EP1534837A2 - Voies d'apicomplexan, inhibiteurs et administration de medicaments - Google Patents

Voies d'apicomplexan, inhibiteurs et administration de medicaments

Info

Publication number
EP1534837A2
EP1534837A2 EP03788516A EP03788516A EP1534837A2 EP 1534837 A2 EP1534837 A2 EP 1534837A2 EP 03788516 A EP03788516 A EP 03788516A EP 03788516 A EP03788516 A EP 03788516A EP 1534837 A2 EP1534837 A2 EP 1534837A2
Authority
EP
European Patent Office
Prior art keywords
gondii
triclosan
apicomplexan
amino acid
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03788516A
Other languages
German (de)
English (en)
Other versions
EP1534837A4 (fr
Inventor
Fiona L. Henriquez
Samantha A. Campbell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of EP1534837A2 publication Critical patent/EP1534837A2/fr
Publication of EP1534837A4 publication Critical patent/EP1534837A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the phylum Apicomplexa consists of a large number of protozoans, including species of Plasmodium, Cryptosporidium, Theileria, Babesia, and Toxoplasma. These parasites cause a wide array of diseases in both humans and livestock.
  • Toxoplasma gondii as a model obligate protozoan intracellular parasite, can enter all host cells in nearly all vertebrates and has a special propensity for cyst formation and recrudescence with tissue destruction in the central nervous system. Toxoplasmosis gondii results in a chronic central nervous system infection in more than a third of the world population, as well as acute life threatening disease in immunocomprised individuals.
  • Toxoplasma gondii is an apicomplexan parasite that can have devastating neurological and ocular effects on those who are infected and can result in systemic disease and death when acquired in utero.
  • Congenitally infected and immunocompromised hosts (caused by AIDS, chemotherapy, malignancy, transplantation or autoimmune diseases and their treatments) suffer the most severe clinical manifestations of infection with T. gondii.
  • felines While felines are the definitive hosts to T. gondifs sexual stage, humans act as intermediate hosts for the other two stages of the T gondii life cycle, the tachyzoite and the bradyzoite.
  • the fast dividing tachyzoite proliferates within cells in many tissues until it lyses the host cells.
  • cyst formation begins 8 days after infection and then persists for the remainder of the host's life.
  • the cysts which contain hundreds of the slow dividing bradyzoites, form in many tissues but especially in muscle and brain. Bradyzoites are more resistant to acid and pepsin and may use anaerobic metabolism, whereas tachyzoites use aerobic metabolism.
  • the tachyzoite to bradyzoite conversion is induced by environmental stress created by the host's immune system.
  • a reverse process is responsible for disease reactivation that results in uncontrollable tachyzoite multiplication and occurs whenever the host's immune functions are impaired.
  • Malaria is caused by the apicomplexan parasites of the genus Plasmodium.
  • Plasmodium The four common species of Plasmodium (P. falciparum, P. malariae, P. vivax and P. ovale) infect millions of people and account for the death of more than 2 million children annually.
  • the emergence of drug resistance has limited the useful life span of many antimalarial medicines.
  • Current treatments include inhibitors of the folate synthetic pathway such as pyrimethamine and sulphadoxine.
  • DHFR dihydrofolate reductase
  • Sulfadiazine can cause allergy and is commonly poorly tolerated, which results in problems with compliance.
  • this combination therapy acts only on the rapidly dividing tachyzoite stage associated with active disease and does not affect the quiescent bradyzoite stage that forms cysts throughout the body.
  • bradyzoite forms remain a reservoir of infection even in treated individuals and can give rise to repeated disease reactivation. This is especially evident in congenitally infected and immunocompromised individuals. Disease reactivation is common in the eye and brain where the consequences can be serious. Therapy is often required on multiple occasions and for long periods of time.
  • a promising target pathway in apicomplexan parasites is that of fatty acid synthesis because plants and animals use different types of enzymes in their synthesis of fatty acids.
  • mammals synthesize fatty acids with the help of Type I fatty acid synthases.
  • the enzymes of fatty acid synthesis form on different domains of a single multi-functional protein.
  • Plants and some bacteria synthesize fatty acids using Type II fatty acid synthases.
  • the enzymes of fatty acid synthesis are discrete mono-functional proteins.
  • Apicomplexans, including P. falciparum and T. gondii use Type II fatty acid synthases.
  • T. gondii fatty acid synthase, Fabl has not yet been identified or characterized.
  • Fab I enoyl acyl carrier protein reductase (ENR)
  • ELR enoyl acyl carrier protein reductase
  • Fab I is an enzyme used in fatty acid synthesis. It is a single chain polypeptide in plants, bacteria, and mycobacteria, but is part of a complex polypeptide in animals and fungi. Certain other enzymes in fatty acid synthesis in apicomplexan parasites appear to have multiple forms, homologous to either a plastid sequence, a plant-like single chain enzyme, or more like the animal complex polypeptide.
  • CoA and malonyl-CoA are converted to acetyl-ACP and malonyl-ACP with the help of acetyl-CoA-ACP transacylase (ACAT) and malonyl-CoA-ACP transacylase (MCAT).
  • ACAT acetyl-CoA-ACP transacylase
  • MCAT malonyl-CoA-ACP transacylase
  • ⁇ -ketoacyl-ACP synthase ⁇ - KAS then catalyzes a condensation reaction to form ⁇ -ketoacyl-ACP.
  • This cycle of reduction, dehydration and reduction can repeat up to seven times, and in the case of P. falciparum results in fatty acids with 10, 12 and 14 carbon long chains.
  • Enzymes of mammalian lipid synthesis form domains on a multi-functional protein, whereas those enzymes in plants and certain bacteria are found on discrete mono-functional polypeptides. These differences have been exploited by a number of compounds which selectively inhibit bacterial or plant enzymes, but do not inhibit mammalian enzymes. Both T. gondii and P. falciparum have been shown to possess mono-functional, plant- or bacterial-like fatty acid biosynthesis enzymes which are targeted to the plastid organelle via a bipartite, N-terminal transit sequence.
  • Enoyl acyl carrier protein reductase catalyses the NAD (P)-dependent reduction of a trans-2,3 enoyl moiety into a saturated acyl chain, the second reductive step in the fatty acid biosynthesis pathway.
  • NAD NAD
  • Enoyl-ACP reductase also known as Fabl— is an attractive antimicrobial target.
  • Triclosan a common anti-bacterial agent, found in deodorant, toothpaste, soap and plastics, is an inhibitor of ENR.
  • the effects of triclosan on P. falciparum and T. gondii infection in vitro and in vivo have shown it is effective at inhibiting parasite growth.
  • Analysis of B. napus, E. coli and P. falciparum amino acid sequences suggest that 11 residues are critical in triclosan' s inhibitory effects.
  • shikimate pathway Another target pathway in apicomplexan parasites is the shikimate pathway, which is essential for the production of all aromatic compounds in plants, bacteria, and fungi. Characterization of the shikimate pathway in T. gondii is of special interest because the pathway is absent from animals but essential for the parasite, making it a promising target for the development of new anti-parasitic agents.
  • Plant enzymes, although nuclear encoded, are largely active in the chloroplast and accordingly posses a N-terminal transit sequence.
  • AROM 3-deoxy-D-arabino-heptulosonate 7- phosphate
  • the shikimate pathway operates in the cytosol of bacteria and fungi, but in plants it is also known to operate in plastid organelles.
  • the pathway utilizes phosphoenolpyruvate and erythrose 4-phosphate to produce chorismate through seven catalytic steps. While branches exist from various intermediate products of the pathway, chorismate represents the major branch point. The various branches give rise to many end products. Derivatives of chorismate include tryptophan via an anthranilate intermediate, phenylalanine and tyrosine via prephenate or arogenate, and vitamin K and metal chelators containing dihydroxybenzoic acid such as enterochelin via isochorismate.
  • Chorismate also is used for production of ubiquinone and p-amino benzoic acid (PABA), which subsequently is converted into folates.
  • PABA ubiquinone and p-amino benzoic acid
  • the shikimate pathway also gives rise to many secondary metabolites including flavanones and napthoquinones and there is an alternative version of the pathway with aminated intermediates which give rise to aminohydroxybenzoate (AHBA), the precursor of the ansamycin antibiotics.
  • AHBA aminohydroxybenzoate
  • the shikimate pathway plays a role in production of PABA and folates in apicomplexan parasites.
  • Cryptosporidium parvum is another apicomplexan parasite that cuases disease in humans and livestokc. It causes debilitating and life-theatening diarrhea in patients infected with HIV. It can also occur in epidemics where it is most severe in the young and elderly. There is currently no effective treatment for the disease caused by this parasite.
  • the shikimate pathway has proven to be a viable target for the herbicide glyphosate. Specifically, 5 -enolpyrivylshikimate-3 -phosphate (EPSP) synthase, the sixth enzyme in the pathway, has been found to be the target for the widely used herbicide glyphosate.
  • the compound also inhibits EPSP synthase of T. gondii and the growth of T. gondii, P. falciparum, and C. parvum.
  • a number of other compounds that inhibit various other enzymes in the shikimate pathway have been described, and some have been demonstrated to inhibit the growth of bacteria. Surprisingly none of these have been developed commercially.
  • An advantage of developing agents that target the shikimate pathway is their potential to inhibit the growth of bacterial and fungal pathogens as well as apicomplexan parasites.
  • multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of enterococci, Streptococcus pneumonia and enteric gram-negative bacteria.
  • multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of enterococci, Streptococcus pneumonia and enteric gram-negative bacteria.
  • multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of enterococci, Streptococcus pneumonia and enteric gram-negative bacteria.
  • multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of enterococci, Streptococcus pneumonia and enteric gram-negative bacteria.
  • multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of
  • the shikimate pathway is found only in microorganisms and plants, never in animals, making it a viable target for herbicides.
  • the shikimate pathway was also identified in apicomplexans, including T. gondii. All enzymes of the shikimate pathway have already been obtained in pure form from a variety of prokaryotic and eukaryotic sources, and their respective DNAs have been characterized for several organisms.
  • the shikimate pathway was investigated as a common route essential for the biosynthesis of aromatic amino acids phenylalanine, tyrosine, and tryptophan. Through a sequence of seven metabolic steps, it converts phosphoenelpyruvate (PEP) and erythrose 4-phosphate (E4P) into chorismate, the precursor of the primary aromatic amino acids and many aromatic secondary metabolites. All pathway intermediates can also be considered branch point compounds that may serve as substrates for other metabolic pathways. III. DAHP Synthase
  • the first step of the shikimate pathway is the condensation of PEP and
  • the third step of the shikimate pathway dehydration of DHQ to give 3-dehydroshikimate (DHS), is catalyzed by DHQ dehydratase. Then, there is a reduction of DHS to shikimate, catalyzed by a shikimate dehydrogenase that is either NADP-dependent or pyrrolo-quinoline quinone dependent.
  • shikimate kinase catalyzes the phosphorylation of shikimate to yield shikimate 3 -phosphate (S3P).
  • S3P shikimate 3 -phosphate
  • the penultimate step involves the condensation of a second PEP with S3P to yield 5- enolpyruvylshikimate 3-phospate (EPSP) and inorganic phospate.
  • chorismate synthase catalyzes a trans- 1,4 elimination of phospate from EPSP to produce chorismate. From here, the pathway splits into several branches to produce phenylalanine and tryosine, tryptophan, ubiquinone, and a variety of folates. Additional branches exist from chorismate in certain organisms, including isoprenoid synthesis, and from other intermediates, such as quinate synthesis from dehydroquinate. As mentioned above, DAHPS is the initial enzyme in the shikimate pathway. It catalyzes the condensation of PEP and E4P.
  • DAHPS is an enzyme from E. coli, the organism in which it was first discovered. Wild-type E. coli produces three feedback inhibitor-sensitive DAHPS isoenzymes: a Tyr-sensitive, a Phe-snsitive, and a Trp-sensitive enzyme. Because DAHPS in E. coli is regulated at the protein level by feedback inhibition, both Phe- and Tyr-sensitive isoenzymes can be completely inhibited by about 0.1 mM of the corresponding amino acid. The Trp-sensitive isoenzyme is partially inhibited by Trp.
  • Plant DAHPS have also been obtained in pure form from a variety of plants including carrot, potato, tobacco, arabidopsis, and tomato. Although, like E. coli, some plants have three DAHPS-encoding genes, the structures of the encoded enzymes are quite different from the structures of the bacterial DAHPS. In fact, the comparison of the primary amino acid sequences of a plant DAHPS with a bacterial DAHPS typically shows surprisingly low identity. Due to large primary structure differences, a distinction is made between small bacterial Type I DAHPS and Type II plant DAHPS. T. gondii DAHPS had not yet been identified.
  • T. gondii is regulated and inhibited are important.
  • the results of such studies lead to novel ways of treating toxoplasmosis and greater understanding of the T. gondii parasite.
  • Glyphosate for example, was among the first compounds used to inhibit T. gondii' s growth.
  • Inhibition of EPSP synthase with product rescue with PABA in T. gondii provided evidence that the shikimate pathway was present in apicomplexan parasites. Since then, a multitude of other compounds have been synthesized and tested in vitro and in vivo in an effort to identify those without toxicity to host cells and the ability to inhibit apicomplexan parasites. Other targets in the shikimate pathway would be useful.
  • apicomplexan parasites have a vestigial plastid organelle called an apicoplast, most likely derived from an ancient algal endosymbiont.
  • Evidence of plant biosynthetic pathways in these parasites led to the identification of the first apicomplexan shikimate pathway enzyme, chorismate synthase.
  • Chorismate synthase was isolated from T. gondii and a number of Plasmodium species and in all cases the proteins lacked an obvious ⁇ -terminal transit sequence, suggesting that they are cytosolically active and unlikely to be located in the apicoplast.
  • Phylogenetic analysis inferred that these apicomplexan chorismate synthases were most closely related to fungal enzymes.
  • the alternative pathway of respiration has been most extensively studied in higher plants, which have two pathways for mitochondrial electron flow: the cytochrome respiratory pathway, which is found in all mitochondria and the alternative respiratory pathway, which is absent from mammals.
  • the cytochrome respiratory pathway which is found in all mitochondria
