AU2003259848A1 - Apicomplexan pathways, inhibitors, and drug delivery - Google Patents

Description

WO 2004/016220 PCT/US2003/025571 APICOMPLEXAN PATHWAYS, INHIBITIORS, AND DRUG DELIVERY [0001] Inventors: Rima L. McLeod, Ernest Mui, Benjamin Samuel, Douglas Mack, Michael Kirisits, Paul Wender, Jonathan Rothbard, Brian Hearn, Craig Roberts, David Rice, Stephen Muensch, Sean PT. Prigge, Samantha A. Campbell, John R. Coggins, Fiona Roberts, Fiona L. Henriquez, Wilbur Milhous, and Dennis Kyle. BACKGROUND [0002] The phylum Apicomplexa consists of a large number of protozoans, including species of Plasmodium, Cryptosporidium, Theileria, Babesia, and Toxoplasma. These parasites cause a wide array of diseases in both humans and livestock. [0003] Apicomplexan infections are among the most common and devastating infectious diseases. Malaria (Plasmodium) kills one child every eleven seconds and three million people every year. It is a cause of substantial morbidity in pregnant women and young children. Toxoplasma gondii, as a model obligate protozoan intracellular parasite, can enter all host cells in nearly all vertebrates and has a special propensity for cyst formation and recrudescence with tissue destruction in the central nervous system. Toxoplasmosis gondii results in a chronic central nervous system infection in more than a third of the world population, as well as acute life threatening disease in immunocomprised individuals. [0004] Toxoplasma gondii is an apicomplexan parasite that can have devastating neurological and ocular effects on those who are infected and can result in systemic disease and death when acquired in utero. Congenitally infected and immunocompromised hosts (caused by AIDS, chemotherapy, malignancy, transplantation or autoimmune diseases and their treatments) suffer the most severe clinical manifestations of infection with T. gondii. [0005] While felines are the definitive hosts to T. gondii's sexual stage, humans act as intermediate hosts for the other two stages of the T. gondii life cycle, the tachyzoite and the bradyzoite. In an acute infection, the fast dividing tachyzoite proliferates within cells in many tissues until it lyses the host cells. In persons who WO 2004/016220 PCT/US2003/025571 2 are immunocompetant, cyst formation begins 8 days after infection and then persists for the remainder of the host's life. The cysts, which contain hundreds of the slow dividing bradyzoites, form in many tissues but especially in muscle and brain. Bradyzoites are more resistant to acid and pepsin and may use anaerobic metabolism, whereas tachyzoites use aerobic metabolism. The tachyzoite to bradyzoite conversion is induced by environmental stress created by the host's immune system. A reverse process is responsible for disease reactivation that results in uncontrollable tachyzoite multiplication and occurs whenever the host's immune functions are impaired. [0006] Malaria is caused by the apicomplexan parasites of the genus Plasmodium. The four common species of Plasmodium (P. falciparum, P. malariae, P. vivax and P. ovale) infect millions of people and account for the death of more than 2 million children annually. The emergence of drug resistance has limited the useful life span of many antimalarial medicines. Current treatments include inhibitors of the folate synthetic pathway such as pyrimethamine and sulphadoxine. [0007] Pyrimethamine inhibits the action of dihydrofolate reductase (DHFR) and thus the production of tetrahydrofolate, which is required for a number of reactions. DHFR is present in humans; pyrimethamine-induced depletion of folate cofactors can lead to bone marrow suppression. Sulfadiazine can cause allergy and is commonly poorly tolerated, which results in problems with compliance. Furthermore, for T gondii this combination therapy acts only on the rapidly dividing tachyzoite stage associated with active disease and does not affect the quiescent bradyzoite stage that forms cysts throughout the body. Thus the encysted bradyzoite forms remain a reservoir of infection even in treated individuals and can give rise to repeated disease reactivation. This is especially evident in congenitally infected and immunocompromised individuals. Disease reactivation is common in the eye and brain where the consequences can be serious. Therapy is often required on multiple occasions and for long periods of time. [0008] Current treatments of pyrimethamine and sulfadiazine block the production of folic acid in the parasite and are effective against the quickly dividing tachyzoite stage of T. gondii. However, these treatments are less than ideal because 25% of the population has allergic reactions to sulfadiazine. Additionally, these anti-microbial agents are not effective against the slowly dividing bradyzoite stage of T gondii, WO 2004/016220 PCT/US2003/025571 3 leaving hosts susceptible to recrudescent infection. Disease reactivation can be extremely detrimental as tachyzoites commonly attack the eye and brain. Frequent and extended periods of therapy are often required. Therefore, new anti-microbials, and new medicines are urgently needed for the treatment of these diseases. I. FabI [0009] A number of plant-like biochemical pathways associated with the vestigial plastid organelle of T gondii and Plasmnodium species have been suggested as new targets for such medicines. [00010] A promising target pathway in apicomplexan parasites is that of fatty acid synthesis because plants and animals use different types of enzymes in their synthesis of fatty acids. Generally, mammals synthesize fatty acids with the help of Type I fatty acid synthases. In this case, the enzymes of fatty acid synthesis form on different domains of a single multi-functional protein. Plants and some bacteria synthesize fatty acids using Type II fatty acid synthases. In this case, the enzymes of fatty acid synthesis are discrete mono-functional proteins. Apicomplexans, including P. falciparum and T. gondii, use Type II fatty acid synthases. However, T. gondii fatty acid synthase, FabI, has not yet been identified or characterized. [00011] Fab I, enoyl acyl carrier protein reductase (ENR), is an enzyme used in fatty acid synthesis. It is a single chain polypeptide in plants, bacteria, and mycobacteria, but is part of a complex polypeptide in animals and fungi. Certain other enzymes in fatty acid synthesis in apicomplexan parasites appear to have multiple forms, homologous to either a plastid sequence, a plant-like single chain enzyme, or more like the animal complex polypeptide. [00012] In the Type II scheme of fatty acid synthesis [FIG. 1(A) and (B)], acetyl CoA and malonyl-CoA are converted to acetyl-ACP and malonyl-ACP with the help of acetyl-CoA-ACP transacylase (ACAT) and malonyl-CoA-ACP transacylase (MCAT). -ketoacyl-ACP synthase (P3- KAS) then catalyzes a condensation reaction to form P-ketoacyl-ACP. This in turn undergoes a reduction, catalyzed by -ketoacyl ACP reductase (1-KAR) to form 3-hydroxylacyl-ACP, a dehydration, catalyzed by 3 hydroxyacyl-ACP dehydrase (p-HAD) to form P3 trans-enoyl-ACP, and a reduction, catalyzed by enoyl-ACP reductase (ENR) to form butyryl-ACP. This cycle of WO 2004/016220 PCT/US2003/025571 4 reduction, dehydration and reduction can repeat up to seven times, and in the case of P. falciparum results in fatty acids with 10, 12 and 14 carbon long chains. [00013] Enzymes of mammalian lipid synthesis form domains on a multi-functional protein, whereas those enzymes in plants and certain bacteria are found on discrete mono-functional polypeptides. These differences have been exploited by a number of compounds which selectively inhibit bacterial or plant enzymes, but do not inhibit mammalian enzymes. Both T. gondii and P. falciparum have been shown to possess mono-functional, plant- or bacterial-like fatty acid biosynthesis enzymes which are targeted to the plastid organelle via a bipartite, N-terminal transit sequence. Compounds such as aryloxyphenoxypropionates, cyclohexanedione herbicides and thiolactomycin which inhibit acetyl-CoA carbozylase (ACC) and 13-ketoacyl-ACP synthase (Fab H) respectively, have been demonstrated to restrict the growth of T. gondii in vitro. [00014] Enoyl acyl carrier protein reductase (ENR) catalyses the NAD (P) dependent reduction of a trans-2,3 enoyl moiety into a saturated acyl chain, the second reductive step in the fatty acid biosynthesis pathway. Studies on the inhibition of ENR by compounds such as the diazaborines support a concept that this enzyme could be a target for the development of new antibacterial agents. [00015] Enoyl-ACP reductase (ENR)-also known as FabI--is an attractive anti microbial target. Triclosan, a common anti-bacterial agent, found in deodorant, toothpaste, soap and plastics, is an inhibitor of ENR. The effects of triclosan on P. falciparum and T. gondii infection in vitro and in vivo have shown it is effective at inhibiting parasite growth. Analysis of B. napus, E. coli and P. falciparum amino acid sequences suggest that 11 residues are critical in triclosan's inhibitory effects. II. The Shikimate Pathyway [00016] Another target pathway in apicomplexan parasites is the shikimate pathway, which is essential for the production of all aromatic compounds in plants, bacteria, and fungi. Characterization of the shikimate pathway in T. gondii is of special interest because the pathway is absent from animals but essential for the parasite, making it a promising target for the development of new anti-parasitic agents.

WO 2004/016220 PCT/US2003/025571 5 [00017] Plant enzymes, although nuclear encoded, are largely active in the chloroplast and accordingly posses a N-terminal transit sequence. In contrast, all fungi examined to date have mono-functional 3-deoxy-D-arabino-heptulosonate 7 phosphate (DAHP) synthases and chorismate synthases and a pentafunctional polypeptide termed AROM. The AROM polypeptide has domains analogous to the bacterial enzymes; dehydroquinate (DHQ) synthase, EPSP synthase, shikimate kinase, DHQase and shikimate dehydrogenase. [00018] The shikimate pathway operates in the cytosol of bacteria and fungi, but in plants it is also known to operate in plastid organelles. The pathway utilizes phosphoenolpyruvate and erythrose 4-phosphate to produce chorismate through seven catalytic steps. While branches exist from various intermediate products of the pathway, chorismate represents the major branch point. The various branches give rise to many end products. Derivatives of chorismate include tryptophan via an anthranilate intermediate, phenylalanine and tyrosine via prephenate or arogenate, and vitamin K and metal chelators containing dihydroxybenzoic acid such as enterochelin via isochorismate. Chorismate also is used for production of ubiquinone and p-amino benzoic acid (PABA), which subsequently is converted into folates. The shikimate pathway also gives rise to many secondary metabolites including flavanones and napthoquinones and there is an alternative version of the pathway with aminated intermediates which give rise to aminohydroxybenzoate (AHBA), the precursor of the ansamycin antibiotics. The shikimate pathway plays a role in production of PABA and folates in apicomplexan parasites. [00019] Twenty percent of the carbon derived from carbohydrate catabolism is utilized in the shikimate pathway in certain organisms, and, therefore, it is a major part of their metabolism. Animals not only lack the shikimate pathway enzymes, but also, with the), lack many of the enzymes downstream of chorismate, dihydrofolate reductase (DHFR) is an exception. This pathway and its branches in apicomplexan parasites provide a number of interrelated targets for antiparasite agents. [00020] Cryptosporidium parvum is another apicomplexan parasite that cuases disease in humans and livestokc. It causes debilitating and life-theatening diarrhea in patients infected with HIV. It can also occur in epidemics where it is most severe in WO 2004/016220 PCT/US2003/025571 6 the young and elderly. There is currently no effective treatment for the disease caused by this parasite. [00021] The shikimate pathway has proven to be a viable target for the herbicide glyphosate. Specifically, 5-enolpyrivylshikimate-3-phosphate (EPSP) synthase, the sixth enzyme in the pathway, has been found to be the target for the widely used herbicide glyphosate. The compound also inhibits EPSP synthase of T. gondii and the growth of T. gondii, P. falciparum, and C. parvum. A number of other compounds that inhibit various other enzymes in the shikimate pathway have been described, and some have been demonstrated to inhibit the growth of bacteria. Surprisingly none of these have been developed commercially. Two of these compounds, the fluorinated analogues of shikimate (6R)-6-fluoro-shikimate and (6S)-6-fluoro-shikimate, were subsequently found to inhibit the growth of P. falciparum in vitro, presumably through competitive inhibition of the shikimate pathway. [00022] Genes encoding many shikimate pathway enzymes have been cloned from various bacteria, plants and fungi. In contrast, chorismate synthase genes of T gondii and P. falciparum are the only apicomplexan representatives cloned and sequenced. [00023] An advantage of developing agents that target the shikimate pathway is their potential to inhibit the growth of bacterial and fungal pathogens as well as apicomplexan parasites. There are growing concerns associated with the emergence of multi-drug resistance bacteria such as Staphylococcus aureus as well as a number of enterococci, Streptococcus pneumonia and enteric gram-negative bacteria. In addition, there is concern about the increased occurrence of multi-drug resistance among Mycobacterium tuberculosis, Salmonella typhi, Shigella species and Neisseria gonorrheae. In immunocompromised patients, multiple infections with fungi and a variety of different classes of organisms including mycobacteria and apicomplexan parasites may occur. There is great need for the development of new antimicrobial agents and one that targeted several of these diseases would be especially beneficial. [000241 The shikimate pathway is found only in microorganisms and plants, never in animals, making it a viable target for herbicides. The shikimate pathway was also identified in apicomplexans, including T. gondii. All enzymes of the shikimate pathway have already been obtained in pure form from a variety of prokaryotic and WO 2004/016220 PCT/US2003/025571 7 eukaryotic sources, and their respective DNAs have been characterized for several organisms. [00025] However, there are many differences among the shikimate pathways of bacteria, fungi, and plants, even subtle differences between closely related species. These variations in structure and possible modes of regulation and inhibition makes research on the T. gondii shikimate pathway more complex. For example, the shikimate pathway operates in the cytosol of bacteria and fungi, but in plants it is also known to operate in plastid organelles. Subeellular localization of enzymes in the shikimate pathway has not yet been established definitively in T. gondii. Knowledge of enzyme regulation and specific mechanisms of inhibition and function are also incomplete for T. gondii. Despite the incomplete data, existing research suggests the shikimate pathway is an essential metabolic pathway in apicomplexans. Furthermore, in vitro experiments have shown the shikimate pathway to be a viable herbicide target in T gondii. Specifically, 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase, the sixth enzyme in the pathway, is the target for glyphosate, a widely used herbicide commercially sold as Roundup®. A number of other compounds that inhibit various other enzymes in the shikimate pathway have also been identified. [00026] The shikimate pathway was investigated as a common route essential for the biosynthesis of aromatic amino acids phenylalanine, tyrosine, and tryptophan. Through a sequence of seven metabolic steps, it converts phosphoenelpyruvate (PEP) and erythrose 4-phosphate (E4P) into chorismate, the precursor of the primary aromatic amino acids and many aromatic secondary metabolites. All pathway intermediates can also be considered branch point compounds that may serve as substrates for other metabolic pathways. III. DAHP Synthase [00027] The first step of the shikimate pathway is the condensation of PEP and E4P, yielding 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) and inorganic phosphate (FIG. 2). The enzymatic synthesis of DAHP is catalyzed by DAHP synthase (DAHPS). The second reaction of the shikimate pathway is the elimination of the phosphate from DAHP to generate 3-dehydroquinate (DHQ). This reaction is catalyzed by DHQ synthase. DHQ synthase is activated by inorganic posphate, one of the reaction products. Conversion of DAHP to DHQ is caused by an intra- WO 2004/016220 PCT/US2003/025571 8 molecular exchange of the DAHP ring oxygen with carbon 7, driven by the cleavage of the phosphoester. The third step of the shikimate pathway, dehydration of DHQ to give 3-dehydroshikimate (DHS), is catalyzed by DHQ dehydratase. Then, there is a reduction of DHS to shikimate, catalyzed by a shikimate dehydrogenase that is either NADP-dependent or pyrrolo-quinoline quinone dependent. Next, shikimate kinase catalyzes the phosphorylation of shikimate to yield shikimate 3-phosphate (S3P). The penultimate step involves the condensation of a second PEP with S3P to yield 5 enolpyruvylshikimate 3-phospate (EPSP) and inorganic phospate. This reversible reaction is catalyzed by the monomeric enzyme EPSP. In the seventh and final step in the main trunk of the shikimate pathway, chorismate synthase catalyzes a trans-1,4 elimination of phospate from EPSP to produce chorismate. From here, the pathway splits into several branches to produce phenylalanine and tryosine, tryptophan, ubiquinone, and a variety of folates. Additional branches exist from chorismate in certain organisms, including isoprenoid synthesis, and from other intermediates, such as quinate synthesis from dehydroquinate. [00028] As mentioned above, DAHPS is the initial enzyme in the shikimate pathway. It catalyzes the condensation of PEP and E4P. DAHP is then converted by subsequent reactions into chorismate synthase. DAHPS is an enzyme from E. coli, the organism in which it was first discovered. Wild-type E coli produces three feedback inhibitor-sensitive DAHPS isoenzymes: a Tyr-sensitive, a Phe-snsitive, and a Trp-sensitive enzyme. Because DAHPS in E. coli is regulated at the protein level by feedback inhibition, both Phe- and Tyr-sensitive isoenzymes can be completely inhibited by about 0.1 mM of the corresponding amino acid. The Trp-sensitive isoenzyme is partially inhibited by Trp. Plant DAHPS have also been obtained in pure form from a variety of plants including carrot, potato, tobacco, arabidopsis, and tomato. Although, like E. coli, some plants have three DAHPS-encoding genes, the structures of the encoded enzymes are quite different from the structures of the bacterial DAHPS. In fact, the comparison of the primary amino acid sequences of a plant DAHPS with a bacterial DAHPS typically shows surprisingly low identity. Due to large primary structure differences, a distinction is made between small bacterial Type I DAHPS and Type II plant DAHPS. T. gondii DAHPS had not yet been identified. Since the shikimate pathway appears to function in these parasites it was WO 2004/016220 PCT/US2003/025571 9 assumed that it must be present but no definitive proof existed that this enzyme was present.Moreover, if present , the mechanisms for regulation and inhibition DAHPS are unknown. [00029] Better understanding of the mechanisms whereby the shikimate pathway in T. gondii is regulated and inhibited are important. The results of such studies lead to novel ways of treating toxoplasmosis and greater understanding of the T gondii parasite. Glyphosate, for example, was among the first compounds used to inhibit T gondii's growth. Inhibition of EPSP synthase with product rescue with PABA in T gondii provided evidence that the shikimate pathway was present in apicomplexan parasites. Since then, a multitude of other compounds have been synthesized and tested in vitro and in vivo in an effort to identify those without toxicity to host cells and the ability to inhibit apicomplexan parasites. Other targets in the shikimate pathway would be useful. IV. Alternative Oxidase Cryptospridium Parvum [00030] A number of apicomplexan parasites have a vestigial plastid organelle called an apicoplast, most likely derived from an ancient algal endosymbiont. Evidence of plant biosynthetic pathways in these parasites led to the identification of the first apicomplexan shikimate pathway enzyme, chorismate synthase. Chorismate synthase was isolated from T. gondii and a number of Plasmodium species and in all cases the proteins lacked an obvious N-terminal transit sequence, suggesting that they are cytosolically active and unlikely to be located in the apicoplast. Phylogenetic analysis inferred that these apicomplexan chorismate synthases were most closely related to fungal enzymes. [00031] Analyses so far have not revealed an apicoplast in C. parvum, consequently the identification of targets unrelated to this organelle is vital. One such target is the alternative pathway of respiration, which in addition to being present in higher plants, has been described in fungi, green algae and in a limited number of protozoa including Trypanosoma brucei. [00032] The alternative pathway of respiration has been most extensively studied in higher plants, which have two pathways for mitochondrial electron flow: the cytochrome respiratory pathway, which is found in all mitochondria and the alternative respiratory pathway, which is absent from mammals. During conventional WO 2004/016220 PCT/US2003/025571 10 mitochondrial respiration electrons are passed from complexes I or II to ubiquinone and then on to the cytochrome oxidases, complex III and IV. At each point protons are transferred across the inner membrane creating a transmembrane potential that is coupled to ATP production. The alternative pathway diverges from the cytochrome pathway after the ubiquinone complex. Electrons flowing through the alternative oxidase (AOX) are donated directly to oxygen to form water. In addition to the mitochondrial located AOX, many plants have also been demonstrated to have an additional similar oxidase, termed immutans, which is located in their chloroplasts. [00033] Recently cyanide insensitive oxidase activity has been described in P. falciparum and a number of compounds reported to inhibit this process in plants, fungi and protozoa have been demonstrated to curtail the growth of P. falciparum in vitro. Although these observations provided evidence for the existence of an alternative pathway of respiration, they do not provide any information regarding the molecular nature of the oxidase involved. Moreover, AOX is notably absent from published annotation of the P. falciparum genome project. [00034] Apicomplexan genome projects were screened for candidate AOXs the first molecular evidence for an AOX in the apicomplexa was located. And this evidence comes from C. parvum where the presence of a mitochondrion has been the subject of much recent debate and the enzymes necessary for oxidative phosporylation are apparently absent. These studies also provide information regarding the likely evolution of AOX and the related immutans proteins. [00035] Further, there also is the potential of bioterrorism use for apicomplexan parasites. Compounds which inhibit one apicomplexan parasite, such as T. gondii, often also are effective against other pathogenic, phylogenetically related apicomplexan parasites, e.g., those that cause malaria. Antimicrobial targets in apicomplexans are shared with certain other microorganisms that have metabolic pathways or enzymes not present or very different from the enzymes in humans. SUMMARY OF THE INVENTION [00036] A novel apicomplexan Fab I (enoyl acyl carrier protein reductase, ENR) was found in Toxoplasma gondii. The effects of triclosan, a potent and specific inhibitor of this enzyme, on the in vitro growth of T. gondii was demonstrated. Similar to the effect of triclosan on a wide variety of bacteria, this compound WO 2004/016220 PCT/US2003/025571 11 markedly inhibits growth and survival of the apicomplexan parasite Toxoplasma gondii at low concentrations (i.e., IC50 ~l50-2000 and 62 nanogram/ml respectively). [00037] The cDNA, genomic DNA and amino acid sequences of T. gondii FabI were characterized in order to verify triclosan 's mode of action against the parasite. Results enable knockout and complementation of the knockout parasite to characterize the biology of lipid synthesis in T. gondii, the production of the recombinant protein, characterization of the recombinant enzyme, high throughput screening of recombinant protein with libraries of compounds known to inhibit other Fabls, creation of a protein crystal, solution of the crystal structure and a basis for rational drug design. A cDNA molecule of the FabI gene in T. gondii is shown in FIG. 4(A). A molecule of the Fab I enzyme having the deduced amino acid sequence of the Fab I enzyme in Toxoplasma gondii is shown in FIG. 4(B). The protein may be a recombinant. [00038] Discovery and characterization of an apicomplexan Fab I gene and the gene for DAHP synthase and their encoded enzymes provide means to rationally design novel inhibitory compositions useful for prevention and treatment of apicomplexan and microbial related diseases. For example, triclosan is a lead compound. [00039] The recombinant protein is used to determine the crystal structure of the enzyme from which novel inhibitors are designed. [00040] The information on the mRNA sequence corresponding to the amino acid sequence of apicomplexan Fab I is used to develop iRNA which will compete for the FAB I mRNA. [00041] Despite the availability of the P. falciparum genome sequence it has been difficult to identify the genes for the other shikimate pathway enzymes. Taking advantage of the studies of other apicomplexan genomes, more shikimate pathway enzyme genes were located from T gondii. [00042] The plastid targeting sequence of the Toxoplasma gondii Fab I amino acid sequence according to FIG. 4(B) or the DAHPs amino acid sequence according to FIG. 7(A) and (B), are used to design antimicrobial agents and inhibitors of apicomplexan growth and survival. [00043] Triclosan inhibits apicomplexan growth and survival. To deliver inhibitors to the micororganism, systems are developed.

