e ) the tpi gene coding for the triose phosphate isomerase, f) the metF gene coding for the methylene tetrahydrofolate reductase, g) the metB gene coding for the cystahionin gamma synthase, h) the metC gene coding for the cystahionin gamma lyase, i ) the glyA gene coding for the serine hydroxymethyltransferase, j) the metY gene coding for the O-acetylhomoserine sulfhydrylase, k) the methH gene synthase coding for the vitamin B12-dependent methionine synthase,
I) dem für die Phosphoserin-Aminotransferase kodierenden gen serC, m) dem serB Gen, das für die Phosphoserin-Phosphatase kodiert, n) dem cysE Gen, das für die Serine Acetyl-Transferase kodiert, und o) dem hom Gen, das eine Homoserin-Dehydrogenase kodiert,I) the gene coding for the phosphoserine aminotransferase, m) the serB gene coding for the phosphoserine phosphatase, n) the cysE gene coding for the serine acetyl transferase, and o) the hom gene, the one Encoded homoserine dehydrogenase,
überexprimiert oder so mutiert ist, dass die korrespondierenden Proteine, verglichen mit nicht mutierten Proteinen, in geringerem Maße oder nicht durch Stoffwechselmetabolite in ihrer Aktivität beeinflusst werden.is overexpressed or mutated in such a way that the corresponding proteins, compared to non-mutated proteins, are influenced to a lesser extent or not by metabolic metabolites in their activity.
13. Verfahren gemäß einem der vorhergehenden Ansprüche, wobei man coryneformen Bakterien fermentiert, in denen gleichzeitig wenigstens eines der Gene, ausgewählt unter a) dem für die Homoserine-Kinase kodierenden Gen thrB, b) dem für die Threonin Dehydratase kodierenden Gen ilvA, c) dem für die Threonin Synthase kodierenden Gen thrC d) dem für die Meso-Diaminopimelat D-Dehydrogenase kodierenden Gen ddh e) dem für die Phosphoenolpyruvat-Carboxykinase kodierenden Gen pck, f) dem für die Glucose-6-Phosphat-6-lsomerase kodierenden Gen pgi, g) dem für die Pyruvat-Oxidase kodierenden Gen poxB, h) dem für die Dihydrodipicolinat Synthase kodiernden Gen dapA, i) dem für die Dihydrodipicolinat Reduktase kodiernden Gen dapB; oder j) dem für die Diaminopicolinat Decarboxylase kodiernden Gen13. The method according to any one of the preceding claims, wherein coryneform bacteria are fermented, in which at least one of the genes selected simultaneously from a) the gene coding for the homoserine kinase thrB, b) the gene coding for the threonine dehydratase ilvA, c) the thrC gene coding for the threonine synthase d) the gene coding for the meso-diaminopimelate D-dehydrogenase ddh e) the gene pck coding for the phosphoenolpyruvate carboxykinase, f) the gene coding for the glucose-6-phosphate-6-isomerase pgi, g) the gene poxB coding for the pyruvate oxidase, h) the gene dapA coding for the dihydrodipicolinate synthase, i) the gene dapB coding for the dihydrodipicolinate reductase; or j) the gene coding for the diaminopicolinate decarboxylase
durch Veränderung der Expressionsrate oder durch Einführung einer gezielten Mutation abschwächt ist.is weakened by changing the expression rate or by introducing a targeted mutation.
14. Verfahren gemäß einem oder mehreren der vorhergehenden Ansprüche, wobei man Mikroorganismen der Art Corynebacterium glutamicum einsetzt.14. The method according to one or more of the preceding claims, wherein microorganisms of the type Corynebacterium glutamicum are used.
15. Verfahren zur Herstellung eines L-Methionin haltigen Tierfuttermittel-Additivs aus Fermentationsbrühen, welches folgende Schritte umfasst a) Kultivierung und Fermentation eines L-Methionin produzierenden Mikroorganismus in einem Fermentationsmedium; b) Entfernung von Wasser aus der L-Methionin haltigen Fermentationsbrühe; c) Entfernung der während der Fermentation gebildeten Biomasse in einer Menge von 0 bis 100 Gew.-%; und d) Trocknung der gemäß b) und/oder c) erhaltenen Fermentationsbrühe, um das Tierfuttermittel-Additiv in der gewünschten Pulver- oder Granulatform zu erhalten.15. A method for producing an L-methionine-containing animal feed additive from fermentation broths, which comprises the following steps: a) cultivation and fermentation of a L-methionine-producing microorganism in a fermentation medium; b) removal of water from the fermentation broth containing L-methionine; c) removal of the biomass formed during the fermentation in an amount of 0 to 100% by weight; and d) drying the fermentation broth obtained according to b) and / or c) in order to obtain the animal feed additive in the desired powder or granule form.
16. Verfahren gemäß Anspruch 15, wobei man Mikroorganismen gemäß der Definition in einem der Ansprüche 1 bis 14 einsetzt. 16. The method according to claim 15, wherein one uses microorganisms as defined in any one of claims 1 to 14.
EP03794944A 2002-08-26 2003-08-26 Method for zymotic production of fine chemicals (meta) containing sulphur Withdrawn EP1537224A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10239073 2002-08-26
DE10239073A DE10239073A1 (en) 2002-08-26 2002-08-26 Fermentative production of sulfur-containing fine chemicals, useful e.g. as feed additive, by culturing bacteria containing heterologous sequence for homoserine O-acetyltransferase
PCT/EP2003/009452 WO2004024932A2 (en) 2002-08-26 2003-08-26 Method for zymotic production of fine chemicals (meta) containing sulphur