  • the alternative respiratory pathway which is absent from mammals.
  • electrons are passed from complexes I or II to ubiquinone and then on to the cytochrome oxidases, complex III and IN.
  • protons are transferred across the inner membrane creating a transmembrane potential that is coupled to ATP production.
  • the alternative pathway diverges from the cytochrome pathway after the ubiquinone complex.
  • Electrons flowing through the alternative oxidase (AOX) are donated directly to oxygen to form water.
  • AOX alternative oxidase
  • immutans which is located in their chloroplasts.
  • apicomplexan parasites there also is the potential of bioterrorism use for apicomplexan parasites.
  • Compounds which inhibit one apicomplexan parasite, such as T. gondii often also are effective against other pathogenic, phylogenetically related apicomplexan parasites, e.g., those that cause malaria.
  • Antimicrobial targets in apicomplexans are shared with certain other microorganisms that have metabolic pathways or enzymes not present or very different from the enzymes in humans.
  • a novel apicomplexan Fab I (enoyl acyl carrier protein reductase, ENR) was found in Toxoplasma gondii.
  • ENR enoyl acyl carrier protein reductase
  • T. gondii Fabl The cDNA, genomic DNA and amino acid sequences of T. gondii Fabl were characterized in order to verify triclosan 's mode of action against the parasite. Results enable knockout and complementation of the knockout parasite to characterize the biology of lipid synthesis in T. gondii, the production of the recombinant protein, characterization of the recombinant enzyme, high throughput screening of recombinant protein with libraries of compounds known to inhibit other Fabls, creation of a protein crystal, solution of the crystal structure and a basis for rational drug design.
  • a cDNA molecule of the Fabl gene in T. gondii is shown in FIG. 4(A).
  • a molecule of the Fab I enzyme having the deduced amino acid sequence of the Fab I enzyme in Toxoplasma gondii is shown in FIG. 4(B).
  • the protein may be a recombinant.
  • apicomplexan Fab I gene and the gene for DAHP synthase and their encoded enzymes provide means to rationally design novel inhibitory compositions useful for prevention and treatment of apicomplexan and microbial related diseases.
  • triclosan is a lead compound.
  • the recombinant protein is used to determine the crystal structure of the enzyme from which novel inhibitors are designed.
  • the plastid targeting sequence of the Toxoplasma gondii Fab I amino acid sequence according to FIG. 4(B) or the DAHPs amino acid sequence according to FIG. 7(A) and (B), are used to design antimicrobial agents and inhibitors of apicomplexan growth and survival.
  • Triclosan inhibits apicomplexan growth and survival. To deliver inhibitors to the micororganism, systems are developed.
  • a transporter such as a polypeptide delivers antimicrobials such as small molecules to microorganisms that include parasites sequestered by multiple membrane barriers and structures. The small molecules include growth inhibitors.
  • a method to deliver a pharmaceutical composition into a microorganism includes the steps of: [00046] attaching at least one polypeptide to the composition to form a complex; and; [00047] contacting the microorganism with the polypeptide composition complex.
  • the microorganism may be a parasite, e.g. Toxoplasma gondii.
  • the at least one polypeptide may be polyarginine.
  • the polyarginine may be an octaarginine. Delivery includes encysted T. gondii bradyzoites.
  • a method to test a candidate transporter for delivery of a pharmaceutical composition into a microorganism includes the steps of: [00050] contacting the pharmaceutical composition with the candidate transporter; and [00051] determining whether the pharmaceutical composition is delivered into the microorganism by the candidate transporter.
  • FIG. 1 (A) and (B) are schematics of the fatty acid synthesis pathway.
  • FIG. 2 is a schematic of the shikimate pathway.
  • FIG. 3 is the DNA sequence of the probe used to screen libraries for T. gondii Fab I.
  • FIG. 4 (A) is the cDNA nucleotide sequence of the Fab I gene in T. gondii
  • (B) shows the deduced amino acid sequence of the cDNA.
  • FIG. 5 is a multiple structure-based sequence alignment of Fabls from E. coli, H. Pylori, B. subtilis, S. aureus, B. napus, P. falcipurum, and T gondii.
  • Secondary sequence structure features include ⁇ and ⁇ helices of E. coli and B. napus enzymes are shown as lines above and below alignments. Amino acids critical for secondary structure are in reverse type and amino acids critical for triclosan binding are below black-filled circles. Dark amino acids are conserved between P. falciparum, T. gondii and B. napus.
  • FIG. 6 (A) and (B) shows the action of DAHP synthase
  • FIG. 7 shows a multi-sequence alignment of known plant and bacteria and yeast DAHPS. 100 percent homology across species is shown in dark sections. Note marked differences between plant as contrasted with yeast and bacterial DAHPS; (B) shows consensus sequences with T. gondii.
  • FIG. 8 (A) PCR primer design (B) contigs and intervening sequences.
  • FIG. 9 (A) and (B) are illustrative copies of web pages for various searches.
  • FIG. 10 is the molecular formula and model for triclosan.
  • FIG. 11 demonstrates inhibition of T. gondii by triclosan.
  • FIG. 12 is a stereo view of the three dimensional arrangement of the atoms that form the binding pocket for triclosan, in E. coli enoyl reductase, with the 11 residues that have any atom within 4 A of the inhibitor, labeled. This is important in assigning the relative contributions made to the interaction with triclosan by the critical amino acids that are also present in the T. gondii enzyme.
  • FIG. 13 is the signal and transit peptide of Fabl.
  • FIG. 14 represents schematic representations of oligomers, conjugates, type II fatty acid synthesis pathway in apicomplexans, and residues of triclosan and ⁇ NR critical for their interaction.
  • FIG. 15 demonstrates uptake of short oligomers of arginine and lysine by T. gondii tachyzoites and encysted bradyzoites.
  • FIG. 15(A) shows the use of comparative flow cytometry to measure labeling of T. gondii tachyzoites incubated with FITC conjugated polyamino acid compounds. Numbers in parenthesis indicate % positive cells.
  • DIC Fluorescence and differential interference contrast
  • FIG. 16 demonstrates the effect of azide on uptake of arginine triclosan conjugates by tachyzoites (3a), and excysted bradyzoites (3b) and cysts (3c).
  • FIG. 17 demonstrates intracellular and extracellular tachyzoites taking up triclosan conjugated to octaarginine.
  • FIG. 17(A) shows fluorescence images of live intracellular tachyzoites following 10 or 30 minute exposure to triclosan octaarginine conjugate (non- releasable conjugate 4).
  • Parasite nuclei arrows
  • host cell nuclei HN
  • FITC signal is seen in host cell cytoplasm (HC) and nuclei (HN), and in parasites residing in parasitophorous vacuole (v).
  • Scale bar 10 microns.
  • FIG. 17(B) demonstrates uptake of triclosan octaarginine conjugate (non- releasable conjugate 4) by extracellular and intracellular tachyzoites.
  • Flow cytometric analysis showing representative dot blots of RH strain and transgenic parasites expressing the green fluorescent protein (ACP-GFP) exposed to triclosan r8 conjugated to rhodamine (ent-6) for 10 minutes. Intracellular parasites were exposed to the transporter and then released from the host cells prior to analyses.
  • ACP-GFP green fluorescent protein
  • FIG. 18 is a representation of T. gondii ENR: Deduced amino acid sequence and structure, purification of recombinant protein and kinetics of enzyme activity in the presence of octaarginine releasable conjugate.
  • A shows multiple structure-based sequence alignment showing deduced amino acid sequence of T. gondii enoyl ACP reductase and enoyl reductases of E. coli, H. pylori, B. subtilis, S. aureus, P. falciparum and B. napus.
  • the secondary structures and sequence numbers of the E. coli and the R. napus enzymes are shown above and below the alignment, respectively.
  • (B) demonstrates SDS-PAGE of TgENR purification.
  • SigmaMarker Sigma
  • Lanes 2-6 show fractions eluted from the HiTrap Q Fast Flow column containing pure TgENR.
  • (C)) shows a time course of TgENR inhibition by releasable octaarginine triclosan conjugate (Tr8), compound 7. Inhibition curves were measured at 0 hours (solid squares), 12 hours (solid triangles) and 24 hours (solid circles) of incubation at 37 °C. The three open symbols to the right show TgENR activity at these time points with no added inhibitor.
  • Enzyme activity is expressed as turnovers per TgENR molecule per second and inhibitor concentration is expressed as the log of the Tr8 concentration in molar units.
  • IC 50 values calculated by nonlinear regression analysis are displayed graphically as dashed vertical lines for the three inhibition curves, showing an increase of inhibitory activity with time.
  • a black vertical dashed line marks the concentration of TgENR used in these assays and thus represents a value below which inhibition can not be properly measured in these assays. Error bars show the variation between triplicate measurements at each point. When not visible, the variation is smaller than the symbol.
  • FIG. 19 demonstrates in-vitro and in-vivo effects of octaarginine triclosan conjugates on T.
  • gondii infected host cells in medium or treated with pyrimethamine (0.1 ⁇ g/ml) and sulfadiazine (25 ⁇ g/ml) (P/S) which inhibit parasite growth.
  • P/S pyrimethamine
  • P/S sulfadiazine
  • T. gondii releasable octaarginine triclosan
  • Tr8 releasable octaarginine triclosan
  • PBS Dulbecco's phosphate buffered saline
  • Tr8 PBS For the PBS exposed cultures (not controls), T or Tr8 PBS then were replaced at varying intervals with (IMDM-FCS) which was present for the remainder of the 3.5 day culture period. Parasite growth was determined by 3 H uracil uptake at the end of 3.5 days of culture in growth medium. Brief exposures to Tr8 partially inhibited parasite growth and the 3.5 day exposure (or a 48 hour exposure, data not shown) inhibited parasite growth almost completely. Unconjugated triclosan had no effect. The photomicrographs (Giemsa stain) on the right show the "protective" effect of Tr8, but not T, in PBS on the infected host cell monolayer.
  • the large empty areas represent host cell destruction by intracellular parasite growth, which is inhibited by polyarginine conjugated triclosan and not by the triclosan in PBS.
  • C the subcellular distribution of octaarginine triclosan conjugate in tachyzoites was determined by deconvolution microscopy using non-releasable triclosan r8 conjugated to rhodamine, and transgenic parasites expressing the green fluorescent protein (GFP) targeted to the parasite plastid organelle.
  • GFP green fluorescent protein
  • FIG. 20(A) shows an SDS-PAGE of the pfENR purification.
  • SigmaMarker wide range molecular weight markers are shown in lane 1.
  • Pure MBP-ENR fusion protein produced by the pMALc2x vector (lane 2) and Factor Xa digested fusion protein (lane 3) are shown.
  • Lane 4 shows pfENR produced by in vivo cleavage using the pMALcHT vector.
  • (B) shows a schematic of the pMALcHT vector. Amino acids in the linker region between the maltose binding protein (MBP) and pfENR (ENR) are shown using one letter abbreviations. The seven residue TEN protease recognition site is boxed and a gap indicates the protease cleavage site.
  • FIG. 21 shows a representative 1° oscillation image of data collected from the pfE ⁇ R complexed with ⁇ AD + and triclosan crystal on a Quantum Q4 CCD detector on station 14.1 at the SRS Daresbury Laboratory.
  • the resolution at the edge of the image corresponds to a resolution of 2.2 angstroms.
  • FIG. 22 A representative 0.1° oscillation image of data collected from crystals of tgENR with bound NAD+ and triclosan. The resolution at the edge of the image corresponds to a resolution of 1.5 A..
  • FIG. 23 shows crystals of T. gondii ENR complexed with NAD+ and triclosan grown in 1.6M Am Sulfate pH 9.0.
  • FIG. 24 shows alignment of the AROM polypeptide with bacterial enzymes.
  • the T gondii arom gene is 19460b ⁇ and is interrupted by 19 introns (black).
  • B DHQ synthase, EPSP synthase, skikimate kinase, dehydroquinase and shikimate dehydrogenase. The entire polypeptide spans 3332 amino acides.
  • C The five central shikimate pathway enzymes are fused in fungi (e.g. S. cerevisiae), are monofunctional in plants (e.g. L.
  • D Amino acid alignment of the DHQ synthase domains from a number of AROM polypeptides. Sequences are: T. gondii (Accession no. AY314743); P. carinii (Assession no. Q12659); S. cerevisiae (Accession no. NP010412) and E. nidulans (Accession no. P07547). Dashes indicate gaps to maximise alignment.
  • the residues identified to be important in the E. nidulans enzyme and conserved in the T. gondii protein are marked by asterisks.
  • the secondary structure prediction of the T. gondii protein is given above the alignment, where arrows represent beta strands and cylinders alpha helical regions. This is compared to the known structure of the E. nidulans DHQ synthase domain given below the alignment.
  • FIG. 25 shown phylogenetic analysis of the DAHP gene. Molecular arrangement of the T. gondii DAHP synthase gene. The gene is 8207bp and is interrupted by 13 introns.
  • FIG. 26 shows phylogenes of EPSP synthase( A) shows the EPSP phylogeny.
  • (B) and (C) show the phylogenies of shikimate kinase and shikimate dehydrogenase respectively.
  • the taxon and character sampling for these phylongenies is as follows: EPSP 69 taxa and 293 amino acid characters, shikimate kinase 44 taxa and 139 characters, the shikimate dehydrongenase 52 tasa and 166 characters.
  • the T. gondii AROM domains cluster with the fungal homologues suggesting they are related, given the taxon sampling available.
  • the shikimate kinase phylogeny also revealed a potential cyanobacterial to plant gene transfer, consistent with this plant enzyme originating from the plant chloroplast endosymbiont.
  • FIG. 27 shows the effect of SHAM and 8-HQ on the in vitro growth of T. gondii and C. parvum.
  • SHAM and 8-HQ inhibited the growth of C. parvum (A & B) and of T. gondii (C & D) (p ⁇ 0.05) compared with untreated cultures (Media).
  • PRM Paromomycin, P/S, Pyrimthamine/Sulphadiazine and RH, T. gondii strain).
  • FIG. 28 shows the multiple sequence alignment of AOXs from diverse species including the C. parvum AOX (TU502). Sequences were aligned using CLUSTAL W, within MacNector 7.0. The predicted C. parvum mitochondrial targeting sequence is in bold.
  • FIG. 29 shows the western blot analysis of T. gondii extract using various antisera raised to AOX.
  • A Polyclonal anti T. brucei AOX (TAO) reacted with proteins of 33kD and 66kD in control samples containing T brucei extract (TB) corresponding with monomeric and dimeric forms respectively.
  • B Monoclonal IA2 [M TB(IA2)] that was raised to TAO reacted with a protein of approximately 66kD in T gondii extract.
  • C Polyclonal anti Voodoo Lily (S. gattatum) AOX (P VDL) reacted with a protein of 33kD in T. gondii extract corresponding with a putative monomeric form of AOX.
  • FIG. 30 shows the phylogenetic tree of the Alternative Oxidase
  • Immutans genes reveal two potential endosymbiotic gene transfers.
  • the Eukaryotic Alternative Oxidase genes cluster with the alpha proteobacteria suggesting a mitochondrial origin for the Eukaryotic Alternative Oxidase.
  • the Plant Immutans genes cluster with the Cyanobacteria suggesting a chloroplast origin for the plant Immutans genes.