WO 2004/016220 PCT/US2003/025571 12 [00044] A transporter such as a polypeptide delivers antimicrobials such as small molecules to microorganisms that include parasites sequestered by multiple membrane barriers and structures. The small molecules include growth inhibitors. Improved crystals of enoyl reductase (ENR) provide target information for disruption of this enzyme in apicomplexan. [00045] A method to deliver a pharmaceutical composition into a microorganism, includes the steps of: [00046] attaching at least one polypeptide to the composition to form a complex; and; [00047] contacting the microorganism with the polypeptide composition complex. The microorganism may be a parasite, e.g. Toxoplasma gondii. [00048] The at least one polypeptide may be polyarginine. The polyarginine may be an octaarginine. Delivery includes encysted T. gondii bradyzoites. [00049] A method to test a candidate transporter for delivery of a pharmaceutical composition into a microorganism, includes the steps of: [000501 contacting the pharmaceutical composition with the candidate transporter; and [00051] determining whether the pharmaceutical composition is delivered into the microorganism by the candidate transporter. BRIEF DESCRIPTION OF THE DRAWINGS [00052] FIG. 1 (A) and (B) are schematics of the fatty acid synthesis pathway. [00053] FIG. 2 is a schematic of the shikimate pathway. [00054] FIG. 3 is the DNA sequence of the probe used to screen libraries for T. gondii Fab I. [00055] FIG. 4 (A) is the eDNA nucleotide sequence of the Fab I gene in T. gondii (B) shows the deduced amino acid sequence of the eDNA. [00056] FIG. 5 is a multiple structure-based sequence alignment of Fabls from E. coli, H. Pylori, B. subtilis, S. aureus, B. napus, P. falcipurum, and T. gondii. Secondary sequence structure features, include a and 1 helices of E. coli and B. napus enzymes are shown as lines above and below alignments. Amino acids critical for secondary structure are in reverse type and amino acids critical for triclosan binding WO 2004/016220 PCT/US2003/025571 13 are below black-filled circles. Dark amino acids are conserved between P. falciparum, T. gondii and B. napus. [00057] FIG. 6 (A) and (B) shows the action of DAHP synthase [00058] FIG. 7 (A) shows a multi-sequence alignment of known plant and bacteria and yeast DAHPS. 100 percent homology across species is shown in dark sections. Note marked differences between plant as contrasted with yeast and bacterial DAHPS; (B) shows consensus sequences with T gondii. [00059] FIG. 8 (A) PCR primer design (B) contigs and intervening sequences. [00060] FIG. 9 (A) and (B) are illustrative copies of web pages for various searches. [00061] FIG. 10 is the molecular formula and model for triclosan. [00062] FIG. 11 demonstrates inhibition of T. gondii by triclosan. (a) no inhibitory effect of triclosan on the host cells uptake of thymidine; appearance of the monolayer also was unchanged. (b) effect of triclosan on T. gondii uracil uptake; triclosan reduces uracil uptake by intracellular T. gondii 4 days after infection; IC50 was = 62 nanograms per ml; effect increased between days 1 to 4, for example, in a separate experiment, for 125 nanograms per ml of triclosan on day 1, percentage inhibition was 20% and on day 4 was 72% and for pyrimethamine/sulfadiazine percentages of inhibition at these times were 63% and 100% respectively. Abbreviations: RH = RH strain ofT. gondii within fibroblasts; No RH=Control with fibroblasts alone; DMSO = fibroblasts with highest concentration of DMSO; P/S = fibroblasts, T. gondii, pyrimethamine and sulfadiazine used as a positive control for the assay; CPM = counts per minute. [00063] FIG. 12 is a stereo view of the three dimensional arrangement of the atoms that form the binding pocket for triclosan, in E. coli enoyl reductase, with the 11 residues that have any atom within 4 A of the inhibitor, labeled. This is important in assigning the relative contributions made to the interaction with triclosan by the critical amino acids that are also present in the T. gondii enzyme. [00064] FIG. 13 is the signal and transit peptide of FabI. [000651 FIG. 14 represents schematic representations of oligomers, conjugates, type II fatty acid synthesis pathway in apicomplexans, and residues of triclosan and ENR critical for their interaction.

WO 2004/016220 PCT/US2003/025571 14 [00066] FIG. 15 demonstrates uptake of short oligomers of arginine and lysine by T. gondii tachyzoites and encysted bradyzoites. [00067] FIG. 15(A) shows the use of comparative flow cytometry to measure labeling of T. gondii tachyzoites incubated with FITC conjugated polyamino acid compounds. Numbers in parenthesis indicate % positive cells. (Inset: Fluorescence and differential interference contrast (DIC) microscopy assays of uptake by r7 FITC, compound 1, by T. gondii tachyzoites.) [00068] FIG. 15(B) shows fluorescence images demonstrating uptake of FITC conjugated polyamino acid compounds by T. gondii tissue cysts. Scale bar =10 microns. [00069] FIG. 16 demonstrates the effect of azide on uptake of arginine triclosan conjugates by tachyzoites (3a), and excysted bradyzoites (3b) and cysts (3c). [00070] FIG. 17 demonstrates intracellular and extracellular tachyzoites taking up triclosan conjugated to octaarginine. [00071] FIG. 17(A) shows fluorescence images of live intracellular tachyzoites following 10 or 30 minute exposure to triclosan octaarginine conjugate (non releasable conjugate 4). Parasite nuclei (arrows) and host cell nuclei (HIN) were stained with Hoechst. FITC signal is seen in host cell cytoplasm (HC) and nuclei (HN), and in parasites residing in parasitophorous vacuole (v). Scale bar = 10 microns. [00072] FIG. 17(B) demonstrates uptake of triclosan octaarginine conjugate (non releasable conjugate 4) by extracellular and intracellular tachyzoites. Flow cytometric analysis showing representative dot blots of RH strain and transgenic parasites expressing the green fluorescent protein (ACP-GFP) exposed to triclosan r8 conjugated to rhodamine (ent-6) for 10 minutes. Intracellular parasites were exposed to the transporter and then released from the host cells prior to analyses. [00073] FIG. 18 is a representation of T. gondii ENR: Deduced amino acid sequence and structure, purification of recombinant protein and kinetics of enzyme activity in the presence of octaarginine releasable conjugate. (A) shows multiple structure-based sequence alignment showing deduced amino acid sequence of T. gondii enoyl ACP reductase and enoyl reductases of E. coli, H. pylori, B. subtilis, S. aureus, P. falciparum and B. napus. The secondary structures and sequence numbers WO 2004/016220 PCT/US2003/025571 15 of the E. coli and the B. napus enzymes are shown above and below the alignment, respectively. (B) demonstrates SDS-PAGE of TgENR purification. SigmaMarker (Sigma) wide range molecular weight markers are shown in lane 1. Lanes 2-6 show fractions eluted from the HiTrap Q Fast Flow column containing pure TgENR. (C)) shows a time course of TgENR inhibition by releasable octaarginine triclosan conjugate (Tr8), compound 7. Inhibition curves were measured at 0 hours (solid squares), 12 hours (solid triangles) and 24 hours (solid circles) of incubation at 37 oC. The three open symbols to the right show TgENR activity at these time points with no added inhibitor. Enzyme activity is expressed as turnovers per TgENR molecule per second and inhibitor concentration is expressed as the log of the Tr8 concentration in molar units. IC 50 values calculated by nonlinear regression analysis are displayed graphically as dashed vertical lines for the three inhibition curves, showing an increase of inhibitory activity with time. A black vertical dashed line marks the concentration of TgENR used in these assays and thus represents a value below which inhibition can not be properly measured in these assays. Error bars show the variation between triplicate measurements at each point. When not visible, the variation is smaller than the symbol. [00074] FIG. 19 demonstrates in-vitro and in-vivo effects of octaarginine triclosan conjugates on T. gondii growth, and subcellular distribution of rhodamine conjugated octaarginine triclosan. (A) shows octaargininine conjugated to triclosan, either as a non-releasable or releasable compound, had no toxic effect on replication of host cells as measured by 3 H thymidine uptake. Only releasable octaarginine triclosan conjugate had an inhibitory effect on parasite growth, as measured by 3 H uracil incorporation. Controls included T. gondii infected host cells in medium or treated with pyrimethamine (0.1 g/ml) and sulfadiazine (25 pg/ml) (P/S) which inhibit parasite growth. (B) demonstrates brief exposures of T gondii to releasable octaarginine triclosan (Tr8) but not triclosan (T) in Dulbecco's phosphate buffered saline (PBS) had a small inhibitory effect on T. gondii. Two hours following infection of host cells with tachyzoites, cultures were incubated with T or Tr8 (12.5pM) either in PBS or in growth medium (IMDM-FCS). For the PBS exposed cultures (not controls), T or Tr8 PBS then were replaced at varying intervals with (IMDM-FCS) which was present for the remainder of the 3.5 day culture period. Parasite growth was determined by 3

H

WO 2004/016220 PCT/US2003/025571 16 uracil uptake at the end of 3.5 days of culture in growth medium. Brief exposures to Tr8 partially inhibited parasite growth and the 3.5 day exposure (or a 48 hour exposure, data not shown) inhibited parasite growth almost completely. Unconjugated triclosan had no effect. The photomicrographs (Giemsa stain) on the right show the "protective" effect of Tr8, but not T, in PBS on the infected host cell monolayer. The large empty areas represent host cell destruction by intracellular parasite growth, which is inhibited by polyarginine conjugated triclosan and not by the triclosan in PBS. (C) the subcellular distribution of octaarginine triclosan conjugate in tachyzoites was determined by deconvolution microscopy using non-releasable triclosan r8 conjugated to rhodamine, and transgenic parasites expressing the green fluorescent protein (GFP) targeted to the parasite plastid organelle. Fluorescence and DIC images showing rhodamine signal surrounds the GFP signal, partly overlapping it. Inset shows higher magnification of the boxed area showing rhodamine signal partly overlapping plastid. Scale bar = 10 microns. (D) in vivo administration of releasable triclosan r8, ent-7, but not triclosan in PBS, reduces numbers of intraperitoneal tachyzoites five days after challenge (p = 0.006). [00075] FIG. 20(A) shows an SDS-PAGE of the pfENR purification. SigmaMarker wide range molecular weight markers are shown in lane 1. Pure MBP-ENR fusion protein produced by the pMALc2x vector (lane 2) and Factor Xa digested fusion protein (lane 3) are shown. Lane 4 shows pfENR produced by in vivo cleavage using the pMALcHT vector. (B) shows a schematic of the pMALcHT vector. Amino acids in the linker region between the maltose binding protein (MBP) and pfENR (ENR) are shown using one letter abbreviations. The seven residue TEV protease recognition site is boxed and a gap indicates the protease cleavage site. [00076] FIG. 21 shows a representative 10 oscillation image of data collected from the pfENR complexed with NAD + and triclosan crystal on a Quantum Q4 CCD detector on station 14.1 at the SRS Daresbury Laboratory. The resolution at the edge of the image corresponds to a resolution of 2.2 angstroms. [00077] FIG. 22 A representative 0.10 oscillation image of data collected from crystals of tgENR with bound NAD+ and triclosan. The resolution at the edge of the image corresponds to a resolution of 1.5 A..

WO 2004/016220 PCT/US2003/025571 17 [00078] FIG. 23 shows crystals of T gondii ENR complexed with NAD+ and triclosan grown in 1.6M Am Sulfate pH 9.0. [00079] FIG. 24 shows alignment of the AROM polypeptide with bacterial enzymes. Molecular arrangement of the shikimate pathway enzymes are the same in T. gondii and different from plants and bacteria. (A) The T. gondii arom gene is 19460bp and is interrupted by 19 introns (black). (B), DHQ synthase, EPSP synthase, skikimate kinase, dehydroquinase and shikimate dehydrogenase. The entire polypeptide spans 3332 amino acides. (C) The five central shikimate pathway enzymes are fused in fungi (e.g. S. cerevisiae), are monofunctional in plants (e.g. L. escultentum), with the exception of dehydroquinase and shikimate dehydrogenase which are fused to form a bifunctional protein. In general the bacterial enzymes are monofunctional (e.g. E. coli). A gap indicates that the genes are not fused. (D) Amino acid alignment of the DHQ synthase domains from a number of AROM polypeptides. Sequences are: T. gondii (Accession no. AY314743); P. carinii (Assession no. Q12659); S. cerevisiae (Accession no. NP010412) and E. nidulans (Accession no. P07547). Dashes indicate gaps to maximise alignment. The residues identified to be important in the E. nidulans enzyme and conserved in the T. gondii protein are marked by asterisks. The secondary structure prediction of the T. gondii protein is given above the alignment, where arrows represent beta strands and cylinders alpha helical regions. This is compared to the known structure of the E. nidulans DHQ synthase domain given below the alignment. [00080] FIG. 25 shown phylogenetic analysis of the DAHP gene. Molecular arrangement of the T. gondii DAHP synthase gene. The gene is 8207bp and is interrupted by 13 introns. [00081] FIG. 26 shows phylogenes of EPSP synthase( A) shows the EPSP phylogeny. (B) and (C) show the phylogenies of shikimate kinase and shikimate dehydrogenase respectively. The taxon and character sampling for these phylongenies is as follows: EPSP 69 taxa and 293 amino acid characters, shikimate kinase 44 taxa and 139 characters, the shildkimate dehydrongenase 52 tasa and 166 characters. In all the phylogenies the T. gondii AROM domains cluster with the fungal homologues suggesting they are related, given the taxon sampling available. The shikimate kinase phylogeny also revealed a potential cyanobacterial to plant gene WO 2004/016220 PCT/US2003/025571 18 transfer, consistent with this plant enzyme originating from the plant chloroplast endosymbiont. [00082] FIG. 27 shows the effect of SHAM and 8-HQ on the in vitro growth of T. gondii and C. parvum. SHAM and 8-HQ inhibited the growth of C. parvum (A & B) and of T. gondii (C & D) (p<0.0 5 ) compared with untreated cultures (Media). (PRM, Paromomycin, P/S, Pyrimthamine/Sulphadiazine and RH, T gondii strain). [00083] FIG. 28 shows the multiple sequence alignment of AOXs from diverse species including the C. parvum AOX (TU502). Sequences were aligned using CLUSTAL W, within MacVector 7.0. The predicted C. parvum mitochondrial targeting sequence is in bold. [00084] FIG. 29 shows the western blot analysis of T gondii extract using various antisera raised to AOX. (A) Polyclonal anti T brucei AOX (TAO) reacted with proteins of 33kD and 66kD in control samples containing T. brucei extract (TB) corresponding with monomeric and dimeric forms respectively. (B) Monoclonal IA2 [M TB(IA2)] that was raised to TAO reacted with a protein of approximately 66kD in T gondii extract. (C) Polyclonal anti Voodoo Lily (S. gattatum) AOX (P VDL) reacted with a protein of 33kD in T. gondii extract corresponding with a putative monomeric form of AOX. [00085] FIG. 30 shows the phylogenetic tree of the Alternative Oxidase and Immutans genes reveal two potential endosymbiotic gene transfers. The Eukaryotic Alternative Oxidase genes cluster with the alpha proteobacteria suggesting a mitochondrial origin for the Eukaryotic Alternative Oxidase. The Plant Immutans genes cluster with the Cyanobacteria suggesting a chloroplast origin for the plant Immutans genes. The phylogenies were calculated from a masked alignment of 50 taxa and a sampling of 172 amino acid characters. Posterior probabilities and Bootstrap values are shown in the respective order (Posterior probability/Bootstrap value) on the branch labels. For full phylogenetic methods see the methods section of this paper. AOX sequences that have been reported to have a putative mitochondrial targeting peptide are marked on the phylogeny with (M-tp). Immutans proteins that have been shown to localize to the chloroplast are marked (P-L). The three prokaryote sequences were recovered from annotated genome projects, the Synechoccus sp. and WO 2004/016220 PCT/US2003/025571 19 Novosphingobium aromaticivorans are listed as hypothetical proteins in GenBank (see gi 23133458 and gi 23109030). [00086] FIG. 31 shows the morphological evidence for the presence of mitochondrion in different life-cycle stages of C. parvum. MDBK host cells infected with GCH1 strain of C. parvum were stained with the mitochondrial dye, MitoTracker Green FM and processed for deconvolution fluorescence microscopy, as detailed in Experimental Procedures. [00087] Composite A: Two trophozoites inside parasitophorous vacuoles showing discrete but beaded staining with the mitochondrial dye MitoTracker Green FM (pseudocolored red). Note that the staining is localized to one region of the parasite. [00088] Composite B: Collection of merozoites inside a parasitophorous vacuole (arrow). The parasites take up the mitochondrial dye MitoTracker GreenFM (pseudocolored red). Host mitochondria are also evident. HC - host cytoplasm containing host mitochondria. Scale Bar: 5 microns. [00089] FIG. 32 demonstrates the primary peptide sequence of the alternative oxidase enzyme found in two strains of Cryptosporidia parvum (strainGCH1 and TU502) . The protein is made up of an ORF of 1005bp, comprising a polypeptide of 335 amino acids with a predicted molecular weight of 39.2 KDa. An amino-terminal mitochondrial targeting sequence of 14 amino acids (in Blue) was identified using MitoProt II, TargetP version 1.0 and Predator. Ploymorphisms between the strains are identified in red. The strains are 97.71% identical at the nucleotide level and 97.02% identical at the amino acid level. [00090] FIG. 33 demonstrates a clustal alignment of AOX peptide sequences for various organisms. [00091] FIG. 34 demonstrates the primary peptide sequence of the AroM enzyme complex found in Toxoplasma gondii. [00092] FIG. 35 demonstrates gene sequences for four of the AroM enzymes in Cryptosporidia parvum.