Publications (1)

Publication Number Publication Date
EP1537224A2 true EP1537224A2 (en) 2005-06-08

Family

ID=31501950

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03794944A Withdrawn EP1537224A2 (en) 2002-08-26 2003-08-26 Method for zymotic production of fine chemicals (meta) containing sulphur

Country Status (9)

Country Link
US (2) US7238502B2 (en)
EP (1) EP1537224A2 (en)
JP (1) JP2005537024A (en)
KR (1) KR20050034745A (en)
CN (1) CN100462440C (en)
AU (1) AU2003264108A1 (en)
BR (1) BR0313759A (en)
DE (1) DE10239073A1 (en)
WO (1) WO2004024932A2 (en)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7297800B2 (en) * 2001-12-27 2007-11-20 Ajinomoto Co., Inc. Process of producing glutamate derivatives
DE10239082A1 (en) 2002-08-26 2004-03-04 Basf Ag Fermentative production of sulfur-containing fine chemicals, useful e.g. as feed additive, by culturing bacteria containing heterologous sequence for O-acetylhomoserine sulfhydrolase
DE10239308A1 (en) 2002-08-27 2004-03-11 Basf Ag Fermentative production of sulfur-containing fine chemicals, useful e.g. as feed additive, by culturing bacteria containing heterologous sequence for methionine synthase
DE10359668A1 (en) 2003-12-18 2005-07-14 Basf Ag Process for the preparation of methionine
ATE489471T1 (en) * 2005-07-18 2010-12-15 Evonik Degussa Gmbh USE OF DIMETHYL DISULFIDE FOR METHIONINE PRODUCTION IN MICROORGANISMS
KR100905381B1 (en) 2006-07-28 2009-06-30 씨제이제일제당 (주) Microorganism producing l-methionine precursor and method of producing l-methionine and organic acid from the l-methionine precurosr
KR20080061801A (en) * 2006-12-28 2008-07-03 씨제이제일제당 (주) Polypeptide to improve L-methionine production capacity, microorganisms overexpressing the polypeptide and L-methionine production method using the microorganism
US9005952B2 (en) * 2008-04-04 2015-04-14 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and the method of producing L-methionine precursor using the microorganism
US7851180B2 (en) * 2008-04-04 2010-12-14 Cj Cheiljedang Corporation Microorganism producing L-methionine precursor and the method of producing L-methionine precursor using the microorganism
UA112050C2 (en) * 2008-08-04 2016-07-25 БАЄР ХЕЛСКЕР ЛЛСі THERAPEUTIC COMPOSITION CONTAINING MONOCLONAL ANTIBODY AGAINST TISSUE FACTOR INHIBITOR (TFPI)
WO2011073738A1 (en) * 2009-12-14 2011-06-23 Metabolic Explorer Use of inducible promoters in the production of methionine
SG183443A1 (en) 2010-03-01 2012-09-27 Bayer Healthcare Llc Optimized monoclonal antibodies against tissue factor pathway inhibitor (tfpi)
PL2657250T3 (en) * 2010-12-21 2018-02-28 Cj Cheiljedang Corporation Variant polypeptide having homoserine acetyltransferase activity and microorganism expressing same
CN103289928B (en) * 2013-05-31 2015-03-04 浙江工业大学 Pseudomonas fluorescent and application thereof in biosynthesizing methionine
SG11201609757XA (en) * 2014-05-23 2016-12-29 Evonik Degussa Gmbh Biosynthetic production of acyl amino acids
US20180135085A1 (en) * 2015-07-10 2018-05-17 Evonik Degussa Gmbh Amino acid production
KR20250133498A (en) * 2024-02-28 2025-09-08 경북대학교 산학협력단 Recombinant microorganism with improved L-methionine production ability by increasing dihydrofolate reductase activity and method for producing L-methionine using the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1172437A1 (en) * 1999-04-19 2002-01-16 Kyowa Hakko Kogyo Co., Ltd. Novel desensitized aspartokinase