  • the phylogenies were calculated from a masked alignment of 50 taxa and a sampling of 172 amino acid characters. Posterior probabilities and Bootstrap values are shown in the respective order (Posterior probability/Bootstrap value) on the branch labels. For full phylogenetic methods see the methods section of this paper.
  • AOX sequences that have been reported to have a putative mitochondrial targeting peptide are marked on the phylogeny with (M-tp).
  • Immutans proteins that have been shown to localize to the chloroplast are marked (P-L).
  • the three prokaryote sequences were recovered from annotated genome projects, the Synechoccus sp. and Novosphingobium aromaticivorans are listed as hypothetical proteins in GenBank (see gi 23133458 and gi 23109030).
  • FIG. 31 shows the morphological evidence for the presence of mitochondrion in different life-cycle stages of C. parvum.
  • MDBK host cells infected with GCHl strain of C. parvum were stained with the mitochondrial dye, MitoTracker Green FM and processed for deconvolution fluorescence microscopy, as detailed in Experimental Procedures.
  • Composite A Two trophozoites inside parasitophorous vacuoles showing discrete but beaded staining with the mitochondrial dye MitoTracker Green FM (pseudocolored red). Note that the staining is localized to one region of the parasite.
  • Composite B Collection of merozoites inside a parasitophorous vacuole
  • FIG. 32 demonstrates the primary peptide sequence of the alternative oxidase enzyme found in two strains of Crypto sporidia parvum strainGCHl and TU502) .
  • the protein is made up of an ORF of 1005bp, comprising a polypeptide of 335 amino acids with a predicted molecular weight of 39.2 KDa.
  • An amino-terminal mitochondrial targeting sequence of 14 amino acids was identified using MitoProt II, TargefP version 1.0 and Predator.
  • Ploymorphisms between the strains are identified in red.
  • the strains are 97.71% identical at the nucleotide level and 97.02% identical at the amino acid level.
  • FIG. 33 demonstrates a clustal alignment of AOX peptide sequences for various organisms.
  • FIG. 34 demonstrates the primary peptide sequence of the AroM enzyme complex found in Toxoplasma gondii.
  • FIG. 35 demonstrates gene sequences for four of the AroM enzymes in
  • FAB I A plant-like FAB I was identified in Toxoplasma gondii. The nucleotide sequence and deduced amino acid sequence were prepared and correct sequences were confirmed. FAB I is a single chain, discrete enzyme. All requisite residues for FAB I enzyme activity were confirmed.
  • the T. gondii enoyl acyl carrier protein reductase has a putative plastid targeting sequence and unique polar insertions.
  • the FAB I structure is modeled on E. coli and B. napus FAB I structure alone and complexed to triclosan. Key amino acids were identified for determination of 2° structure. Residues for binding triclosan were conserved providing explanation for inhibition by triclosan. Triclosan inhibits T. gondii (nm) in a pattern similar to the action of mefloquine. Soluble protein can be overexpressed.
  • a partial DNA sequence was identified in the Toxoplasma EST and genome projects and was used to make a probe (FIG. 3).
  • the cDNA sequence of T. gondii Fabl was identified using library screening protocols [FIG. 4(A)].
  • the amino acid sequence deduced from this cDNA sequence shows remarkable homology to Fabl sequences of other organisms, especially plants and Plasmodium falciparum, and includes all amino acids necessary for Fabl secondary structure [FIG. 4(B)].
  • the putative protein contains 417 amino acids and includes the 11 amino acid residues necessary for binding triclosan and inhibition of T. gondii Fabl by triclosan.
  • a signal sequence and putative plastid targeting sequence were also identified.
  • Signal peptide cleavage site is after A in the sequence MAFT.
  • the true start is at M in the sequence KMVGF by chloroplast algorithm, the predicted cleavage site for the transit peptide is between the D and the S in the sequence RAADS.
  • Preliminary results indicate that there are at least three introns in the genomic sequence, in contrast to none in P. falciparum.
  • Identification of both the cDNA and genomic DNA sequences of T. gondii Fabl enables knockout and complementation of the knockout parasite to characterize the biology of lipid synthesis in T. gondii, the production of the recombinant protein with libraries of compounds known to inhibit other Fabl, and creation of a protein crystal solution of the crystal structure as a basis for rational drug design.
  • T. gondii growth inhibition was assessed over a 4-day period as described previously (Mack et al., 1984; Roberts et al., 1998; Zuther et al, 1999) using human foreskin fibroblasts (HFF) infected with 105 tachyzoites of the RH strain of T. gondii.
  • HFF human foreskin fibroblasts
  • the assays are based on microscopic visual inspection of infected and inhibitor treated cultures, and on quantitation of nucleic acid synthesis of the parasite by measuring uptake of 3H uracil into the parasite's nucleic acid. Uracil is not utilized by mammalian cells.
  • RH tachyzoites
  • Me49 bradyzoites
  • R5 mutants mixed tachyzoites/bradyzoites of the Me49 strain that can be stage switched by culture conditions
  • Toxicity of a candidate inhibitor was assessed by its ability to prevent growth of human foreskin fibroblasts (HFF) after 4 days and after 8 days as measured by tritiated thymidine uptake and microscopic evaluation. Confluent monolayers of HFF were infected with tachyzoites and bradyzoites. Inhibitor was added one hour later. Non-toxic doses were used in parasite growth inhibition assays. Parasite growth was measured by ability to incorporate tritiated uracil during the last 48 hours of culture.
  • HFF human foreskin fibroblasts
  • Triclosan also was effective against T. gondii, in nanomolar amounts. IC50 was 62 nanograms/ml. There was no toxicity to host cells at these concentrations.
  • the discovery and characterization of an apicomplexan Fab I and discovery of triclosan as a lead compound provide means to rationally design novel inhibitory compounds. A new approach to the great need for additional, less toxic antimicrobial agents effective against T. gondii. Other novel inhibitors of sequential enzymatic steps in the apicomplexan lipid synthesis pathway are predicted to be synergistic with triclosan and other inhibitors of Fab I. There is a rational basis for discovery of synergistic inhibitors of this pathway effective against multiple different microorganisms (Payne et al, 2000).
  • DNA sequences derived from these clones revealed that three of the clones contained the entire Fabl cDNA sequence and that two of the clones contained only partial sequences of T. gondii Fabl.
  • the complete Fabl clones contained between 3397 and 3462 nucleotides.
  • T. gondii Fabl The amino acid sequence of T. gondii Fabl was deduced by translation of the cDNA sequence [FIGS. 4(A) and (B)], and revealed that there are 417 amino acids in the putative protein.
  • the deduced amino acid sequence of T. gondii Fabl was aligned with sequences of Fabl from P. falciparum , B. subtilis and E. coli. This analysis revealed that key amino acid sequences are conserved and that 11 amino acid residues critical to triclosan inhibition are also present (FIG. 13). This result suggests that triclosan has a similar mode of inhibition in T gondii as in other species.
  • N-terminal extension of the amino acid sequence was also identified as belonging to signaling and targeting peptides.
  • a putative 27 amino acid signal peptide was identified using SignalP VI.1 World Wide Web Server, 1 and a putative 66 amino acid chloroplast transit peptide sequence was identified using ChloroP 1.1 Position Server.
  • T. gondii Fabl contains the 30 amino acids residues which are necessary to define the secondary structure of Fabl. These residues are conserved in plants, bacteria and apicomplexans including the plant, B. napus, the bacteria, E. coli, H. pylori, B. subtilis and S. aureus, and the apicomplexan parasites P. falciparum and T. gondii. In addition to these critical 30 amino acid residues, T gondii also contains the 11 amino acid residues that are necessary for triclosan binding. These residues are less than four A away from one or more triclosan atoms and make it highly likely that triclosan inhibits T. gondii in the same way it inhibits B. napus and E. coli.
  • T. gondii plastid is a four membrane enclosed structure with its own extra-nuclear DNA and is believed to be evolutionarily derived from endocytosed algae.
  • T. gondii plastid there is an extension of a bipartite leader on the N-terminal side of the plastid targeted protein.
  • the leader contains a signal peptide that is similar to eukaryotic secretory signal sequences that carries the unfolded protein into the golgi apparatus. Following the signal peptide, there is a transit sequence that is exposed by cleavage to allow transport across plastid membranes (FIG. 13). The presence of these two domains in T. gondii Fabl suggests that it is a nuclear-encoded protein translocated to the parasite plastid where it functions in the synthesis of fatty acids .
  • T. gondii Fabl The identification of both the cDNA and genomic DNA sequences of T. gondii Fabl enables the elucidation of the function of fatty acids in T. gondii and provides a new target for the development of anti-microbial agents.
  • T. gondii also enables the production of a recombinant protein.
  • the cDNA was placed into the pMAL-c2X vector for over- expression and purification. After the protein was obtained, the enzymatic properties were characterized and a protein crystal formed and its structure were solved.
  • the recombinant T. gondii Fabl protein can also be used to conduct a high throughput screening with libraries of compounds known to inhibit other Fabls and with those whose functions are unknown. Further, the crystal structure made possible from the T. gondii Fabl sequence provides a basis for rational drug design.
  • Enoyl ACP reductase is a key enzyme active in fatty acid synthesis.
  • Bacterial and apicomplexan fatty acid synthesis occurs by the Type II pathway, shown in a schematic representation in FIG. 14(B) and is dependent on monofunctional polypeptides including ENR.
  • mammalian fatty acid synthesis occurs by the Type I pathway in which the key enzymes are present on a polyfunctional single polypeptide.
  • Apicomplexan ENR is a promising target for inhibitors because toxicity to humans should be minimal.
  • apicomplexans fatty acid synthesis takes place in a subcellular organelle called the plastid.
  • the antimicrobial agent 5-chloro-2-[2,4- dichlorophenoxy] phenol (triclosan) (FIG. 14(C)) had been found to inhibit bacterial ENRs.
  • Micromolar concentrations of triclosan dissolved in DMSO inhibit replication of apicomplexan parasites by binding to, and inhibiting, apicomplexan ENR.
  • the sequence of the Plasmodium falciparum ENR shows significant sequence similarity to enoyl reductases from other species with, for example, 47% identity to the enzyme from Brassica napus.
  • the pfENR sequence differs from all other ENR sequences determined to date in that it contains a 43 amino acid insert in a loop which, in the ENRs from other species is known to undergo substantial conformation change on inhibitor (and presumably substrate) binding.
  • the structure of this loop is therefore of particular interest in the exploitation of pfENR for drug discovery due to its possible interactions with substrate, cofactor or inhibitors.
  • DAHPS DAHP synthase
  • the shikimate pathway is characterized through its first catalytic step, DAHP synthase 7 [FIG. 6(A) and (B)], and through inhibition of the pathway at other key enzymatic steps.
  • DAHPS DAHP synthase
  • a bio- informatics approach and molecular biology techniques including RT/PCR, gDNA and cDNA library screening, cloning and sequencing, a partial T. gondii DAHP synthase gene sequence was obtained.
  • a bio-informatics approach provided two contigs with similarity to other DAHP synthase sequences. Using RT/PCR, these sequences were confirmed as present in both Me49 and RH strains of T.
  • the shikimate pathway in T. gondii was characterized through two different approaches: 1) Characterization of the first catalytic enzyme of the shikimate pathway, DAHP synthase 2) Inhibition of the shikimate pathway at key enzymatic steps. cDNA and gDNA partial gene sequences and deduced partial amino acid sequences of T. gondii DAHP synthase were identified. Inhibition of T. gondii growth by aurintrycarboxylate acid, a compound that had inhibited EPSP synthase enzymatic activity of other species was tested.
  • T. gondii DAHPS DNA sequence for T. gondii DAHPS, the partial cDNA sequence is approximately 1200 DNA bases in length. This sequence was assembled using three PCR products. Sequencing of gDNA from the first of three clone isolated from library screening yielded the 3' end of the DAHPS gene. Analysis to date indicates that there are at least 3 introns in the confirmed regions of this gene. Furthermore, analysis and multisequence alignments indicates that T. gondii DAHPS more closely resembles plant than bacterial and yeast DAHPS.
  • a challenge for the development of antimicrobials effective against apicomplexans is delivery.
  • Effective agents have to gain entry to the host cell, cross the parasitophorous vacuole, enter the parasite and specialized organelles therein such as the plastid or nucleus. This is potentially more difficult in the case of Toxoplasma gondii bradyzoites which reside in a cyst structure, composed partly of host and partly of parasite constituents.
  • the vast majority of interesting small molecules will never be used for therapeutics because they cannot traverse biologic barriers to reach their targets.
  • Short oligomers of arginine can transport inhibitory compounds into an apicomplexan parasite, including extracellular T. gondii tachyzoites and bradyzoites, intracellular tachyzoites and encysted bradyzoites.
  • the peptide transporter can deliver to, and release, lead inhibitory compounds, inside tachyzoites that are multiplying within parasitophorous vacuoles, to the cytoplasm and to subcellular organelles such as the apicomplexan nucleus and the perimeter of the plastid, where they are efficacious.
  • octaarginine can deliver compounds into bradyzoites in cysts and tachyzoites in vivo.
  • Oligoarginine antimicrobial conjugates provide a novel way to eliminate T. gondii tachyzoites and to deliver antimicrobial agents to intracellular T. gondii tachyzoites and bradyzoites within cysts.
  • T. gondii was selected for study both as a model apicomplexan parasite, and because of the great need to develop better ways to target this particular parasite to prevent and treat the diseases it causes in its active and chronic, untreatable life cycle stage.
  • the ability of short oligomers of arginine to cross parasite subcellular membranes, such as nuclear membranes or membranes of the plastid organelle can be used for targeting other microbial and plant species including other apicomplexan parasites and bacteria including those described herein.
  • T. gondii resides in an unusual intracellular compartment called the parasitophorous vacuole that is delimited by a highly specialized membrane that lacks integral membrane proteins of the host cell and is a parasite modified membrane barrier. This membrane barrier is in intimate association with host cell mitochondria and ER posing additional barriers.
  • the vacuole contains a network of tubulo-vesicular membranous structures of unknown function. Parasite-secreted proteins modify this network.
  • glycosylphosphatidylinositol (GPI)-anchored proteins dominate the plasma membrane of Toxoplasma.
