EP1506224A1

EP1506224A1 - Polypeptide antigen inducing hiv neutralizing antibodies

Info

Publication number: EP1506224A1
Application number: EP03752794A
Authority: EP
Inventors: Florence Boudet; Rapha[Lle El Habib; Tino Krell; Régis SODOYER; Michel Chevalier
Original assignee: Aventis Pasteur SA; Sanofi Pasteur Inc
Current assignee: Sanofi Pasteur Inc
Priority date: 2002-05-17
Filing date: 2003-05-12
Publication date: 2005-02-16
Also published as: FR2839721B1; FR2839721A1; WO2003097676A1; AU2003249403A1; CA2485453A1

Abstract

The invention concerns a polypeptide of formula N-L-C, wherein N represents the sequence of amino acids 25-81 of gp41, C represents the sequence of amino acids 112-157 of gp41, and L represents the flexible linker comprising 2 to 30 amino acids, for preparing a pharmaceutical composition for inducing antibodies neutralizing HIV primary isolates.

Description

Polypeptide antigen inducing HIV neutralizing antibodies

The present invention relates to a polypeptide antigen derived from the gp41 protein, as well as to its use for immunization against HIV-related infection. This work was co-funded by the ANRS.

The development of a method of immunization against HIV is today one of the priorities of scientific research.

The major obstacles which are the great genetic variability of the virus and the low exposure to the immune system of conserved neutralizing viral epitopes considerably hamper the development of a vaccine capable of neutralizing primary isolates of HIV.

The HIV envelope glycoprotein which is required to make the virus infectious is the target of neutralizing antibodies. These characteristics have made the latter a subject of intense investigation. The use for vaccine purposes of polypeptides derived from the gp41 protein has been described in WO00 / 40616. According to this request, the N helices can be used alone or in combination with the C helices to induce neutralizing antibodies.

The Applicant here proposes a new polypeptide antigen which can be used for therapeutic and prophylactic immunization against HIV-related infection. The Applicant has indeed demonstrated a polypeptide derived from the ectodomain of the protein gp41 which is capable of inducing antibodies neutralizing the primary isolates of HIV. The present invention therefore relates to a polypeptide represented by the formula:

N-L-C In which: N represents the amino acid sequence 25-81 of gp41,

C represents the amino acid sequence 112-157 of gp41, and L represents a flexible binding sequence comprising from 2 to 30 amino acids. According to a particular embodiment, N represents SEQ ID No. 1 and C represents SEQ ID N ⁰ 2. According to a preferred embodiment, the polypeptide consists of the sequence SEQ

ID # 3.

According to another embodiment, the polypeptide as defined above further comprises a sequence containing the ERDRD epitope. According to a particular embodiment, the polypeptide as defined above comprises an additional sequence of formula (G) aS- (H) b in which G represents a glycine residue, H represents a histidine residue, a is greater than or equal to 4 and b is greater than or equal to 6, said sequence being linked by a friend link from to the NH ₂ - or COOH-terminal end of the polypeptide.

According to a particularly preferred embodiment, the polypeptide according to the present invention consists of the sequence SEQ ID No. 4.

The present invention also relates to a conjugate comprising a polypeptide as defined above, conjugated to a protein or a carrier peptide. The present invention also relates to a DNA sequence coding for a polypeptide or for a conjugate as defined above.

The present invention also relates to an expression vector comprising said DNA sequence.

According to a preferred embodiment, the DNA codes for a polypeptide as defined above which further comprises a sequence containing the ERDRD epitope.

The present invention also relates to a host cell containing the vector as defined above.

According to another aspect, the present invention relates to a process for the preparation of a polypeptide as defined above comprising the expression of said polypeptide from a host cell as defined above.

According to another aspect, the present invention relates to a pharmaceutical composition comprising at least one polypeptide, or at least one conjugate, or at least one expression vector as defined above, a pharmaceutically acceptable excipient and optionally an adjuvant. According to a particular embodiment, the pharmaceutical composition comprises a polypeptide of sequence SEQ ID No. 4 and an adjuvant selected from the group consisting of DC-Chol and aluminum gel.

The present invention also relates to the polypeptide as defined above for its use as a medicament, in particular for the induction of specific neutralizing antibodies in a mammal.