WO 2004/016220 PCT/US2003/025571 20 DETAILED DESCRIPTION OF THE INVENTION [00093] Plant like enzymes and the cDNA sequences encoding them were identified and characterized in T. gondii, P. falciparum and C. parvum. These findings provide targets for inhibitors of apicomplexan parasite growth targets. FabI [00094] A plant-like FAB I was identified in Toxoplasma gondii. The nucleotide sequence and deduced amino acid sequence were prepared and correct sequences were confirmed. FAB I is a single chain, discrete enzyme. All requisite residues for FAB I enzyme activity were confirmed. The T. gondii enoyl acyl carrier protein reductase has a putative plastid targeting sequence and unique polar insertions. The FAB I structure is modeled on E. coli and B. napus FAB I structure alone and complexed to triclosan. Key amino acids were identified for determination of 20 structure. Residues for binding triclosan were conserved providing explanation for inhibition by triclosan. Triclosan inhibits T. gondii (nm) in a pattern similar to the action ofmefloquine. Soluble protein can be overexpressed. [00095] A partial DNA sequence was identified in the Toxoplasma EST and genome projects and was used to make a probe (FIG. 3). The eDNA sequence of T. gondii FabI was identified using library screening protocols [FIG. 4(A)]. The amrino acid sequence deduced from this cDNA sequence shows remarkable homology to FabI sequences of other organisms, especially plants and Plasmodiumfalciparum, and includes all amino acids necessary for FabI secondary structure [FIG. 4(B)]. The putative protein contains 417 amino acids and includes the 11 amino acid residues necessary for binding triclosan and inhibition of T. gondii FabI by triclosan. A signal sequence and putative plastid targeting sequence were also identified. Signal peptide cleavage site is after A in the sequence MAFT. The true start is at M in the sequence KMVGF by chloroplast algorithm, the predicted cleavage site for the transit peptide is between the D and the S in the sequence RAADS. Preliminary results indicate that there are at least three introns in the genomic sequence, in contrast to none in P. falciparum. Identification of both the eDNA and genomic DNA sequences of T. gondii FabI enables knockout and complementation of the knockout parasite to characterize the biology of lipid synthesis in T. gondii, the production of the recombinant protein with libraries of compounds known to inhibit other FabI, and WO 2004/016220 PCT/US2003/025571 21 creation of a protein crystal solution of the crystal structure as a basis for rational drug design. This sequence was then converted to an amino acid sequence at www.expasy.ch/tools/dna.html. The sequence was aligned using the "Multiple Sequence Alignment at http://searchlauncher.bcm.tmc.edu (FIG. 5). [00096] Analysis of the pattern of sequence conservation confirmed that the FabI protein in T. gondii has all the residues that have been identified as essential for enzyme activity. There is much greater sequence similarity with the plant enzymes than with the ENRs of bacterial origin. [00097] For T. gondii, growth inhibition was assessed over a 4-day period as described previously (Mack et al., 1984; Roberts et al., 1998; Zuther et al., 1999) using human foreskin fibroblasts (HFF) infected with 105 tachyzoites of the RH strain of T. gondii. The assays are based on microscopic visual inspection of infected and inhibitor treated cultures, and on quantitation of nucleic acid synthesis of the parasite by measuring uptake of 3H uracil into the parasite's nucleic acid. Uracil is not utilized by mammalian cells. Parasites present as tachyzoites (RH, Ptg., a clone derived from the Me49 strain), bradyzoites (Me49), and R5 mutants (mixed tachyzoites/bradyzoites of the Me49 strain that can be stage switched by culture conditions) are suitable for assay systems used to study effects of inhibitors. Only the RH strain tachyzoites, cultured for up to 72 hours, had been used in previously reported assays. The use of Me49, Ptg, and R5 mutants are unique aspects of the methods used in these assays in this invention. [00098] Toxicity of a candidate inhibitor was assessed by its ability to prevent growth of human foreskin fibroblasts (HFF) after 4 days and after 8 days as measured by tritiated thymidine uptake and microscopic evaluation. Confluent monolayers of HFF were infected with tachyzoites and bradyzoites. Inhibitor was added one hour later. Non-toxic doses were used in parasite growth inhibition assays. Parasite growth was measured by ability to incorporate tritiated uracil during the last 48 hours of culture. [00099] Triclosan also was effective against T. gondii, in nanomolar amounts. IC50 was 62 nanograms/ml. There was no toxicity to host cells at these concentrations. [000100] The discovery and characterization of an apicomplexan Fab I and discovery of triclosan as a lead compound provide means to rationally design novel inhibitory WO 2004/016220 PCT/US2003/025571 22 compounds. A new approach to the great need for additional, less toxic antimicrobial agents effective against T. gondii. Other novel inhibitors of sequential enzymatic steps in the apicomplexan lipid synthesis pathway are predicted to be synergistic with triclosan and other inhibitors of Fab I. There is a rational basis for discovery of synergistic inhibitors of this pathway effective against multiple different microorganisms (Payne et al., 2000). [000101] Information was obtained from T. gondii because FAB I was purified include that the N terminal sequence is the same as B. napus FAB I, enzyme activity is NADH dependent and inhibited by triclosan. FAB I is involved in synthesis of 10, 12 C fatty acids. In a P. berghei murine model, Triclosan administered subcutaneously (3 or 38 mg/kg) was nontoxic, cleared parasitemia and prevented death. Synergy was demonstrated in vitro with cerulein, an inhibitor of Fab F, B, H. [000102] Five clones were isolated from the T. gondii eDNA library. Analysis of the DNA sequences derived from these clones revealed that three of the clones contained the entire FabI eDNA sequence and that two of the clones contained only partial sequences of T. gondii FabI. The complete FabI clones contained between 3397 and 3462 nucleotides. [0001031 The amino acid sequence of T. gondii FabI was deduced by translation of the cDNA sequence [FIGS. 4(A) and (B)], and revealed that there are 417 amino acids in the putative protein. The deduced amino acid sequence of T. gondii FabI was aligned with sequences of FabI from P. falciparum , B. subtilis and E. coli. This analysis revealed that key amino acid sequences are conserved and that 11 amino acid residues critical to triclosan inhibition are also present (FIG. 13). This result suggests that triclosan has a similar mode of inhibition in T. gondii as in other species. [000104] An N-terminal extension of the amino acid sequence was also identified as belonging to signaling and targeting peptides. In particular, a putative 27 amino acid signal peptide was identified using SignalP V1.1 World Wide Web Server, 1 and a putative 66 amino acid chloroplast transit peptide sequence was identified using ChloroP 1.1 Position Server. 1 http://www.cbs.dmt.dk/cgi-bin/nph-webface?obid=sinalp.3D52C65800385000&opt=none WO 2004/016220 PCT/US2003/025571 23 [0001051 In addition to the sequenced cDNA clones, four genomic DNA clones were isolated. There appear to be least three introns in the genomic DNA sequence of T. gondii FabI. [000106] Identification and sequencing of T. gondii FabI revealed similarity between Fab I in T. gondii, P. falciparum and other organisms. T. gondii FabI contains the 30 amino acids residues which are necessary to define the secondary structure of FabI. These residues are conserved in plants, bacteria and apicomplexans including the plant, B. napus, the bacteria, E. coli, H. pylori, B. subtilis and S. aureus, and the apicomplexan parasites P. falciparum and T. gondii. In addition to these critical 30 amino acid residues, T. gondii also contains the 11 amino acid residues that are necessary for triclosan binding. These residues are less than four A away from one or more triclosan atoms and make it highly likely that triclosan inhibits T. gondii in the same way it inhibits B. napus and E. coli. [000107] In analyzing the amino acid sequence of P. falciparum FabI, several amino acid insertions were found whose function(s) and origins remain unknown. In two such inserts, B. napus FabI had corresponding inserts. The sequencing of T. gondii FabI reveals amino acid inserts that coincide with those inserts present in both P. falciparum and B. napus. P. falciparum also contained a third, polar insert which had no counterpart in other species. Analysis of the T. gondii FabI sequence indicates only partial coincidence with this larger malarial insert. The function of these inserts is unknown. [000108] Another finding is the presence of sequences that are consistent with signal and transit peptides. These peptides are important because they explain how nuclear encoded T. gondii FabI can be transported across several membranes into the T. gondii plastid. The T. gondii plastid is a four membrane enclosed structure with its own extra-nuclear DNA and is believed to be evolutionarily derived from endocytosed algae. In the general scheme of transport of a protein into the T. gondii plastid, there is an extension of a bipartite leader on the N-terminal side of the plastid targeted protein. The leader contains a signal peptide that is similar to eukaryotic secretory signal sequences that carries the unfolded protein into the golgi apparatus. Following the signal peptide, there is a transit sequence that is exposed by cleavage to allow transport across plastid membranes (FIG. 13). The presence of these two WO 2004/016220 PCT/US2003/025571 24 domains in T. gondii FabI suggests that it is a nuclear-encoded protein translocated to the parasite plastid where it functions in the synthesis of fatty acids. [000109] The identification of both the cDNA and genomic DNA sequences of T. gondii FabI enables the elucidation of the function of fatty acids in T. gondii and provides a new target for the development of anti-microbial agents. [000110] Knowing the amino acid sequence of T. gondii also enables the production of a recombinant protein. The cDNA was placed into the pMAL-c2X vector for over expression and purification. After the protein was obtained, the enzymatic properties were characterized and a protein crystal formed and its structure were solved. [000111] The recombinant T. gondii FabI protein can also be used to conduct a high throughput screening with libraries of compounds known to inhibit other Fabls and with those whose functions are unknown. Further, the crystal structure made possible from the T. gondii FabI sequence provides a basis for rational drug design. [000112] Enoyl ACP reductase (ENR) is a key enzyme active in fatty acid synthesis. Bacterial and apicomplexan fatty acid synthesis occurs by the Type II pathway, shown in a schematic representation in FIG. 14(B) and is dependent on monofunctional polypeptides including ENR. In contrast, mammalian fatty acid synthesis occurs by the Type I pathway in which the key enzymes are present on a polyfunctional single polypeptide. Apicomplexan ENR is a promising target for inhibitors because toxicity to humans should be minimal. In apicomplexans, fatty acid synthesis takes place in a subcellular organelle called the plastid. The antimicrobial agent 5-chloro-2-[2,4- dichlorophenoxy] phenol (triclosan) (FIG. 14(C)) had been found to inhibit bacterial ENRs. Micromolar concentrations of triclosan dissolved in DMSO inhibit replication of apicomplexan parasites by binding to, and inhibiting, apicomplexan ENR. [000113] The sequence of the Plasmodium falciparum ENR (pfENR) shows significant sequence similarity to enoyl reductases from other species with, for example, 47% identity to the enzyme from Brassica napus. However, the pfENR sequence differs from all other ENR sequences determined to date in that it contains a 43 amino acid insert in a loop which, in the ENRs from other species is known to undergo substantial conformation change on inhibitor (and presumably substrate) binding. The structure of this loop is therefore of particular interest in the exploitation WO 2004/016220 PCT/US2003/025571 25 of pfENR for drug discovery due to its possible interactions with substrate, cofactor or inhibitors. Recently the structure of pfENR has been solved to 2.4A, but unfortunately no density could be seen for the 43 amino acid insert due to disorder in this part of the structure, thus leaving an important piece of the structure undetermined. In order to address this problem, a new expression system was developed for this enzyme. Expression and purification of pfENR give crystals of a new form, which diffract to high resolution. The structures of triclosan, oligomers, and conjugates of oligoarginines and the site of action of triclosan are shown in FIG. 14 (A-C). [000114] Characterization of DAHP synthase (DAHPS)The shikimate pathway is characterized through its first catalytic step, DAHP synthase 7 [FIG. 6(A) and (B)], and through inhibition of the pathway at other key enzymatic steps. Using a bio informatics approach and molecular biology techniques including RT/PCR, gDNA and cDNA library screening, cloning and sequencing, a partial T. gondii DAHP synthase gene sequence was obtained. Specifically, a bio-informatics approach provided two contigs with similarity to other DAHP synthase sequences. Using RT/PCR, these sequences were confirmed as present in both Me49 and RH strains of 7T. gondii. Intervening sequences were found between the two contigs in Me49 [FIG. 8(A) - (C)]. Multi-sequence alignment and analysis of this sequence showed T. gondii DAHP synthase has remarkable homology with that of plants but retains the key residues of both plant and bacteria DAHP synthase (FIG. 7). A variety of shikimate pathway inhibitory compounds have also been tested in vitro with some lead inhibitor compounds identified. 1000115] The shikimate pathway in T. gondii was characterized through two different approaches: 1) Characterization of the first catalytic enzyme of the shikimate pathway, DAHP synthase 2) Inhibition of the shikimate pathway at key enzymatic steps. cDNA and gDNA partial gene sequences and deduced partial amino acid sequences of T. gondii DAHP synthase were identified. Inhibition of T.gondii growth by aurintrycarboxylate acid, a compound that had inhibited EPSP synthase enzymatic activity of other species was tested. [000116] Through bio-informatics searches and analyses, including BLAST searches and sequence analysis with software programs including MacVector®, two discontinuous non-overlapping putative DAHPS partial sequences from the T. gondii WO 2004/016220 PCT/US2003/025571 26 genomic DNA database were obtained. Both of these contigs were confirmed to be present in T gondii DNA for the Me49 and RH strains by PCR, proving they were not contamination artifacts in the genome sequncing project. Furthermore, a partial but continuous sequence was deduced from Me49 c DNA sequence followed by software analysis after the intervening sequence between the two discontinuous contigs was obtained using PCR. This eDNA sequence is approximately 1200 DNA base pairs in length. After translation into amino acid sequence, further analysis and multisequence alignments of this PCR product sequence showed remarkable homology with known plant DAHPS amino acid sequences. All key residues were conserved. Additionally, in the intervening sequence section there was 50 percent identity with plant DAHPS amino acid sequences and nearly none with bacterial and yeast DAHPS. Currently, the 3' end of the putative T. gondii gene has been obtained after sequencing the isolated plasmid DNA obtained from the gDNA library. DAHPS [000117] Using bio-informatics, PCR and library screning for a putative partial DNA sequence for T gondii DAHPS, the partial eDNA sequence is approximately 1200 DNA bases in length. This sequence was assembled using three PCR products. Sequencing of gDNA from the first of three clone isolated from library screening yielded the 3' end of the DAHPS gene. Analysis to date indicates that there are at least 3 introns in the confirmed regions of this gene. Furthermore, analysis and multisequence aligmnents indicates that T gondii DAHPS more closely resembles plant than bacterial and yeast DAHPS. [000118] Sequence data and characterization presented herein lays a foundation for a variety of important future studies of the regulation and function of this gene. Possible extensions include the over-expression of DAHPS in E. coli, crystallography to study the structure of the enzyme,high throughput screening of libraries of inhibitory compounds, attempts to inhibit this enzyme with RNAi, production of antibodies to recombinant protein to use for immunolocalization studies, studies to determine whether there are GCN4 binding motifs or GCN4 binding, and studies of stage specific expression of protein. At present there are no plant ( or plant-like) DAHPS crystal structures that have been solved.

WO 2004/016220 PCT/US2003/025571 27 Delivery of Antimicrobials [000119] A challenge for the development of antimicrobials effective against apicomplexans is delivery. Effective agents have to gain entry to the host cell, cross the parasitophorous vacuole, enter the parasite and specialized organelles therein such as the plastid or nucleus. This is potentially more difficult in the case of Toxoplasma gondii bradyzoites which reside in a cyst structure, composed partly of host and partly of parasite constituents. The vast majority of interesting small molecules will never be used for therapeutics because they cannot traverse biologic barriers to reach their targets. [000120] Short oligomers of arginine can transport inhibitory compounds into an apicomplexan parasite, including extracellular T. gondii tachyzoites and bradyzoites, intracellular tachyzoites and encysted bradyzoites. The peptide transporter can deliver to, and release, lead inhibitory compounds, inside tachyzoites that are multiplying within parasitophorous vacuoles, to the cytoplasm and to subcellular organelles such as the apicomplexan nucleus and the perimeter of the plastid, where they are efficacious. Furthermore, octaarginine can deliver compounds into bradyzoites in cysts and tachyzoites in vivo. Oligoarginine antimicrobial conjugates provide a novel way to eliminate T. gondii tachyzoites and to deliver antimicrobial agents to intracellular T. gondii tachyzoites and bradyzoites within cysts. [000121] T. gondii was selected for study both as a model apicomplexan parasite, and because of the great need to develop better ways to target this particular parasite to prevent and treat the diseases it causes in its active and chronic, untreatable life cycle stage. The ability of short oligomers of arginine to cross parasite subcellular membranes, such as nuclear membranes or membranes of the plastid organelle can be used for targeting other microbial and plant species including other apicomplexan parasites and bacteria including those described herein. [0001221 T. gondii resides in an unusual intracellular compartment called the parasitophorous vacuole that is delimited by a highly specialized membrane that lacks integral membrane proteins of the host cell and is a parasite modified membrane barrier. This membrane barrier is in intimate association with host cell mitochondria and ER posing additional barriers.

WO 2004/016220 PCT/US2003/025571 28 [000123] The vacuole contains a network of tubulo-vesicular membranous structures of unknown function. Parasite-secreted proteins modify this network. [000124] Unlike mammalian plasma membranes, and similar to many other parasitic protozoa, including the malaria parasite, glycosylphosphatidylinositol (GPI)-anchored proteins dominate the plasma membrane of Toxoplasma. The densely packed surface proteins are likely to hinder access of macromolecules to the underlying plasma membrane, which is in tight association with the inner membrane complex forming the parasite pellicle. [000125] Inhibitors related herein target a metabolic pathway in the parasite plastid, an organelle acquired by secondary endosymbiosis. [000126] Most notably, transporters of the present invention with their antimicrobial cargo cross the walls of the cysts that contain bradyzoite forms of the parasite. No currently used antimicrobial compound previously has been shown to cross the cyst wall. This form of the parasite is untreatable. [0001271 Initially, uptake of fluoresceinated hepta-D-arginine (r7, compound 1) and controls penta-D-arginine (r5, compound 2) and hepta-L-lysine (K7, compound 3) compounds (FIG. 14(A)) into extracellular and intracellular tachyzoites, and extracellular and encysted bradyzoites, was studied using deconvolution fluorescence microscopy and flow cytometry (FIG. 15). R designates the levo isomer; r designates the dextro isomer; the number following the r indicates the number of arginines in the compound. Short arginine oligomers were found to cross all membranes and to enter each life cycle stage and compartment (FIG. 15). Deconvolution fluorescence microscopy revealed that r7 facilitated uptake of fluoresceinated compounds into tachyzoites (FIG. 15(A), Inset). Flow cytometric analysis (FIG. 15(A)) demonstrated that uptake of r7 was greater than that of r5 or K7, (7 arginines>>5 arginines or 7 lysines). This was consistent with earlier studies demonstrating that longer oligomers of arginines (7 or 8) entered the eukaryotic cells better than shorter oligomers. Deconvolution microscopy demonstrated that short arginine oligomers could cross cyst walls and enter encysted bradyzoites (FIG. 15(B)). Uptake of short arginine oligomers into tachyzoites and bradyzoites was very rapid (seconds), and in bradyzoites, the fluoresceinated compound moved from the cytoplasm to the nucleus over the first day.

WO 2004/016220 PCT/US2003/025571 29 [0001281 Fluoresceinated, non-releasable triclosan, conjugate 4, then was studied by microscopic analyses. The conjugated triclosan was taken up by extracellular tachyzoites and by bradyzoites within cysts approximately ten seconds after addition (FIG. 16). Treatment with azide blocked uptake of short arginine oligomers linked to triclosan by tachyzoites (FIG. 16(A)), and by bradyzoites (FIG. 16(B)) but did not completely inhibit uptake into encysted bradyzoites under the conditions studied (FIG. 16(C)). Thus, uptake into tachyzoites and bradyzoites is a facilitated process. Uptake of fluoresceinated triclosan R8 (conjugate 4) into tachyzoites was substantially greater (one and a half logs) than triclosan R4 (conjugate 5), after incubation for 10 seconds, 1 minute, and 10 minutes. Uptake of triclosan R8 increased over time. As uptake into isolated bradyzoites was blocked by azide, the inability of azide to completely abrogate uptake by encysted bradyzoites is surprising and suggested that more than a single mechanism of uptake might be involved in uptake across the cyst wall. [000129] Fluorescein tagged conjugate 4 and its enantiomer both entered host fibroblasts. T gondii is an obligate intracellular parasite and resides inside a specialized vacuolar compartment known as the parasitophorous vacuole delimited by the parasitophorous vacuole membrane. To determine whether the transporter conjugated to triclosan can enter this specialized compartment, tachyzoites within a vacuole in human fibroblasts were studied. Intracellular tachyzoites took up fluoresceinated triclosan r8 (conjugate ent-4), within minutes (FIG. 17(A)). This was also confirmed by flow cytometric analysis (FIG. 17(B)). T. gondii ENR Compared to P. falciparum ENR [000130] Prior to the present invention, the only apicomplexan ENR identified was that of P. falciparum. To compare P. falciparum and T. gondii ENRs, particularly with reference to their triclosan binding sites, portions of T. gondii ENR were identified in a database, full length eDNA clones were isolated, sequenced, deduced amino acid sequences were determined and enzymatically active recombinant protein was produced (FIG. 18). Analysis of the deduced amino acid sequence revealed that key amino acid residues are conserved between T. gondii (FIG. 18(A), accession munber to be assigned), P. falciparum, B. napus, and bacterial ENRs and that 11 amino acid residues involved in triclosan binding are also conserved (FIG. 18(A)).

WO 2004/016220 PCT/US2003/025571 30 This result suggests that triclosan is likely to have a similar mode of inhibition in T gondii as in other species. In keeping with a plastid localization of this enzyme in other apicomplexans, a bi-partite transit sequence consisting of a cleavable von hiejne secretory signal (the first 27 amnino acids) followed by a chloroplast-like targeting, sequence (amino acid numbers 28-66) were identified. Alignment with the gDNA sequence in the database indicated that there are four introns. In analyzing the amino acid sequence of P. falciparum ENR, several amino acid insertions were found. B. napus ENR had inserts corresponding to two of those from P. falciparum ENR. The sequence of T. gondii ENR has multiple amino acid sequences that coincide with those inserts present in both P. falciparum and B. napus ENRs. P. falciparum ENR also contained a third, polar insert which had no counterpart in other species. Analysis of the T. gondii ENR sequence indicates only partial conservation of this larger malarial insert. The function(s) and origins of these inserts are unknown. The predicted ENR structure suggested a strategy whereby octaarginine could be conjugated to triclosan both in a releasable manner (see FIG. 14 legend), exposing a key part of the inhibitor essential in the binding of triclosan to ENR only upon its release, and in a non-releasable manner, preventing access to the critical site where a hydroxyl in triclosan binds apicomplexan ENR. Triclosan's insolubility in aqueous media, unless prepared using DMSO or ethanol, limits its clinical use, but provides an opportunity to compare the efficacy against T. gondii of triclosan alone versus triclosan delivered by conjugation to octaarginine. Effects of triclosan conjugated to short oligomers of arginine on activity of recombinant ENR (FIG. 18(B, C)) and on intracellular T. gondii were also studied (FIG. 19(A, B)). For these studies, a releasable conjugate of triclosan, compound 7, was synthesized. Attachment of triclosan to octaarginine was achieved by readily-hydrolyzable ester bond so that the triclosan cargo (FIG. 14(C)) could be released to bind to T. gondii ENR and thus inhibit the parasite. Effects of Troclosan Conjugated to Short Oligomers of Arginine on Activity of ENR [000131] Inhibition of enzyme activity paralleled kinetics of release of the conjugated triclosan (FIG. 18(C)). Releasable triclosan octaarginines (conjugates 7 and 8) were effective in inhibiting T. gondii tachyzoites (FIG. 19(A)), as was triclosan WO 2004/016220 PCT/US2003/025571 31 but only when dissolved in DMSO. Neither non-releasable triclosan R8 (conjugate 9) nor octaarginine alone was active, indicating the specificity of triclosan (FIG. 19). [000132] As the non-releasable triclosan R8 (conjugate 9), was without effect, triclosan must be released from R8, to be active (FIG. 14). It is not sufficient just to make triclosan soluble, and R8 (conjugate 10), and R4 (conjugate 11), had no effect on T. gondii alone. [000133] A kinetic analysis of the pharmacologic effect of the conjugate (T1/ 2 =12 hours) revealed that some activity could be detected after short exposure: For example, following a brief (10 minute to 2 hour) exposure there was a modest effect of triclosan r8 (conjugate ent-7), in PBS, but not triclosan in PBS, when uptake of 3 H uracil was measured in the last 18 hours of 3.5 days of culture (FIG. 19(B)). Two hours was substantially less than the time required for 50% dissociation of triclosan r8 (conjugate ent-7), (half-life of dissociation in PBS=12 hours). Exposure throughout the first 48 hours gave full efficacy (i.e., IC 90) of triclosan r8 (compound ent-7), in medium and serum (FIG. 19(B)). This is consonant with the "delayed death phenotype" seen for antimicrobial agents such as clindamycin and azithromycin believed to effect plastid associated processes. [000134] To be active against the parasite, triclosan must be targeted to, and released in the vicinity of, or within, the plastid where enzymes of apicomplexan fatty acid synthesis are targeted and active. Because short oligomers of arginine alone and linked to triclosan rapidly entered the parasite cytoplasm and nucleus, a question was whether short oligomers of arginine linked to trielosan also were in close proximity to, or entered the plastid, because the delayed death phenotype of triclosan suggested that they were likely to act on a plastid associated process. Also, analysis of T. gondii ENR suggested that the plastid was a likely site of action of this inhibitor of ENR. To determine whether short oligomers of arginine delivered triclosan to the vicinity of the plastid, a rhodamine conjugated r8 linked to triclosan (ent-6) was synthesized to facilitate co-localization studies of r8 conjugate, and a parasite in which the plastid was labeled with green fluorescent protein was examined. These studies showed a dense ring of rhodamine signal at the perimeter of the plastid that co-localized with the outer portion of the plastid and a less intense signal in the center of the plastid (FIG. 19(C)). As triclosan conjugate 7 was effective in vitro, studies were performed WO 2004/016220 PCT/US2003/025571 32 to determine the effect of this triclosan conjugate in vivo. For these studies, a model was developed in which tachyzoites of the RH strain were inoculated intraperitoneally into mice. Mice were treated intraperitoneally with triclosan r8 (compound ent-7), or triclosan (suspended in PBS) or PBS daily for four days beginning on the day they were infected. The numbers of parasites present in the peritoneal cavity were determined on the fifth day, following the four days of treatment. To develop and test this new assay, initially, sulfadiazine was given to mice in their drinking water in the four days following infection. Sulfadiazine and triclosan r8 (compound ent-7), but not triclosan in PBS, reduced subsequent parasite burden (p<0.