  • the densely packed surface proteins are likely to hinder access of macromolecules to the underlying plasma membrane, which is in tight association with the inner membrane complex forming the parasite pellicle.
  • Inhibitors related herein target a metabolic pathway in the parasite plastid, an organelle acquired by secondary endosymbiosis.
  • transporters of the present invention with their antimicrobial cargo cross the walls of the cysts that contain bradyzoite forms of the parasite.
  • Short arginine oligomers were found to cross all membranes and to enter each life cycle stage and compartment (FIG. 15).
  • Deconvolution fluorescence microscopy revealed that r7 facilitated uptake of fluoresceinated compounds into tachyzoites (FIG. 15(A), Inset).
  • Flow cytometric analysis demonstrated that uptake of r7 was greater than that of r5 or K7, (7 arginines»5 arginines or 7 ly sines). This was consistent with earlier studies demonstrating that longer oligomers of arginines (7 or 8) entered the eukaryotic cells better than shorter oligomers.
  • Uptake of triclosan R8 increased over time. As uptake into isolated bradyzoites was blocked by azide, the inability of azide to completely abrogate uptake by encysted bradyzoites is surprising and suggested that more than a single mechanism of uptake might be involved in uptake across the cyst wall.
  • T. gondii is an obligate intracellular parasite and resides inside a specialized vacuolar compartment known as the parasitophorous vacuole delimited by the parasitophorous vacuole membrane.
  • tachyzoites within a vacuole in human fibroblasts were studied. Intracellular tachyzoites took up fluoresceinated triclosan r8 (conjugate ent-4), within minutes (FIG. 17(A)). This was also confirmed by flow cytometric analysis (FIG. 1 (B)).
  • T. gondii ENR has multiple amino acid sequences that coincide with those inserts present in both P. falciparum and B. napus ENRs.
  • P. falciparum ENR also contained a third, polar insert which had no counterpart in other species. Analysis of the T. gondii ENR sequence indicates only partial conservation of this larger malarial insert. The function(s) and origins of these inserts are unknown.
  • the predicted ENR structure suggested a strategy whereby octaarginine could be conjugated to triclosan both in a releasable manner (see FIG.
  • Triclosan' s insolubility in aqueous media limits its clinical use, but provides an opportunity to compare the efficacy against T. gondii of triclosan alone versus triclosan delivered by conjugation to octaarginine. Effects of triclosan conjugated to short oligomers of arginine on activity of recombinant ENR (FIG.
  • triclosan To be active against the parasite, triclosan must be targeted to, and released in the vicinity of, or within, the plastid where enzymes of apicomplexan fatty acid synthesis are targeted and active. Because short oligomers of arginine alone and linked to triclosan rapidly entered the parasite cytoplasm and nucleus, a question was whether short oligomers of arginine linked to triclosan also were in close proximity to, or entered the plastid, because the delayed death phenotype of triclosan suggested that they were likely to act on a plastid associated process. Also, analysis of T. gondii ENR suggested that the plastid was a likely site of action of this inhibitor of ENR.
  • a rhodamine conjugated r8 linked to triclosan (ent-6) was synthesized to facilitate co-localization studies of r8 conjugate, and a parasite in which the plastid was labeled with green fluorescent protein was examined. These studies showed a dense ring of rhodamine signal at the perimeter of the plastid that co-localized with the outer portion of the plastid and a less intense signal in the center of the plastid (FIG. 19(C)). As triclosan conjugate 7 was effective in vitro, studies were performed to determine the effect of this triclosan conjugate in vivo.
  • mice were treated intraperitoneally with triclosan r8 (compound ent-7), or triclosan (suspended in PBS) or PBS daily for four days beginning on the day they were infected. The numbers of parasites present in the peritoneal cavity were determined on the fifth day, following the four days of treatment.
  • sulfadiazine was given to mice in their drinking water in the four days following infection. Sulfadiazine and triclosan r8 (compound ent-7), but not triclosan in PBS, reduced subsequent parasite burden (p ⁇ 0.006).
  • TgENR The expression and purification of TgENR was carried out using the same protocol as for the pfENR. Crystals of TgENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 ⁇ l of the protein solution (20 mg/ml TgENR in 20 mM Tris pH 7.5, 100 mM NaCI, 5 ⁇ M NAD + and 6 ⁇ M triclosan) with 2.5 ⁇ l of the reservoir solution at 290 K. Initial screening of crystallization conditions was conducted using Crystal Screen, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) followed by optimization of promising conditions. The best crystals grew in a reservoir solution composed of 1.6M Ammonium Sulfate pH 9 and took one week to reach a size of approximately 0.1 x 0.05 x 0.3 mm . Diffraction of TgENR crystals
  • Table 1 Data collection and processing for pfENR crystals. Values in parentheses indicate data in the highest resolution shell.
  • Table 2 Data collection and processing for tgENR crystals. Values in parentheses indicate data in the highest resolution shell.
  • TGG 7014 contained sequences homologous to EPSP synthase, shikimate kinase, dehydroquinase and shikimate dehydrogenase.
  • TGG 3535 a fragment of gDNA of approximately 5kb, contained sequences homologous to DHQ synthase the remaining enzyme present in the fungal AROM. PCR was used to amplify a region spanning the two fragments, the sequence of which confirmed that the fragments were contiguous. This established that these five enzymes are clustered in the T gondii genome. To determine whether the genes were fused to form an AROM type arrangement the cDNA sequence was determined. Initially, a probe was generated from a region of the putative DHQ synthase to screen a T. gondii (RH strain) tachyzoite cDNA library. This obtained the 5' region of the putative DHQ synthase gene including the initiation codon.
  • T. gondii RH strain
  • T. gondii AROM The predicted T. gondii AROM (TgAROM) polypeptide has all the domains, known to be highly conserved in fungal AROMs and the enzyme domains are arranged in the same order as observed in fungi (FIG. 24 B). Nonetheless, TgAROM has a number of obvious differences from the fungal counterparts. Notably the protein is considerably larger than the fungal AROMs which range in size from 1563 amino acids in Neurospora crassa to 1588 amino acids in Saccharomyces cerevisiae. The T gondii AROM protein has a number of insertions not present in the fungal counterparts.
  • the DHQ synthase and shikimate dehydrogenase domains from Emericella nidulans can be expressed as enzymatically active proteins in E. coli (Moore and Hawkins, 1993).
  • the EPSP synthase domain is not active when expressed as a single domain but is when expressed as part of a DHQ synthase-EPSP synthase bifunctional protein.
  • the DHQ synthase domain from E. nidulans has been expressed in E. coli and the 3D structure determined by X- ray crystallography. As this is the only component of the AROM polypeptide to have been studied in depth, the DHQ synthase domains from both the T. gondii and E.
  • nidulans AROMs were compared to determine if the key features are conserved between both proteins (FIG. 24 D). All the key residues which are reported to be involved in the mechanism of the E. nidulans DHQ synthase are conserved within the T gondii protein. These include the residues corresponding to E. nidulans Glu 194, His 271 and His 287 which interact with the pentacoordinate Zn 2+ , as well as those involved in providing a phosphate-binding pocket, Lys 152, Asn 162, Asn 268, His 275 and Lys 356.
  • the EPSP phylogeny shows the plants grouping next to the cyanobacteria
  • FIG. 25 A shows the plant homologs clustered within a diverse group of bacteria but with no clear affiliation with the cyanobacterial homologs, suggesting that the plant shikimate dehydrogenase gene is not of plastidic origin.
  • the shikimate dehydrogenase phylogeny is weakly supported through out the tree topology, making it inappropriate to exclude an origin from the chloroplast genome.
  • the genotype 1 C. parvum (TU502 isolate) genome project was searched for DNA sequences with potential to code an AOX using the T. brucei AOX amino acid sequences (Genbank accession: Q26710) and the tBLASTn alogrithim.
  • Four short genomic DNA sequences C. parvum genome project were identified as potential partial genes for C. parvum AOX (cp011120_a331_cll_082.r, cp011130_a354 ⁇ f03_027.r, cp010319_a015_ful_016.r, and cp011120_a331_cll_082.f).
  • the chromatograms of these sequences were edited and assembled using Sequencher 4.1 (Genecodes).
  • the nucleotide sequence was used to search the C. parvum, genotype II (IOWA strain) genome project and yielded two Contigs, gn ⁇ CNMUN_5807
  • a region including the ORF was amplified from both strains using PCR and both strands sequenced.
  • the ORFs from the GCHl (Genbank Accession AY312954) and TU502 (Genbank Accession AY312955) strains are 97.71% identical at the nucleotide level and 97.02% identical at the amino acid level.
  • Each of the resulting sequences yield an open reading frame of 1008bp that encodes a polypeptide of 336 amino acids in length with a predicted molecular weight of 39.2 Kda.
  • the proteins are predicted to have an N-terminal mitochondrial targeting sequence of 14 amino acids using MitoProt II, TargetP version 1.0 and Predator (www.inra.fr/servlets/WebPredotar).
  • the predicted mature polypeptide has a theoretical molecular weight of 37.46 Kda.
  • the C. parvum AOX protein has significant identity with previously described AOXs (FIG. 28) including the four highly conserved regions characteristic of alternative oxidases, the LET region and the NERMHL, LEEEA and RJDE H regions, which contain the postulated ligands to the diiron center.
  • SHAM was found to significantly inhibit the in vitro growth of C. parvum over untreated control cultures in a dose dependent manner with lOug/ml concentration inhibiting approximately 50% of growth and lOO ⁇ g/ml inhibiting approximately 90% of growth (P ⁇ 0.05). 8-HQ also inhibited the in vitro growth of C. parvum with lug/ml concentration inhibiting approximately 50% of growth and lOO ⁇ g/ml inhibiting approximately 90%> of growth (FIG. 27 A-B). Paromomycin (2000 ⁇ g/ml) used as a positive control inhibited just over 20% of parasite growth. The effect of SHAM and 8-hydroxyquinoline on growth of T. gondii
  • SHAM was found to significantly inhibit the in vitro growth of T. gondii over control cultures in a dose dependent manner with 0.78 ⁇ g/ml inhibiting over 90% of growth (PO.0001) (FIG. 27 B). Similarly 8-HQ also inhibited the in vitro growth of r. gondii with concentrations of 2.5 ⁇ g/ml inhibiting approximately 80% of parasite growth (P ⁇ 0.005) (FIG. 27 C). Pyrimethamine and sulphadiazine used in combination as a positive control inhibited greater than 95% of parasite growth. The effect of SHAM and 8-hydroxyquinoline on growth of P. falciparum
  • Phlyogenetic analysis was used to investigate the evolutionary origins of eukaryotic alternative oxidase and the plant immutans protein.
  • Immutans genes have so far only been detected in genomes of plants, in the case of Capsicum annum and Lycopersicum esculantum the immutan proteins have been reported to functionally locate to the chloroplast organelle.
  • Phylogenetic analysis shows that the immutans genes cluster with the cyanobacterial sequences (see FIG. 30) suggesting that the plant immutans gene have been derived from the endosymbiotic incorporation of the cyanobacterium that led to the establishment of the plant chloroplast. This evolutionary scenario is consistent with the taxonomic distribution of the immutans gene and the functional localization of this protein.
  • a phylogenetic relationship that suggests the eukaryotic AOX genes have been derived from the endosymbiotic genome of the alpha proteobacterium that led to the mitochondrial organelle.
  • Eukaryotic AOX proteins have been demonstrated to function within or closely associated to the mitochondrion organelle. This observation accompanied by the phylogenetic evidence makes the eukaryotic AOX a good candidate for an endosymbiotic gene transfer from the mitochondrial or mitochondrial progenitor genome, although other evolutionary scenarios could explain this phylogenetic tree topology, such as horizontal gene transfer (HGT).
  • HGT horizontal gene transfer
  • MitoTracker Green FM is a mitochondrion-selective stain that is concentrated by active mitochondria and well retained during cell fixation.
  • the different morphological forms of C. parvum in culture were identified using Differential Interference Contrast (DIC) microscopy.
  • DIC Differential Interference Contrast
  • FIG. 31 (A) in trophozoites-stage parasites the dye is concentrated and shows a discrete, but beaded staining (pseudocolored - red) pattern. This raises the possibility that the mitochondrion during this stage of intracellular growth is likely to be branched and/or segmented.
  • FIG. 31(B) shows merozoite-stage parasites with a more diffuse Mitotracker staining pattern.
  • this staining pattern resembles host cell mitochondrial staining, indicating that during this stage of the life cycle the parasite mitochondrial organelle has undergone a morphological change.
  • Cryptosporidium has a complex life cycle so it is conceivable that during differentiation the putative mitochondrion undergoes changes in form and metabolic function in different life cycle stages making it difficult to visualize by morphological analysis.
  • the number and morphological features of mitochondrial structures differ markedly with possible close association with the plastid organelle making visualization difficult.
  • classical inhibitors of the respiratory chain such as cyanide and azide are not active against the sporozoite stages of C. parvum in vitro and atovaquone is not active in a murine model.
  • enzyme activities associated with the TCA cycle would appear to be absent at least from the sporozoite stage.
  • C. parvum has been shown to possess a pyruvate:ferredoxin oxidoreductase/NADPH- cytochrome P450 reductase (PFOR) similar to the protein found in Euglena gracilis, with the major difference being the absence of a N-terminal mitochondrial targeting sequence.
  • PFOR pyruvate:ferredoxin oxidoreductase/NADPH- cytochrome P450 reductase
  • Electron flow via the AOX does not contribute to transmembrane potential and two of the three potential coupling sites for proton transport and thus ATP production are lost. Since the energy of electron flow through the pathway is not conserved as chemical energy, it is lost through the generation of heat. The ability of this heat to assist in the dispersion of insect attractants and thus pollination during the flowering of Sauromatum guttatum (Noodoo Lily) is the only proven function of AOX in higher plants. Nonetheless, a number of other possible advantages of using AOX have been suggested. As many plants release cyanide following damage or infection, the AOX would provide a cyanide resistant means to maintain at least partial mitochondrial function. In addition, AOX has been suggested to function in an energy overflow system, maintaining a partial electron transport chain to allow TCA cycle to proceed in the absence of adenylate regulation.
  • the AOX and the conventional cytochrome oxidases are expressed in a stage specific manner.
  • the procyclic stages, found in the tsetse fly, have well developed cristae in their mitochondria and synthesise ATP by oxidative phosporylation.
