EP1534728A2 - Antisense-modulation der glucocorticoid-rezeptor-expression - Google Patents
Antisense-modulation der glucocorticoid-rezeptor-expressionInfo
- Publication number
- EP1534728A2 EP1534728A2 EP03729073A EP03729073A EP1534728A2 EP 1534728 A2 EP1534728 A2 EP 1534728A2 EP 03729073 A EP03729073 A EP 03729073A EP 03729073 A EP03729073 A EP 03729073A EP 1534728 A2 EP1534728 A2 EP 1534728A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- kcal
- mol
- antisense compound
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Definitions
- the present invention provides compositions and methods for modulating the expression of mammalian glucocorticoid receptor.
- this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding human glucocorticoid receptor.
- Such oligonucleotides may modulate the expression of glucocorticoid receptor.
- Non insulin-dependent diabetes mellitus a debilitating disease characterized by abnormal elevation of blood glucose levels, is driven by three factors: increased hepatic glucose production, inadequate clearance of glucose via insulin mediated pathways, and decreased uptake of circulating glucose by tissues. (Diabetes Review 5(3), 177-269, (1997)). Administration of agents which decrease hepatic glucose production are a fundamental approach to controlling blood glucose levels (Am. J. Physiol. 257, E35-E42 (1989). J. Clin. Endocrinol Metab. 11, 1 180-1183 (1994) and J Clin. Invest., 92, 2283-2290 (1993)).
- Glucocorticoids have been shown to have major influences on glucose production. Glucocorticoid excess aggravates established diabetes and glucocorticoid deficiency reduces blood glucose and improves glucose control in diabetic mice. (Diabetes Review, 1(3), 301-308, (1993). Diabetologia, 9, 376-379 (1973). Horm. Metab. Res., 9, 152-156 (1977)). The underlying mechanism responsible for these effects is believed to be glucocorticoid-induced upregulation of hepatic enzymes required for gluconeogenesis. (Recent Prog. Horm. Res., 26, 41 1-457 (1970). Physiol. Rev., 64, 170-259 (1984).
- the glucocorticoids are lipid soluble hormones synthesized in the adrenal cortex. They readily pass through cell membranes, enter the cytoplasm of target tissues, and bind to glucocorticoid receptors in the cytoplasm by complexation with heat shock proteins. Upon binding of the hormone to its receptor, the receptor undergoes a conformational change which results in dissociation of heat shock proteins and translocation of the ligand-bound glucocorticoid receptor into the nucleus where it can either initiate or repress specific gene transcription.
- Transcriptional activation occurs when the ligand bound receptor complex homodimerizes, and the homodimeric receptor ligand complex binds to chromosomal DNA at sequence-specific sites in the promoter region of regulated genes.
- genes which glucocorticoids up-regulate are those which play key roles in gluconeogenesis and glycogenolysis, particularly PEPCK and glucose-6- phosphatase. (Advanced Enzymology., Meister, Ed. New York, John Wiley and Sons, Inc., 203-281 (1994). and Diabetes 45, 1563-1571(1996)).
- Phosphoenolpyruvatecarboxy kinase catalyzes the conversion of oxaloacetate to phosphoenolpyruvate and glucose-6- phosphatase catalyzes the conversion of glucose-6-phosphate into glucose, both of which are required for the synthesis of glucose from oxaloacetate in the liver.
- Aventis® a potent glucocorticoid receptor antagonist, reduces mRNA levels of PEPCK and glucose-6-phosphate in the liver and causes a 50% reduction of plasma glucose levels in obese diabetic db/db transgenic mice.
- agents which function as glucocorticoid antagonists represent a novel approach to controlling type II diabetes
- agents which antagonize the glucocorticoid receptor have been the subject of active current research for their clinical potential.
- U.S. Pat. No. 5,929,058 discloses a method for treating type II diabetes comprising administering a combination of nonselective steroidal agents exhibiting mineralcorticoid receptor agonist activity and glucocorticoid receptor antagonist activity.
- non- steroidal, glucocorticoid-selective agents which antagonize the glucocorticoid receptor. These compounds would be particularly useful for treating type II diabetes and the symptoms thereof, such as hyperglycemia, inadequate glucose clearance, obesity, hyperinsulinemia, hypertriglyceridemia, and high circulating glucocorticoid levels.
- Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of GR expression.
- Figure 1 shows the cDNA sequence of human glucocorticoid receptor and the encoded protein sequence.
- Figure 2 shows the cDNA sequence of murine glucocorticoid receptor and the encoded protein sequence.
- the present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding glucocorticoid receptor, and which modulate the expression of mammalian glucocorticoid receptor (GR).
- Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of glucocorticoid receptor in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention.
- the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding glucocorticoid receptor, ultimately modulating the amount of glucocorticoid receptor produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding glucocorticoid receptor.
- target nucleic acid and “nucleic acid encoding GR” encompass DNA encoding GR, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
- the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
- This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense".