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5835197A (en) 1981-08-26 1983-03-01 Kyowa Hakko Kogyo Co Ltd Plamid pcg 2
US4601893A (en) 1984-02-08 1986-07-22 Pfizer Inc. Laminate device for controlled and prolonged release of substances to an ambient environment and method of use
GB2165546B (en) 1984-08-21 1989-05-17 Asahi Chemical Ind A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom
DE4027453A1 (en) 1990-08-30 1992-03-05 Degussa NEW PLASMIDES FROM CORYNEBACTERIUM GLUTAMICUM AND DERIVED PLASMIDE VECTORS
DE4440118C1 (en) 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Gene expression in coryneform bacteria regulating DNA
JPH10229891A (en) 1997-02-20 1998-09-02 Mitsubishi Rayon Co Ltd Method for producing malonic acid derivative
JP4623825B2 (en) 1999-12-16 2011-02-02 協和発酵バイオ株式会社 Novel polynucleotide
US6942996B2 (en) * 2000-08-02 2005-09-13 Degussa Ag Isolated polynucleotide from Corynebacterium encoding a homocysteine methyltransferase
AU2001287631A1 (en) * 2000-08-02 2002-02-13 Degussa A.G. Nucleotide sequences which code for the metf gene
DE10109690A1 (en) * 2000-09-02 2002-03-14 Degussa New nucleotide sequences encoding the metY gene
DE10046870A1 (en) 2000-09-20 2002-03-28 Basf Ag Genetic manipulation of corynebacteria, useful for preparing fine chemicals, using a non-replicable vector that is not recognized as foreign
DE10217058A1 (en) * 2002-04-17 2003-11-27 Basf Ag Process for the production of fine chemicals containing sulfur
DE10222858A1 (en) 2002-05-23 2003-12-04 Basf Ag Process for the fermentative production of sulfur-containing fine chemicals
DE10239082A1 (en) 2002-08-26 2004-03-04 Basf Ag Fermentative production of sulfur-containing fine chemicals, useful e.g. as feed additive, by culturing bacteria containing heterologous sequence for O-acetylhomoserine sulfhydrolase
DE10239308A1 (en) 2002-08-27 2004-03-11 Basf Ag Fermentative production of sulfur-containing fine chemicals, useful e.g. as feed additive, by culturing bacteria containing heterologous sequence for methionine synthase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1172437A1 (en) * 1999-04-19 2002-01-16 Kyowa Hakko Kogyo Co., Ltd. Novel desensitized aspartokinase

Also Published As

Publication number Publication date
JP2005537024A (en) 2005-12-08
US20070218526A1 (en) 2007-09-20
BR0313759A (en) 2005-06-21
AU2003264108A1 (en) 2004-04-30
CN100462440C (en) 2009-02-18
CN1788090A (en) 2006-06-14
US7238502B2 (en) 2007-07-03
US20060003425A1 (en) 2006-01-05
WO2004024932A2 (en) 2004-03-25
WO2004024932A3 (en) 2004-04-22
DE10239073A1 (en) 2004-03-11
KR20050034745A (en) 2005-04-14

Similar Documents

Publication Publication Date Title
EP2235194B1 (en) Method for fermentatively producing 1,5-diaminopentane
US20070218526A1 (en) Method for zymotic production of fine chemicals containing sulphur (metA)
EP1769080B1 (en) Microorganisms for producing sulphur-containing compounds
EP1697526B1 (en) Psod expression units
EP1516059B1 (en) Method for the production of sulphur-containing fine chemicals by fermentation
EP1908842A2 (en) PEF-TU expression units
EP1908841A1 (en) Multiple promoters and their use for gene expression
EP1497443A2 (en) Methods for producing sulphurous fine chemicals by fermentation using meth-coding coryneform bacteria
EP1942198A2 (en) P-ET-TS expression units in Corynebacterium Glutamicum
EP1537225A2 (en) Method for zymotic production of fine chemicals (mety) containing sulphur
EP1537223A2 (en) Method for the production by fermentation of sulphur-containing fine chemicals (metf)
DE10109690A1 (en) New nucleotide sequences encoding the metY gene
DE10136986A1 (en) New cysD, N, K, E and H genes from coryneform bacteria, useful, when over expressed, for increasing fermentative production of L-amino acids
DE10109689A1 (en) New nucleotide sequences coding for the metE gene
DE10109687A1 (en) New nucleotide sequences coding for the metH gene
DE10109688A1 (en) New nucleotide sequences coding for the metR and metZ genes
DE10109686A1 (en) New nucleotide sequences coding for the metf gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050329

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20061204

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EVONIK DEGUSSA GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120424