  • long slender forms of the parasite, found in the blood stream of the mammalian host are reliant on glycolysis, which takes place in the glycosome.
  • the NADH produced as a result of glycolysis is re-oxidised in the mitochondria by a system comprising, glycerol-3-phosphate dehydrogenase, ubiquinone and AOX.
  • the mitochondria of the procyclic forms lack cytochrome oxidases and are incapable of oxidative phosphorylation.
  • the apparent absence of a conventional respiratory chain in C. parvum raises the possibility that it may also posses a modified respiratory chain similar to that observed in T brucei.
  • the advantage conferred in these circumstances would be the ability to re-oxidise NADH in the anaerobic environment in which it survives for most of its life cycle.
  • T. gondii and P. falciparum that are capable of oxidative phosporylation, the advantage of employing an AOX for energy demands would not be clear.
  • ROS mitochondrial reactive oxygen species
  • TGG 7014 contained sequences homologous to EPSP synthase, shikimate kinase, dehydroquinase and shikimate dehydrogenase.
  • TGG 3535 a fragment of genomic (g)DNA of approximately 5kb, contained sequences homologous to DHQ synthase the remaining enzyme present in the fungal AROM.
  • PCR was used to amplify a region spanning the two fragments, the sequence of which confirmed that the fragments were contiguous. This established that these five enzymes are clustered in the T. gondii genome.
  • the cDNA sequence was determined. Initially, a probe was generated from a region of the putative DHQ synthase to screen a T. gondii (RH strain) tachyzoite cDNA library. This obtained the 5' region of the putative DHQ synthase gene including the initiation codon.
  • an alternative approach involving RT-PCR was used to amplify cDNA from T.
  • T. gondii and a series of overlapping cDNA clones were obtained and sequenced.
  • the clones were assembled, which revealed a lOkb sequence that had a single open reading frame encoding a polypeptide of 3332 amino acids with a predicted molecular weight of 361.7 kDa.
  • Comparison of the cDNA with the gDNA sequence reveals the gene consists of 20 exons (FIG. 26(A)).
  • TgAROM T. gondii AROM
  • the predicted T. gondii AROM (TgAROM) polypeptide has all the domains, known to be highly conserved in fungal AROMs with all the enzyme domains arranged in the same order as observed in fungi (FIG. 26(B)).
  • TgAROM has a number of obvious differences from the fungal counterparts.
  • the protein is considerably larger than the fungal AROMs, which range in size from 1563 amino acids in Neurospora crassa to 1588 amino acids in Saccharomyces cerevisiae.
  • the T gondii AROM protein has a number of insertions not present in the fungal counterparts. Analysis of the relative hydrophobicity and charge of these regions, using the ExPASy ProtScale tool (http://us.expasy.org/cgi-bin/protscale.pl), suggests that these areas could form exposed surface loops. The functions of these regions are not obvious although similar hydrophilic insertions have been noted in a number of apicomplexan enzymes including chorismate synthase.
  • nidulans has been expressed in E. coli and the 3D structure determined by X-ray crystallography. As this is the only component of the AROM polypeptide to have been studied in depth, the DHQ synthase domains from both the T. gondii and E. nidulans AROMs were compared to determine if the key features are conserved between both proteins (FIG. 34D). All the key residues identified by Carpenter et al, (1998) which are known to be involved in the mechanism of the E. nidulans DHQ synthase are conserved within the T. gondii protein. These include the residues corresponding to E.
  • the residues identified as important in the binding of the DAHP substrate analogue, carbaphosphonate (Lys 152, Asn 268, His 275 and Lys 356 and Arg 130) are conserved within the TgAROM protein. This provides insight into the rational design of other possible inhibitors for the T. gondii DHQ synthase.
  • DAHP synthase catalyses the first committed step in the shikimate pathway.
  • Two classes of this enzyme have been described.
  • Class I (AroAi) were originally described as 39kDa proteins similar to the E. coli enzymes and paralogues, but can now be subdivided into AroA ⁇ ⁇ and AroAi ⁇ exemplified by the E. coli orthologues and the B. subtilis orthologues respectively.
  • Many fungal and one Oomycete, Phytophtora infestans have had Class I (AroA ⁇ ) genes sequenced, suggesting a wide eukaryote taxonomic distribution.
  • AroA ⁇ Class II DAHPs were originally described as similar to the 54kDa higher plant enzymes, but are now known also to exist in a number of divergent microbes such as Streptomyces and in the fungi N. crassa.
  • AroA ⁇ are feed back inhibited by arogenate a precursor of phenylalanine and tyrosine.
  • Many bacteria, including E. coli have 3 paralogous AroAi, DAHPs designated AroF, AroG and AroH that are inhibited by tyrosine, phenylalanine and tryptophan respectively.
  • fungi N the fungi N.
  • crassa and several prokaryotes possess both Class I and II DAHP synthases consequently, it has been suggested that the two DAHPs classes may have different functions, for example the fungus, N. crassa and the bacterium Streptomyces hygroscopicus class II enzymes have been linked to secondary metabolism such as the production of antibiotics.
  • T. gondii DAHP synthase was a member of the AroA ⁇ family.
  • the T. gondii DAHP synthase (TgDAHP) is 615 amino acids in length and has a predicted molecular weight of 67.4 kDa, significantly larger than the previously described Class II enzymes due to the presence of a number of insertions (data not shown) analogous to those observed in the other shikimate pathway enzymes.
  • the fungi and apicomplexa lineages are distant relatives within the eukaryotic evolutionary tree.
  • the shikimate pathway is ancestral to eukaryotes and has evolved through vertical decent, or a horizontal gene transfer (HGT) event has occurred between these two lineages.
  • HGT horizontal gene transfer
  • alternative evolutionary scenarios should also be considered. These include the possibility that the shikimate pathway genes may have been derived from independent HGT events or alternatively, from endosymbiotic gene transfer from either the mitochondrial or the apicoplast endosymbiont.
  • the DHQase domain is best aligned by focusing on the lysine residue involved in the formation of the covalent imine intermediate, which is characteristic of the type I family of DHQases. This residue lies at the centre of an eight stranded ⁇ / ⁇ barrel which forms the core of this domain. Secondary structure predictions of the DHQase portion from the T. gondii AROM polypeptide can identify many, but not all of the components of this ⁇ / ⁇ barrel structure. Further analysis at the structural level maybe required to fully determine if this sequence is capable of forming the correct ⁇ / ⁇ barrel structure.
  • the phylogeny for the DHQ synthase was poorly supported and did not resolve a tree topology with any confidence. Several attempts were made to adjust the alignment and character sampling to improve the resolution of the phylogenetic tree. The phylogeny did not resolve whether the DHQ synthase was more closely related to fungal homologs or clustered within the prokaryote homologs (data not shown). Leaving unsolved the evolutionary origin of the T. gondii DHQ synthase AROM domain, which plausibly may have evolved from a separate HGT event from a prokaryote source. However, the DHQ synthase phylogeny confirmed that the T. gondii DHQ synthase gene did not originate from the apicoplast genome as the T. gondii enzyme did not cluster with either the plants or the cyanobacteria on our phylogenetic tree.
  • gondii are related by vertical decent, from a distant eukaryotic ancestor of both lineages as all four phylogenies show the grouping of T. gondii with the Fungi. Although HGT between the Fungi and T. gondii lineages could explain the tree topologies recovered, this explanation is less parsimonious than the hypothesis of vertical decent as it would require the transfer of three genetic units, the AROM, DAHP synthase and chorismate synthase between these two lineages.
  • the EPSP phylogeny shows the plants grouping next to the cyanobacteria
  • FIG. 26A shows the plant homologs clustered within a diverse group of bacteria but with no clear affiliation with the cyanobacterial homologs. Suggesting that the plant shikimate dehydrogenase gene is not of plastidic origin. However, the shikimate dehydrogenase phylogeny is weakly supported through out the tree topology, making it inappropriate to exclude an origin from the chloroplast genome.
  • the shikimate pathway may have been an ancestral trait in eukaryotes another possibility had to be considered. That is, the T. gondii genes may have been derived directly from the nuclear genome of the algal endosymbiont that is responsible for the apicoplast. Analysis could not exclude this possibility. Given that the shikimate pathway and the AROM supergene appear to have a wide eukaryotic distribution, it is plausible that the algal nucleus may have contained the ancient eukaryotic shikimate pathway genes with an AROM like polypeptide.
  • shikimate pathway genes in plants may have been inherited from the prokaryote progenitor of the chloroplast. This endosymbiotic gene transfer would be evident if the plant shikimate pathway proteins clustered with the cyanobacteria in phylogenies. Phylogenetic evidence for this endosymbiotic gene transfer was found in two of the phylogenies; shikimate kinase (FIG. 25 B) and chorismate synthase. However the shikimate kinase gene transfer between the cyanobacteria and plant is only weakly supported with a bootstrap value of 50%. Table: 4
  • Polyarginine peptides were synthesized using solid phase techniques and commercially available fluorenylmethoxycarbonyl (Fmoc) amino acids, resins and reagents using commonly available peptide synthesizer and techniques well established within the scientific literature. Fastmoc cycles were used with O-(7- azabenzotriazol-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate (HATU). The peptides and conjugates were cleaved from the resin using 95% trifluoroacetic acid (TFA) and 5% triisopropyl silane for 24 h.
  • Fmoc fluorenylmethoxycarbonyl
  • Genomic DNA and cDNA libraries were screened to identify and characterize the T. gondii Fabl gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program.
  • the cDNA library was constructed using tachyzoites of the RH strain of T. gondii and the ⁇ -Zap II phage vector (Stratagene).
  • the gDNA library was constructed using genomic DNA from the RH strain of T. gondii and the ⁇ -DASH II bacteriophage vector (Stratagene).
  • cDNA and genomic DNA libraries were titered to determine the ⁇ phage concentrations.
  • XL 1 -Blue MRA for genomic library screening
  • XL 1 -Blue MRF' for cDNA library screening
  • E. coli E. coli was infected with 50, 000 plaque forming units (pfu), spread on NZY plates and incubated overnight at 30° C. Phage containing T. gondii DNA was then transferred onto nitrocellulose filters.
  • the DNA was crosslinked to the nitrocellulose filter using a UN Crosslinker (Stratagene).
  • the filters were prehybridized in a solution containing denatured salmon sperm D ⁇ A. This step was done in order to reduce non-specific binding of the radioactively labeled D ⁇ A probe to the membranes.
  • the prehybridization solution also contained 2X Pipes buffer, 50% deionized formamide and 0.5%) SDS.
  • the filters were prehybridized for two hours in this solution at 42 ° C while shaking at 225 RPM. While prehybridization was taking place, the D ⁇ A probe with labeled with 32p using a random primed D ⁇ A labeling kit (Roche).
  • the labeled probe was denatured and added to a bag containing the membranes in freshly prepared hybridization solution.
  • the filters were allowed to shake at 225 rpm overnight at 42° C. In this step, the probe hybridized with homologous T. gondii sequences present on the filters.
  • the hybridized filters were washed three times under high stringency conditions using 0.1 X SSC and 0.1% SDS that was heated to 60° C. This step removed radioactive probe that was not specifically bound to the filters. Washed filters were then exposed overnight at -70° C with Kodak BioMax Film. Development of the exposed film revealed hybridization of the labeled probe with DNA from the T. gondii libraries and was visualized as dark spots on the film. Select plaques corresponding to these dark spots were then harvested from the original plates from which the filters were derived and stored at 4° in a solution of chloroform and SM buffer. The phage from these plaques were then titered and used to infect the appropriate host strain of bacteria.
  • the Wizard Mini-Prep DNA Purification Kit (Promega) was used to isolate plasmid DNA from the bacterial cultures. The DNA was then further purified using ammonium acetate precipitation and was quantitated on a 1% agarose gel before being sent to the DNA sequencing facility. The DNA was sequenced using a variety of primers including some from the pBluescript vector and some that were designed using preliminary sequence data. Characterization of DAHP synthase (DAHPS)
  • Genomic DNA (gDNA) and complementary DNA (cDNA) libraries were screened to identify and characterize the T. gondii DAHPS gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program.
  • the cDNA library was made using tachyzoites from the RH strain of T gondii and the ⁇ -Zap II bacteriophage vector from Stratagene®.
  • the gDNA library was created using genomic DNA from the RH strain and the ⁇ -Dash II bacteriophage vector from Stratagene®.
  • a multi-sequence alignment of various plant and yeast DAHPS amino acid sequences was made and regions of conservation were identified. Using these conserved amino acid sequences to do BLAST searches, two discontinuous gDNA sequences containing portions of the 3' end of the T. gondii DAHPS gene were identified in the T. gondii DNA database (Toxodb.org). Both sequences were translated, analyzed, and compared to known DAHPS. PCR primers were designed based upon regions in the multi-sequence alignment and used to obtain and amplify a continuous DNA sequence using both RH and Me49 strains of T. gondii as the PCR template. The PCR products were isolated using a QIAX II R extraction kit.
  • the DNA was then cloned into E. coli using a TOPO TA Cloning ® kit and plated for amplification. Optimal colonies were selected and the DNA was extracted and purified through a Mini-Prep ® . A digest was then run to cut out the desired DNA sequences from the vectors they were cloned into using the EcoRl enzyme. Following a Mini-Prep ® purification, the DNA was sequenced. After analysis of the sequence data, a PCR product of the Me49 strain was selected for use as a probe to screen the gDNA and cDNA libraries.
  • Genomic DNA (gDNA) and complementary DNA (cDNA) libraries were screened to identify and characterize the T. gondii DAHPS gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program.
  • the cDNA library was made using tachyzoites from the RH strain of T. gondii and the ⁇ -Zap II bacteriophage vector from Stratagene®.
  • the gDNA library was created using genomic DNA from the RH strain and the ⁇ -Dash II bacteriophage vector from Stratagene®. Both cDNA and gDNA libraries were titred to determine the ⁇ phage concentrations of the stock library in order to infect E. coli at correct concentrations of the phage.
  • XLl-Blue MRA for gDNA library screening
  • XLl-Blue MRF' for cDNA library screening
  • the DNA probe was radioactively labeled with P using a Roche ® random primed DNA labeling kit.