- the functions of DNA to be interfered with include replication and transcription.
- the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
- the overall effect of such interference with target nucleic acid function is modulation of the expression of GR.
- modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
- inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target.
- Targeting an antisense compound to a particular nucleic acid is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding GR.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
- a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the "start codon” or the "AUG start codon".
- translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- the terms "translation initiation codon” and "start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formyl methionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding GR, regardless of the sequence(s) of such codons.
- a translation termination codon (or "stop codon”) of a gene may have one of three sequences, i.e. 5'-UAA, 5'-UAG and 5'- UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively).
- start codon region and “translation initiation codon region” “refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.
- target regions include the 5' untranslated region (5 'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3 'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
- 5 'UTR 5' untranslated region
- 3 'UTR known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
- the 5' cap of an mRNA comprises an N7- methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
- the 5' cap region may also be a preferred target region.
- mRNA splice sites i.e., intron-exon junctions
- intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets.
- introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA.
- oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
- adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds.
- “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
- An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
- Antisense compounds are commonly used as research reagents and diagnostics.
- antisense oligonucleotides which are able to inhibit gene expression with extraordinar specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use. [0020] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
- modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
- antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonuclectide mimetics such as are described below.
- the antisense compounds in accordance with this invention preferably comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 50 nucleobases.
- the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides).
- Particularly preferred antisense compounds are antisense oligonuclectides, even more preferably those comprising from about 12 to about 25 nucleobases.
- the antisense compounds in accordance with this invention preferably comprise a nucleic acid sequence selected from the group consisiting of SEQ ID NO: 1 -SEQ ID NO:4769, and a fragment of at least eight contiguous nucleotides of SEQ ID NO: 1 -SEQ ID NO:4769.
- a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the normal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
- Various salts, mixed salts and free acid forms are also included.
- Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541 ,306; 5,550,1 1 1; 5,563,253; 5,571,799; 5,587,361 ; and 5,625,050, each of which is herein inco ⁇ orated by reference.
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- alkene containing backbones sulfamate backbones
- sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH component parts.
- Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541 ,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
- both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound, one such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331 ; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991 , 254, 1497-1500.
- Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH 2 -NH-O-CH 2 -, -CH 2 -N (CH 3 ) -O-CH 2 - [known as a methylene (methylimino) or MMI backbone] , - CH 2 -O-N (CH 3 ) -CH 2 -, -CH 2 N(CH 3 )-N(CH 3 )- CH 2 - and -O-N(CH 3 )-CH -CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH 2 -] of the above referenced U.S.
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O- alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C ⁇ to C ⁇ 0 alkyl or C 2 to Cio alkenyl and alkynyl.
- oligonucleotides comprise one of the following at the 2' position: Ci to Cio, ( lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ON0 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2' - methoxyethoxy (2' -O-CH 2 CH 2 OCH 3 , also known as 2'-O- (2-methoxyethyl) or 2'- MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethyla inoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH 2 -O-CH.-N (CH 2 ) 2 , also described in examples herein below.
- Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substitute
- nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991 , 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5-substituted pyrimidines include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O- methoxyethyl sugar modifications.
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
- a thioether e.g., hexyl-S-tritylthiol (Manoharan et a ⁇ ., Ann. N. Y. Ac ⁇ d. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
- Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther., 1996, 277, 923-937).
- Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S.: 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541 ,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731 ; 5,591 ,584; 5,109,124; 5,1 18,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,24
- antisense compounds which are chimeric compounds.
- Chimeric antisense compounds or “chimeras,” in the context of this invention are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
- oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
- An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex.
- RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
- Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers.
- the antisense compounds used in accordance with this invention may be conveniently, and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
- the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
- the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or abso ⁇ tion.
- Representative United States patents that teach the preparation of such uptake, distribution and/or abso ⁇ tion assisting formulations include, but are not limited to, U.S.: 5,108,921 ; 5,354,844; 5,416,016; 5,459,127; 5,521 ,291 ; 5,543,158; 5,547,932; 5,583,020; 5,591 ,721 ; 4,426,330; 4,534,899; 5,013,556; 5,108,921 ; 5,213,804; 5,227,170; 5,264,221 ; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein inco ⁇ orated by reference.
- the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. [0040]
- prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug versions of the oligonuclectides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 119).
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for pu ⁇ oses of the present invention.
- a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines.
- Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
- Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
- Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
- Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
- salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
- acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
- salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygal
- the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits.
- an animal preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of GR, is treated by administering antisense compounds in accordance with this invention.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
- Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
- the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding GR, enabling sandwich and other assays to easily be constructed to exploit this fact.
- Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding GR can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of GR in a sample may also be prepared.
- the present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention.
- compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-O- methoxyethyl modification are believed to be particularly useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful.
- Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
- compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
- compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- the preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention. Emulsions
- compositions of the present invention may be prepared and formulated as emulsions.
- Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter.
- Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
- emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
- Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed.
- compositions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in- oil-in-water (w/o/w) emulsions.
- Such complex formulations often provide certain advantages that simple binary emulsions do not.
- Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
- a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
- Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
- Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, abso ⁇ tion bases, and finely dispersed solids (Idson, in Pharmaceutical Dosaqe Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
- Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
- Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
- HLB hydrophile/lipophile balance
- surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 285).
- Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Abso ⁇ tion bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
- polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
- non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions.
- Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethyl cellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersedphase droplets and by increasing the viscosity of the external phase.
- polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
- cellulose derivatives for example, carboxymethyl cellulose and carboxypropylcellulose
- synthetic polymers for example, carbomers, cellulose ethers,
- emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often inco ⁇ orate preservatives.
- preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p- hydroxybenzoic acid, and boric acid.
- Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
- Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
- antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- compositions of oligonucleotides and nucleic acids are formulated as microemulsions.
- a microemulsion may be defined as a system of water, oil and amphiphile, which is a single optically isotropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 245).
- microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system.
- microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852 '5).
- Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
- microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
- microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
- Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
- the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1- butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
- Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
- the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
- the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced abso ⁇ tion of drugs.
- Lipid based microemulsions both o/w and w/o have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 1 1, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205).
- Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug abso ⁇ tion due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications.
- microemulsion compositions and formulations of the present invention will facilitate the increased systemic abso ⁇ tion of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
- Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the abso ⁇ tion of the oligonucleotides and nucleic acids of the present invention.
- Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical
- Liposomes There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
- Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Noncationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo. [0069] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient.
- liposomes which is highly deformable and able to pass through such fine pores.
- Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can inco ⁇ orate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245).
- Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
- Liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic abso ⁇ tion of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
- liposomes to deliver agents including high-molecular weight DNA into the skin.
- Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
- Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [0075] Liposomes, which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs.
- liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
- Neutral liposome compositions for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE).
- DOPE dioleoyl phosphatidylethanolamine
- Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- PC phosphatidylcholine
- Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising Novasome TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.TP.Pharma. Sci., 1994, 4, 6, 466).
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when inco ⁇ orated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G M I , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- Liposomes comprising sphingomyelin. Liposomes comprising 1 ,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).
- liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
- Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C 12 15G, that contains a PEG moiety.
- Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
- a limited number of liposomes comprising nucleic acids are known in the art.
- WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
- U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
- U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
- Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self- repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
- Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes.
- HLB hydrophile/lipophile balance
- the nature of the hydrophilic group also known as the "head" provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285)
- the surfactant molecule is not ionized, it is classified as a nonionic surfactant.
- Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
- Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
- Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
- the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
- Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
- the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
- Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
- the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric.
- Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
- the use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
- Penetration Enhancers include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals.
- Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-1 ipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non- chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
- surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that abso ⁇ tion of oligonucleotides through the mucosa. is enhanced.
- these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene- 9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252).
- Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (l-monooleoyl-.rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, 1 -dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C,. ⁇ o alkyl esters thereof (e.g., methyl, isopropyl and t- butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate,
- Bile salts [0094] The physiological role of bile includes the facilitation of dispersion and abso ⁇ tion of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935).
- Various natural bile salts, and their synthetic derivatives act as penetration enhancers.
- the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
- the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington 's Pharmaceutical
- Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that abso ⁇ tion of oligonucleotides through the mucosa is enhanced.
- chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339).
- Chelating agents of the invention include but are not limited to disodium.
- ethylenediaminetetraacetate citric acid
- salicylates e.g., sodium salicylate, 5-methoxysalicylate and homovanilate
- N-acyl derivatives of collagen e.g., laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92;
- nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance abso ⁇ tion of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
- This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1 -alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621-626).
- Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention.
- cationic lipids such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
- nucleic acids may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and te ⁇ enes such as limonene and menthone.
- glycols such as ethylene glycol and propylene glycol
- pyrrols such as 2-pyrrol
- azones such as 2-pyrrol
- te ⁇ enes such as limonene and menthone.
- compositions of the present invention also inco ⁇ orate carrier compounds in the formulation.
- carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
- a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
- the recovery of a partially phosphorothioate oligonuclectide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4- acetamido-4'isothiocyano-stilbene-2,2'disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 1 15-121 ; Takakura et al, Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
- a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
- binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
- compositions of the present invention Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention.
- suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone and the like.
- Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
- the solutions may also contain buffers, diluents and other suitable additives.
- Pharmaceutically acceptable organic or inorganic excipients suitable for non- parenteral administration which do not deleteriously react with nucleic acids can be used.
- Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone and the like.
- Other Components include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone and the like.
- Other Components may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti -inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6- mercaptopurine, 6-thioguanine, cytarabine (CA), 5-fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES).
- anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambuci
- Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
- compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 5 os found to be effective in in vitro and in vivo animal models.
- dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
- 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA).
- Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein inco ⁇ orated by reference.
- the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
- Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides are synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21 , 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA). 2'-Fluoro amidites 2'-Fluorodeoxyadenosine amidites
- 2'-fluoro oligonucleotides are synthesized as described previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841 ] and United States patent 5,670,633, herein inco ⁇ orated by reference. Briefly, the protected nucleoside N6- benzoyl-2'-deoxy-2'-fluoroadenosine is synthesized utilizing commercially available 9-beta-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a S N 2- displacement of a 2'-beta-trityl group.
- N6-benzoyl-9-beta-D- arabinofuranosyladenine is selectively protected in moderate yield as the 3 ',5'- ditetrahydropyranyl (THP) intermediate.
- THP 3 ',5'- ditetrahydropyranyl
- Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite intermediates.
- Synthesis of 2 '-deoxy-2 '-fluorouridine is accomplished by the modification of a literature procedure in which 2,2'anhydro-l-beta-D- arabinofuranosyluracil is treated with 70% hydrogen fluoride-pyridine. Standard procedures are used to obtain the 5'-DMT and 5'-DMT-3'-phosphoramidites. 2'-Fluorodeoxycytidine
- 2 '-deoxy-2 '-fluorocytidine is synthesized via amination of 2'-deoxy-2'- fluorouridine, followed by selective protection to give N4-benzoyl-2 '-deoxy-2 '- fluorocytidine. Standard procedures are used to obtain the 5'-DMT and 5'-DMT- 3 'phosphoramidites.
- 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
- the ether is decanted and the residue is dissolved in a minimum amount of methanol (ca. 400 mL).
- the solution is poured into fresh ether (2.5 L) to yield a stiff gum.
- the ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that is crushed to a light tan powder.
- the material is used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid.
- a first solution is prepared by dissolving 3'-O-acetyl-2'-O- methoxyethyl-5 '-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH 3 CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L), cooled to -5°C and stirred for 0.5 h using an overhead stirrer.
- POCl 3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10 ° C, and the resulting mixture stirred for an additional 2 hours.
- the first solution is added dropwise, over a 45 minute period, to the latter solution.
- the resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO 3 and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound.
- N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyIcytidine-3'- amidite N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) is dissolved in CH 2 C1 2 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere.
- the resulting mixture is stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete).
- the reaction mixture is extracted with saturated NaHCO 3 (1x300 mL) and saturated NaCl (3x300 mL).
- the aqueous washes are back-extracted with CH C1 2 (300 mL), and the extracts are combined, dried over MgSO 4 and concentrated.
- the residue obtained is chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give the title compound.
- 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
- Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
- reaction vessel is cooled to ambient and opened.
- TLC Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate
- 70%> conversion to the product In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column chromatography (2kg silica gel, ethyl acetate-hexanes gradient 1 :1 to 4:1).
- reaction mixture is flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) is added to get a clear solution.
- Diethyl- azodicarboxylate (6.98mL, 44.36mmol) is added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop.
- the reaction is stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent is evaporated in vacuum.
- Residue obtained is placed on a flash column and eluted with ethyl acetate :hexane (60:40), to get 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine as white foam.
- Aqueous NaHCO 3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x20mL). Ethyl acetate phase is dried over anhydrous Na 2 SO 4 , evaporated to dryness.
- Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL).
- Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes.
- reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs.
- 5% NaHCO 3 (25mL) solution is added and extracted with ethyl acetate (2x25mL).
- Ethyl acetate layer is dried over anhydrous Na 2 SO 4 and evaporated to dryness.
- the residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH 2 C1 2 to get 5'-O- tertbutyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine as a white foam.
- Triethylamine trihydrofluoride (3.91 mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5'-O-tert-butyldiphenylsilyl-2'-O-[N,N- dimethylaminooxyethyl]-5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH C1 2 ). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH 2 C1 2 to get 2'-O-(dimethylaminooxyethyl)-5- methyluridine.
- reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added.
- the reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere.
- the progress of the reaction is monitored by TLC (hexane:ethyl acetate 1 : 1).
- the solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHC0 (40mL). Ethyl acetate layer is dried over anhydrous Na SO 4 and concentrated.
- Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'- O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam.
- 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'- O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly. N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite]
- the 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-0-alkylation of diaminopurine riboside.
- Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2- ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer.
- 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'- O-(2ethylacetyl)guanosine by treatment with adenosine deaminase.
- Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5 '-O-(4,4'- dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2 '-O-(2- ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine.
- the hydroxyl group may be displaced by N- hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2- ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
- 2'-dimethyIaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites [00137] 2 '-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2O-CH 2 -O-CH 2 -N(CH2) 2 , or 2'- DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
- the bomb is cooled to room temperature and opened.
- the crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL).
- the excess phenol is extracted into the hexane layer.
- the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated.
- the residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2%> triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
- the thiation wait step is increased to 68 sec and is followed by the capping step.