The present invention also relates to a method of induction of specific neutralizing antibodies in a mammal comprising the administration of a pharmaceutical composition as defined above and the induction of said antibodies. According to a preferred embodiment, the administration is carried out by oral or intramuscular route.

The invention is described in more detail in the following description.

The Applicant has surprisingly demonstrated that the polypeptide according to the invention induces specific IgG antibodies neutralizing the primary HIV isolates.

The induction of antibodies neutralizing primary isolates can be determined by the neutralization test as described in the article by C. Moog et al (AIDS Research and human retroviruses, vol. 13 (1), 13-27, 1997 ) to which one can refer for a complete description of the latter. It is estimated in the context of the present invention that neutralizing antibodies have been induced by the antigen tested according to the C. Moog technique when the serum diluted at least 1/4 in the presence of HIV results in a reduction by a factor of 10. of the viral titer in comparison to HIV alone, the viral titer being evaluated by the amount of p24 produced in the culture supernatant.

The induction of antibodies neutralizing the primary isolates can also be determined by the D. Montefiori neutralization test as described in J. Infect. Dis. 1996, 173: 60-67. In this test, the neutralizing titer is expressed by the percentage reduction in p24 antigen produced in the culture supernatants when the virus is incubated in the presence of serum diluted with VΛ compared to the virus in the absence of serum. It is considered in the context of the present invention that neutralizing antibodies have been induced when the reduction in the level of p24 produced reaches at least 80% with a serum diluted with VΛ.

It is considered in the context of the present invention that the antibodies induced by the polypeptide according to the invention are neutralizing if a neutralizing activity is detected for a given isolate in at least one of the two tests above.

The induction of antibodies neutralizing the HIV-1 MN laboratory strain can be estimated using the MT-2 cell line according to the method of D. Montefiori, described in: DC Montefiori et al. J Clin Microbiol. 1988, 26: 231-5). In this method, the neutralizing titer is expressed as the inverse of the dilution of the serum (in arithmetic value) protecting at least 50% of cells from the cytopathogenic effect of the HIV virus.

The N and C sequences constituting the polypeptide according to the present invention can be derived from any HIV gp41 protein, including strains VEU and HIV2, including laboratory strains and primary isolates. Preferably, the constituent sequences are derived from a VŒU strain and in particular from an HIV 1 LAI strain. The numbering of the amino acids is done by reference to the sequence of the fragment of gp41 SEQ ID No 8 in which the first amino acid A is number 1. According to a preferred embodiment, N represents SEQ ID No 1 and C represents SEQ ID # 2. The nucleotide and peptide sequences of a large number of gp41 proteins are known and available for example on the Internet on the site http://hiv-web.lanl.gov/ as well as in the corresponding compendiums of Los Alamos. It is clear that any sequence into which one or more conservative mutations which do not substantially alter immunogenicity have been introduced is also included within the scope of the present invention. The N and C sequences are linked to each other via an L-linking peptide sequence comprising from 2 to 30 amino acids. This linkage sequence L is a loop allowing the pairing of the sequences N and C with one another in an anti-parallel orientation. The polypeptide according to the present invention is a trimer consisting of 3 NLC monomers forming a bundle in which the N helices are paired together and the C helices are paired with the N helices in an anti-parallel orientation.

The appropriate L sequences in the context of the present invention can be selected by using secondary structure prediction software GOR (Garnier, Osguthorpe and Robson (1078), J. Mol. Biol., 120, 97-120; http : //molbiol.soton.ac.uk/compute/GOR.html) on the NLC sequence by specifying in the windows "propeller" and "extended" the unknown notion. The percentage of helix in the prediction of the secondary structure of L must be less than 10. The L sequences advantageously have a weak hydrophobic character, preferably hydrophilic to facilitate the purification of the corresponding polypeptide. The hydrophilic character can be obtained by the use of amino acid having a hydrophilic character such as serine which can be associated with glycines. According to a preferred embodiment, the polypeptide according to the invention has the sequence SEQ ID No. 3. This sequence can advantageously be modified to reduce its hydrophobic character, for example by introducing at least one of the following mutations: W85D; L91K; I92K and W103D and preferably by the introduction of at least any 2 mutations selected from the group of the 4 mutations proposed above, or even all of said mutations.