  • the nitrocellulose membranes were prehybridized for two hours at 42 ° C in a hybridization solution of 2X Pipes buffer, 50 percent deionized formamide, 0.5 percent SDS, and denatured salmon sperm DNA.
  • the labeled probe was denatured through heating at 100° C for five minutes and added the hybridization solution. The membranes were incubated overnight at 225 rpm and 42° C to allow the probe to hybridize with homologous T.
  • gondii sequences on the nitrocellulose membranes were washed three times using 0.1 X SSC and 0.1% SDS heated to 60° C to remove radioactive probe not specifically bound to the membranes. Film was then placed on top of the membranes and allowed to expose at -70° C. After approximately 16-18 hours, the film was developed to capture the radiation signals of the hybridized probe. Using the dark spots on the film as a guide, select positive plaques were cored out of the specific NZY plates from which the T. gondii DNA had been lifted off. The plaques were stored in a mixture of 20 ⁇ l chloroform and 500 ⁇ l SM buffer. Nortexing allowed the chloroform to draw out the phage. The library screening process was then repeated using this using a correct dilution of this solution to infect E. coli with 50, 000 plaque forming units again.
  • T. gondii D ⁇ A inserted into the ⁇ -ZapII vector will be extracted and cloned into pBluescript phagemids by infecting XLl-Blue MRF' E. coli with purified phage and incubating for 15 minutes at 37 ° C with ExAssist Helper Phage. Three milliliters of LB broth will then be added and the solution will be allowed to incubate at 37 ° C for 2.5 hours.
  • the solution will be heated to 65 ° C for 20 minutes and spun at lOOOg for 15 minutes.
  • SOLR cells will then be infected using the resultant supernant containing the excised pBluescript phagemids which will then plated onto LB cultures containing ampicillin and incubated at 30 ° C overnight. Select colonies will be harvested from the plates and cultured overnight at 37 ° C in LB broth.
  • Plasmid DNA purified through a Mini-Prep® will then isolate plasmid DNA from the bacterial cultures. The DNA was further purified using ammonium acetate precipitation and sent for sequencing. Inhibition of the shikimate pathway with Aurintrycarboxylate (ATA) ATA's inhibition of T.
  • ATA Aurintrycarboxylate
  • gondii growth was assessed over multiple 1 and 4- day periods using human foreskin fibroblasts (HFF) as host cells. Toxicity for HFF was tested simultaneously by treating uninfected HFF with the same concentrations of this compound. For both challenge experiments, HFF were grown until a confluent mono-layer covered the bottom of a 96-well culture plate at 37 ° C.For toxicity experiments HFF were incubated at lower concentrations so they were nonconfluent and not contact inhibited in order to assess effect of the compound on growth of fibroblasts. Challenge plates were then infected with 10 3 tachyzoites of the RH strain of T. gondii.
  • triplicate culture wells were then treated with appropriate levels of either sulphadiazine(46 ⁇ M), pyrimethamine(0.4 ⁇ M ), ATA (473.6 ⁇ M, 236.8 ⁇ Mm 118,4 ⁇ M, 23.7 ⁇ M, 20 ⁇ M, lO ⁇ M, 5 ⁇ M, l ⁇ M , or 0.5 ⁇ M), or a combination of the three.
  • PABA rescue experiments were conducted with the infected HFF being treated with the of the above listed compounds in combination with PABA (lO ⁇ M). Culture plates were then incubated at 37 ° C for either one or four days.
  • HFF HFF were labeled with radioactive thymidine 24 hours before the end of the experiment and in challenge experiments, RH T gondii were radioactively labeled with uracil 24 hours before the end of the experiment. After incubation, at the end of the either a 1 or 4 day experiment, the HFF mono-layer was washed with Hank's solution and then harvested and counted using a TOP Count® .
  • Peptides were synthesized using solid phase techniques and commercially available fluorenylmethoxycarbonyl (Fmoc) amino acids, resins and reagents (PE biosystems, Foster City, California and Novabiochem, San Diego, California) using Applied Biosystems 433 Peptide Synthesizer. Fastmoc cycles were used with O-(7- azabenzotriazol-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate (HATU). The peptides and conjugates were cleaved from the resin using 95% trifluoroacetic acid (TFA) and 5% triisopropyl silane and for 24 h.
  • Fmoc fluorenylmethoxycarbonyl
  • Triclosan was reacted with glutaric anhydride (GA) in the presence of DIPEA to provide the desired glutaric acid product, i.e., Triclosan-GA-Arg n -CONH 2; 7 and 8. Attachment of the transporter was accomplished by the solution phase reaction with the appropriate oligomer of D- or L-arginine.
  • Triclosan-AA-Arg 8 -CONH 9 the previously described ⁇ -substituted acetic acid product was attached to the transporter by reaction with the resin-bound octa-L- arginine(Pbf). The conjugate was subsequently cleaved from the resin, and the Pbf sulfonamides removed.
  • HPLC HPLC to monitor the change in the ratio of conjugate to internal standards (benzoic acid) over time. Maintenance of T. gondii tachyzoites.
  • HFF Human foreskin fibroblasts
  • FCS Fetal Calf Serum
  • Tachyzoites of the RH strain were maintained by serially passing the parasite in HFF on a weekly basis. At this time approximately 70-90% of the HFF are infected with the parasite.
  • Parasites used in experiments were passed through a 25 gauge needle and centrifuged at 400g for 15min at 4°C. Green fluorescent protein, plastid-labeled, RH strain parasites were provided by B. Streipen and D. Roos (University of Pennsylvania). Production and isolation of T. gondii cysts.
  • the mixture was underlayered with 2ml 90% Percoll and then centrifuged at 2500 x g at 18 °C. Cysts that co-purify with erythrocytes were concentrated into the bottom layer and 1ml of the upper layer were combined and diluted in 10 volumes of PBS and centrifuged at 2500 x g for 15 min. Erythrocytes were lysed by addition of 1.8ml distilled water to the cyst pellet followed immediately by addition of 0.2 ml of lOx PBS. Cysts were centrifuged at 100 x g for 10 min and resuspended in PBS 2% FCS for uptake studies. Uptake of polyamines into T. gondii using deconvolution microscopy.
  • Live cells were examined using Zeiss Axiovert inverted fluorescence microscope or Zeiss Axioplan both equipped with cooled CCD camera (MicroMAX). Image capture and deconvolution were performed with Slidebook or Openlab (Improviosn, Ltd) on Macintosh Dual Processor G4. Optical sections were taken through the depth of the cell and the software used to deconvolve these images and construct 3-D volume views. Uptake of polyamines into T. gondii using flow cytometry.
  • the parasites were washed 3x in cold PBS (1ml) and resuspended in approximately 200 ⁇ l of PBS.
  • the cells were analyzed by flow cytometry using a FACScan with data acquisition and analysis using Cell Quest software (Becton Dickinson). Flow cytometric studies were also carried out similarly with transgenic parasites expressing GFP and using rhodamine conjugate ent-6.
  • a cDNA library was screened to identify and characterize the T. gondii
  • the library was obtained from the NIH AIDS Research and Reference Reagent Program.
  • the cDNA library was constructed using tachyzoites of the RH strain of T. gondii.
  • a genomic DNA sequence containing a portion of the 3' end of the T. gondii ENR gene was identified by searching the T. gondii DNA data base with ENR DNA sequences from malarial parasites. An amino acid sequence of the 3' end of T. gondii ENR was deduced from this genomic DNA and compared with other ENR sequences including B. napus, E. coli and P. falciparum. PCR primers were designed and used to amplify a portion of the 3' end of the target gene using genomic DNA from the RH strain of T. gondii as the PCR template.
  • the T. gondii ENR probe was used to identify six clones that were isolated from the T. gondii cDNA library. Analysis of the cDNA sequences derived from the 6 clones revealed that 4 of the clones contained the entire ENR cDNA sequence and that 2 of the clones contained only partial sequence of T. gondii ENR. The largest cDNA ENR clone contained 3462 nucleotides. [000208] The amino acid sequence of T. gondii ENR was deduced by translation of the cDNA sequence and revealed that there are 417 amino acids in the putative protein. The deduced amino acid sequence of T. gondii ENR was aligned with sequences of ENR from P.
  • T. gondii ENR T. gondii ENR
  • TgENR T. gondii ENR
  • Amplified DNA encoding residues 103-417 of TgENR was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEN (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag.
  • pMALcHT pMALc2x vector
  • pSTP8 was transformed into BL21 Star (DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21- CodonPlus (DE3) cells (Stratagene) and a plasmid (pKM586) encoding the TEV protease. Cells were grown, harvested and lysed as described in reference 24. Cell lysate was clarified by centrifugation and applied to a 5 ml HiTrap Chelating HP column (Pharmacia).
  • TgE ⁇ R Toxoplasma gondii
  • crotonyl-CoA crotonyl-CoA
  • the standard reaction mixture in a total volume of 100 ⁇ l contained 20 mM Na/K phosphate buffer pH 7.5, 100 mM NaCI, 100 ⁇ M crotonyl-CoA (Sigma), 100 ⁇ M NADH (Sigma), 10% glycerol and 0.04 ⁇ g of pure recombinant TgENR.
  • Inhibition by r8-Triclosan over a 24 hour period was measured by incubating TgENR (14.5 nM) at 37 °C with different concentrations of r8-Triclosan (2.5 ⁇ M, 0.5 ⁇ M, 100 nM, 20 nM, 4 nM, 800 pM and 160 pM) in 20 mM Na K phosphate buffer pH 7.5, 100 mM NaCI, 10% glycerol. Aliquots were removed at 0, 12 and 24 hours and assayed for TgENR activity.
  • the IC 50 value at 24 hours is an upper limit because inhibition can not be properly measured near the concentration of TgENR used in these assays (11.6 nM).EN.REFLIST.
  • Assays to assess inhibition of T. gondii tachyzoite growth in vitro Human foreskin fibroblasts were cultured in 96-well plates (Corning) at a concentration 1 x 10 4 in lOO ⁇ l in IMDM-C.
  • Triplicate cultures were treated with either releasable triclosan conjugate 7, [triclosan-glutaric acid- arg 8 - CONH 2 ] (T-r8) or a non releasable triclosan conjugate, 4, [triclosan-Orn(FITC)-arg 8 - CONH ] (Tr ⁇ NRF).
  • a combination of pyrimethamine 0.1 ⁇ g/ml and sulfadiazine 25 ⁇ g/ml was used.
  • Labtek slides with parallel experimentally treated cultures were fixed in aminoacridine, stained with Giemsa and examined microscopically. Effect of antimicrobial agents on host cells in vitro.
  • mice there were at least 5 mice per group. There were triplicate cultures for each data point for each in vitro assay. Each experiment was performed at least twice. Statistical analysis was with Student's T test or Chi square analyses or one-way ANOVA or Tukey's test. Expression and purification of pfENR using the pMALc2x vector.
  • the coding sequence of P. falciparum ENR was amplified from gDNA of the 3D7 strain of P. falciparum using PfuTurbo polymerase (Stratagene).
  • the primers (For) 5'- GGTGGTGAATTCTCAAACATAAACAAAATTAAAGAAG -3' and (Rev) 5'- GGTGGTGTCGACTTATTCATTTTCATTGCGATATATATC -3', were used to amplify nucleotides encoding amino acids 85-432 and to introduce a proximal EcoRI and distal Sail site (underlined) in the PCR product.
  • Nucleotides encoding the amino-terminal 84 residues of pfENR were excluded because this region is principally composed of a signal peptide and an organellar transit peptide.
  • the resulting amplicon was digested with EcoRI and Sail and ligated into the pMALc2x vector (New England Biolabs).
  • the resulting pSTP6 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid isolated from BL21-CodonPlus(DE3) cells (Stratagene) and used for the expression of MBP- ENR fusion protein.
  • Cells were grown in LB medium at 37° C to an optical density at 600 nm of 0.8 and then induced with the addition of IPTG to a final concentration of 0.4 mM. The culture was maintained in shaker flasks at 20° C for 12 hours and then harvested by centrifugation. [000216] Cells were resuspended in lysis buffer (20mM Na/K phosphate pH 7.5, 1 mg/ml lysozyme (Sigma), 2.5 ⁇ g/ml DNAse I (Sigma), 200mM NaCI) and sonicated. Cell lysate was clarified by centrifugation and applied to a 10 ml amylose column (New England Biolabs) for affinity purification (FIG.
  • lysis buffer 20mM Na/K phosphate pH 7.5, 1 mg/ml lysozyme (Sigma), 2.5 ⁇ g/ml DNAse I (Sigma), 200mM NaCI
  • a second construct of pfENR also containing residues 85-432 was designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease.
  • the amplicon described above was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEV (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag (FIG. 20B).
  • the resulting ligation product, pSTP7 was transformed into BL21 Star(DE3) cells (Invitrogen).
  • the coding sequence of P. falciparum ENR was amplified from gDNA of the 3D7 strain of P. falciparum using PfuTurbo polymerase (Stratagene).
  • the primers (For) 5'- GGTGGTGAATTCTCAAACATAAACAAAATTAAAGAAG -3' and (Rev) 5'- GGTGGTGTCGACTTATTCATTTTCATTGCGATATATATC -3', were used to amplify nucleotides encoding amino acids 85-432 and to introduce a proximal EcoRI and distal Sail site (underlined) in the PCR product.
  • Nucleotides encoding the amino-terminal 84 residues of pfENR were excluded because this region is principally composed of a signal peptide and an organellar transit peptide.
  • the resulting amplicon was digested with EcoRI and Sail and ligated into the pMALc2x vector (New England Biolabs).
  • the resulting pSTP6 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid isolated from BL21-CodonPlus(DE3) cells (Stratagene) and used for the expression of MBP-ENR fusion protein.
  • Cells were grown in LB medium at 37° C to an optical density at 600 nm of 0.8 and then induced with the addition of IPTG to a final concentration of 0.4 mM. The culture was maintained in shaker flasks at 20° C for 12 hours and then harvested by centrifugation.
  • reaction mixture was desalted with a HiPrep 26/10 Desalting column (Pharmacia) and applied to a SP Sepharose cation exchange column (Pharmacia). Column fractions containing pure pfENR protein were pooled for further analysis.
  • a second construct of pfENR also containing residues 85-432 was designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease.
  • the amplicon described herein was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEV (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag.
  • the resulting ligation product, pSTP7 was transformed into BL21 Star(DE3) cells (Invitrogen).
  • the linker region of the pMALc2x vector was modified to contain a TEV protease cut site followed by a six histidine tag, generating the pMALcHT expression vector (FIG. 20B).
  • This vector was cotransformed into E. coli along with a plasmid encoding the TEV protease (pKM586) and a plasmid encoding three rare tRNAs (pRIL)..
  • pKM586 plasmid encoding the TEV protease
  • pRIL rare tRNAs
  • a long, low temperature induction period during the expression of the MBP-ENR fusion protein also served to expose the fusion protein to digestion by constitutively expressed TEV protease.
  • the resulting pfENR digestion product could then be purified via a histidine tag exposed by cleavage.
  • Crystals of pfENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 ⁇ l of the protein solution (12 mg/ml pfENR in 20 mM Na/K phosphate pH 8.0, 150 mM NaCI, 5 ⁇ M NAD + and 6 ⁇ M triclosan) with 2.5 ⁇ l of the reservoir solution at 290 K.
  • Initial screening of crystallisation conditions was conducted using Crystal Screen 1, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) of which the Peg/Ion screen solution 11 (20% (w/v) PEG 3350 and 200mM KI) produced the best quality crystals.