- the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution.
- Phosphinate oligonucleotides are prepared as described in U.S. Patent
- Alkyl phosphonate oligonucleotides are prepared as described in U.S.
- 3 '-Deoxy-3 '-methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein inco ⁇ orated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S.
- Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein inco ⁇ orated by reference.
- 3 '-Deoxy-3 '-amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein inco ⁇ orated by reference.
- Phosphotriester oligonucleotides are prepared as described in U.S.
- Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein inco ⁇ orated by reference.
- Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein inco ⁇ orated by reference.
- PNAs Peptide nucleic acids
- PNA Peptide nucleic acids
- Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides.
- Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”. [2'-O-Me]— [2'-deoxy]--[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides [00155] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and 2'- deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 380B, as above.
- Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl- 3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'- O-phosphoramidite for 5' and 3' wings.
- the standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl.
- the fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3:1 ammonia/ethanol at room temperature overnight then lyophilized to dryness.
- [00156] [2'-O-(2-methoxyethyl)]-[2'-deoxy]—[-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides are prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of phorothioate oligonucleotides are prepared as per the procedure abo 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.
- oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis are periodically checked by P nuclear magnetic resonance spectroscopy, and for some studies oligonuclectides are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162- 18171.
- Oligonucleotides are synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format.
- Phosphodiester internucleotide linkages are afforded by oxidation with aqueous iodine.
- Phosphorothioate internucleotide linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1 ,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
- Standard base -protected beta-cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g.
- Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites.
- Oligonucleotides are cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
- oligonucleotide concentration is assessed by dilution of samples and UV absorption spectroscopy.
- the full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
- the effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative pu ⁇ oses, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR.
- T-24 cells The human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
- ATCC American Type Culture Collection
- Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- A549 cells [00166] The human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
- ATCC American Type Culture Collection
- Human neonatal dermal fibroblast can be obtained from the Clonetics Co ⁇ oration (Walkersville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Co ⁇ oration, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.
- HEK Human embryonic keratinocytes
- Clonetics Corporation Walkersville MD
- HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the supplier.
- Cells are routinely maintained for up to 10 passages as recommended by the supplier.
- MCF-7 cells [00169] The human breast carcinoma cell line MCF-7 is obtained from the American Type Culure Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10%> fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- the mouse lung epithelial cell line LA4 is obtained from the American Type Culure Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000-6000 cells/ well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
- Treatment with antisense compounds [00174] When cells reached 80% confluency, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 200 ⁇ L OPTl-MEM ,m -] reduced-serum medium (Gibco BRL) and then treated with 130 ⁇ L of OPTI-MEMTMTM-l containing 3.75 ⁇ g/mL LIPOFECT1NTM (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16-24 hours after oligonucleotide treatment.
- the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of H-ras or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments.
- Antisense modulation of GR expression can be assayed in a variety of ways known in the art.
- GR mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred.
- RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.
- mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single- plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer- probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art.
- Protein levels of GR can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS).
- Antibodies directed to GR can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1 -11.11.5, John Wiley Sons, Inc., 1997.
- Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1 10.16.11, John Wiley & Sons, Inc., 1998.
- Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21 , John Wiley Sons, Inc., 1997.
- Enzyme-linked immunosorbent assays ELISA are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 1 1.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
- Poly(A)+ mRNA isolation [00179] Poly(A)+ mRNA is isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1 , pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96- well plates, growth medium is removed from the cells and each well is washed with 200 ⁇ L cold PBS.
- lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5%) NP-40, 20 mM vanadyl-ribonucleoside complex
- NP-40 20 mM vanadyl-ribonucleoside complex
- 55 ⁇ L of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 ⁇ L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
- the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes.
- 60 pL of elution buffer (5 mM Tris- HCl pH 7.6), preheated to 70°C is added to each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.
- Total mRNA is isolated using an RNEASY 96TM kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 ⁇ L cold PBS. 100 ⁇ L Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 ⁇ L of 70%> ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96TM well plate attached to a QIA VAC TM manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 15 seconds.
- Buffer RW1 1 mL of Buffer RW1 is added to each well of the RNEASY 96TM plate and the vacuum again applied for 15 seconds.
- 1 mL of Buffer RPE is then added to each well of the RNEASY 96 plate and the vacuum applied for a period of 15 seconds.
- the Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes.
- the plate is then removed from the QIAVACTM manifold and blotted dry on paper towels.
- the plate is then re-attached to the QIAVAC TM manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 60 ⁇ L water into each well, incubating I minute, and then applying the vacuum for 30 seconds.
- the elution step is repeated with an additional 60 ⁇ L water.
- the repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
- Quantitation of GR mRNA levels is determined by real-time quantitative PCR using the ABI PRISM TM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high- throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate.
- ABI PRISM TM 7700 Sequence Detection System PE-Applied Biosystems, Foster City, CA
- reporter dye e.g., JOE, FAM, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA
- a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
- annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'- exonuclease activity of Taq polymerase.
- cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
- additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the
- ABI PRISM 7700 Sequence Detection System In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
- PCR reagents can be obtained from PE-Applied Biosystems, Foster City, CA. RT-PCR reactions are carried out by adding 25 ⁇ L PCR cocktail (lx
- TAQMAN TM buffer A 5.5 MM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20
- RNAse inhibitor 1.25 Units AMPLITAQ GOLD , and 12.5 Units MuLV reverse transcriptase
- the RT reaction is carried out by incubation for 30 minutes at 48°C.
- 40 cycles of a two- step PCR protocol are carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension).
- Probes and primers to human GR were designed to hybridize to a human GR sequence shown in Figure 1 , using published sequence information (GenBank accession number NM_000176, inco ⁇ orated herein).
- the PCR primers were: forward primer: AGGTTGTGCAAATTAACAGTCCTAACT SEQ ID NO : 4774 reverse primer: TAGTCTTTTGCAACCATCATCCA SEQ ID NO : 4775 and the PCR probe is: FA -AGCACCTAGTCCAGTGACCTGCTGGGTAAA-TAMPA SEQ ID
- Probes and primers to mouse GR were designed to hybridize to a mouse GR sequence shown in Figure 2, using published sequence information (GenBank NM_008173 inco ⁇ orated herein). For mouse GR the PCR primers were:
- forward primer CGGGACCACCTCCCAAAC SEQ ID NO : 4780
- reverse primer GCACCCCATAATGGCATACC SEQ ID NO : 4781
- the PCR probe is: FAM-TGCCTGGTGTGCTCCGATGAAGC- TAMPA SEQ ID NO : 4782 where FAM
- PCR primers were: forward primer: AGAGAAATTTGAGGATGAGAACTTCAT SEQ ID NO : 4783 reverse primer: TTGTGTTTGGTCCAGCATTTG SEQ ID NO : 4784 and the PCR probe is: JOE- AAGCATACAGGTCCTGGCATCTTGTCCAT- TAMRA SEQ ID NO : 4785 where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PEApplied Biosystems, Foster City, CA) is the quencher dye.
- oligonucleotides are designed to target different regions of the human GR RNA, using published sequences (GenBank accession number NM_000176.1). The oligonucleotides are shown in Table 1. "Target site” indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. The indicated parameters for each oligo were predicted using RNAstructure 3.7 by David H.
- RNA folding algorithm is based on the following research:D.H. Mathews, et al., Journal of Molecular Biology, 288, 91 1 -940, (1999). OligoWalk is based on the following research: D.H. Mathews, et al., RNA, 5, 1458-1469 (1999).
- the Dynalign algorithm is based on the following research: D.H.
- the oligos are sorted by the predicted free energy of the oligo interupting the predicted secondary structure of the messenger RNA.
- All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting often 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings".
- the wings are composed of 2 '-methoxy ethyl (2'-MOE) nucleotides.
- Cytidine residues in the 2'-MOE wings are 5-methylcytidines. All cytidine residues are 5-methylcytidines.
- Target total duplex Tm of target molecular molecu Site oligo binding formation Duplex structure oligo oligo
- Target total duplex Tm of target molecular imolecul Site oligo binding formation
- Duplex structure oligo oligo
- CTCCACCCCAGAGCAAATGC 1945 SEQ ID NO: 63 -30.8 -40.5 91.4 -9.7 0 -4.5
- AAGACATTTTCGATAGCGGC 1559 SEQ ID NO: 76 -30.4 -33.6 82.5 -3.2 0 -4.5 kcal/mol kcal/mol deg C kcal/mol kcal/mol kcal/mol kcal/mol
- Target total duplex Tm of target molecular molecul Site oligo binding formation
- Duplex structure oligo oligo
- Target total duplex Tm of target molecular imolecul Site oligo binding formation
- Duplex structure oligo oligo
- Target total duplex Tm of target molecular imolecul Site oligo binding formation
- Duplex structure oligo oligo
- GCGTAGTCATGATCCTCCAA 1800 SEQ ID NO: 216 -27.7 -37.2 86.3 -8.8 0 -9.1
- GTCTTCGCTGCTTGGAGTCT 294 SEQ ID NO -.219 -27.6 -38.9 89.1 -8.5 -2.8 -10.4