0 0 6 ). Expression, purification and crystallisation of TgENR [000135] The expression and purification of TgENR was carried out using the same protocol as for the pfENR. Crystals of TgENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 pl of the protein solution (20 mg/ml TgENR in 20 mM Tris pH 7.5, 100 mM NaC1, 5 pM NAD + and 6 jiM triclosan) with 2.5 il of the reservoir solution at 290 K. Initial screening of crystallization conditions was conducted using Crystal Screen, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) followed by optimization of promising conditions. The best crystals grew in a reservoir solution composed of 1.6M Ammonium Sulfate pH 9 and took one week to reach a size of approximately 0.1 x 0.05 x 0.3 mm 3 . Diffraction of TgENR crystals [0001361 X-ray analysis at the European Synchrotron Radiation Facility (ESRF) of crystals frozen at 100 K using 20% glycerol as a cryoprotectant showed that they diffracted to beyond 1.6 A. Rotation images were collected with 0.10 oscillation width and 0.5 minute exposure times on an ADSC Quantum 4 detector at station ID 14.4 (FIG. 22). The data were processed and scaled using the DENZO/SCALEPACK package (Otwinowski & Minor, 1997). Analysis of the diffraction data using the autoindexing routine in the program DENZO showed that the crystals belong to the orthorhombic system, unit cell parameters a= 60.62 A, b= 152.92 A, c= 282.90 A, and a=y=3=9 0 .00. Significant reflections were observed up to the edge of the image-plate detector (FIG. 22), and a good quality data set was collected to 2.0 A. Data collection and processing statistics can be found in Table 2. Gel filtration studies and analysis of WO 2004/016220 PCT/US2003/025571 33 the self Patterson suggest that the asymmetric unit contains two complete tetramers within the asymmetric unit, separated fractionally by a 0.5 shift along the b axis. [000137] Data collected at the Daresbury Synchrotron Radiation Source (SRS) were processed and scaled using the DENZO/SCALEPACK package. Analysis of the diffraction data using the autoindexing routine in the program DENZO showed that the crystals belong to the primitive monoclinic system, unit cell parameters a= 88.18 A, b= 82.37 A, c= 94.82 A, and c=y=90 0 3=90.77o. Reflections were observed along the OkO axis (b*) only where they satisfied the condition k = 2n, indicating that the crystals belonged to the space group P2 1 . Significant reflections were observed up to the edge of the image-plate detector (FIG. 21), and a good quality data set was collected to 2.2 A. Data collection and processing statistics can be found in Table 1. Table 1. Data collection and processing for pfENR crystals. Values in parentheses indicate data in the highest resolution shell. Space Group P2 1 Wavelength used (A) 0.9600 Resolution range (A) 50-2.18 (2.26-2.18) Unique reflections 77,321 (7,521) Multiplicity 3.1 (3.0) Completeness of all data (%) 97.2 (94.7) I/o-(I) >3 (%) 72.6 (49.6) Rmerge + (%) 0.095 (0.395) Rmerge = >hkljIi Iml/Zhklli, where Ii and Im are the observed intensity and mean intensity of related reflections, respectively. [000138] Gel filtration studies indicate that pfENR is a tetramer in solution like the enzymes from E. coli and B. napus and consideration of the possible values of Vm demonstrate that the asymmetric unit contains a complete tetramer with a Vm of 2.2 A 3 Da- 1 within the range observed for protein crystals. Table 2. Data collection and processing for tgENR crystals. Values in parentheses indicate data in the highest resolution shell. Space Group Orthorhombic I. Wavelength used (A) II. 0.9600 Resolution range (A) 50-2.00 (2.17-2.01) Unique reflections 144, 883 (15, 384) Multiplicity 2.7 (2.2) Completeness of all data (%) 91.4 (87.2) WO 2004/016220 PCT/US2003/025571 34 Average I/o 5.6 (3.9) Rmerge (%) 0.110 (0.191) Rmerge= -hk!IJi - Jm/ hkl'm, where i and Im are the observed intensity and mean intensity of related reflections, respectively. AROM [000139] A search of the Toxoplasma genome project (ToxoDB 2.1) revealed two contigs (assembled genomic sequences) containing regions that appeared to code for a number of shikimate pathway enzymes. TGG 7014 contained sequences homologous to EPSP synthase, shikimate kinase, dehydroquinase and shikimate dehydrogenase. The order of the genes on this contiguous region of DNA, although spanning some 20kb, was identical to the genomic arrangement for the same four enzymes of the fungal AROM pentafunctional protein (Duncan et al., 1987). TGG 3535, a fragment of gDNA of approximately 5kb, contained sequences homologous to DHQ synthase the remaining enzyme present in the fungal AROM. PCR was used to amplify a region spanning the two fragments, the sequence of which confirmed that the fragments were contiguous. This established that these five enzymes are clustered in the T. gondii genome. To determine whether the genes were fused to form an AROM type arrangement the cDNA sequence was determined. Initially, a probe was generated from a region of the putative DHQ synthase to screen a T. gondii (RH strain) tachyzoite cDNA library. This obtained the 5' region of the putative DHQ synthase gene including the initiation codon. However as this sequence was truncated, an alternative approach involving RT-PCR was used to amplify eDNA from T. gondii and a series of overlapping cDNA clones were obtained and sequenced. The clones were assembled, which revealed a 10kb sequence that had a single open reading frame encoding a polypeptide of 3332 amino acids with a predicted molecular weight of 361.7 kDa. Comparison of the cDNA with the gDNA sequence reveals the gene consists of 20 exons (FIG. 24A). [000140] The predicted T. gondii AROM (TgAROM) polypeptide has all the domains, known to be highly conserved in fungal AROMs and the enzyme domains are arranged in the same order as observed in fungi (FIG. 24 B). Nonetheless, TgAROM has a number of obvious differences from the fungal counterparts. Notably the protein is considerably larger than the fungal AROMs which range in size from WO 2004/016220 PCT/US2003/025571 35 1563 amino acids in Neurospora crassa to 1588 amino acids in Saccharomyces cerevisiae. The T. gondii AROM protein has a number of insertions not present in the fungal counterparts. Analysis of the relative hydrophobicity and charge of these regions, using the ExPASy ProtScale tool (http://us.expasy.org/cgi-bin/protscale.pl), suggests that these areas could form exposed surface loops. The functions of these regions are not obvious although similar hydrophilic insertions have been noted in a number of apicomplexan enzymes including chorismate synthase. [000141] Early studies established that although the fungal AROM was highly susceptible to proteolysis, many of the individual domains retained their enzymatic activity. This observation allowed biochemical characterisation of the various enzyme components and encouraged the expression and characterisation of individual or bifunctional domains. For example, the DHQ synthase and shikimate dehydrogenase domains from Emericella nidulans can be expressed as enzymatically active proteins in E. coli (Moore and Hawkins, 1993). However, the EPSP synthase domain is not active when expressed as a single domain but is when expressed as part of a DHQ synthase-EPSP synthase bifunctional protein. The DHQ synthase domain from E. nidulans has been expressed in E. coli and the 3D structure determined by X ray crystallography. As this is the only component of the AROM polypeptide to have been studied in depth, the DHQ synthase domains from both the T. gondii and E. nidulans AROMs were compared to determine if the key features are conserved between both proteins (FIG. 24 D). All the key residues which are reported to be involved in the mechanism of the E. nidulans DHQ synthase are conserved within the T gondii protein. These include the residues corresponding to E. nidulans Glu 194, His 271 and His 287 which interact with the pentacoordinate Zn 2+ , as well as those involved in providing a phosphate-binding pocket, Lys 152, Asn 162, Asn 268, His 275 and Lys 356. In addition, the residues identified in binding to the DAHP substrate analogue, carbaphosphonate (Lys 152, Asn 268, His 275 and Lys 356 and Arg 130) are conserved within the TgAROM protein. This provides insight into the rational design of other possible inhibitors for the T. gondii DHQ synthase. A secondary structure prediction of the TgAROM generated by the PredictProtein programme (Rost, 1996) (http://cubic.bioc.columbia.edu/predictprotein/), has been aligned with the known secondary structure elements of the E. nidulans enzyme (FIG.

WO 2004/016220 PCT/US2003/025571 36 24 D). There is broad agreement in the predicted positions of alpha helices and beta strand regions between both species. [0001421 The EPSP phylogeny shows the plants grouping next to the cyanobacteria (FIG. 25 A), however they do not form a monophyletic cluster, providing weak evidence of an endosymbiotic gene transfer. The shikimate dehydrogenase phylogeny (FIG. 25 C) shows the plant homologs clustered within a diverse group of bacteria but with no clear affiliation with the cyanobacterial homologs, suggesting that the plant shikimate dehydrogenase gene is not of plastidic origin. However, the shikimate dehydrogenase phylogeny is weakly supported through out the tree topology, making it inappropriate to exclude an origin from the chloroplast genome. The relevant DAHP class II cyanobacterial homologs are not available; consequently an appropriate test of the potential endosymbiotic origins of this gene from the chloroplast is presently not possible. The phylogenetic investigations reported here provide some evidence that the plant shikimate pathway is derived from the chloroplast endosymbiosis. [000143] Re-examination of the completed P. falciparum genome did not provide evidence of an AROM type protein. However, a potential EPSP synthase/shikimate kinase bifunctional protein (Accession no. NP472984) is evident and is likely to be that previously reported to have low similarity with S. cerevisiae AROM polypeptide. Homologues of this potential EPSP synthase/shikimate kinase bifunctional protein are present in a number of other Plasmodium species (P. yoelii Accession no. EAA17633 and P. chabaudi chrPch002449). This raises the question as to why the remaining enzymes are not readily identifiable. It seems unlikely that these enzymes are absent, as there is evidence for the final three enzymes of the pathway, providing a route from shikimate to chorismate. Also inhibition of one of these enzymes, EPSP synthase, is capable of restricting parasite growth. There is no known route to produce shikimate other than by the four missing enzymes and shikimate would not be available within the host. This suggests that there may be enzymes with the same biochemical ability, but vastly different in sequence, thus making them difficult to identify. Alternatively this highlights a potential inadequacy in the present gene prediction and thus annotation of the P. falciparum genome project.

WO 2004/016220 PCT/US2003/025571 37 [0001441 The first evidence for the entire set of seven shikimate pathway enzymes in any apicomplexan parasite, their genetic and molecular arrangement and their likely evolutionary origin are presented herein. The results presented for T. gondii provides the tools for functional studies, structural determination and rational drug design. Phylogenetic comparisons suggest that the AROM gene fusion was an innovation likely to have been present in the progenitor of modern eukaryotes. Thus, the shikimate pathway, rather than being confined to bacteria, fungi and plants and at least some apicomplexans, is likely to have been an ancient attribute. It has been lost in many taxa, including mammals that are now dependent on exogenous aromatic compounds. In plants the ancient gene organisation has not survived and it seems likely that the source of the shikimate pathway genes, which are essentially bacterial like, has been through the acquisition of the chloroplast as more data becomes available. It also seems likely that the list of taxa where this ancient pathway has been retained is likely to grow as we see the completion of more eukaryotic genome projects. Identification and expression of AOX in C. parvum [000145] The genotype 1 C. parvum (TU502 isolate) genome project was searched for DNA sequences with potential to code an AOX using the T. brucei AOX amino acid sequences (Genbank accession: Q26710) and the tBLASTn alogrithim. Four short genomic DNA sequences C. parvum genome project were identified as potential partial genes for C. parvum AOX (cp011120_a331_cll_082.r, cp011130_a354 f03_027.r, cp010319_a015_f01_016.r, and cp011120_a331_c11 082.f). The chromatograms of these sequences were edited and assembled using Sequencher 4.1 (Genecodes). The nucleotide sequence was used to search the C. parvum, genotype II (IOWA strain) genome project and yielded two Contigs, gn\CVMUN_58071cparvum Contig1622 and gn\CVMUN_58071cparvum-Contig649, that shared almost complete identity with the 3' and 5' flanking regions, respectively of the sequence assembled for the genotype 1 strain, confirming the presence of this gene in both type 1 and type 2 strains of C. parvum. [0001461 A region including the ORF was amplified from both strains using PCR and both strands sequenced. The ORFs from the GCH1 (Genbank Accession AY312954) and TU502 (Genbank Accession AY312955) strains are 97.71% identical WO 2004/016220 PCT/US2003/025571 38 at the nucleotide level and 97.02% identical at the amino acid level. Each of the resulting sequences yield an open reading frame of 1008bp that encodes a polypeptide of 336 amino acids in length with a predicted molecular weight of 39.2 Kda. The proteins are predicted to have an N-terminal mitochondrial targeting sequence of 14 amino acids using MitoProt II, TargetP version . 1.0 and Predator (www.inra.fr/servlets/WebPredotar). The predicted mature polypeptide has a theoretical molecular weight of 37.46 Kda. The C. parvum AOX protein has significant identity with previously described AOXs (FIG. 28) including the four highly conserved regions characteristic of alternative oxidases, the LET region and the NERMHL, LEEEA and R_DEH regions, which contain the postulated ligands to the diiron center. It has all of the amino acids, previously described as invariant among AOXs in the areas surrounding these four regions with the exception of two, the first of these is an isoleucine instead of a threonine in position 228 of the sequence which it shares with the closely related inmmutans proteins and the second is an arginine instead of an alanine at position 315. In contrast immutans has an asparagine at this position (FIG. 28). [0001471 Using RT-PCR, and the primers CpAOXRT sense and CpAOXRT antisense, a product of 1070bp was amplified from mRNA isolated from cultured GCH1 isolate indicating that this gene is transcribed. Control reactions that used RNA isolated from non-infected MBDK cells or where MMLV reverse transcriptase was omitted from the RT reaction did not yield any product, confirming that cDNA was amplified. The effect of SHAM and 8-HQ on growth of C. parvum [000148] SHAM was found to significantly inhibit the in vitro growth of C. parvum over untreated control cultures in a dose dependent manner with 10Oug/ml concentration inhibiting approximately 50% of growth and 100pg/ml inhibiting approximately 90% of growth (P< 0.05). 8-HQ also inhibited the in vitro growth of C. parvum with lug/ml concentration inhibiting approximately 50% of growth and 100pg/ml inhibiting approximately 90% of growth (FIG. 27 A-B). Paromomycin (2000tg/ml) used as a positive control inhibited just over 20% of parasite growth.

WO 2004/016220 PCT/US2003/025571 39 The effect of SHAM and 8-hydroxyquinoline on growth of T. gondii [000149] SHAM was found to significantly inhibit the in vitro growth of T. gondii over control cultures in a dose dependent manner with 0.78tg/ml inhibiting over 90% of growth (P<0.0001) (FIG. 27 B). Similarly 8-HQ also inhibited the in vitro growth of T. gondii with concentrations of 2.5pg/ml inhibiting approximately 80% of parasite growth (P<0.005) (FIG. 27 C). Pyrimethamine and sulphadiazine used in combination as a positive control inhibited greater than 95% of parasite growth. The effect of SHAM and 8-hydroxyquinoline on growth of P. falciparum [000150] SHAM was found to inhibit the in vitro growth of the W2 and D6 strains of P. falciparumin (IC 5 os of 5.7pg/ml and 6.2ptg/ml, respectively and IC 9 0s of 43 and 25tg/ml, respectively). 8-HQ also inhibited the in vitro growth of the W2 and D6 strains of P. falciparum (IC 5 os of 1.6tg/ml and 1.2jg/ml, respectively and IC 90 s of 4.5 and 1.9[tg/ml, respectively) (Table 3). Table 3. The IC 5 0 s and IC 90 s of SHAM and 8-HQ for the pyrimethamine resistant (W2) and pyrimethamine-sensitive(D 6 ), P.falciparum clones P.falciparum clone Inhibitor IC 50 (ug/ml) IC 90 (ug/ml) W2 SHAM 5.7 43 8-HQ 1.6 4.5 D6 SHAM 6.2 25 8-HQ 1.2 1.9 Phylogenetic analyses of Alternative oxidase and Immutans genes [000151] Phlyogenetic analysis was used to investigate the evolutionary origins of eukaryotic alternative oxidase and the plant immutans protein. BLAST searches of all annotated and submitted genome sequence data from GenBank (searched 04/03), revealed three putative prokaryote homologs, two from the Cyanobacterium Nostoc sp. and Synechcoccus sp. and a sequence from the alpha proteobacterium Novosphingobium aromaticivorans. These were aligned with all known eukaryotic AOX and immutans genes and the Cryptosporidium parvum AOX gene reported here.

WO 2004/016220 PCT/US2003/025571 40 [000152] Immutans genes have so far only been detected in genomes of plants, in the case of Capsicum annum and Lycopersicum esculantum the immutan proteins have been reported to functionally locate to the chloroplast organelle. Phylogenetic analysis shows that the immutans genes cluster with the cyanobacterial sequences (see FIG. 30) suggesting that the plant immutans gene have been derived from the endosymbiotic incorporation of the cyanobacterium that led to the establishment of the plant chloroplast. This evolutionary scenario is consistent with the taxonomic distribution of the immutans gene and the functional localization of this protein. [000153] The alpha proteobacterial putative AOX gene groups within the eukaryotic alternative oxidase phylogenetic cluster. A phylogenetic relationship that suggests the eukaryotic AOX genes have been derived from the endosymbiotic genome of the alpha proteobacterium that led to the mitochondrial organelle. Eukaryotic AOX proteins have been demonstrated to function within or closely associated to the mitochondrion organelle. This observation accompanied by the phylogenetic evidence makes the eukaryotic AOX a good candidate for an endosymbiotic gene transfer from the mitochondrial or mitochondrial progenitor genome, although other evolutionary scenarios could explain this phylogenetic tree topology, such as horizontal gene transfer (HGT). MitoTracker staining of C. parvum trophozoites and merozoites [000154] Having shown the presence of alternative pathway of respiration in C parvum, it was of interest to see if a respiring mitochondrial-like structure(s) could be identified. MitoTracker Green FM, is a mitochondrion-selective stain that is concentrated by active mitochondria and well retained during cell fixation. The different morphological forms of C. parvum in culture were identified using Differential Interference Contrast (DIC) microscopy. The adequacy of mitochondrial staining was assessed by looking to see if the host mitochondria are stained, under the experimental conditions used. As shown in FIG. 31 (A), in trophozoites-stage parasites the dye is concentrated and shows a discrete, but beaded staining (pseudocolored - red) pattern. This raises the possibility that the mitochondrion during this stage of intracellular growth is likely to be branched and/or segmented. During the intracellular life-cycle, the fully developed trophozoites-stage parasite undergoes first generation schizogony resulting in the formation of eight merozoites.

WO 2004/016220 PCT/US2003/025571 41 FIG. 31(B) shows merozoite-stage parasites with a more diffuse Mitotracker staining pattern. Remarkably, this staining pattern resembles host cell mitochondrial staining, indicating that during this stage of the life cycle the parasite mitochondrial organelle has undergone a morphological change. Fixing cells with 3% formaldehyde, thus abolishing mitochondrial membrane potential, prior to MitoTracker loading, showed only non-specific background staining of cells strongly suggesting that the pattern of fluorescence signal shown in FIG. 31 is mitochondrial specific. [000155] The presence of an AOX in apicomplexans has been suggested by noting that cyanide an inhibitor of complex IV and thus conventional respiration, was only able to inhibit 70% of oxygen consumption in P. falciparum. Furthermore, SHAM an inhibitor of AOX was able to inhibit some of the remaining oxygen consumption. These observations are consistent with the ability of SHAM or propyl gallate to potentiate the inhibitory effect of atovaquone, an inhibitor of complex III of the conventional respiratory system, on the in vitro growth of P. falciparum. However, the recent completion of the P. falciparum genome project has not assisted in identification of any strong candidate AOX, based on sequence comparison with any of the published sequences from plants, fungi or a small selection of protozoans. A survey of the available, completed and ongoing, apicomplexan genome projects identified an AOX in C. parvunm. [000156] The alternative oxidases thus far described from plants, fungi, and protozoan, have a high level of amino acid conservation and a number of conserved features. These include a cleavable, N-terminal, signal sequence and four predicted helices containing regions of high amino acid identity that are postulated to contribute to the diiron binding site proposed in structural models. The C. parvum AOX would appear to share all of these features including an N-terminal mitochondrial targeting sequence. [000157] The presence of mitochondria in C. parvum has been a contentious issue. Early studies suggested the absence of this organelle and a more recent 3-D ultrastructural analysis of the sporozoites of C. parvum failed to reveal any structure similar morphologically to mitochondria found in other apicomplexan parasites. A small ribosome-studded organelle has been reported to have some structural similarities with mitochondria. However, most functional biochemical studies are WO 2004/016220 PCT/US2003/025571 42 consistent with C parvum having an anaerobic metabolism and being amitochondriate. Ultrastructural studies have shown the presence of mitochondrion like structure in the merozoites of a closely related species, C. muris. Cryptosporidium has a complex life cycle so it is conceivable that during differentiation the putative mitochondrion undergoes changes in form and metabolic function in different life cycle stages making it difficult to visualize by morphological analysis. For example, in a related apicomplexan parasite P. falciparum, the number and morphological features of mitochondrial structures differ markedly with possible close association with the plastid organelle making visualization difficult. Nonetheless, classical inhibitors of the respiratory chain such as cyanide and azide are not active against the sporozoite stages of C. parvum in vitro and atovaquone is not active in a murine model. Furthermore, enzyme activities associated with the TCA cycle would appear to be absent at least from the sporozoite stage. A number of nornnally mitochondrial located nuclear encoded proteins including valyl-tRNA synthase, adenylate kinase and chaperonin (Cpn) 60 are reported. However, C. parvum has been shown to possess a pyruvate:ferredoxin oxidoreductase/NADPH cytochrome P450 reductase (PFOR) similar to the protein found in Euglena gracilis, with the major difference being the absence of a N-terminal mitochondrial targeting sequence. The apparent loss of the N-terminal sequence has been suggested as evidence of evolutionary adaptation accompanying the loss of the mitochondrion. However HSP70 in the microsporidian, Trachipleistophora hominis has been shown to localize to the remnant mitochondrion in the absence of a identifiable mitochondrial targeting peptide. The presence of a mitochondrial compartment is supported both through the identification of a C. parvum AOX and through MitoTracker staining of structures in both the trophozoite and merozoite stages. [0001581 With the absence of any good candidate AOXs identified from the P. falciparum genome project, the role of known inhibitors of this molecule on the growth of P. falciparum and T. gondii was investigated. This confirmed the previously reported ability of SHAM to inhibit the in vitro growth of P. falciparum and demonstrated that 8-HQ another known inhibitor of this molecule restricts the growth of this parasite at similar concentrations. This was independent of the 2 WO 2004/016220 PCT/US2003/025571 43 strains of P. falciparum investigated. In addition, these two compounds are active in vitro against T. gondii. [000159] Previous studies failed to detect cyanide insensitive respiration in extracellular T. gondii tachyzoites, however the studies reported herein examined the effect of AOX inhibitors on the replication of intracellular tachyzoite stages. The apparent lack of AOX activity in extracellular T. gondii may reflect differences in oxygen consumption between intracellular and extracellular tachyzoites. In support of this, a reduction in mitochondrial membrane potential is evident after tachyzoites invade a host cell. The presence of AOX in T. gondii was further investigated by western blotting of tachyzoites with antibodies raised to AOXs from a number of heterologous species. These antibodies recognised a protein of the expected size around 33kDa and an apparent dimer of around 66kDa. Examination of the T gondii genome, currently at 6x coverage, and the vast number of ESTs available from different strains and life cycle stages did not definitively identify an AOX although a number of candidates are currently being pursued and this task may become easier when gene prediction has been optimized for this organism. However, the apparent absence of any strong candidate AOX in the P. falciparum genome project, raises the possibility that the molecule responsible for cyanide resistant respiration and susceptible to inhibitors of AOXs may bear little sequence similarity with previously described AOXs. [0001601 The description of the first apicomplexan AOX raised the question of the origin of AOX in these parasites and prompted phylogenetic analyses of the newly discovered sequence and available AOX sequences and immutans sequences. These analyses tested the hypothesis that both AOX and immutans are derived from separate endosymbiotic gene transfers (EGT). Support for this hypothesis was first obtained through identification of putative AOXs in alpha proteobacteria and two putative cyanobacterial immutans proteins. These prokaryote groups include the probable progenitors of the mitochondrial and chloroplasts organelles. No evidence was found to reject this hypothesis, indeed phylogeny suggest that these genes are derived from endosymbiotic gene transfers, although other evolutionary scenarios such as independent horizontal gene transfer events could explain the phylogenetic relationships observed. However, the subcellular localisation of these proteins WO 2004/016220 PCT/US2003/025571 44 combined with phylogenetic investigations suggests that these genes are derived from endosymbiotic origins from the mitochondria in the case of AOX and the chloroplast in the case of immutans. This is the most parsimonious evolutionary scenario given that the bacterial sampling available does not enable a comprehensive phylogenetic evaluation of these putative EGT's. Further sequencing of bacterial homologues may necessitate the re-evaluation of the phylogeny and the hypothesized evolutionary origin of these eukaryote genes. [000161] Electron flow via the AOX does not contribute to transmembrane potential and two of the three potential coupling sites for proton transport and thus ATP production are lost. Since the energy of electron flow through the pathway is not conserved as chemical energy, it is lost through the generation of heat. The ability of this heat to assist in the dispersion of insect attractants and thus pollination during the flowering of Sauromatum guttatum (Voodoo Lily) is the only proven function of AOX in higher plants. Nonetheless, a number of other possible advantages of using AOX have been suggested. As many plants release cyanide following damage or infection, the AOX would provide a cyanide resistant means to maintain at least partial mitochondrial function. In addition, AOX has been suggested to function in an energy overflow system, maintaining a partial electron transport chain to allow TCA cycle to proceed in the absence of adenylate regulation. [0001621 In T. brucei, the AOX and the conventional cytochrome oxidases are expressed in a stage specific manner. The procyclic stages, found in the tsetse fly, have well developed cristae in their mitochondria and synthesise ATP by oxidative phosporylation. In contrast, long slender forms of the parasite, found in the blood stream of the mammalian host are reliant on glycolysis, which takes place in the glycosome. The NADH produced as a result of glycolysis is re-oxidised in the mitochondria by a system comprising, glycerol-3-phosphate dehydrogenase, ubiquinone and AOX. The mitochondria of the procyclic forms lack cytochrome oxidases and are incapable of oxidative phosphorylation. The apparent absence of a conventional respiratory chain in C parvum raises the possibility that it may also posses a modified respiratory chain similar to that observed in T. brucei. The advantage conferred in these circumstances would be the ability to re-oxidise NADH in the anaerobic environment in which it survives for most of its life cycle.