According to a particular embodiment, the polypeptide of formula NLC as defined above further comprises a sequence containing the Kennedy ERDRD epitope. The ERDRD sequence can be linked in N- or C-terminal of the polypeptide, directly or from preferably via a flexible link. Such a flexible link typically comprises around ten amino acids, preferably of a hydrophilic nature. Sequences comprising glycines and serines such as GGR are, for example, perfectly suitable. The ERDRD epitope can also be inserted at the L sequence of the polypeptide. In such a scenario, the epitope will preferably be surrounded by linkage sequences ensuring the junction with the N and C sequences. The nature of these sequences is easily determinable by the use of the secondary structure prediction software GOR mentioned above. above, the objective being that the linkage sequence L allows the anti-parallel pairing of the N and C helices. The expression “a sequence comprising the ERDRD epitope” is therefore understood in the context of the present invention to consist of: the ERDRD epitope, possibly of a flexible link and possibly of some additional amino acids which would result from the process of construction of the plasmids expressing the polypeptide due to the use of the restriction sites. This is the case, for example, of the amino acids RSGGGGS present at the C-terminal of the constructs tested in Example 4. The polypeptide according to the invention can be obtained by any conventional technique of chemical synthesis or genetic engineering.

When the polypeptide is produced by chemical synthesis, the polypeptide according to the invention can be synthesized in the form of a single sequence, or in the form of several sequences which are then linked to each other. Chemical synthesis can be carried out in solid phase or in solution, these two synthesis techniques being well known to those skilled in the art. These techniques are described in particular by Atherton and Shepard in "solid phase peptide synthesis (IRL press Oxford, 1989) and by Houbenweyl in" method der organischen chemie "edited by E. Wunsch vol, 15-1 and II thieme, Stuttgart, 1974, as well as in the following articles, all of which are incorporated here for reference: Dawson PE et al (Science 1994; 266 (5186): 776-9); Kochendoerfer GG et al (1999; 3 (6): 665- 71); and Dawson PE et al, Annu Rev Biochem 2000; 69: 923-60.

The polypeptide according to the invention can also be produced by genetic engineering techniques well known to those skilled in the art. When the polypeptide according to the invention is produced by genetic engineering, it comprises at the NH2-terminal end an additional methionine residue corresponding to the translation of the first initiation codon. These techniques are described in detail in Molecular Cloning: a molecular manual by Maniatis et al, Cold Spring Harbor, 1989. Conventionally, the PCR technique is used to produce the DNA sequence coding for the polypeptide according to the invention in a form insertable into a vector of expression. The DNA sequence thus obtained is then inserted into an expression vector. The expression vector containing the sequence of interest is then used to transform a host cell allowing the expression of the sequence of interest. The polypeptide produced is then isolated from the culture medium by conventional chromatography techniques well known to those skilled in the art. Preferably, high performance liquid chromatography (HPLC) is used in the purification. Typically, the cells are collected at the end of the culture by centrifugation and taken up in a neutral buffer, to be broken by any suitable means. The cell lysate is then centrifuged at approximately 10000 g to separate the soluble material from the insoluble material. SDS-PAGE analysis of the supernatant and the centrifugation pellet will reveal whether or not the polypeptide is soluble. In the case where the polypeptide is not soluble, the solubilization is obtained by means of a buffer containing urea, guanidine or other solubilizing agents. Centrifugation at this stage removes debris and other insoluble products which would interfere with the chromatography. The next step consists in loading the solubilized molecule onto an affinity column, which can be of the metal chelate type, if a polyhistidine tail is integrated on the polypeptide of interest. The system which allows the purification by affinity can be of varied nature, like immunoaffinity, affinity on blue of cibachron, etc ... At this stage the protein presents a level of purity close to or higher than 80%, as one can be determined by SDS PAGE electrophoresis followed by staining with coomassie blue. An additional chromatography step can be added for polishing the polypeptide, mention may be made, for example, of gel filtration and reverse phase chromatography.