- ATGACGACTCAACTGCTTCT 2639 SEQ ID NO: 221 -27.6 -35.5 84.4 -7.9 0 -2.6
- GGTTTAGGTGCCATCCTTCT 2756 SEQ ID NO: 222 -27.6 -37.3 88.2 -6.8 -2.9 -11.8
- GCCACCGTTGGTGCCAGTCT 650 SEQ ID NO: 225 -27.5 -43 95.2 -12.1 -3.2 -14.2
- TTGGGCACTGGTGGTTTAGG 2768 SEQ ID NO: 229 -27.5 -39 91.7 -9.4 -0.9 -12.3
- GATCTCCACCCCAGAGCAAA 1948 SEQ ID NO:233 -27.4 -39.8 90 -11.9 -0.1 -4.2
- AGAATACTGGAGATTTGAGT 3194 SEQ ID NO: 238 -27.3 -32 79.7 -4.7 0 -6.6
- GCCTCAGCAACCTTCACTGC 4301 SEQ ID NO: 241 -27.3 -40.5 91.6 -12.4 -0.6 -3.8
- GCAGCCGAGATAAACAACTT 54 SEQ ID NO: 242 -27.2 -34.1 83.9 -6.9 0 -3.2
- TTCTGTTTTCACTTGGGGCA 950 SEQ ID NO: 244 -27.2 -35.5 86.3 -7.8 -0.1 -6.4
- TGTCATCTCCAGATCCTTGG 1233 SEQ ID NO: 246 -27.2 -37.8 86.5 -9.5 -1 -6.2
- GTGAAGACGCAGAAACCTTC 249 SEQ ID NO: 249 -27.1 -35.3 84.7 -7 -1.1 -4.8
- GAGGAGCTGGATGGAGGAGA 1342 SEQ ID NO: 251 -27.1 -42.7 92.3 -15.6 0 -5.3
- TCTCCACTGAAGCAGATATA 3250 SEQ ID NO: 253 -27.1 -34.8 83.5 -7.2 -0.1 -7.2
- TAGGTACAGACAGGGCCTCT 3386 SEQ ID NO: 254 -27.1 -41.2 93.5 -12.2 -1.9 -10.7
- AACTGTTTGGTTTCTGAGAC 4242 SEQ ID NO: 286 -26.8 -32.3 81.2 -4.9 0 -8.5
- GGACTAGGTGCTCTATACCA 3303 SEQ ID NO: 292 -26.7 -38.2 89.4 -8.6 -2.9 -11.8
- AATTGGTGACAGATGGGAAT 3630 SEQ ID NO: 294 -26.7 -33.9 82.1 -4.1 -3.1 -6.2
- GCCACCTTGAATAGAAATCA 3904 SEQ ID NO: 295 -26.7 -32.9 81.5 -6.2 0 -1.3
- CTGTTTGGTTTCTGAGACCA 4240 SEQ ID NO: 296 -26.7 -34.6 84.3 -2.7 -3.4 -18.5
- CAGAGTTCGATGAAATCTTC 973 SEQ ID NO: 300 -26.6 -31.2 77.6 -3.6 -0.3 -9.7
- TCTTGACAATGGCTTTTCCT 2223 SEQ ID NO: 306 -26.6 -33.5 82.6 -6.9 0 -3.8
- TTTTGACAAGAATACTGGAG 3202 SEQ ID NO: 308 -26.6 -30.3 78.2 -3.7 0 -5.5
- CAGGTCACTGGACTAGGTGC 3312 SEQ ID NO: 309 -26.6 -40.9 92.2 -11.3 -3 -10.7
- Target total duplex Tm of target molecular imolecu Site oligo binding formation Duplex structure oligo oligo
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Diabetes (AREA)
- Genetics & Genomics (AREA)
- Obesity (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Endocrinology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Child & Adolescent Psychology (AREA)
- Heart & Thoracic Surgery (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cardiology (AREA)
- Emergency Medicine (AREA)
- Biochemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US38185702P | 2002-05-20 | 2002-05-20 | |
| US381857P | 2002-05-20 | ||
| PCT/US2003/016084 WO2003099215A2 (en) | 2002-05-20 | 2003-05-20 | Antisense modulation of glucocorticoid receptor expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1534728A2 true EP1534728A2 (de) | 2005-06-01 |
| EP1534728A4 EP1534728A4 (de) | 2005-10-26 |
Family
ID=29584332
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03729073A Withdrawn EP1534728A4 (de) | 2002-05-20 | 2003-05-20 | Antisense-modulation der glucocorticoid-rezeptor-expression |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1534728A4 (de) |
| JP (1) | JP2005525829A (de) |
| AU (1) | AU2003233634A1 (de) |
| WO (1) | WO2003099215A2 (de) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1711606A2 (de) * | 2004-01-20 | 2006-10-18 | Isis Pharmaceuticals, Inc. | Modulation der expression des glucocorticoidrezeptors |
| EP1799859B1 (de) * | 2004-09-17 | 2014-07-02 | Isis Pharmaceuticals, Inc. | Verbesserte antisense-oligonukleotide |
| CN101313066A (zh) * | 2005-09-19 | 2008-11-26 | 强生医药研究及开发有限责任公司 | 糖皮质激素受体表达的调节 |
| WO2007136988A2 (en) | 2006-05-05 | 2007-11-29 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of gccr |
| JP2009171895A (ja) * | 2008-01-24 | 2009-08-06 | Hitachi Software Eng Co Ltd | 核内ノンコーディングrnaの機能解析方法 |
| MX2011011395A (es) * | 2009-05-15 | 2011-11-18 | Hoffmann La Roche | Composiciones y metodos para inhibir la expresion de genes de receptor de glucocorticoide. |
| US9068185B2 (en) | 2010-03-12 | 2015-06-30 | Sarepta Therapeutics, Inc. | Antisense modulation of nuclear hormone receptors |