WO 2004/016220 PCT/US2003/025571 45 [000163] In the case of T. gondii and P. falciparum that are capable of oxidative phosporylation, the advantage of employing an AOX for energy demands would not be clear. However, use of the AOX by plants has been demonstrated to reduce the levels of mitochondrial reactive oxygen species (ROS) which may confer advantages to protozoan parasites which in addition to their endogenously produced reactive oxygen species have to contend with host immune response derived ROS. It has also been reported that while the conventional terminal cytochrome oxidases are susceptible to inhibition by nitric oxide, the AOX is resistant. This would confer a considerable advantage to many intracellular protozoan parasites as this molecule is produced during the immune response and has been shown to restrict their growth. [000164] A search of the Toxoplasma genome project (ToxoDB 2.1) revealed two contigs (assembled genomic sequences) containing regions that appeared to code for a number of shikimate pathway enzymes. TGG 7014 contained sequences homologous to EPSP synthase, shikimate kinase, dehydroquinase and shildkimate dehydrogenase. The order of the elements on this contiguous region of DNA, although spanning some 20kb, was identical to the genomic arrangement for the same four enzymes of the fungal AROM pentafuinctional protein. TGG 3535, a fragment of genomic (g)DNA of approximately 5kb, contained sequences homologous to DHQ synthase the remaining enzyme present in the fungal AROM. PCR was used to amplify a region spanning the two fragments, the sequence of which confirmed that the fragments were contiguous. This established that these five enzymes are clustered in the T. gondii genome. To determine whether the genes were fused to form an AROM type arrangement the cDNA sequence was determined. Initially, a probe was generated from a region of the putative DHQ synthase to screen a T. gondii (RH strain) tachyzoite eDNA library. This obtained the 5' region of the putative DHQ synthase gene including the initiation codon. However as this sequence was truncated, an alternative approach involving RT-PCR was used to amplify cDNA from T. gondii and a series of overlapping eDNA clones were obtained and sequenced. The clones were assembled, which revealed a 10kb sequence that had a single open reading frame encoding a polypeptide of 3332 amino acids with a predicted molecular weight of 361.7 kDa. Comparison of the cDNA with the gDNA sequence reveals the gene consists of 20 exons (FIG. 26(A)).

WO 2004/016220 PCT/US2003/025571 46 [000165] The predicted T gondii AROM (TgAROM) polypeptide has all the domains, known to be highly conserved in fungal AROMs with all the enzyme domains arranged in the same order as observed in fungi (FIG. 26(B)). Nonetheless, TgAROM has a number of obvious differences from the fungal counterparts. Notably the protein is considerably larger than the fungal AROMs, which range in size from 1563 amino acids in Neurospora crassa to 1588 amino acids in Saccharomyces cerevisiae. The T. gondii AROM protein has a number of insertions not present in the fungal counterparts. Analysis of the relative hydrophobicity and charge of these regions, using the ExPASy ProtScale tool (http://us.expasy.org/cgi-bin/protscale.pl), suggests that these areas could form exposed surface loops. The functions of these regions are not obvious although similar hydrophilic insertions have been noted in a number of apicomplexan enzymes including chorismate synthase. [000166] Early studies established that, although the fungal AROM was highly susceptible to proteolysis, many of the resultant individual domains retained their enzymatic activity. This observation allowed biochemical characterisation of the various enzyme components of the AROM and encouraged the expression and characterisation of individual or bifunctional domains of the AROM. For example, the DHQ synthase and shikimate dehydrogenase domains from the Emericella nidulans arom gene can be expressed as individual enzymatically active proteins in E. coli. However, the EPSP synthase domain is not active when expressed as a single domain but only shows activity when expressed as part of a DHQ synthase-EPSP synthase bifunctional protein. The DHQ synthase domain from E. nidulans has been expressed in E. coli and the 3D structure determined by X-ray crystallography. As this is the only component of the AROM polypeptide to have been studied in depth, the DHQ synthase domains from both the T. gondii and E. nidulans AROMs were compared to determine if the key features are conserved between both proteins (FIG. 34D). All the key residues identified by Carpenter et al., (1998) which are known to be involved in the mechanism of the E. nidulans DHQ synthase are conserved within the T. gondii protein. These include the residues corresponding to E. nidulans Glu 194, His 271 and His 287 which interact with the pentacoordinate Zn 2+ , and the residues involved in providing a phosphate-binding pocket, Lys 152, Asn 162, Asn 268, His 275 and Lys 356. In addition, the residues identified as important in the WO 2004/016220 PCT/US2003/025571 47 binding of the DAHP substrate analogue, carbaphosphonate (Lys 152, Asn 268, His 275 and Lys 356 and Arg 130) are conserved within the TgAROM protein. This provides insight into the rational design of other possible inhibitors for the T. gondii DHQ synthase. A secondary structure prediction of the TgAROM generated by the PredictProtein programme (http://cubic.bioc.columbia.edu/predictprotein), has been aligned with the known secondary structure elements of the E. nidulans enzyme (FIG. 26(D)). There is general consensus in the predicted positions of alpha helices and beta strand regions between both species. The Shikimate Pathway [000167] DAHP synthase catalyses the first committed step in the shikimate pathway. Two classes of this enzyme have been described. Class I (AroAi) were originally described as 39kDa proteins similar to the E. coli enzymes and paralogues, but can now be subdivided into AroAs and AroAD exemplified by the E. coli orthologues and the B. subtilis orthologues respectively. Many fungal and one Oomycete, Phytophtora infestans, have had Class I (AroAi) genes sequenced, suggesting a wide eukaryote taxonomic distribution. Class II (AroAn) DAHPs were originally described as similar to the 54kDa higher plant enzymes, but are now known also to exist in a number of divergent microbes such as Streptomyces and in the fungi N crassa. In plants, AroAn are feed back inhibited by arogenate a precursor of phenylalanine and tyrosine. Many bacteria, including E. coli have 3 paralogous AroAi, DAHPs designated AroF, AroG and AroH that are inhibited by tyrosine, phenylalanine and tryptophan respectively. Interestingly the fungi N. crassa and several prokaryotes possess both Class I and II DAHP synthases, consequently, it has been suggested that the two DAHPs classes may have different functions, for example the fungus, N. crassa and the bacterium Streptomyces hygroscopicus class II enzymes have been linked to secondary metabolism such as the production of antibiotics. [000168] The tBLASTn alogrithim was used to search ToxoDB 2.1 for evidence of both Class I or and II DAHP synthases. A portion of Contig TGG_9597 was found to code for a putative protein with similarity to Class II DAHP synthase, but no likely candidates were identified for a Class I DAHP synthase. This region was amplified by PCR and used as a probe to screen a T. gondii cDNA library. This produced a number of overlapping clones that assembled to give the entire T. gondii DAHP WO 2004/016220 PCT/US2003/025571 48 synthase, which was confirmed by RT-PCR amplification to produce a full length clone (Genbank accession number AY341375). Initial alignments revealed that the T gondii DAHP synthase was a member of the AroAll family. The T. gondii DAHP synthase (TgDAHP) is 615 amino acids in length and has a predicted molecular weight of 67.4 kDa, significantly larger than the previously described Class II enzymes due to the presence of a number of insertions (data not shown) analogous to those observed in the other shikimate pathway enzymes. [000169] Having identified the genes that encode all seven steps of the shikimate pathway the evolutionary origins of these genes were investigated. Current sampling of shikimate pathway genes is confined primarily to prokaryotes, fungi and plants. Previous work had suggested plant shikimate pathway is derived from gene transfer events from prokaryotic genomes, most probably the cyanobacterial endosymbiont that became the plastid. As such the plants and the fungi do not form a monophyletic eukaryote group on the phylogenetic trees of shikimate pathway genes. Step seven, chorismate synthase, had been demonstrated to cluster with fungal homologues on phylogenetic trees. The fungi and apicomplexa lineages are distant relatives within the eukaryotic evolutionary tree. As such there are at least two possible explanations for the topology of the chorismate synthase tree, either the shikimate pathway is ancestral to eukaryotes and has evolved through vertical decent, or a horizontal gene transfer (HGT) event has occurred between these two lineages. In nvestigating the evolution of the six remaining shikimate pathway genes alternative evolutionary scenarios should also be considered. These include the possibility that the shikimate pathway genes may have been derived from independent HGT events or alternatively, from endosymbiotic gene transfer from either the mitochondrial or the apicoplast endosymbiont. [000170] A full phylogenetic investigation of the remaining six genetic units that encode the T gondii shikimate pathway was used to test whether the T gondii shikimate pathway had a single common origin and to analyse whether these genes were derived from vertical decent or had been inherited horizontally from either the apicoplast genome, mitochondrial genome or any other source. Inheritance from the apicoplast would be evident if the T. gondii shikimate pathway genes clustered with the plants or the cyanobacterial taxonomic groups on phylogenetic trees. Inheritance WO 2004/016220 PCT/US2003/025571 49 from the mitochondria would be evident if the T. gondii shikimate pathway genes clustered with the alpha proteobacterial taxonomic groups on phylogenetic trees. [000171] All six genes were aligned with the available homologues from GenBank retrieved using tBLASTn. The genes were aligned automatically using the program ClustalX and refined manually using the program genetic data environment (GDE). The alignments were masked to exclude sequence positions that could not be aligned with confidence such as hyper-variable regions of the protein sequence. The dehydroquinase portion of the AROM is highly variable with few conserved characters identifiable, a reasonable alignment and character sampling could not be achieved, preventing phylogenetic analysis. However, BLAST searches suggest that the T gondii enzyme is most similar to the type I enzyme normally associated with the AROM protein. The DHQase domain is best aligned by focusing on the lysine residue involved in the formation of the covalent imine intermediate, which is characteristic of the type I family of DHQases. This residue lies at the centre of an eight stranded c/P13 barrel which forms the core of this domain. Secondary structure predictions of the DHQase portion from the T gondii AROM polypeptide can identify many, but not all of the components of this c/P3 barrel structure. Further analysis at the structural level maybe required to fully determine if this sequence is capable of forming the correct a/P barrel structure. [000172] The five remaining masked protein alignments were phylogenetically analysed with Bayesian Maximum Likelihood methods using the program Mr Bayes 2.01 with a gamma correction for variable site rates with the shape parameter estimated from the data using the JTT matrix. Tree and parameter space was sampled using the Metropolis-coupled Markov chain Monte Carlo method (MCMCMC) initiated on a random tree and run for 500,000 generations and sampled every 1000 generations. Trees were sampled from the plateau in the MCMCMC and used to calculate a consensus tree; all other trees were excluded as burnin. Bootstrap values from a distance analysis were calculated with the program PUZZLEBOOT (Holder, M., and Roger, A.J. PUZZLEBOOT version 1.03. http//hades.biochem.dal.ca/Rogerlab/Software/software.html.) using the gamma correction and proportion of invariant site values derived and averaged from the plateau in the MCMCMC parameter space search.

WO 2004/016220 PCT/US2003/025571 50 [000173] The T. gondii DAHP gene sequence clustered with the class II homolog from N. crassa with 51% bootstrap support in phylogenetic analysis. This tree topology is consistent with the phylogenetic relationships seen in the chorismate synthase phylogeny which show the T. gondi gene clustering with the fungi and similarly suggests that the T. gondii and the N. crassa DAHP genes have a common origin. These two eukaryotes group strongly (92% bootstrap support) with a DAHP homologue from the delta proteobacteria Stigmatalla aurantiaca. This relationship suggests that the origin of the primitive eukaryote DAHP synthase enzyme, present in both T. gondi and N. crassa is from the delta proteobacteria. Increased sampling of prokaryote genomes may reveal an alternative sister group to the T. gondii/fungi cluster. The presence of the two distantly related S. auranitiaca homologues suggests that further prokaryote DAHP synthase genes remain unsampled or alternatively there have been HGT events from a eukaryote to S. auranitiaca. No cyanobacterial Class II DAHP synthase genes were detected preventing an appropriate evaluation of the plastid origin of DAHP class II genes in plants. [000174] The phylogeny for the DHQ synthase was poorly supported and did not resolve a tree topology with any confidence. Several attempts were made to adjust the alignment and character sampling to improve the resolution of the phylogenetic tree. The phylogeny did not resolve whether the DHQ synthase was more closely related to fungal homologs or clustered within the prokaryote homologs (data not shown). Leaving unsolved the evolutionary origin of the T. gondii DHQ synthase AROM domain, which plausibly may have evolved from a separate HGT event from a prokaryote source. However, the DHQ synthase phylogeny confirmed that the T. gondii DHQ synthase gene did not originate from the apicoplast genome as the T. gondii enzyme did not cluster with either the plants or the cyanobacteria on our phylogenetic tree. [000175] The remaining three genetic units of the AROM indicated a monophyletic relationship between the fungi and T. gondii. This relationship was supported with moderate bootstrap values of 49%, 78% and 64% in the phylogenies of EPSP synthase (FIG. 26A), shikimate kinase (FIG. 26B) and shikimate dehydrogenase (FIG. 26C) respectively. In the case of the EPSP synthase and shikimate dehydrogenase, the T gondii genes grouped at the base of the fungal cluster consistent with these genetic WO 2004/016220 PCT/US2003/025571 51 units being inherited by vertical decent from the common ancestor of fungi and T gondii. Interestingly the shikimate kinase Bayesian phylogeny recovered the T. gondii gene within the fungal cluster, however the bootstrap tree topology is consistent with the EPSP synthase and shikimate dehydrogenase phylogenies implying that T gondii groups at the base of the fungal cluster. This suggests that the position of the T. gondii shikimate kinase gene within the fungal cluster, rather than at the base is an artifact. 1000176] Overall the phylogenetic analyses are consistent with the proposition that the shikimate pathway genes in fungi and T. gondii are related by vertical decent, from a distant eukaryotic ancestor of both lineages as all four phylogenies show the grouping of T gondii with the Fungi. Although HGT between the Fungi and T gondii lineages could explain the tree topologies recovered, this explanation is less parsimonious than the hypothesis of vertical decent as it would require the transfer of three genetic units, the AROM, DAHP synthase and ehorismate synthase between these two lineages. There is also evidence that the shikimate pathway is widespread through-out the eukaryote kingdom, for example the Oomycete, Phytophtora infestans, encodes a DAHP synthase protein (see Genbank accession number AF424663.1). Additionally there is biochemical evidence of an AROM-like protein in Euglena gracilis, supporting the hypothesis that the AROM genetic arrangement in particular is both widespread and therefore probably of ancient derivation in the Eukaryotic kingdom. Although there are marked differences in intron number and gene length between the T. gondii AROM and the known fungal AROMs it is highly unlikely that this five-gene fusion would have evolved independently on two separate occasions within the eukaryotic kingdom. It is even more unlikely that the five-gene fusion, if it were to occur independently in the eukaryote kingdom, would produce a fused gene with the same domain order. Thus, the most parsimonious explanation is that the AROM supergene was an ancient eukaryotic innovation and probably occurred by the fusion of the genes encoded on a previously evolved prokaryotic operon donated from the bacterial progenitor of the eukaryotes. A survey of some 80 currently available completed prokaryotic genomes found clustering of shikimate pathway genes in a number of taxa, some of which are known to be co-transcribed as an operon. The lack of a described clustering in the precise order of the AROM WO 2004/016220 PCT/US2003/025571 52 functional domains, may reflect lack of sampling or alternatively that multiple sequential fusion events, coupled with rearrangements in domain order were necessary to derive an efficient functional AROM protein. 10001771 The EPSP phylogeny shows the plants grouping next to the cyanobacteria (FIG. 26A), however they do not form a monophyletic cluster, providing weak evidence of an endosymbiotic gene transfer. The shikimate dehydrogenase phylogeny (FIG. 25C) shows the plant homologs clustered within a diverse group of bacteria but with no clear affiliation with the cyanobacterial homologs. Suggesting that the plant shikimate dehydrogenase gene is not of plastidic origin. However, the shikimate dehydrogenase phylogeny is weakly supported through out the tree topology, making it inappropriate to exclude an origin from the chloroplast genome. The relevant DAHP class II cyanobacterial homologs are not available; consequently an appropriate test of the potential endosymbiotic origins of this gene from the chloroplast is presently not possible. The phylogenetic investigations reported here provide weak evidence that the plant shikimate pathway is derived from the chloroplast endosymbiosis, it is therefore apparent that further testing of this hypothesis is required. [000178] Re-examination of the completed P. falciparum genome did not provide evidence of an AROM type protein. However, a potential EPSP synthase/shikimate kinase bifunctional protein is evident (Accession no. NP472984) and is likely to be the gene previously reported to have low similarity with S. cerevisiae AROM polypeptide. Homologues of this potential EPSP synthase/shikimate kinase bifunctional protein are present in a number of other Plasmodium species (P. yoelii Accession no. EAA17633 and P. chabaudi chrPch002449). This raises the question as to why the remaining enzymes are not readily identifiable. It seems unlikely that these enzymes are absent, as we now have evidence for the final three enzymes of the pathway, providing a route from shikimate to chorismate. Inhibition of one of these enzymes, EPSP synthase, is capable of restricting parasite growth. There is no known route to produce shikimate other than by the four missing enzymes and shikimate would not be available within the host. This suggests that there may be enzymes with the same biochemical ability but vastly different in sequence, thus making them difficult to identify. Alternatively this highlights a potential ongoing challenge for WO 2004/016220 PCT/US2003/025571 53 gene prediction and thus complete annotation of the P. falciparum and other Plasmodium genome projects. [000179] In testing the evolutionary origin of the T. gondii shikimate pathway a number of possible evolutionary scenarios were considered that could have arisen during apicomplexan evolution. These include the possibility of direct vertical decent or the acquisition of genes that encode plastid located enzymes from the algal endosymbiont. On the latter case, these genes would have been derived from the algal plastid genome and may or may not have been transferred to the nuclear genome as proposed for modern plants. Homologs from the cyanobacteria and the plants were included, in an attempt to exclude an origin from the plastid genome of the progenitior of the apicoplast. No evidence was found to suggest that the T gondii shikimate pathways genes were inherited from the apicoplast genome. However, as these studies progressed and with the realisation that the shikimate pathway may have been an ancestral trait in eukaryotes another possibility had to be considered. That is, the T gondii genes may have been derived directly from the nuclear genome of the algal endosymbiont that is responsible for the apicoplast. Analysis could not exclude this possibility. Given that the shikimate pathway and the AROM supergene appear to have a wide eukaryotic distribution, it is plausible that the algal nucleus may have contained the ancient eukaryotic shikimate pathway genes with an AROM like polypeptide. [000180] The shikimate pathway genes in plants may have been inherited from the prokaryote progenitor of the chloroplast. This endosymbiotic gene transfer would be evident if the plant shikimate pathway proteins clustered with the cyanobacteria in phylogenies. Phylogenetic evidence for this endosymbiotic gene transfer was found in two of the phylogenies; shikimate kinase (FIG. 25 B) and chorismate synthase. However the shikimate kinase gene transfer between the cyanobacteria and plant is only weakly supported with a bootstrap value of 50%. Table: 4 Measure Position Value Cutoff Conclusion max. C 28 0.563 0.37 Yes max. Y 28 0.471 0.34 Yes max. S 10 0.980 0.88 Yes mean. S 1-27 0.681 0.48 Yes WO 2004/016220 PCT/US2003/025571 54 [000181] When the M at position 26 was entered along with the 35 amino acids that followed, the conclusions were all "no." WO 2004/016220 PCT/US2003/025571 55 Table 5: Amino Acid Composition of FabI B.Napus T.Gondii P.Falciparum Ala (A) 40 12.78% 45 13.98% 23 6.48% Arg (R) 13 4.15% 15 4.66% 12 3.38% Asn (N) 15 4.79% 10 3.11% 41 11.55% Asp (D) 17 5.43% 20 6.21% 22 6.2% Cys (C) 1 0.32% 0 0 2 0.56% Gin (Q) 5 1.6% 10 3.11% 10 2.82% Glu (E) 16 5.11% 12 3.73% 21 5.92% Gly (G) 27 8.63% 34 10.56% 19 5.35% His (H) 2 0.64% 6 1.86% 6 1.69% Ile (I) 23 7.35% 13 4.04% 33 9.3% Leu (L) 27 8.63% 32 9.94% 25 7.04% Lys (K) 16 5.11% 16 4.97% 33 9.3% Met (M) 6 1.92% 4 1.24% 11 3.1% Phe (F) 11 3.51% 9 2.8% 10 2.82% Pro (P) 15 4.79% 16 4.97% 8 2.25% Ser (S) 35 11.18% 30 9.32% 29 8.17% Thr (T) 12 3.83% 10 3.11% 15 4.23% Trp (W) 3 0.96% 3 0.93% 2 0.56% Tyr (Y) 10 3.19% 13 4.04% 21 5.92% Val (V) 19 6.07% 24 7.45% 12 3.38% MATERIALS AND METHODS Delivery of Compositions to Microorganisms [000182] Polyarginine peptides were synthesized using solid phase techniques and commercially available fluorenylmethoxycarbonyl (Fmoc) amino acids, resins and reagents using commonly available peptide synthesizer and techniques well established within the scientific literature. Fastmoc cycles were used with O-(7 azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU). The peptides and conjugates were cleaved from the resin using 95% trifluoroacetic acid (TFA) and 5% triisopropyl silane for 24 h. The longer reaction times were necessary for complete removal the 2,2,4,6,7-pentamethyldihydrobenzofurane-5-sulfonyl (Pbf) protecting groups from the oligomers of arginine. The peptides were subsequently filtered from the resin, precipitated using diethyl ether, purified using high performance liquid chromatography reverse-phase columns (Alltech Altima, Chicago, Illinois) and characterized using 1 H NMR (Varian Associates, Palo Alto, California) and electrospray mass spectrometry.