The polypeptide according to the invention can thus be obtained in purified form on. in a form having a purity level of at least 80%. The level of purity is defined in relation to the other proteins present in the mixture which are considered to be contaminants. This rate is evaluated by colorimetry of an SDS-PAGE using coomassie blue. A densitometric measurement of the bands makes it possible to quantify the level of purity. The measurement of the purity rate can also be done by reverse phase HPLC by measuring the area of the different peaks.

To carry out the synthesis of the polypeptide, any expression vector conventionally used for the expression of a recombinant protein can be used in the context of the present invention. This term therefore includes both so-called “living” expression vectors such as viruses and bacteria as well as expression vectors of the plasmid type. Vectors are preferably used in which the DNA sequence of the polypeptide according to the invention is dependent on a strong promoter, inducible or non-inducible. As an example of a promoter which can be used, mention may be made of the T7 TARN polymerase promoter.

Expression vectors preferably include at least one selection marker. Such markers include, for example, the dihydrofolate reductase gene or the neomycin resistance gene for culture of eukaryotic cells and the kanamycin, tetracycline or ampicillin resistance genes for culture in E. coli and other bacteria.

Mention may be made, as expression vector which can be used in the context of the present invention, of the plasmids pET28 (Novagen) or pBAD (Invitrogen) for example; viral vectors such as: baculovirus, poxvirus, in particular the poxviruses described in the patents

US 5,942,235, US 5,756,103 and US 5,990,091, the entirety of which is incorporated herein by reference, the recombinant vaccinia viruses, in particular the recombinant viruses described in patents EP 83286, US 5,494,807 and US 5,762,938 in which the sequence is cloned of DNA coding for a polypeptide according to the invention. To promote expression and purification of the polypeptide, the latter can be expressed in a modified form, such as a fusion protein, and can include not only secretory signals, but also additional heterologous functional regions.

For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminal of the polypeptide to improve stability and maintenance in the host cell. Advantageously, the polypeptide according to the present invention is produced in the form of a fusion peptide comprising an additional sequence of formula

(G) aS- (H) b in which G represents a glycine residue, H represents a histidine residue, and preferably a is greater than or equal to 4 and b is greater than or equal to 6 linked by an amide bond at the end NH2- or COOH- terminal of the polypeptide. This sequence allows rapid purification by immunoaffinity of the polypeptide according to the invention.

For the expression of the polypeptide, any host cell conventionally used in association with the expression vectors described above can be used.

Mention may be made, by way of nonlimiting example, of the cells of E. coli, BL21 (lamdaDE3), HB101, Top 10, CAG 1139, Bacillus, eukaryotic cells such as CHO or Vero. Preferably, the following expression vector / cell system will be used in the context of the present invention: pET (Cer) / BL21LamdaDE3, or BL211amdaDE3 (RIL). Depending on the host cell used for the expression of the polypeptide, the polypeptides of the present invention may be glycosylated or non-glycosylated. In addition, the polypeptides according to the invention may also include an additional methionine residue at the N-terminal. A subject of the present invention is also the conjugates comprising a polypeptide according to the invention and a carrier protein or a carrier peptide.

The carrier protein (or peptide) (eur) strengthens the immunogenicity of the polypeptide according to the invention in particular by increasing the production of specific antibodies. Said carrier protein (or peptide) (eur) preferably comprises one or more T helper epitope (s). By “helper T epitope” is meant a chain of amino acids which, in the context of one or more molecules of MHC class II, activates the helper T lymphocytes. According to an advantageous embodiment, the carrier protein (or peptide) (eur) used improves the water solubility of the polypeptide according to the invention.

As carrier protein, phage surface proteins such as the pIII or pVLII protein of phage Ml 3 can be used, for example bacterial surface proteins such as LamB, OmpC, ompA, ompF and PhoE proteins. coli, the CotC or CotD protein of B. Subtilis, bacterial porins such as the PI porin of Neisseria gonorrheae, the PI or P2 porin of H. influenzae B, porin class I of N. meningitidis B, porin P40 of K. pneumoniae, lipoproteins such as OspA from B. bugdorfi, PspA from S. pneumoniae, TBP2 from N. meningitidis B, TraT from E. coli as well as adhesin A from S. pneumoniae; “heat shock” proteins such as Hsp65 or Hsp71 from M. tuberculosis or bovis or Hin 47 from H. infuenzae type B. Are also particularly suitable in the context of the present invention, detoxified bacterial toxins such as tetanus or diphtheria toxoid, the B subunit of cholera toxin, the B subunit of cholera toxin, the B subunit endotoxin A from P. aeruginosa or exotoxin A from S. aureus. As carrier peptide, it is possible to use, for example in the context of the present invention, the peptides p24E, p24N, p24H and p24M described in WO94 / 29339 as well as the PADRE peptides as described by Del guercio et al (Vaccine (1997); voll5 / 4, p441-448).