| US8901098B2 (en) | 2011-10-25 | 2014-12-02 | Isis Pharmaceuticals, Inc. | Antisense modulation of GCCR expression |
| JP6049143B2 (ja) * | 2011-12-15 | 2016-12-21 | 国立大学法人東京農工大学 | オリゴヌクレオチド、グルココルチコイド感受性増強剤、医薬組成物、及び発現ベクター |
| US10364433B2 (en) * | 2014-11-14 | 2019-07-30 | The Regents Of The University Of California | Modulation of AGPAT5 expression |
| JP2021524233A (ja) | 2018-05-17 | 2021-09-13 | リージェンツ オブ ザ ユニバーシティ オブ ミネソタ | 薬物耐性免疫細胞及びその用途 |
| AU2022237663A1 (en) * | 2021-03-19 | 2023-10-12 | Metagenomi Therapeutics, Inc. | Multiplex editing with cas enzymes |
| WO2024245930A2 (en) * | 2023-05-26 | 2024-12-05 | E-Therapeutics Plc | Inhibitors of expression and/or function |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU5729098A (en) * | 1996-12-24 | 1998-07-17 | Zymogenetics Inc. | Treatment agents and methods for treating type ii diabetes and symptoms of type ii diabetes |
-
2003
- 2003-05-20 EP EP03729073A patent/EP1534728A4/de not_active Withdrawn
- 2003-05-20 JP JP2004506742A patent/JP2005525829A/ja not_active Withdrawn
- 2003-05-20 AU AU2003233634A patent/AU2003233634A1/en not_active Abandoned
- 2003-05-20 WO PCT/US2003/016084 patent/WO2003099215A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| EP1534728A4 (de) | 2005-10-26 |
| AU2003233634A8 (en) | 2003-12-12 |
| WO2003099215A3 (en) | 2005-03-31 |
| JP2005525829A (ja) | 2005-09-02 |
| AU2003233634A1 (en) | 2003-12-12 |
| WO2003099215A2 (en) | 2003-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2002028878A1 (en) | Antisense modulation of smad6 expression | |
| AU6952800A (en) | Antisense modulation of pi3k p85 expression | |
| EP2332955A2 (de) | Antisense-Modulation der Expression von Acyl-CoA-Cholesterin-Acyltransferase-2 | |
| EP1549387A1 (de) | Antisense-modulierung der farnesoid-x-rezeptor-expression | |
| WO2003012057A2 (en) | Antisense modulation of serum amyloid a4 expression | |
| WO2004016224A2 (en) | Antisense modulation of vegf co-regulated chemokine-1 expression | |
| WO2003014307A2 (en) | Antisense modulation of apolipoprotein(a) expression | |
| AU2002355552A1 (en) | Antisense modulation of apolipoprotein(A) expression | |
| WO2003014306A2 (en) | Antisense modulation of cholesteryl ester transfer protein expression | |
| WO2004028458A2 (en) | Antisense modulation of microsomal prostaglandin e2 synthase expression | |
| EP1534728A2 (de) | Antisense-modulation der glucocorticoid-rezeptor-expression | |
| WO2002018409A1 (en) | Antisense modulation of hpk/gck-like kinase expression | |
| WO2002064737A2 (en) | Antisense modulation of protein phosphatase 2 catalytic subunit beta expression | |
| EP1218395B1 (de) | Antisense-modulation von x-verbundenen inhibitoren der apoptosis-expression | |
| WO2002062818A2 (en) | Antisense modulation of casein kinase 2-alpha expression | |
| EP1543159A2 (de) | Antisense-modulation der endothel-spezifischen molekül 1 expression | |
| WO2002024720A1 (en) | Antisense modulation of caspase 2 expression | |
| US5985664A (en) | Antisense modulation of Sentrin expression | |
| US6107092A (en) | Antisense modulation of SRA expression | |
| WO2004016749A2 (en) | Antisense modulation of acyl-coa synthetase 1 expression | |
| WO2004003201A2 (en) | Antisense modulation of lrh1 expression | |
| WO2002027033A1 (en) | Antisense modulation of mekk4 expression | |
| EP1567538A2 (de) | Antisense-modulation der gfat-expression | |
| WO2002022840A1 (en) | Antisense modulation of madh6 expression | |
| EP1539689A2 (de) | Antisense-modulation der expression von endothellipase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20041203 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20050909 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/11 A Ipc: 7A 61K 31/7088 B Ipc: 7C 07H 21/00 B Ipc: 7A 61P 3/00 B |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20051124 |