  • This aforementioned screen was optimised, changing both the pH and precipitant concentrations to achieve an optimal reservoir solution composed of 19.5 % (w/v) PEG 3350 and 230 mM KI. This condition produced good quality crystals which took four to five weeks to reach a size of 0.15 x 0.10 x 0.10 mm 3 .
  • X-ray analysis at the Daresbury Synchrotron Radiation Source (SRS) of crystals frozen at 100 K using 20% glycerol as a cryo protectant showed that they diffracted to beyond 2.2 A. Rotation images were collected with 1° oscillation width and 1 minute exposure times on an ADSC Quantum 4 detector at station 14.1.
  • T. gondii ENR closely mirror those described for pfENR.
  • Constructs of tgENR were designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease.
  • the tgENR gene was amplified with a 5' EcoRI endonuclease cleavage site and a 3' Sail endonuclease cleavage site " for insertion into the multiple cloning site of the pMALc2x vector (New England Biolabs).
  • the tgENR amplicon was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEN (Tobacco Etch Virus) protease cut site followed by a six histidine tag.
  • TEN tobacco Etch Virus
  • the sequence of the resulting ligation product was verified and it was transform into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21-CodonPlus(DE3) cells (Stratagene) and a plasmid (pKM586) encoding the TEV protease (Kapust & Waugh, 2000).
  • crotonyl-ACP is the physiological substrate of tgENR
  • crotonyl-coenzyme A can be used in place of crotonyl-ACP as a substrate in the assay of pfENR.
  • Crotonyl-coenzyme A is a facile substrate of tgENR as well.
  • the standard reaction mixture will contain 100 mM Na/K phosphate buffer pH 7.5, 150 mM NaCI, 100 ⁇ M crotonyl-CoA (Sigma), 100 ⁇ M NADH (Sigma).
  • the reactions are initiated at 25°C by addition of 1 ⁇ g of pure recombinant tgENR.
  • This assay was used to monitor tgENR inhibition by an octaarginine tagged triclosan compound over a 24 hour period. Hydrolysis of the octaarginine tag released triclosan, leading to decreasing IC50 values (11 nM at 24 hours) over the time course of the experiment.
  • Nonlinear regression analysis was performed using GraphPad Prism software.
  • IC 50 values for common ENR inhibitors e.g. triclosan
  • indole naphthyridinone compound 4 from Affinium Pharmaceuticals and compounds from the Walter Reed Army Institute of Research (WRAIR).
  • the compounds identified at WRAIR may ultimately come from two different sources: from the WRAIR chemical database (200,000+ compounds) or from chemical synthesis by WRAIR medicinal chemists (and contract chemists). These compounds will be screened for activity against pfENR at WRAIR. Compounds with IC50 values against pfENR in the low micromolar range will be tested against tgENR.
  • Crystals of tgENR were prepared by the hanging drop vapor diffusion method. Crystals of TgENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 ⁇ l of the protein solution (20 mg/ml TgENR in 20 mM Tris pH 7.5, 100 mM NaCI, 5 ⁇ M NAD + and 6 ⁇ M triclosan) with 2.5 ⁇ l of the reservoir solution at 290 K. Initial screening of crystallization conditions was conducted using Crystal Screen, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) followed by optimization of promising conditions. The best crystals grow in a reservoir solution composed of 1.6M Ammonium Sulfate pH 9 and take one week to reach a size of approximately 0.1 x 0.05 x 0.3 mm .
  • Inhibitor complexes of tgENR will be obtained through cocrystallization with the compound, a technique that proved successful in obtaining the structure of triclosan bound to pfENR.
  • Compounds with poor solubility will be solubilized in DMSO or ethanol and then diluted with the appropriate buffer for cocrystallization experiments. If precipitation occurs with this procedure, the compounds will be dissolved in ether and evaporate drops of the solution on cover slips. A drop of mother liquor containing one or more crystals will be placed on top of the dried compound and the cover slip will be inverted over a well containing mother liquor and sealed. The crystal will be allowed to equilibrate with the solid compound for several weeks. Data collection and reduction
  • Diffraction data is collected using the departmental X-ray facility or at an
  • the departmental facility is based around a Rigaku RU200 rotating anode generator and a copper anode.
  • the system provides X-rays for two identical data collection stations. On each station the X-rays are focused on the crystal with a helium filled MSC/YALE optical twin platinum/nickel mirror system.
  • the specimen crystal is mounted in a fiber loop in a stream of nitrogen gas at 100K, produced by a Oxford Cryosystems cryostream cooler.
  • the diffracted X-rays are measured using a MarResearch MAR345 image plate detector system and the resulting images analysed and processed with a cluster of SGI workstations and Linux PCs.
  • Suitable International Synchrotron sources which the group have routinely used and on which time will be made available include those at ESRF Grenoble and SRS Daresbury.
  • the ESRF Synchrotron provides a variety of beamlines which are suitable for the use of multiple wavelength anomalous dispersion techniques (MAD) for the structure determination of proteins (BM14, ID 14.4 and ID29). This can include the exploitation of anomalous scattering from Selenium incorporated in the protein as seleno-methionine or from other heavy atoms which have been soaked in to pre grown crystals. Specific stations on the Grenoble ring are particularly well suited for data collection on crystals that are either very small or which have long cell dimensions (microfocus beamline).
  • the beamtime allocation for the Sheffield at the ESRF has provided access at approximately 4 monthly intervals.
  • the latter allocations are awarded following scrutiny of bids providing details of the current projects in the laboratory.
  • the group can bid through a rapid response mechanism for allocation of beamtime for high priority projects.
  • the Daresbury Synchrotron Radiation Source (beamlines 14.1, 14.2 and 9.6) can be used for high resolution data collection and the position of this laboratory, less than 50 miles from Sheffield makes this particular Synchrotron very convenient.
  • the Sheffield group has a guaranteed allocation of beamtime at Daresbury which provides Synchrotron access every 4 to 6 weeks.
  • a major role in this interaction is via the nicotinamide ring of the NAD + .
  • an important element of the inhibition is the formation of a covalent bond between the 2' hydroxyl of the nicotinamide ribose and the boron of the drug.
  • the formation of this covalent bond also explains why the replacement of the B-N group in the diazaborine by an isoelectronic C-C unit in an isoquinoline analogue showed no biological activity.
  • the formation of this covalent bond between the diazaborine and the NAD + on the enzyme effectively creates a tight, non-covalently bound bisubstrate analogue and provides a clear opportunity to mimic this in the design of a novel series of inhibitors.
  • CATALYST 4.7 software (Accelrys Inc., San Diego, CA) (Kurogi & Guner, 2001) after a sufficient body of structure/ activity data has been generated for tg ⁇ NR.
  • CATALYST is an integrated commercially available software package that generates pharmacophores, commonly referred to as hypotheses. It enables the use of structure and activity data for a set of lead compounds to create a hypothesis, thus characterizing the activity of the lead set.
  • HypoGen algorithm At the heart of the software is the HypoGen algorithm that allows identification of hypotheses that are common to the 'active' molecules in the training set but at the same time not present in the 'inactives'. A set of 15 inhibitors will form the training set for the program.
  • CATALYST CATALYST
  • the CATALYST model treats molecular structures as templates comprising chemical functions localized in space that will bind effectively with complementary functions in the enzyme active site.
  • the most relevant chemical features are extracted from a small set of compounds that cover a broad range of activity.
  • Molecular flexibility is taken into account by considering each compound as an ensemble of conformers representing different accessible areas in 3D space. The "best searching procedure" will be applied to select representative conformers within 20 kcal/mol from the global minimum (Grigorov, et al., 1997).
  • the conformational model of the training set was used for hypothesis (pharmacophore) generation within CATALYST, which aims to identify the best 3 -dimensional arrangement of chemical functions explaining the activity variations among the compounds in the training set.
  • the automatic generation procedure using the HypoGen algorithm in CATALYST will be adopted for generation of the hypotheses.
  • the method recommends a collection of 15-20 chemically diverse molecules with biological activity covering 4-5 orders of magnitude for the training set.
  • Pharmacophore generation will be carried out with the 15 ENR inhibitors by setting the default parameters in the automatic generation procedure in CATALYST such as function weight 0.302, mapping coefficient 0, resolution 297 pm, and activity uncertainty 3.
  • An uncertainty ⁇ in the CATALYST paradigm indicates an activity value lying somewhere in the interval from "activity divided by ⁇ " to "activity multiplied by ⁇ ".
  • Hypotheses approximating the pharmacophore of the ENR inhibitors are described as a set of aromatic hydrophobic, hydrogen bond acceptor, hydrogen bond acceptor lipid, positively and negatively ionizable sites distributed within a 3D space. The statistical relevance of various generated hypotheses is assessed on the basis of the cost relative to the null hypothesis and the correlation coefficients. The hypotheses are then used to estimate the activities of the training set. These activities are derived from the best conformation generation mode of the conformers displaying the smallest root-mean square (RMS) deviations when projected onto the hypothesis.
  • RMS root-mean square
  • HypoGen considers a pharmacophore that contains features with equal weights and tolerances. Each feature (e.g. hydrogen-bond acceptor, hydrogen-bond donor, hydrophobic, positive ionizable group, etc) contributes equally to estimate the activity. Similarly, each chemical feature in the HypoGen pharmacophore requires a match to a corresponding ligand atom to be within the same distance or tolerance (Greenidge & Weiser, 2001). [000245] The pharmacophore developed in this study can be used for two purposes.
  • CIS Chemical Information System
  • Genomic DNA from oocysts was extracted. Briefly, TU502 and GCHl oocysts were purified from feces collected from infected calves as previously described. The putative AOX open reading frame was amplified from gDNA using PCR. Primers used to amplify AOX were: sense [5'-ccgctcgtgctgacatgaa-3'j and antisense [5'-gttcattacctgattatgaaataataacaatctcaag-3']. The expression of AOX mRNA in C.
  • cDNA was produced from 7 ⁇ g of RNA using Moloney Murine leukemia virus (MMLV) reverse transcriptase (Invitrogen, Paisley, Scotland UK).
  • MMLV Moloney Murine leukemia virus
  • 7 ⁇ g of RNA was combined with 18 ⁇ l of 5 x first strand buffer (250mM Tris-HCl pH8.3, 375 mM KC1, 15 mM MgCl2), 18 ⁇ l of deoxynucleoside triphosphate mix (10 mM), 9 ⁇ l of 0.1 M dithiothreitol, 80 units of RNAsin ribonuclease inhibitor (Promega), 500ng of random hexamer primers (Promega) and 1200 units of M-MLV reverse transcriptase.
  • 5 x first strand buffer 250mM Tris-HCl pH8.3, 375 mM KC1, 15 mM MgCl2
  • deoxynucleoside triphosphate mix 10 mM
  • PCR products were separated on a 1.5% agarose gel and visualized by ethidium bromide staining under UV illumination. Following excision from the gel, products were purified using the QIAquick Gel Purification kit (Qiagen) according to the manufacturer's instructions and ligated into pDRTVE using the Qiagen PCR Cloning Kit (Qiagen). 2 ⁇ ls of the ligation reaction was used to transform DH5 ⁇ using the heat-shock transformation method of Cohen et al, (1972).
  • Tachyzoites (RH strain) were obtained from the peritoneal exudates of infected ND4 mice. After centrifugation the pellet was subjected to 3 rounds of freeze-thawing. Protein concentration was measured by Bradford assay. Protein extracts were boiled for 5 minutes in sample buffer (75mM Tris, 5% glycerol, 1%SDS and 0.001% bromophenol blue, pH6.8) 30 ⁇ g of protein loaded for each centimeter of gel.
  • sample buffer 75mM Tris, 5% glycerol, 1%SDS and 0.001% bromophenol blue, pH6.8
  • Proteins were separated on 10% polyacrylamide gel containing 0.8% N,N'-bis- methylene acrylamide, 0.1% sodium dodecylsulfate (SDS) and 0.375M Tris-HCl (pH8.8) which were polymerised by the addition of 0.025% tetramethylethylenediamine (TEMED) (Sigma) and ammonium persulfate (Sigma). Electrode buffer consisted of 0.025M Tris, 0.193M glycine and 0.1% SDS (pH8.0). Following electrophoresis for 1 hour at 200V, samples were transferred to a PVDF membrane (micron Separations Inc. Westborough, PA, USA) at 4°C using a semi-dry blotter.
  • PVDF membrane micron Separations Inc. Westborough, PA, USA
  • the PVDF membrane was blocked in PBS, 10% dried milk, 0.1% Tween 20, for 1 hour at room temperature. Following three washes in PBS/Tween 20 the membrane was incubated in PBS/Tween alone, for negative controls or with anti-AOX antibody (polyclonal anti-.T brucei TAO, monoclonal anti- T brucei TAO [MTB(IA2)] or polyclonal anti-voodoo lily [S. gattatum] AOX) and incubated at room temperature for 1 hour with shaking.
  • anti-AOX antibody polyclonal anti-.T brucei TAO, monoclonal anti- T brucei TAO [MTB(IA2)] or polyclonal anti-voodoo lily [S. gattatum] AOX
  • MRBAYES Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Un gène Fab I d'apicomplexan et le gène pour la DAHP synthase dans Toxoplasma gondii et leurs enzymes codées constituent des moyens pour développer de façon rationnelle de nouvelles compositions inhibitrices, utiles dans la prévention et le traitement des maladies liées à l'apicomplexan. On peut, par exemple, utiliser le triclosan en tant que composé principal. L'administration d'inhibiteurs aux micro-organismes au moyen de polymères d'acides aminés courts est un nouveau procédé de traitement des infections actives et une nouvelle méthode pour acheminer des anti-microbiens jusqu'aux parasites latents enkystés. La voie de shikimate est cruciale pour la survie des parasites d'apicomplexan Plasmodium falciparum, Toxoplasma gondii et Cryptosporidium parvum. En raison de son absence chez les mammaliens, elle représente une cible thérapeutique intéressante. L'invention concerne aussi des gènes codant les eznymes de la voie de shikimate T. gondii. Des séquences supposées d'AOX ont été identifiées et séquencées à partir des souches de type 1 et de type 2 de C. parvum. Le gène code pour un polypeptide de 336 acides aminés et comprend une séquence de transit N-terminale similaire à celle présente dans des protéines ciblées sur les mitochondries d'autres espèces. L'oxydase alternative (AOX) est une autre cible des nouveaux agents anti-microbiens pour C. parvum.
EP03788516A 2002-08-15 2003-08-14 Voies d'apicomplexan, inhibiteurs et administration de medicaments Withdrawn EP1534837A4 (fr)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US40403302P 2002-08-15 2002-08-15
US404033P 2002-08-15
US43820503P 2003-01-06 2003-01-06
US438205P 2003-01-06
US46343203P 2003-04-16 2003-04-16
US463432P 2003-04-16
US47288703P 2003-05-23 2003-05-23
US472887P 2003-05-23
PCT/US2003/025571 WO2004016220A2 (fr) 2002-08-15 2003-08-14 Voies d'apicomplexan, inhibiteurs et administration de medicaments