The carrier protein (or peptide) (eur) is linked to the N or C terminal end of the polypeptide according to the invention by any conjugation method well known to those skilled in the art. In addition, the sequence coding for the protein (or peptide) carrier can advantageously be fused to the sequence coding for the polypeptide according to the invention and the resulting sequence can be expressed in the form of a fusion protein by any conventional method. All the genetic engineering techniques useful for doing this are described in Maniatis et al. said conjugates can be isolated by any conventional purification method well known to those skilled in the art.

The subject of the present invention is also the DNA sequences coding for the polypeptides and the conjugates according to the invention as well as the expression vectors comprising said sequences and the host cells transformed by said vectors. The DNA sequences coding for the polypeptides according to the invention can be easily produced by PCR using as template the nucleotide sequence of a gp41 protein.

Rather than extracting and purifying the polypeptide or the conjugate expressed by the expression vector, it is often easier and sometimes more advantageous to use the expression vector itself in the vaccine according to the invention. The present invention therefore also relates to any expression vector as defined above. In such a scenario, the expression vector is devoid of a marker and preferably corresponds to a viral vector, in particular a poxvirus such as ALVAC or NYVAC. Such a vector can also contain at least one other sequence coding for a HTV antigen. By way of example, mention may be made of the sequences of the HIV antigens which are conventionally used in the vectors described in patents US5942235, US5756103 and US5762938.

The expression vector according to the invention preferably comprises a sequence coding for a polypeptide of formula NLC as defined above, further comprising a sequence comprising the ERDRD epitope as defined above which is linked at the end N- or C-terminal of said polypeptide. According to a particularly preferred embodiment, the expression vector comprises a sequence coding for the polypeptide of formula: AA25-AA157-GGRERDRDRSGGGGS.

Any host cell as defined above transformed by such an expression vector is also included in the context of the present invention. The present invention also relates to antibodies directed against the polypeptides and conjugates as described above. The preparation of such antibodies is carried out by conventional techniques for obtaining polyclonal and monoclonal antibodies well known to those skilled in the art.

These antibodies are particularly suitable for use in a passive immunization scheme.

The present invention also relates to pharmaceutical compositions which can be used for therapeutic and prophylactic immunization against HIV-related infection. The compositions according to the present invention comprise at least one polypeptide, at least at least one conjugate or at least one expression vector as defined above in an amount suitable for inducing a specific humoral response, a pharmaceutically acceptable excipient or diluent and optionally an adjuvant.

The amount of polypeptide, conjugate or vector in the composition according to the present invention depends on many parameters as will be understood by those skilled in the art, such as the nature of the carrier protein, the vector used or, the route of administration. An appropriate amount is an amount such that a specific humoral immune response is induced after administration of said composition. The quantity of polypeptide to be administered is of the order of 10 μg to 5 mg, the quantity selected varying according to the route of administration. The amount of conjugate to be administered will be deducted from the amounts indicated above, taking into account the MW of the carrier protein. The amount of expression vector to be administered is of the order of 10 to 5000 μg in the case of a non-viral vector and of the order of 10 ^E 4 to 10 ^E 8 TCID50 in the case of a viral vector .

The pharmaceutical compositions according to the present invention can also contain an adjuvant. Any pharmaceutically acceptable adjuvant or mixture of adjuvants conventionally used in the field of vaccines can be used for this purpose. Examples of suitable adjuvants that may be mentioned include aluminum salts such as aluminum hydroxide or aluminum phosphate and DC-Chol. Conventional auxiliary agents such as wetting agents, fillers, emulsifiers, buffers, etc. can also be added to the composition according to the invention.