WO 2004/016220 PCT/US2003/025571 56 Cloning of the FabI gene [000183] Genomic DNA and cDNA libraries were screened to identify and characterize the T. gondii FabI gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program. The cDNA library was constructed using tachyzoites of the RH strain of T. gondii and the X-Zap II phage vector (Stratagene). The gDNA library was constructed using genomic DNA from the RH strain of T. gondii and the X-DASH II bacteriophage vector (Stratagene). [000184] After designing the probe, cDNA and genomic DNA libraries were titered to determine the X phage concentrations. XL1-Blue MRA (for genomic library screening) and XL1-Blue MRF' (for cDNA library screening) strains of E. coli were infected with 50, 000 plaque forming units (pfu), spread on NZY plates and incubated overnight at 300 C. Phage containing T gondii DNA was then transferred onto nitrocellulose filters. The DNA was then denatured by soaking the filters in a solution of 1.5 M NaC1 and 0.5 M NaOH for two minutes, neutralized by soaking filters in 1.5 M NaC1 and 0.5 M Tris-HCi (pH=8) for five minutes and rinsed for 30 seconds by soaking in 0.2 M Tris-HCI and 2X SSC (pH=7.5). The DNA was crosslinked to the nitrocellulose filter using a UV Crosslinker (Stratagene). [000185] In the next step, the filters were prehybridized in a solution containing denatured salmon sperm DNA. This step was done in order to reduce non-specific binding of the radioactively labeled DNA probe to the membranes. The prehybridization solution also contained 2X Pipes buffer, 50% deionized formamide and 0.5% SDS. The filters were prehybridized for two hours in this solution at 42 C while shaking at 225 RPM. While prehybridization was taking place, the DNA probe with labeled with 3 2 P using a random primed DNA labeling kit (Roche). [000186] After prehybridization, the labeled probe was denatured and added to a bag containing the membranes in freshly prepared hybridization solution. The filters were allowed to shake at 225 rpm overnight at 420 C. In this step, the probe hybridized with homologous T. gondii sequences present on the filters. [000187] The hybridized filters were washed three times under high stringency conditions using 0.1 X SSC and 0.1% SDS that was heated to 600 C. This step removed radioactive probe that was not specifically bound to the filters. Washed WO 2004/016220 PCT/US2003/025571 57 filters were then exposed overnight at -700 C with Kodak BioMax Film. Development of the exposed film revealed hybridization of the labeled probe with DNA from the T. gondii libraries and was visualized as dark spots on the film. Select plaques corresponding to these dark spots were then harvested from the original plates from which the filters were derived and stored at 40 in a solution of chloroform and SM buffer. The phage from these plaques were then titered and used to infect the appropriate host strain of bacteria. The process of lifting plaques onto nitrocellulose filters, crosslinking, prehybridization and hybridization continued until autoradiographs indicated that DNA from each plaque on the filter specifically hybridized with the labeled probe. [000188] When purified positive clone phage populations were isolated after several rounds of screening, the phage DNA was isolated. In the case of the eDNA library, T. gondii DNA inserts were excised from the k-ZaplI vector and cloned into pBluescript phagemids using ExAssist Helper Phage and SOLR cells. This was done by infecting XL1-Blue MRF' E. coli with purified phage and incubating for 15 minutes at 37 C with ExAssist Helper Phage. Three milliliters of LB broth were added, and the solution was allowed to incubate at 37 0 C for 2.5 hours. The solution was then heated to 65 0 C for 20 minutes and spun at 1000Xg for 15 minutes. The resultant supernatant contained the excised pBluescript phagemids and was used to infect SOLR cells. This mixture was then spread on LB plates containing ampicillin and incubated overnight at 30 o C. Individual colonies were then harvested from the plates and cultured overnight at 37 o C in LB broth . The Wizard Mini-Prep DNA Purification Kit (Promega) was used to isolate plasmid DNA from the bacterial cultures. The DNA was then further purified using ammonium acetate precipitation and was quantitated on a 1% agarose gel before being sent to the DNA sequencing facility. The DNA was sequenced using a variety of primers including some from the pBluescript vector and some that were designed using preliminary sequence data. Characterization of DAHP synthase (DAHPS) [000189] Genomic DNA (gDNA) and complementary DNA (cDNA) libraries were screened to identify and characterize the T. gondii DAHPS gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program. The cDNA library was made using tachyzoites from the RH strain of T. gondii and the X-Zap II WO 2004/016220 PCT/US2003/025571 58 bacteriophage vector from Stratagene®. The gDNA library was created using genomic DNA from the RH strain and the )-Dash II bacteriophage vector from Stratagene®. [000190] A multi-sequence alignment of various plant and yeast DAHPS amino acid sequences was made and regions of conservation were identified. Using these conserved amino acid sequences to do BLAST searches, two discontinuous gDNA sequences containing portions of the 3' end of the T. gondii DAHPS gene were identified in the T gondii DNA database (Toxodb.org). Both sequences were translated, analyzed, and compared to known DAHPS. PCR primers were designed based upon regions in the multi-sequence alignment and used to obtain and amplify a continuous DNA sequence using both RH and Me49 strains of T. gondii as the PCR template. The PCR products were isolated using a QIAX II® extraction kit. The DNA was then cloned into E. coli using a TOPO TA Cloning® kit and plated for amplification. Optimal colonies were selected and the DNA was extracted and purified through a Mini-Prep®. A digest was then run to cut out the desired DNA sequences from the vectors they were cloned into using the EcoR1 enzyme. Following a Mini-Prepo purification, the DNA was sequenced. After analysis of the sequence data, a PCR product of the Me49 strain was selected for use as a probe to screen the gDNA and eDNA libraries. [000191] Genomic DNA (gDNA) and complementary DNA (cDNA) libraries were screened to identify and characterize the T. gondii DAHPS gene. Both libraries were obtained from the NIH AIDS Research and Reference Reagent Program. The cDNA library was made using tachyzoites from the RH strain of T. gondii and the X-Zap II bacteriophage vector from Stratagene®. The gDNA library was created using genomic DNA from the RH strain and the k-Dash II bacteriophage vector from Stratagene®. Both cDNA and gDNA libraries were titred to determine the k phage concentrations of the stock library in order to infect E. coli at correct concentrations of the phage. XL1-Blue MRA (for gDNA library screening) and XL1-Blue MRF' (for cDNA library screening) strains of E. coli were infected with 50,000 plaque forming units and plated onto NZY culture plates and incubated 30' C overnight. Then the plates were cooled at 40 C for two hours. Nitrocellulose membranes were WO 2004/016220 PCT/US2003/025571 59 placed onto the surface of the plate for two minutes in order to lift the T gondii DNA off the surface. The membranes were then soaked in a solution of 1.5 M NaCI and 0.5 M NaOH for two minutes to denature the DNA. Five minutes in 1.5 M NaCl and 0.5 M Tris-HCI (pH+8) and a final 30 seconds rinse in 0.2 M Tris-HC1 and 2X SSC (pH=7.5) neutralized the first reaction. The DNA was crosslinked to the nitrocellulose membrane by baking in a oven at 800 C for 2.5 hours. [000192] At the same time, the DNA probe was radioactively labeled with 32 p using a Roche® random primed DNA labeling kit. In order to reduce non-specific binding of the radioactively labeled probe to DNA, the nitrocellulose membranes were pre hybridized for two hours at 42 o C in a hybridization solution of 2X Pipes buffer, 50 percent deionized formamide, 0.5 percent SDS, and denatured salmon sperm DNA. After pre-hybridization, the labeled probe was denatured through heating at 1000 C for five minutes and added the hybridization solution. The membranes were incubated overnight at 225 rpm and 420 C to allow the probe to hybridize with ' homologous T. gondii sequences on the nitrocellulose membranes. Next, the membranes were washed three times using 0.1 X SSC and 0.1% SDS heated to 600 C to remove radioactive probe not specifically bound to the membranes. Film was then placed on top of the membranes and allowed to expose at -700 C. After approximately 16-18 hours, the film was developed to capture the radiation signals of the hybridized probe. Using the dark spots on the film as a guide, select positive plaques were cored out of the specific NZY plates from which the T. gondii DNA had been lifted off. The plaques were stored in a mixture of 20 pl chloroform and 500pl SM buffer. Vortexing allowed the chloroform to draw out the phage. The library screening process was then repeated using this using a correct dilution of this solution to infect E. coli with 50, 000 plaque forming units again. [000193] After multiple rounds of screening, plaques of purified, positive phage DNA were isolated. The gDNA was then amplified and cleaned up for seqencing through a series of Maxi-preps. In the case of the ongoing eDNA library, T. gondii DNA inserted into the X-ZaplI vector will be extracted and cloned into pBluescript phagemids by infecting XL1-Blue MRF' E. coli with purified phage and incubating for 15 minutes at 37 0 C with ExAssist Helper Phage. Three milliliters of LB broth will then be added and the solution will be allowed to incubate at 37 0 C for 2.5 hours.

WO 2004/016220 PCT/US2003/025571 60 The solution will be heated to 65 o C for 20 minutes and spun at 1000g for 15 minutes. SOLR cells will then be infected using the resultant supernant containing the excised pBluescript phagemids which will then plated onto LB cultures containing ampicillin and incubated at 30 0 C overnight. Select colonies will be harvested from the plates and cultured overnight at 37 0 C in LB broth. Plasmid DNA purified through a Mini-Prep® will then isolate plasmid DNA from the bacterial cultures. The DNA was further purified using ammonium acetate precipitation and sent for sequencing. Inhibition of the shikimate pathway with Aurintrycarboxylate (ATA) [000194] ATA's inhibition of T. gondii growth was assessed over multiple 1 and 4 day periods using human foreskin fibroblasts (HFF) as host cells. Toxicity for HFF was tested simultaneously by treating uninfected HFF with the same concentrations of this compound. For both challenge experiments, HFF were grown until a confluent mono-layer covered the bottom of a 96-well culture plate at 37 0 C.For toxicity experiments HFF were incubated at lower concentrations so they were nonconfluent and not contact inhibited in order to assess effect of the compound on growth of fibroblasts. Challenge plates were then infected with 103 tachyzoites of the RH strain of T gondii. For both challenge and toxicity plates, triplicate culture wells were then treated with appropriate levels of either sulphadiazine(46pLM), pyrimethamine(0.4LM ), ATA (473.6pVM, 236.8ptMm 118,4jtM, 23.7tM, 20tM, 10[tM, 5p.M, 1IM , or 0.5 pM), or a combination of the three. PABA rescue experiments were conducted with the infected HFF being treated with the of the above listed compounds in combination with PABA (10tM). Culture plates were then incubated at 37 C for either one or four days. In toxicity experiments, HFF were labeled with radioactive thymidine 24 hours before the end of the experiment and in challenge experiments, RH T. gondii were radioactively labeled with uracil 24 hours before the end of the experiment. After incubation, at the end of the either a 1 or 4 day experiment, the HFF mono-layer was washed with Hank's solution and then harvested and counted using a TOP Count ®.

WO 2004/016220 PCT/US2003/025571 61 Use of SignalP [000195] SignalP was used to analyze the 5' end of the cDNA sequence of FabI in T. gondii. The first M residue in the sequence was the start. The 60 amino acids that followed the methionine were entered. A signal sequence was identified and the most likely cleavage site is between positions 27 and 28: (TMA-FT) Short arginine oligomers, conjugates and controls [000196] Peptides were synthesized using solid phase techniques and commercially available fluorenylmethoxycarbonyl (Fmoc) amino acids, resins and reagents (PE biosystems, Foster City, California and Novabiochem, San Diego, California) using Applied Biosystems 433 Peptide Synthesizer. Fastmoc cycles were used with O-(7 azabenzotriazol- 1 -yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU). The peptides and conjugates were cleaved from the resin using 95% trifluoroacetic acid (TFA) and 5% triisopropyl silane and for 24 h. The longer reaction times were necessary for complete removal the 2,2,4,6,7-pentamethyldihydrobenzofurane-5 sulfonyl (Pbf)-protecting groups from the oligomers of arginine. The peptides were subsequently filtered from the resin, precipitated using diethyl ether, purified using high-performance liquid chromatography reverse-phase columns (Alltech Altima, Chicago, Illinois) and characterized using 1H NMR (Varian Associates, Palo Alto, California) and electrospray mass spectrometry. [000197] For the synthesis of Triclosan-Orn(FITC)-Argn-CONH2, 4 and 5, triclosan was reacted with c-bromoacetic acid to provide the desired cc-substituted acetic acid (AA) product. Attachment of the resin-bound transporter was accomplished by reaction of this acetic acid product with the appropriate oligomer of L-arginine(Pbf) containing an N-terminal L-ornithine(Mtt). After cleavage of the side-chain methyltrityl (Mtt) protecting group using 1% TFA in dichloromethane, the conjugates were labeled with fluoroscein isothiocyanate (FITC) in the presence of diisopropylethyl amine (DIPEA). The conjugates were then deprotected and cleaved from the resin using the previously described protocol. For the synthesis of Triclosan om(TRITC)-args-CONH2, ent-6, tetramethylrhodium isothiocyanate (TRITC) was reacted in the solution phase with Triclosan-D-orn-D-args-CONH2 in the presence of DIPEA. Triclosan was reacted with glutaric anhydride (GA) in the presence of DIPEA to provide the desired glutaric acid product, i.e., Triclosan-GA-Argn-CONH2, WO 2004/016220 PCT/US2003/025571 62 7 and 8. Attachment of the transporter was accomplished by the solution phase reaction with the appropriate oligomer of D- or L-arginine. For the synthesis of Trielosan-AA-Args-CONH2, 9, the previously described a-substituted acetic acid product was attached to the transporter by reaction with the resin-bound octa-L arginine(Pbf). The conjugate was subsequently cleaved from the resin, and the Pbf sulfonamides removed. For the synthesis of GA-Argn-CONH 2 , 10 and 11, the resin bound oligomer of L-arginine(Pbf) was reacted with glutaric anhydride in the presence of DIPEA, followed by cleavage of the resin and Pbf deprotection. [000198] The half-life of conjugate 7 decomposition in PBS was determined using HPLC to monitor the change in the ratio of conjugate to internal standards (benzoic acid) over time. Maintenance of T. gondii tachyzoites. [000199] Human foreskin fibroblasts (HFF) were grown to confluency in 35mm 6 well plates in Iscove's Modified Dulbecco's Media containing 10% Fetal Calf Serum (FCS) (IMDM-C). Tachyzoites of the RH strain were maintained by serially passing the parasite in HFF on a weekly basis. At this time approximately 70-90% of the HFF are infected with the parasite. Parasites used in experiments were passed through a 25 gauge needle and centrifuged at 400g for 15min at 4 0 C. Green fluorescent protein, plastid-labeled, RH strain parasites were provided by B. Streipen and D. Roos (University of Pennsylvania). Production and isolation of T. gondii cysts. 1000200] Four to six week old SPF, female Swiss webster mice (originally from Taconic, NY and then subsequently bred in our SPF colony) were infected intraperitoneally (i.p.) with 50 Me49 cysts in 0.5ml of saline. Cysts were purified by the method of Denton et al. Thirty to 60 days after infection, the brain was removed and homogenized in 1ml PBS by repeated passage through a 22 gauge needle. The brain homgenate was diluted to 13 ml with PBS. Six and one half milliliters of 90% (v/v) Percoll (Pharmacia) in PBS was added and the mixture left to settle for 30 min at 18 C. The mixture was underlayered with 2ml 90% Percoll and then centrifuged at 2500 x g at 18 C. Cysts that co-purify with erythrocytes were concentrated into the bottom layer and 1 ml of the upper layer were combined and diluted in 10 volumes of PBS and centrifuged at 2500 x g for 15 min. Erythrocytes were lysed by addition of WO 2004/016220 PCT/US2003/025571 63 1.8ml distilled water to the cyst pellet followed immediately by addition of 0.2 ml of 10x PBS. Cysts were centrifuged at 100 x g for 10 min and resuspended in PBS 2% FCS for uptake studies. Uptake of polyamines into T. gondii using deconvolution microscopy. [000201] Tachyzoites within host cells (HFF) or released extracellular tachyzoites (RH strain of T. gondii or transgenic parasites expressing GFP - Acyl carrier protein) or bradyzoites in cysts (Me49 strain of T. gondii) were incubated with fluoresceinated r5 or r7 or K7 (lower case r designates D isomers, upper case L isomers) oligomers or a non-releasable, fluoresceinated triclosan R8, conjugate 4, or triclosan r8, conjugate ent-4, conjugate [triclosan-Orn(FITC)-arg8

-CONH

2 ] (T-r8NRF) for various times intervals (see text and also under flow cytometry uptake studies). Live cells were examined using Zeiss Axiovert inverted fluorescence microscope or Zeiss Axioplan both equipped with cooled CCD camera (MicroMAX). Image capture and deconvolution were performed with Slidebook or Openlab (Improviosn, Ltd) on Macintosh Dual Processor G4. Optical sections were taken through the depth of the cell and the software used to deconvolve these images and construct 3-D volume views. Uptake of polyamines into T. gondii using flow cytometry. [000202] The fluorescein conjugated D-arginine oligomers, and r7, 1, and r5, 2, and a lysine heptamer, 3, were each dissolved in PBS (pH 7.2) and their concentration was determined by absorption of fluorescein at 490nm (e=67,000). Triclosan-R8 fluorescein or triclosan-R4 fluorescein conjugates, 4 or 5 respectively, were also studied in this manner. Approximately 1 x 106 tachyzoites of the RH strain of T. gondii were resuspended in PBS 2% FCS containing 12.5gM of each oligomer and incubated at 18 0 C for 10 minutes. The parasites were washed 3x in cold PBS (lml) and resuspended in approximately 200pl of PBS. The cells were analyzed by flow cytometry using a FACScan with data acquisition and analysis using Cell Quest software (Becton Dickinson). Flow cytometric studies were also carried out similarly with transgenic parasites expressing GFP and using rhodamine conjugate ent-6. In order to evaluate the uptake of the transporter, in tachyzoites within host cells, intracellular parasites were exposed at room temperature to 12.5pM rhodamine, conjugate ent-6, in PBS for 10 or 30 minutes, the monolayer washed three times with WO 2004/016220 PCT/US2003/025571 64 PBS and parasites released by scrapping the monolayer and passing through 25 gauge needle twice, washed once as PBS and the extracellular tachyzoites were analyzed by flow cytometry. Treatment with azide to determine whether uptake is a facilitated process. [000203] To determine whether uptake was a facilitated process, tachyzoites or cysts were preincubated for 30 min with 0.5% azide in 2% FCS/PBS buffer before the addition of 12.5 piM conjugate ent-4 or rhodamine conjugate ent-6 controls and then washed in Iml with 0.5% azide in 2% FCS/PBS buffer and resuspended in 0.1ml of the same buffer. Azide treatment of encysted bradyzoites was the same as that of tachyzoites. In some studies with bradyzoites within cysts the concentration of azide was increased to 1 or 2% (w/v). Cloning and Sequencing of T. gondii ENR. [000204] A cDNA library was screened to identify and characterize the T. gondii ENR gene. The library was obtained from the NIH AIDS Research and Reference Reagent Program. The cDNA library was constructed using tachyzoites of the RH strain of T. gondii. [000205] A genomic DNA sequence containing a portion of the 3' end of the T. gondii ENR gene was identified by searching the T. gondii DNA data base with ENR DNA sequences from malarial parasites. An amino acid sequence of the 3' end of T. gondii ENR was deduced from this genomic DNA and compared with other ENR sequences including B. napus, E. coli and P. falciparum. PCR primers were designed and used to amplify a portion of the 3' end of the target gene using genomic DNA from the RH strain of T. gondii as the PCR template. [000206] The following 165 bp PCR product was isolated and used as the probe: 5' TTGCACAGTGACGATGTCGGCGGAGCTGCGCTCTTCCTGCTGTCCCCCCTG GCTCGAGCCGTGAGCGGCGTGACTTTGTATGTAGACAACGGCTTGCATGC TATGGGACAGGCCGTTGATTCGAGATCCATGCCGCCTCTGCAGCGCGCTA CTCAGGAGATAAAT-3'. [000207] The T. gondii ENR probe was used to identify six clones that were isolated from the T. gondii eDNA library. Analysis of the cDNA sequences derived from the 6 clones revealed that 4 of the clones contained the entire ENR cDNA sequence and WO 2004/016220 PCT/US2003/025571 65 that 2 of the clones contained only partial sequence of T. gondii ENR. The largest cDNA ENR clone contained 3462 nucleotides. [000208] The amino acid sequence of T. gondii ENR was deduced by translation of the cDNA sequence and revealed that there are 417 amino acids in the putative protein. The deduced amino acid sequence of T. gondii ENR was aligned with sequences of ENR from P. falciparum, B. subtilis and E. coli. An N-terminal extension of the amino acid sequence was also identified as belonging to signaling and transit peptides. In particular, a putative 27 amino acid signal peptide was identified using SignalP V1.1 (http://www.cbs.dtu.dk/services and a putative 66 amino acid chloroplast transit peptide sequence was identified using ChloroP 1.1 Position Server. Expression and purification of recombinant T. gondii ENR [000209] A construct of T. gondii ENR (TgENR) containing residues 103-417 (and lacking the putative signal and transit peptides) was designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease. Amplified DNA encoding residues 103-417 of TgENR was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEV (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag. The resulting ligation product, pSTP8 was transformed into BL21 Star (DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21 CodonPlus (DE3) cells (Stratagene) and a plasmid (pKM586) encoding the TEV protease. Cells were grown, harvested and lysed as described in reference 24. Cell lysate was clarified by centrifugation and applied to a 5 ml HiTrap Chelating HP column (Pharmacia). Column fractions containing cut TgENR were desalted with a HiPrep 26/10 desalting column (Pharmacia) and loaded on a 5 ml HiTrap Q Fast Flow column (Pharmacia). Fractions containing pure TgENR (Fig. 5b) were then flash frozen for later use in activity experiments. Effect of r8-Triclosan on recombinant T. gondii ENR [000210] The activity of Toxoplasma gondii (Tg)ENR was assayed using crotonyl coenzyme A (crotonyl-CoA) as a substrate and monitoring the consumption of the NADH cofactor (-340 = 6220 M 1 cmn "1 ) with a scanning spectrophotometer. The standard reaction mixture in a total volume of 100 pl contained 20 mM Na/K WO 2004/016220 PCT/US2003/025571 66 phosphate buffer pH 7.5, 100 mM NaC1, 100 pM crotonyl-CoA (Sigma), 100 piM NADH (Sigma), 10% glycerol and 0.04 pg of pure recombinant TgENR. Inhibition by r8-Triclosan over a 24 hour period was measured by incubating TgENR (14.5 nM) at 37 oC with different concentrations of r8-Triclosan (2.5 tMV, 0.5 JIM, 100 nM, 20 nM, 4 nriM, 800 pM and 160 pM) in 20 mM Na/K phosphate buffer pH 7.5, 100 mM NaC1, 10% glycerol. Aliquots were removed at 0, 12 and 24 hours and assayed for TgENR activity. Briefly, 10 pL of 1 mM NADH and 10 gL of 1 mM crotonyl-CoA were added to 80 FLL of incubated TgENR/r8-Triclosan and the reaction was followed for 120 seconds in a Beckman DU-640 spectrophotometer. The final concentration of TgENR was 11.6 nM and the final concentrations ofr8-Triclosan were 2 M, 0.4 gM, 80 nM, 16 nM, 3.2 nM, 640 pM and 128 pM. Nonlinear regression analysis was performed with Prism (GraphPad Software). TgENR was inhibited by r8-Triclosan with an IC 50 value > 1 pM at 0 hours, an ICso value = 40 nM ±10 nM at 12 hours and an IC 50 value < 16 nM at 24 hours. The IC 5 0 value at 24 hours is an upper limit because inhibition can not be properly measured near the concentration of TgENR used in these assays (11.6 nM).EN.REFLIST. Assays to assess inhibition of T. gondii tachyzoite growth in vitro. [0002111 Human foreskin fibroblasts were cultured in 96-well plates (Coming) at a concentration 1 x 10 4 in 100 l in IMDM-C. After 72h, confluent cultures were infected with the 2 x 104 T. gondii parasites in 100 l of IMDM-C 1 h prior to the addition of anti-microbial agents in 25jL1 volume. After 72h, 25ptl of IMDM containing 2.5pCi of [5,6- 3 H] uracil (Moravek Biochemical) was added to each well and cultures incubated for additional 20h. Cells were dislodged and harvested on a 96 well filter plate using a Filtermate 196 harvester (Parkard) and counted by liquid scintillation spectrophotometry using a Topcount (Parkard). Triplicate cultures were treated with either releasable triclosan conjugate 7, [triclosan-glutaric acid- arg8 CONH 2 ] (T-r8) or a non releasable triclosan conjugate, 4, [triclosan-Om(FITC)-arg8 CONH 2 ] (Tr8NRF). As a positive control in these studies, a combination of pyrimethamine 0.1pg/ml and sulfadiazine 25[ig/ml was used. Labtek slides with parallel experimentally treated cultures were fixed in aminoacridine, stained with Giemsa and examined microscopically.