Publications (2)

Publication Number Publication Date
EP1534837A2 true EP1534837A2 (fr) 2005-06-01
EP1534837A4 EP1534837A4 (fr) 2006-09-20

Family

ID=31892261

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03788516A Withdrawn EP1534837A4 (fr) 2002-08-15 2003-08-14 Voies d'apicomplexan, inhibiteurs et administration de medicaments

Country Status (4)

Country Link
EP (1) EP1534837A4 (fr)
AU (1) AU2003259848A1 (fr)
CA (1) CA2535760A1 (fr)
WO (1) WO2004016220A2 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6969514B2 (en) 2003-02-05 2005-11-29 Soll David B Method for treating elevated intraocular pressure, including glaucoma
WO2006095837A1 (fr) * 2005-03-09 2006-09-14 National University Corporation Hokkaido University Structure lipidique membranaire capable de distribuer une substance cible a la mitochondrie
CN118750592B (zh) * 2024-09-06 2025-02-11 华南农业大学 一种缺失TgAROM基因的弓形虫减毒活疫苗
CN120192852B (zh) * 2025-02-28 2025-11-18 华南农业大学 一株弓形虫dahps基因缺失疫苗虫株及其应用

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6403337B1 (en) * 1996-01-05 2002-06-11 Human Genome Sciences, Inc. Staphylococcus aureus genes and polypeptides
CA2291074C (fr) * 1997-05-21 2008-04-01 The Board Of Trustees Of The Leland Stanford Junior University Composition et procede permettant d'ameliorer les transports a travers des membranes biologiques
WO2001027262A1 (fr) * 1999-10-13 2001-04-19 Pantheco A/S Selection de genes utilisant des sequences de pna
AU2002237731B2 (en) * 2000-12-21 2007-03-22 Michael J. Kirisits Fab I and inhibition of apicomplexan parasites

Also Published As

Publication number Publication date
WO2004016220A2 (fr) 2004-02-26
EP1534837A4 (fr) 2006-09-20
AU2003259848A1 (en) 2004-03-03
CA2535760A1 (fr) 2004-02-26
WO2004016220A3 (fr) 2005-02-24

Similar Documents

Publication Publication Date Title
Chiurillo et al. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi
Flannery et al. LFR1 ferric iron reductase of Leishmania amazonensis is essential for the generation of infective parasite forms
Hashimoto et al. Inositol 1, 4, 5‐trisphosphate receptor regulates replication, differentiation, infectivity and virulence of the parasitic protist T rypanosoma cruzi
Griffiths et al. A defect in ATP‐citrate lyase links acetyl‐CoA production, virulence factor elaboration and virulence in C ryptococcus neoformans
Robbins et al. The malaria parasite cyclin H homolog PfCyc1 is required for efficient cytokinesis in blood-stage Plasmodium falciparum
Mavrianos et al. Mitochondrial two-component signaling systems in Candida albicans
Hart et al. Genetic characterization of coenzyme A biosynthesis reveals essential distinctive functions during malaria parasite development in blood and mosquito
Matesanz et al. The cloning and expression of Pfacs1, a Plasmodium falciparum fatty acyl coenzyme A synthetase-1 targeted to the host erythrocyte cytoplasm
Martho et al. The glycerol phosphatase Gpp2: A link to osmotic stress, sulfur assimilation and virulence in Cryptococcus neoformans
WO2004016220A2 (fr) Voies d'apicomplexan, inhibiteurs et administration de medicaments
Cillingová et al. Eukaryotic transporters for hydroxyderivatives of benzoic acid
US20050142113A1 (en) Antimicrobial agents, diagnostic reagents, and vaccines based on unique apicomplexan parasite components
Skariah et al. The FIKK kinase of Toxoplasma gondii is not essential for the parasite’s lytic cycle
Schott et al. Lacking catalase, a protistan parasite draws on its photosynthetic ancestry to complete an antioxidant repertoire with ascorbate peroxidase
Lu et al. Type I and type II fatty acid biosynthesis in Eimeria tenella: enoyl reductase activity and structure
Bhattacharya et al. Role of a differentially expressed cAMP phosphodiesterase in regulating the induction of resistance against oxidative damage in Leishmania donovani
Renaud et al. The HCF101 protein is an important component of the cytosolic iron–sulfur synthesis pathway in Toxoplasma gondii
WO1998003661A2 (fr) Agents antimicrobiens, reactifs de diagnostic et vaccins a base de composants specifiques du parasite apicomplexan
Qasem et al. Mechanistic Constraints on ClpM Expression Underlie Apicoplast Genome Retention in Malaria Parasites
Sorouri et al. MISTR: A conserved MI tochondrial ST ress R esponse network revealed by signatures of evolutionary conflict
Jaremko Identifying Critical Interactions in the Unique Trypanosoma brucei 5S Ribonucleoprotein Complex and Their Role in Ribosome Biogenesis
Lykins et al. From TgO/GABA-AT, GABA, and T-263 mutant to conception of Toxoplasma
Ali et al. Isolation and characterization of a cdc2-related protein kinase 3 (CRK3) from a Sudanese strain of Leishmania donovani
Yeardley Evolutionary histories in microbial eukaryotes of TBCC-domain containing proteins and enzymes that form filaments
Temešinko Importance of mitosomal IscA2 for the activity of cytosolic Fe-S proteins.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

17P Request for examination filed

Effective date: 20050824

RBV Designated contracting states (corrected)

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: KYLE, DENNIS E.

Inventor name: MILHOUS, WILBUR K.

Inventor name: HENRIQUEZ, FIONA L.

Inventor name: ROBERTS, FIONA

Inventor name: COGGINS, JOHN R.

Inventor name: CAMPBELL, SAMANTHA A.

Inventor name: PRIGGE, SEAN

Inventor name: MUENCH, STEPHEN P.

Inventor name: RICE, DAVID W.

Inventor name: ROBERTS, CRAIG W.

Inventor name: HEARN, BRIAN

Inventor name: ROTHBARD, JONATHAN

Inventor name: WENDER, PAUL

Inventor name: KIRISITS, MICHAEL

Inventor name: MACK, DOUGLAS G.

Inventor name: SAMUEL, BENJAMIN

Inventor name: MUI, ERNEST

Inventor name: MCLEOD, RIMA L.

A4 Supplementary search report drawn up and despatched

Effective date: 20060821

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 47/48 20060101ALI20060814BHEP

Ipc: A61K 39/012 20060101ALI20060814BHEP

Ipc: C07H 21/04 20060101ALI20060814BHEP

Ipc: C12P 21/06 20060101ALI20060814BHEP

Ipc: C12N 15/63 20060101ALI20060814BHEP

Ipc: C12N 15/12 20060101ALI20060814BHEP

Ipc: C12N 5/10 20060101ALI20060814BHEP

Ipc: C12N 1/21 20060101ALI20060814BHEP

Ipc: C12N 15/31 20060101AFI20050314BHEP

17Q First examination report despatched

Effective date: 20080717

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110301