The compositions according to the present invention can be prepared by any conventional method known to those skilled in the art. Conventionally, the antigens according to the invention (ie polypeptide, conjugate or vector) are mixed with a pharmaceutically acceptable excipient or diluent, such as water or phosphate-buffered saline. The excipient or diluent will be selected according to the dosage form chosen, the mode and the route of administration as well as pharmaceutical practice. The appropriate excipients or diluents as well as the pharmaceutical formulation requirements are described in detail in Remington's Pharmaceutical Sciences, which represents a reference work in this field. The compositions mentioned above can be administered by any conventional route, usually used in the field of vaccines, such as the parenteral route (intramuscular, subcutaneous, etc.). In the context of the present invention, intramuscular administration will preferably be used for the injectable compositions. Such a administration can advantageously be carried out in the thigh or arm muscles. The compositions according to the present invention can also advantageously be administered orally.

Indeed, the Applicant has demonstrated that the polypeptide according to the invention is very stable in a strongly acid medium (pH <or = at 3). This property makes the polypeptide according to the invention a vaccine antigen of choice for administration by the oral route. In this case, it is possible to administer the polypeptide in the form of a solution having a pH <or = 3 and containing or not an adjuvant. In the case of polypeptides comprising an L sequence with a weak hydrophobic character or with a hydrophilic character, a higher pH can be used. The Applicant has indeed shown that the stability of the forms comprising more hydrophilic loops is obtained over a wider range of pH. The polypeptides comprising such loops can therefore advantageously be used for parenteral administration. Administration via the nasal, vaginal or rectal mucosa can also be recommended in the context of the present invention. The administration can be carried out by the administration of a single dose or of repeated doses, for example at OJ, at 1 month, at 3 months, at 6 months and at 12 months. The OJ, 1 month and 3 month injections should preferably be used with a reminder, the frequency of which can be easily determined by the attending physician.

The pharmaceutical composition according to the present invention can advantageously be administered according to a dosage regimen comprising the co-administration of an expression vector according to the invention and of a polypeptide according to the invention or according to a "prime-boost" scheme wherein the vector according to the invention is administered first and the polypeptide as a booster injection. In these two dosage regimens, the expression vector according to the invention can be replaced by any expression vector expressing one or more antigens or epitopes of HIV different from the polypeptide according to the invention, and in particular by a poxvirus preferably ALVAC or NYVAC. As an example of a vector ALVAC and NYVAC which can be used for this purpose, mention may be made of the vectors described in US Patents 5,942,235, US 5,756,103 and US 5,990,091; EP 83286, US 5,494,807 and US 5,762,938. It is also advantageously possible to use, in the context of compositions which can be administered orally, the bacterial vectors such as lactobacillus or salmonella expressing the polypeptide according to the invention and / or other antigens of HIV, such as those conventionally used in the poxviruses described in US patents above. The use of these bacterial vectors for immunization purposes is described in detail in International Journal of Food Microbiology 41 (1998) 155-167 of PH Pouwels et al and Cell vol 91, 765-775, Dec, 1997 of A. Daiji et al to which we can refer for more details.

The present invention also intends to cover a polypeptide, a conjugate or a vector as defined above and the pharmaceutical composition containing these compounds for their use as a medicament, in particular for the induction of specific neutralizing antibodies in a mammal. Since the antibodies induced have the property of neutralizing the primary isolates of HIV, the polypeptide according to the invention is therefore an antigen of interest for the prophylactic and therapeutic immunization of the human body against infection linked to HIV

The present invention therefore relates to a method of induction of specific neutralizing antibodies in a mammal, preferably a human, comprising the administration of a pharmaceutical composition as defined above and the induction of said specific humoral response.

The term “a specific humoral response” is understood to mean a response comprising the production of antibodies directed specifically against the polypeptide according to the invention. The specific humoral response includes the production of specific IgAs when the composition according to the invention is administered via the mucosa. The production of specific antibodies can be readily determined by standard techniques well known to those skilled in the art such as ELIS A, RIA, Western Blot. The antibodies induced by the polypeptide according to the invention are capable of neutralizing many primary isolates of HIV. This property can be determined by the neutralization test of C. Moog or D. Montefiori.