WO 2004/016220 PCT/US2003/025571 67 Effect of antimicrobial agents on host cells in vitro. [000212] Human foreskin fibroblast were cultured, collected, and processed as described above for the T gondii growth inhibition assay, with the exception that the concentration of HFF was 1.3 x 10 4 in 200 aM of IMDM-C and no parasites were added. This allowed the HFF to be less than confluent throughout the assay allowing their growth to be measured. After 72h, 25tl of IMDM containing 1.25[tCi of [5,6- 3 H] thymidine (Amersham) was added to each well and cultures incubated for additional 20h. Uptake was measured as described above for uptake of uracil into parasites. Effect on host cell monolayers was also evaluated microscopically. Effect of Triclosan r8 on tachyzoites in vivo. [000213] One thousand RH strain parasites were inoculated intraperitoneally into 6 female SW mice (each~ 25 grams and between 2 and 4 months of age) that were bred in our SPF colony. Lypholized releasable triclosan r8 or triclosan were resuspended in DPBS. Forty mg/kg Triclosan r8 or control PBS was inoculated i.p. each day. On the fourth day 1.5ml PBS (pH 7.4) was inoculated i.p. All available peritoneal fluid plus PBS was withdrawn on the fourth day. Total numbers of parasites and concentrations of parasites were quantitated microscopically. Five mice per group were analyzed for i.p. parasite burden in this manner. Five mice per group were observed for survival. Analysis of data and statistics. [000214] In all experiments there were at least 5 mice per group. There were triplicate cultures for each data point for each in vitro assay. Each experiment was performed at least twice. Statistical analysis was with Student's T test or Chi square analyses or one-way ANOVA or Tukey's test. Expression and purification of pfENR using the pMALc2x vector. [000215] The coding sequence of P. falciparum ENR was amplified from gDNA of the 3D7 strain of P. falciparum using PfuTurbo polymerase (Stratagene). The primers (For) 5'- GGTGGTGAATTCTCAAACATAAACAAAATTAAAGAAG -3' and (Rev) 5'- GGTGGTGTCGACTTATTCATTTTCATTGCGATATATATC -3', were used to amplify nucleotides encoding amino acids 85-432 and to introduce a proximal EcoRI and distal Sall site (underlined) in the PCR product. Nucleotides encoding the amino-terminal 84 residues of pfENR were excluded because this region is principally WO 2004/016220 PCT/US2003/025571 68 composed of a signal peptide and an organellar transit peptide. The resulting amplicon was digested with EcoRI and Sall and ligated into the pMALc2x vector (New England Biolabs). The resulting pSTP6 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid isolated from BL21-CodonPlus(DE3) cells (Stratagene) and used for the expression of MBP ENR fusion protein. Cells were grown in LB medium at 370 C to an optical density at 600 nm of 0.8 and then induced with the addition of IPTG to a final concentration of 0.4 mM. The culture was maintained in shaker flasks at 20' C for 12 hours and then harvested by centrifugation. [0002161 Cells were resuspended in lysis buffer (20mM Na/K phosphate pH 7.5, 1 mg/ml lysozyme (Sigma), 2.5 pg/ml DNAse I (Sigma), 200mM NaC1) and sonicated. Cell lysate was clarified by centrifugation and applied to a 10 ml amylose column (New England Biolabs) for affinity purification (FIG. 20A, lane 2). Purified MBP ENR fusion protein was digested with Factor Xa (New England Biolabs) at a ratio of 1 mg Factor Xa per 500 mg of fusion protein in the presence of 1 mM calcium chloride at 4 'C (FIG. 20B, lane 3). The reaction mixture was desalted with a HiPrep 26/10 Desalting column (Pharmacia) and applied to a SP Sepharose cation exchange column (Pharmacia). Column fractions containing pure pfENR protein were pooled for further analysis. Expression and purification of pfENR using the pMALcHT vector. [000217] A second construct of pfENR also containing residues 85-432 was designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease. The amplicon described above was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEV (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag (FIG. 20B). The resulting ligation product, pSTP7 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21-CodonPlus(DE3) cells (Stratagene) and plasmid (pKM586) encoding the TEV protease (Kapust & Waugh, 2001). Cells were grown, harvested and lysed as above. Cell lysate was clarified by centrifugation and applied to a 5 ml HiTrap Chelating HP column (Pharmacia). Column fractions containing cut pfENR were desalted with a HiPrep 26/10 desalting column (Pharmacia) and loaded on a 5 ml HiTrap SP Fast WO 2004/016220 PCT/US2003/025571 69 Flow column (Pharmacia). Pure pfENR (FIG. 20A, lane 4) was then concentrated to 12 mg/ml for crystallization trials. P. falciparum ENR [000218] The coding sequence of P. falciparum ENR was amplified from gDNA of the 3D7 strain of P. falciparum using PfuTurbo polymerase (Stratagene). The primers (For) 5'- GGTGGTGAATTCTCAAACATAAACAAAATTAAAGAAG -3' and (Rev) 5'- GGTGGTGTCGACTTATTCATTTTCATTGCGATATATATC -3', were used to amplify nucleotides encoding amino acids 85-432 and to introduce a proximal EcoRI and distal Sall site (underlined) in the PCR product. Nucleotides encoding the amino-terminal 84 residues of pfENR were excluded because this region is principally composed of a signal peptide and an organellar transit peptide. The resulting amplicon was digested with EcoRI and Sall and ligated into the pMALc2x vector (New England Biolabs). The resulting pSTP6 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransfonned with the pRIL plasmid isolated from BL21-CodonPlus(DE3) cells (Stratagene) and used for the expression of MBP-ENR fusion protein. Cells were grown in LB medium at 370 C to an optical density at 600 nm of 0.8 and then induced with the addition of IPTG to a final concentration of 0.4 mM. The culture was maintained in shaker flasks at 200 C for 12 hours and then harvested by centrifugation. [0002191 Cells were resuspended in lysis buffer (20mM Na/K phosphate pH 7.5, 1 mg/ml lysozyme (Sigma), 2.5 ptg/ml DNAse I (Sigma), 200mM NaC1) and sonicated. Cell lysate was clarified by centrifugation and applied to a 10 ml amylose column (New England Biolabs) for affinity purification. Purified MBP-ENR fusion protein was digested with Factor Xa (New England Biolabs) at a ratio of 1 mg Factor Xa per 500 mg of fusion protein in the presence of 1 mM calcium chloride at 4 oC. The reaction mixture was desalted with a HiPrep 26/10 Desalting column (Pharmacia) and applied to a SP Sepharose cation exchange column (Pharmacia). Column fractions containing pure pfENR protein were pooled for further analysis. [000220] A second construct of pfENR also containing residues 85-432 was designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease. The amplicon described herein was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a WO 2004/016220 PCT/US2003/025571 70 TEV (Tobacco Etch Virus) protease cleavage site followed by a six histidine tag. The resulting ligation product, pSTP7 was transformed into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21 CodonPlus(DE3) cells (Stratagene) and plasmid (pKM586) encoding the TEV protease. Cells were grown, harvested and lysed as above. Cell lysate was clarified by centrifugation and applied to a 5 ml HiTrap Chelating HP column (Pharmacia). Column fractions containing cut pfENR were desalted with a HiPrep 26/10 desalting column (Pharmacia) and loaded on a 5 ml HiTrap SP Fast Flow column (Pharmacia). Pure pfENR was then concentrated to 12 mg/ml for crystallization trials. Overexpression of P. falciparum ENR as a Fusion Protein with MBP [000221] Efficient overexpression of pfENR as a fusion protein with the maltose binding protein (MBP) using the pMALc2x expression vector was accomplished. The resulting MBP-ENR fusion protein was readily purified through affinity chromatography (FIG. 20A, lane 2). However, endoproteolytic digestion of pure MBP-ENR with Factor Xa protease yielded overdigestion products under conditions that did not completely digest all of the MBP-ENR fusion protein (FIG. 20A, lane 3). Better results were obtained using in vivo cleavage of the fusion protein by the Tobacco Etch Virus (TEV) protease. The linker region of the pMALc2x vector was modified to contain a TEV protease cut site followed by a six histidine tag, generating the pMALcHT expression vector (FIG. 20B). This vector was cotransformed into E. coli along with a plasmid encoding the TEV protease (pKM586) and a plasmid encoding three rare tRNAs (pRIL).. A long, low temperature induction period during the expression of the MBP-ENR fusion protein also served to expose the fusion protein to digestion by constitutively expressed TEV protease. The resulting pfENR digestion product could then be purified via a histidine tag exposed by cleavage. Because pfENR is a multimer, uncut MBP-ENR will tend to copurify with cut pfENR. Trace amounts of uncut MBP-ENR were removed by using a subtractive amylose column. Crystallization of pfENR and data collection. [000222] Crystals of pfENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 Rl of the protein solution (12 mg/ml pfENR in 20 mM Na/K phosphate pH 8.0, 150 mM NaC1, 5 jiM NAD

+

and 6 [LM triclosan) with 2.5 pl of the WO 2004/016220 PCT/US2003/025571 71 reservoir solution at 290 K. Initial screening of crystallisation conditions was conducted using Crystal Screen 1, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) of which the Peg/Ion screen solution 11 (20% (w/v) PEG 3350 and 200mM KI) produced the best quality crystals. This aforementioned screen was optimised, changing both the pH and precipitant concentrations to achieve an optimal reservoir solution composed of 19.5 % (w/v) PEG 3350 and 230 mM KI. This condition produced good quality crystals which took four to five weeks to reach a size of 0.15 x 0.10 x 0.10 mm 3 . X-ray analysis at the Daresbury Synchrotron Radiation Source (SRS) of crystals frozen at 100 K using 20% glycerol as a cryo protectant showed that they diffracted to beyond 2.2 A. Rotation images were collected with 1 oscillation width and 1 minute exposure times on an ADSC Quantum 4 detector at station 14.1. These crystallisation conditions were very different to those previously reported by Perozzo et al., which were based on ammonium sulphate. They also give crystals whose diffraction properties appear to be superior giving a lower Rmerge (0.095 compared to 0.123) at a higher resolution of 2.2A versus 2.4A. [000223] The data collected at the Daresbury Synchrotron Radiation Source (SRS) were processed and scaled using the DENZO/SCALEPACK package (Otwinowski & Minor, 1997). Analysis of the diffraction data using the autoindexing routine in the program DENZO showed that the crystals belong to the primitive monoclinic system, unit cell parameters a= 88.18 A, b= 82.37 A, c= 94.82 A, and a=y=9 0 0 13=90.77 0 . Reflections were observed along the OkO axis (b*) only where they satisfied the condition k = 2n, indicating that the crystals belonged to the space group P2 1 . Significant reflections were observed up to the edge of the image-plate detector (FIG. 21), and a good quality data set was collected to 2.2 A. Data collection and processing statistics can be found in Table 1. Gel filtration studies indicate that pfENR is a tetramer in solution like the enzymes from E. coli and B. napus (Baldock et al., 1998, Rafferty et al., 1995) and consideration of the possible values of Vm suggest that the asymmetric unit contains a complete tetramer with a Vm of 2.2 A 3 Da 1 within the range observed for protein crystals (Matthews, 1974). [000224] A preliminary attempt to solve the structure using molecular replacement with the AMORE program (Navaza, 1994) as implemented within the CCP4 package WO 2004/016220 PCT/US2003/025571 72 (Collaborative Computation Project 4) has been carried out using the coordinates of B. napus ENR (Protein Data Bank entry 1D70) as a search model. [000225] The techniques used for the expression and purification of T. gondii ENR closely mirror those described for pfENR. Constructs of tgENR were designed for in vivo cleavage by the TEV (Tobacco Etch Virus) protease. The tgENR gene was amplified with a 5' EcoRI endonuclease cleavage site and a 3' Sall endonuclease cleavage site for insertion into the multiple cloning site of the pMALc2x vector (New England Biolabs). The tgENR amplicon was ligated into a modified version of the pMALc2x vector (pMALcHT) in which the linker region was altered to contain nucleotides encoding a TEV (Tobacco Etch Virus) protease cut site followed by a six histidine tag. The sequence of the resulting ligation product was verified and it was transform into BL21 Star(DE3) cells (Invitrogen). These cells were cotransformed with the pRIL plasmid from BL21-CodonPlus(DE3) cells (Stratagene) and a plasmid (pKM586) encoding the TEV protease (Kapust & Waugh, 2000). Cells were cultured in LB medium at 37 oC to an OD 600 of 0.6 and then induced with IPTG (Sigma) to a final concentration of 0.4mM. The resulting culture were maintained in shaker flasks at 20 oC for 12 hours and then harvested by centrifugation at 6,000 g for 15 minutes. [000226] Cell lysis buffer (20mM Na/K phosphate pH 7.5, 1 mg/ml lysozyme (Sigma), 2.5 pg/ml DNAse I (Sigma), 200mM NaC1) was added to the cell pellets (20mL per liter of original culture) and gently vortexed the suspension. Resuspended cells were incubated on ice for 10 minutes followed by 30 seconds of sonication. Cell lysate was clarified by centrifugation at 20,000 g for 15 minutes at 4 oC and then applied to a 5 ml HiTrap Chelating HP column (Pharmacia) equilibrated in 20 mM Na/K phosphate pH 7.5, 200 mM NaC1. The column was then washed with 10 column volumes of 10 mM imidazole pH 7.5, 200 mM NaC1 and eluted with a linear gradient to 500 mM imidazole pH 7.5. Fractions containing cut tgENR were desalted with a HiPrep 26/10 desalting column (Pharmacia) equilibrated in 20 mM Tris pH 7.25. Desalted protein was loaded on an anion exchange column (HiTrap Q Fast Flow), washed with 10 column volumes of 20 mM Tris pH 7.25, and eluted with a linear gradient to 500 mM NaC1. Fractions containing tgENR were pooled and passed through amnylose resin (New England Biolabs) to remove any remaining MBP-ENR WO 2004/016220 PCT/US2003/025571 73 fusion protein. Finally, the pure tgENR was concentrated with a VivaScience-20 concentrator to 20 mg/ml for crystallization trials. This material is of sufficient purity for crystallization experiments as well as ENR enzyme assays. Assay of pure recombinant tgENR enzyme [000227] The activity of tgENR is assayed by monitoring the consumption of the NADH cofactor (6340 = 6220 M-' cm 1 ) with a scanning spectrophotometer. Although it is highly likely that crotonyl-ACP is the physiological substrate of tgENR, it has been shown that crotonyl-coenzyme A (crotonyl-CoA) can be used in place of crotonyl-ACP as a substrate in the assay of pfENR. Crotonyl-coenzyme A is a facile substrate of tgENR as well. The standard reaction mixture will contain 100 mM Na/K phosphate buffer pH 7.5, 150 mM NaC1, 100 pM crotonyl-CoA (Sigma), 100 pM NADH (Sigma). The reactions are initiated at 25 0 C by addition of 1 pg of pure recombinant tgENR. This assay was used to monitor tgENR inhibition by an octaarginine tagged triclosan compound over a 24 hour period. Hydrolysis of the octaarginine tag released triclosan, leading to decreasing ICs 50 values (11 nM at 24 hours) over the time course of the experiment. Nonlinear regression analysis was performed using GraphPad Prism software. [0002281 A similar assay was used to measure IC 50 values for common ENR inhibitors (e.g. triclosan) as well as the indole naphthyridinone compound 4 from Affinium Pharmaceuticals and compounds from the Walter Reed Army Institute of Research (WRAIR). The compounds identified at WRAIR may ultimately come from two different sources: from the WRAIR chemical database (200,000+ compounds) or from chemical synthesis by WRAIR medicinal chemists (and contract chemists). These compounds will be screened for activity against pfENR at WRAIR. Compounds with IC 50 values against pfENR in the low micromolar range will be tested against tgENR. Stock solutions of these compounds will be dissolved in DMSO at a concentration of 1 mM and tested at a final concentration of 10 1 iM (1% DMSO) as an initial screen for inhibitory activity. Activity measurements will be compared against a blank reaction containing 1% DMSO. Compounds with greater than 50% inhibitory activity (at 10 M concentration) will be assayed at seven concentrations to establish the IC 5 0 value. The best inhibitors will be assayed by using WO 2004/016220 PCT/US2003/025571 74 a range of inhibitor and substrate concentrations to determine Ki values (Enzyme Kinetics from Trinity Software). Preparation of protein crystals [000229] Crystals of tgENR were prepared by the hanging drop vapor diffusion method. Crystals of TgENR were grown using the hanging-drop vapour diffusion technique by mixing 2.5 p1 of the protein solution (20 mg/ml TgENR in 20 mM Tris pH 7.5, 100 mM NaC1, 5 pM NAD + and 6 pM triclosan) with 2.5 pl of the reservoir solution at 290 K. Initial screening of crystallization conditions was conducted using Crystal Screen, Crystal Screen 2 and PEG/Ion Screen (Hampton Research) followed by optimization of promising conditions. The best crystals grow in a reservoir solution composed of 1.6M Ammonium Sulfate pH 9 and take one week to reach a size of approximately 0.1 x 0.05 x 0.3 mm 3 . [0002301 Inhibitor complexes of tgENR will be obtained through cocrystallization with the compound, a technique that proved successful in obtaining the structure of triclosan bound to pfENR. Compounds with poor solubility will be solubilized in DMSO or ethanol and then diluted with the appropriate buffer for cocrystallization experiments. If precipitation occurs with this procedure, the compounds will be dissolved in ether and evaporate drops of the solution on cover slips. A drop of mother liquor containing one or more crystals will be placed on top of the dried compound and the cover slip will be inverted over a well containing mother liquor and sealed. The crystal will be allowed to equilibrate with the solid compound for several weeks. Data collection and reduction [000231] Diffraction data is collected using the departmental X-ray facility or at an International Synchrotron Radiation Source. The departmental facility is based around a Rigaku RU200 rotating anode generator and a copper anode. The system provides X-rays for two identical data collection stations. On each station the X-rays are focused on the crystal with a helium filled MSC/YALE optical twin platinum/nickel mirror system. The specimen crystal is mounted in a fiber loop in a stream of nitrogen gas at 100K, produced by a Oxford Cryosystems cryostream cooler. The diffracted X-rays are measured using a MarResearch MAR345 image plate detector system and the resulting images analysed and processed with a cluster WO 2004/016220 PCT/US2003/025571 75 of SGI workstations and Linux PCs. Suitable International Synchrotron sources which the group have routinely used and on which time will be made available include those at ESRF Grenoble and SRS Daresbury. The ESRF Synchrotron provides a variety of beamlines which are suitable for the use of multiple wavelength anomalous dispersion techniques (MAD) for the structure determination of proteins (BM14, ID14.4 and ID29). This can include the exploitation of anomalous scattering from Selenium incorporated in the protein as seleno-methionine or from other heavy atoms which have been soaked in to pre grown crystals. Specific stations on the Grenoble ring are particularly well suited for data collection on crystals that are either very small or which have long cell dimensions (microfocus beamline). Over the past 3 years the beamtime allocation for the Sheffield at the ESRF has provided access at approximately 4 monthly intervals. The latter allocations are awarded following scrutiny of bids providing details of the current projects in the laboratory. In addition to this the group can bid through a rapid response mechanism for allocation of beamtime for high priority projects. The Daresbury Synchrotron Radiation Source (beamlines 14.1, 14.2 and 9.6) can be used for high resolution data collection and the position of this laboratory, less than 50 miles from Sheffield makes this particular Synchrotron very convenient. As one of the larger Crystallographic Centres in the UK the Sheffield group has a guaranteed allocation of beamtime at Daresbury which provides Synchrotron access every 4 to 6 weeks. Diffraction data from any of these sources can be reduced with MOSFLM (Leslie, 1992), DENZO (Otwinowski & Minor, 1997) and CCP4 (4, 1994) packages. [000232] Initial X-ray analysis at the European Synchrotron Radiation Facility (ESRF) of tgENR crystals frozen at 100 K using 20% glycerol as a cryoprotectant showed that they diffracted to beyond 1.6 A (FIG. 22). Analysis of the diffraction data using the autoindexing routine in the program DENZO showed that the crystals belong to the orthorhombic system, unit cell parameters a= 60.62 A, b= 152.92 A, c= 282.90 A, and ca=y=J3=90.0 0 . Significant reflections were observed up to the edge of the image-plate detector (FIG. 22), and a good quality data set was collected to 2.0 A. Data collection and processing statistics can be found in Table 2. Analysis of the self Patterson suggest that the asymmetric unit contains two complete tetramers within the asymmetric unit.

WO 2004/016220 PCT/US2003/025571 76 Phase determination [000233] The method of molecular replacement (as implemented either within the program AmoRe (Navaza, 1994) or within CNS (Brunger et al., 1998) would provide initial phases to solve the structure for tgENR using the high resolution data (1.5 A) collected at the Daresbury Synchrotron Radiation Source. Search models were constructed based on the existing ENR structures (from E. coli, B. napus or P. falciparum) as a starting model. Multiple isomorphous replacement (MIR) and multiple wavelength anomalous dispersion (MAD) techniques will be used to determine the phases for tgENR. Seleno-L-methionine substituted tgENR enzyme was prepared for crystallization and subsequent use in a selenium MAD experiment. This seleno-methionine labeled tgENR is being expressed and purified. Phase improvement and model building [000234] Initial maps obtained with MIR or MAD phases will be subjected to cycles of density modification and phase improvement using the program DM as implemented in the CCP4 suite. Where the number of copies in the asymmetric unit allows molecular averaging techniques will also be employed to improve the electron density. Atomic models will be produced by interpretation of electron density maps using Silicon Graphics workstations and LINUX PCs on which public domain software packages such as FRODO (Jones, 1985) and O (Jones et al., 1991) or in house software, or the commercial packages Midasplus (Ferrin et al., 1988), MOLSCRIPT (Kraulis, et al., 1991), or Grasp (Nicholls and Honig, 1991) are implemented. Sequence alignments will be performed using CINEMA (Attwood et al., 1997) or related software mounted on a silicon graphics platform. Refinement [000235] All structures will be refined using least squares or maximum likelihood approaches as implemented either in CNS (Crystallography and NMR System; (Brunger et al., 1998)) TNT (Tronrud et al., 1987) or REFMAC (Murshudov, et al., 1997) and ARPP (Lamzin and Wilson, 1993). The refinement process is iterated with cycles of and manual rebuilding and further refinement until convergence is achieved. A bulk solvent correction will be used to allow the inclusion of low resolution reflections in the refinement.

WO 2004/016220 PCT/US2003/025571 77 Location of ligands [000236] Different Fourier maps with coefficients Fo,ligand - Fo,native using native phases will be used to build structures when appropriate. Alternatively, the coordinates of the native model will be refined against the structure factors of the complex. After 100 cycles of gradient refinement, the changes will be located in Fo Fo and 2Fo - Fc maps. Molecular replacement will be used in cases where ligand binding causes the formation of crystals in a different space group. This will be followed by refinement in order to determine accurate positions for the inhibitor. Should molecular replacement approaches fail for any reason then the structure would be solved independently, most probably using MAD based procedures. Distribution of coordinates [000237] Refined coordinates of all crystal structures will be deposited in the Protein Data Bank. Rationale [000238] Results of structural studies from will be used to discover novel and specific ENR inhibitors. These results will come from the high resolution structure of tgENR (1.5 A) and from structures of tgENR with bound inhibitors. pfENR provides an example of how structural analysis can provide fruitful information supporting inhibitor design. Triclosan analogs are designed to improve inhibitor binding to the pfENR enzyme. Structure and activity data will be used to refine a tgENR pharmacophore as part of an iterative cycle of inhibitor discovery. Ultimately, structural data could provide the rationale for synthesizing novel ENR inhibitors based on the insights that gained from studying tgENR with bound inhibitors. Structure comparison [000239] After the structure of tgENR has been determined, to the highest resolution possible structure will be compared with those already available for the enzymes from B. napus, E. coli and P. falciparium. The comparison will seek to identify the key residue changes which could be exploited in the development of inhibitors that would have high potency and specificity against T. gondii. The analysis of the structure of the ENR from P. falciparium has already led to the identification of a number of interesting structural differences between this enzyme and the enzymes of prokaryotic WO 2004/016220 PCT/US2003/025571 78 or plant origin. The most significant of these is the substitution in the substrate binding pocket of a bulky hydrophobic residue in the plant and prokaryotic enzymes by an alanine residue in the P. falciparum enzyme. The structure shows that this sequence change leaves a significant pocket in the parasite enzyme which lies immediately adjacent to the binding site for triclosan identified in our inhibitor analysis of this enzyme. The multi sequence alignment of the parasite ENRs clearly shows that the alanine is conserved across the parasite class of enzymes and a high priority therefore would be to explore the ways in which this difference in structure might be exploited through modifications of the inhibitors. Inhibitor binding studies [000240] Work on inhibitor binding to ENR has shown that a key feature of the tight binding inhibitors is the presence of a negative charge on the inhibitor which mimics that generated on the enolate anion during catalysis. In the structural analysis of triclosan binding to ENR this is provided by the phenolic oxygen of the 4 chlorophenol ring. Structural studies on the binding of a family of diazaborines to ENR have shown that in this case it is the negative charge around the boron and its associated oxygens that provides a negative charge at an equivalent part of the inhibitor. In both complexes the binding of inhibitors is dependent upon the binding of NAD + by the enzyme to generate a strong interaction between the drug and the associated nucleotide. In particular a major role in this interaction is via the nicotinamide ring of the NAD . In the inhibition of ENR by the family of diazaborines an important element of the inhibition is the formation of a covalent bond between the 2' hydroxyl of the nicotinamide ribose and the boron of the drug. The formation of this covalent bond also explains why the replacement of the B-N group in the diazaborine by an isoelectronic C-C unit in an isoquinoline analogue showed no biological activity. The formation of this covalent bond between the diazaborine and the NAD + on the enzyme effectively creates a tight, non-covalently bound bisubstrate analogue and provides a clear opportunity to mimic this in the design of a novel series of inhibitors. [000241] The inhibitor binding studies that have been carried out to date have led to the identification of residues whose substitution in the active site leads to no loss in enzyme activity but significant effects on inhibitor binding. The most important of WO 2004/016220 PCT/US2003/025571 79 these is the substitution of a glycine (Gly93 in E. coli ENR) by amino acids with small side chains such as serine, alanine and cysteine which hardly affect the catalytic parameters of the enzyme. However, these substitutions render the bacterial host resistant to the family of diazaborine inhibitors. Interestingly these mutations have little effect on inhibition by triclosan because although both drugs occupy the same part of the structure the replacement of the bulky sulphonyl oxygens in the diazaborine family by the less bulky 2,4-dichlorophenoxy ring reduce the adverse steric interactions of this part of the inhibitor. Thus, in P.falciparum in ENR which already carries an alanine at this position. [000242] Understanding of the molecular features which influence tight binding of inhibitors to ENR and which can cause problems in the generation of resistance will be invaluable as leads are identified through screening programs disclosed herein. Leads generated in this program will be co-crystallized with tgENR in the presence and absence of nucleotides (NAD or NADH) to identify structural families which could be developed through modifications to their chemistry. Compounds will be sought which might mimic the bi-substrate analogue nature of the diazaborine family as the mimics of the nicotinamide ring will necessarily be prone to fewer problems of resistance. Synthetic changes suggested by the structure of the complexes of tgENR will be investigated. Pharmacophore development [000243] A three-dimensional pharmacophore will be developed using the CATALYST 4.7 software (Accelrys Inc., San Diego, CA) (Kurogi & Guner, 2001) after a sufficient body of structure/ activity data has been generated for tgENR. CATALYST is an integrated commercially available software package that generates pharmacophores, commonly referred to as hypotheses. It enables the use of structure and activity data for a set of lead compounds to create a hypothesis, thus characterizing the activity of the lead set. At the heart of the software is the HypoGen algorithm that allows identification of hypotheses that are common to the 'active' molecules in the training set but at the same time not present in the 'inactives'. A set of 15 inhibitors will form the training set for the program. These inhibitors will be imported into CATALYST and energy minimized to the closest local minimum using the generalized CHARMM-like force field as implemented in the program. The WO 2004/016220 PCT/US2003/025571 80 CATALYST model treats molecular structures as templates comprising chemical functions localized in space that will bind effectively with complementary functions in the enzyme active site. The most relevant chemical features are extracted from a small set of compounds that cover a broad range of activity. Molecular flexibility is taken into account by considering each compound as an ensemble of conformers representing different accessible areas in 3D space. The "best searching procedure" will be applied to select representative conformers within 20 kcal/mol from the global minimum (Grigorov, et al., 1997). The conformational model of the training set was used for hypothesis (pharmacophore) generation within CATALYST, which aims to identify the best 3-dimensional arrangement of chemical functions explaining the activity variations among the compounds in the training set. The automatic generation procedure using the HypoGen algorithm in CATALYST will be adopted for generation of the hypotheses. In order to obtain a reliable model which adequately describes the interaction of ligands with high predictability, the method recommends a collection of 15-20 chemically diverse molecules with biological activity covering 4-5 orders of magnitude for the training set. [000244] Pharmacophore generation will be carried out with the 15 ENR inhibitors by setting the default parameters in the automatic generation procedure in CATALYST such as function weight 0.302, mapping coefficient 0, resolution 297 pm, and activity uncertainty 3. An uncertainty A in the CATALYST paradigm indicates an activity value lying somewhere in the interval from "activity divided by A" to "activity multiplied by A". Hypotheses approximating the pharmacophore of the ENR inhibitors are described as a set of aromatic hydrophobic, hydrogen bond acceptor, hydrogen bond acceptor lipid, positively and negatively ionizable sites distributed within a 3D space. The statistical relevance of various generated hypotheses is assessed on the basis of the cost relative to the null hypothesis and the correlation coefficients. The hypotheses are then used to estimate the activities of the training set. These activities are derived from the best conformation generation mode of the conformers displaying the smallest root-mean square (RMS) deviations when projected onto the hypothesis. HypoGen considers a pharmacophore that contains features with equal weights and tolerances. Each feature (e.g. hydrogen-bond acceptor, hydrogen-bond donor, hydrophobic, positive ionizable group, etc) WO 2004/016220 PCT/US2003/025571 81 contributes equally to estimate the activity. Similarly, each chemical feature in the HypoGen pharmacophore requires a match to a corresponding ligand atom to be within the same distance or tolerance (Greenidge & Weiser, 2001). [000245] The pharmacophore developed in this study can be used for two purposes. It can be used to provide an 'in silico' evaluation of known ENR inhibitors and related compounds. It can also be used to identify compounds unrelated to known ENR inhibitors. Thus, it is may possible to search the in-house Chemical Information System (CIS) database at WRAIR and identify new tgENR inhibitors. This approach is currently being used by WRAIR scientists to refine a pfENR phannrmacophore and identify pfENR inhibitors. The CIS database has over 240,000 compounds and the structures of each of these compounds was transformed into all conformations ranging from 0 to 20 kcal/mol and stored into a multi-conformer form CIS database by using the catDB utility program of the software. The catDB format allows a molecule to be represented by a limited set of conformations thereby permitting conformational flexibility to be included during the search of the database. C. parvum genome projects [000246] Preliminary data was obtained from Virginia Commonwealth University/Tufts University School of Veterinary Medicine Cryptosporidium parvum Genome Sequencing Project for the human isolate (genotype 1, NEMC1 strain), web site: http://www.parvum.mic.vcu.edu/. For the genotype II, IOWA strain, preliminary sequence data was obtained from the University of Minnesota Cryptosporidium parvum Genome (MCPG) sequencing project web-site: http://www.cbc.umn.edu/ResearchProiects/AGAC/Cp/. Each database was searched for DNA sequences that may code for proteins with homology with known AOXs using the tBLASTn alogrithim. In the case of the genotype I sequences, where chromatograms are available these were edited and assembled using Sequencher 4.1 (Genecodes, USA). Amplification, cloning and sequencing of C. parvum AOX and expression in cultured C. parvum [000247] Genomic DNA from oocysts was extracted. Briefly, TU502 and GCH1 oocysts were purified from feces collected from infected calves as previously described. The putative AOX open reading frame was amplified from gDNA using WO 2004/016220 PCT/US2003/025571 82 PCR. Primers used to amplify AOX were: sense [5'-ccgctogtgctgacatgaa-3'] and antisense [5'-gttcattacctgattatgaaataataacaatctcaag-3']. The expression of AOX mRNA in C parvumn-infected Madin-Darby bovine kidney (MBDK) cells in culture was examined by reverse transcriptase (RT)-PCR using specific primers for C parvum AOX, (CpAOXRT sense; 5'-tattacccgctcgtgctcac-3' and CpAOXRT antisense; 5' cctctggtaagccatagtagacg-3'). Confluent monolayers of MBDK cells were infected C. parvum genotype 2 (GCH1 isolate; 5 x 106) oocysts [22]. A control flask containing mock-infected MDBK cells was maintained in parallel and was treated in the same manner as the infected cells. The cultures were incubated at 37 0 C and 5% CO 2 and 95% N 2 for 48 hours. The uninfected- and infected-MDBK cells were collected by centrifugation (1000 x g for 5 minutes) following trypsination and washed once in PBS. The cell pellets were resuspended in PBS (200[l) and 2.2ml of RNAlater (Qiagen, UK) added and the cells immediately frozen at -80 0 C. RNA was extracted using a protocol based on the single-step acid guanidinium thiocyanate-phenol chloroform RNA isolation method [23]. [000248] cDNA was produced from 7pg of RNA using Moloney Murine leukemia virus (MMLV) reverse transcriptase (Invitrogen, Paisley, Scotland UK). In a 90[l reaction volume, 7pg of RNA was combined with 18[l of 5 x first strand buffer (250mM Tris-HCI pH8.3, 375 mM KC1, 15 mM MgC12), 18[l of deoxynucleoside triphosphate mix (10 mM), 9[l of 0.1 M dithiothreitol, 80 units of RNAsin ribonuclease inhibitor (Promega), 500ng of random hexamer primers (Promega) and 1200 units of M-MLV reverse transcriptase. Following a 10 minute pre-incubation at 27 oC, the mixture was incubated at 42 'C for 60 minutes, followed by reaction termination by heating at 95 'C for 5 minutes. Control reactions that omitted MMLV were carried out simultaneously. All cDNA was stored at -20 'C until used in PCR. [000249] All PCR reactions were performed in a 25R1 reaction volume and contained a final concentration of lx PCR buffer (50 mM KC1, 10 mM Tris-HCI pH 9.0, 0.1% Triton X-100), 1.5 mM MgC12, 200pM of each dNTP, 0.5gM of each primer and 0.25 Units Pfu polymerase (Stratagene, UK). Cycling conditions were an initial denaturation at 94 0 C for 3 mins followed by 35 cycles of 94 OC for 30 s, 58 C for 30 s and 60 oC for 1 min. Reactions finished with a final extension period for 10 min at 72

OC.

WO 2004/016220 PCT/US2003/025571 83 [0002501 PCR products were separated on a 1.5% agarose gel and visualized by ethidium bromide staining under UV illumination. Following excision from the gel, products were purified using the QIAquick Gel Purification kit (Qiagen) according to the manufacturer's instructions and ligated into pDRIVE using the Qiagen PCR Cloning Kit (Qiagen). 2pls of the ligation reaction was used to transform DH5a using the heat-shock transformation method of Cohen et al., (1972). [000251] Automated sequencing was performed on cloned products (MWG biotech, Milton Keynes, UK or MWG Biotech, High Point, North Carolina, USA) and sequences assembled using Sequencher (Genecodes). Detection of AOX in T. gondii by Western blotting [000252] Tachyzoites (RH strain) were obtained from the peritoneal exudates of infected ND4 mice. After centrifugation the pellet was subjected to 3 rounds of freeze-thawing. Protein concentration was measured by Bradford assay. Protein extracts were boiled for 5 minutes in sample buffer (75mM Tris, 5% glycerol, 1%SDS and 0.001% bromophenol blue, pH6.8) 30pg of protein loaded for each centimeter of gel. Proteins were separated on 10% polyacrylamide gel containing 0.8% N,N'-bis methylene acrylamide, 0.1% sodium dodecylsulfate (SDS) and 0.375M Tris-HCI (pH8.8) which were polymerised by the addition of 0.025% tetramethylethylenediamine (TEMED) (Sigma) and ammonium persulfate (Sigma). Electrode buffer consisted of 0.025M Tris, 0.193M glycine and 0.1% SDS (pH8.0). Following electrophoresis for 1 hour at 200V, samples were transferred to a PVDF membrane (micron Separations Inc. Westborough, PA, USA) at 4 0 C using a semi-dry blotter. [000253] After protein transfer, the PVDF membrane was blocked in PBS, 10% dried milk, 0.1% Tween 20, for 1 hour at room temperature. Following three washes in PBS/Tween 20 the membrane was incubated in PBS/Tween alone, for negative controls or with anti-AOX antibody (polyclonal anti-T brucei TAO, monoclonal anti T brucei TAO [MTB(IA2)] or polyclonal anti-voodoo lily [S. gattatum] AOX) and incubated at room temperature for 1 hour with shaking. Following a further 3 membrane was incubated in PBS/Tween containing goat anti-mouse IgG-HRP (Sigma) 1/800 dilution. Antibody binding was visualized by enhanced chemoluminescence (ECL) (Amersham, UK) using Hyperfilm ECL (Amersham).

WO 2004/016220 PCT/US2003/025571 84 DOCUMENTS CITED The following publications are incorporated by reference to the extent they teach or enable the present invention. Cohen, S.N., Chang, A.C. & Hsu, L. (1972) Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc Natl Acad Sci USA, 69, 2110-2114. Duncan K., Edwards R.M., Coggins J.R. (1987) Biochemical Journal 246, 375-386. The pentafunctional arom enzyme of Saccharomyces cerevisiae is a mosaic of monofunctional domains Gosset G., Bonner C.A., Jensen R.A. (2001) Journal of Bacteriology Vol 183 No 13, 4061-4070. Microbial origin of plant type 2-keto-3-deoxy-d-arabino heptulosonate 7-phosphate synthases, exemplified by the chorismate and tryptophan regulated enzyme from Xanthomonas campestris Huelsenbeck, J. P., and Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754-755. Mack D., McLeod R., (1984). A new micromethod to study effects of antimicrobial agents on Toxoplasma gondii: Comparison of sulfadoxine and sulfadiazine and study of clindamycin, metronidazole, and cyclosporin A. Antimicrob. Agents Chemother. 26, 26-30. Martin, W., Hoffmeister, M., Rotte, C., and Henze, K. (2001). An overview of endosymbiotic models for the origins of eukaryotes, their ATP-producing organelles (mitochondria and hydrogenosomes), and their heterotrophic lifestyle. Biol Chem 382, 1521-1539. Moore JD, Hawkins AR. (1993) Mol Gen Genet. 240, 92-102. Overproduction of, and interaction within, bifunctional domains from the amino- and carboxy-termini of the pentafunctional AROM protein of Aspergillus nidulans. Otwinowski, Z. & Minor, W. (1997) Methods Enzymol 276, 307-26. Payne D.J., Wallis N.G., Gentry D.R., Rosenberg M., 2000. The impact of genomics on novel antibacterial targets. Curr Opin Drug Discovery Devel. 3(2), 177 Roberts F., Roberts C.W., Johnston J.J., Kyle D.E., Krell T., Coggins J.R., Coombs G.H., Milhous W.K., Tzipori S., Freguson D.J.P., Chakrabati D., McLeod R.

WO 2004/016220 PCT/US2003/025571 85 (1998) Nature 393, 801-805. Evidence for the shikimate pathway in apicomplexan parasites Rost B. (1996) Methods Enzymolology, 266, 525-39 PHD: predicting one dimensional protein structure by profile-based neural networks. Rothbard, J.B., Garlington, S., Lin, Q., Kirschberg, T., Kreider, E., McGrane, P.L., Wender, P.A., and Khavari, P.A. (2000). Conjugation of arginine oligomers to cyclosporin A facilitates topical delivery and inhibition of inflammation. Nat Med 6:1253-7. Stechmann, A., and Cavalier-Smith, T. (2002). Rooting the eukaryote tree by using a derived gene fusion. Science 297, 89-91. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-4882. Zuther E., Johnson J.J., Haselkorn R., McLeod R., and Gomrnicki P., 1999. Growth of Toxoplasma gondii is inhibited by aryloxyphenoxypropionate herbicides targeting acetyl-CoA carboxylase. Proc Natl. Acad Sci USA. 96, 13387-92.

Claims (1)

1. WE CLAIM: [C1] A molecule of the Fab I enzyme having the amino acid sequence of the Fab

   I enzyme in Toxoplasma gondii as shown in FIG. 4(B) or an amino acid sequence that is substantially similar and has the same function. [C2] An isolated DNA molecule encoding T. gondii ENR.

   [C3] A recombinant T. gondii ENR.

   [C4] A crystal preparation of P. falciparum ENR (Fabl).

   [C5] A novel recombinant protein with an amino acid sequence substantially similar to that of Toxoplasma gondii shown FIG. 4(B) or FIG. 7(B) and that has the same function. [C6] Use of the amino acid sequence information from apicomplexan Fab I or

   DAHP synthase as a target to develop inhibitors and antimicrobal agents disease causing agents. [C7] The use of claim 2, wherein the apicomplexan is Toxoplasma gondii.

   [C8] The use of claim 2 wherein the disease causing agents are bacteria.

   [C9] A molecule of the DAHP synthase gene encoding the amino acid sequence of the enzyme in Toxoplasma gondii as shown in FIG. 7(B). [C10] A cDNA molecule as in FIG. 4(A).

   [C11] Use of the recombinant protein of claim 5 to determine the crystal structure of the enzyme from which novel inhibitors can be designed. [C12] Use of the information on the mRNA sequence corresponding to the amino acid sequence of apicomplexan Fab I to develop iRNA which will compete for the FAB I mRNA. [C13] Use of the plastid targeting sequence of the Toxoplasma gondii Fab I amino acid sequence according to FIG. 4(B) or the DAHP amino acid sequence according to FIG. 7, to design antimicrobial agents and inhibitors of apicomplexan growth and survival. [C14] Use of triclosan to inhibit apicomplexan growth and survival.

   [C15] A method to deliver a pharmaceutical composition into a microorganism, the method comprising: i) attaching at least one polypeptide to the composition to form a complex; and ii) contacting the microorganism with the polypeptide composition complex. [C16] The method of claim 15, wherein the microorganism is a parasite.

   [C17] The method of claim 16, wherein the parasite is Toxoplasma gondii.

   [C18] The method of claim 16, wherein the at least one polypeptide is polyarginine. [C19] The method of claim 18, where the polyarginine is octaarginnie.

   [C20] The method of claim 17, wherein delivery is to encysted T. gondii bradyzoites. [C21] The method of claim 15, wherein the composition is a small molecule.

   [C22] The method of claim 15, wherein the composition is triclosan.

   [C23] A method to test a candidate transporter for delivery of a pharmaceutical composition into a microorganism, the method comprising: [C24] contacting the pharmaceutical composition with the candidate transporter; and [C25] determining whether the pharmaceutical composition is delivered into the microorganism by the candidate transporter.