The Applicant has surprisingly demonstrated that the polypeptide according to the invention is capable, after administration, of inducing antibodies capable of neutralizing primary isolates of HCV. Said polypeptide therefore represents a valuable candidate for the development of a vaccine usable for the protection and / or treatment of a large number of subjects at risk or infected with HIV.

The subject of the invention is also a diagnostic method comprising bringing a polypeptide according to the invention into contact with a biological sample and detecting the antibody / polypeptide complexes which have formed. HIV + subjects contain serum anti-gp41 antibodies. An immunological test (such as an ELIS A test in which the polypeptide according to the invention is fixed on the test plate and then brought into contact with the serum to be tested and the antibody / polypeptide complexes are then detected by colorimetry using a second labeled antibody) would therefore make it possible to diagnose infected subjects. The present invention will be described in more detail in the examples which follow, which are given purely by way of illustration of the invention and can in no way be regarded as limiting the scope of the latter.

Example 1: Purification of the polypeptide according to the invention

Cloning:

The DNA sequence coding for the polypeptide SEQ ID No. 4 has been cloned into an inducible expression system.

The vector used is the Pet -cer which is constructed from the pET28 vector from Novagen. The commercial vector pET28c was amplified by PCR using 2 primers located on either side of the region corresponding to the origin FI, so that the amplified product corresponds to almost all of the original vector less the region comprising the origin FI. The unique restriction sites Ascl and Pacl are provided respectively by the 2 primers which served for the amplification. In parallel, the cer fragment is amplified using 2 primers which make it possible to obtain this fragment framed by the Ascl and Pacl sites.

Vector and Cer fragment are digested by the enzymes Ascl and Pacl and then ligated together.

This vector comprises in particular an expression cassette under the control of the T7 promoter, a polylinker downstream of the T7 promoter for the cloning of the gene of interest, the CER fragment located downstream of the polylinker, making it possible to reduce the multimerization of the plasmids, a T7 term transcription terminator and the kanamycin resistance gene.

The upregulation of the promoter is obtained in the presence of T7 RNA polymerase.

A DNA fragment of approximately 0.5 Kb containing the sequence coding for the sequence

SEQ ID No. 3 is obtained by PCR from a plasmid containing the sequence coding for the gpl60 of HIV-1 LAI. The BspHI and Xhol restriction sites, used for cloning, are provided respectively by the 5 '(5' gp41 SPF BspHI) and 3 '(3'gp41TMBR / HSX) PCR primers. The 3 'primer also contains the sequences coding for the poly histidine linkage and the flexible link which connects it to the polypeptide.

The PCR amplified fragment was digested with the enzymes BspEŒ and Xhol and inserted into the expression vector digested with Ncol and Xhol (the Ncol and BspHI sites produce ends

5 'overflowing compatible after digestion).

The PCR amplification conditions are as follows: 97 ° C / 30 s; 55 ° C / 1 min; 72 ° C / 50s;

Taq DNA polymerase - 25 cycles 5 'primer: 5' .... TCATGA CGCTGACGGTACAGGCC 3 '

3 'primer: 5' CCGCrCG GCTAATGGTGATGGTGATGGTGTGACCCTCCCCCTCC ACTTGCCCATTTATCTAA 3 '

The restriction sites BspHI and Xhol are indicated in italics, the initiation codons ATG and of termination TAG (complementary strand) are underlined and in bold characters.

The construction was characterized by restriction mapping, sequencing of the 5 'and 3' junctions as well as of the entire inserted fragment.

Expression tests under conventional conditions have made it possible to obtain and visualize both after staining with Coomassie blue and analysis in western blot, using an anti-polyhistidine antibody, a product of apparent molecular weight. consistent with the expected result.

Expression and purification:

The expression of the plasmid thus obtained is carried out in E. coli BL21 lambda DE3 The cells of E. coli are transformed with approximately 1 ng of the plasmid. The culture of E. coli BL21 DE 3 expressing the polypeptide is produced in TB medium in the presence of kanamycin (25 μg / ml at the end) with an induction lasting 4 hours at 37 ° C. which starts by adding lmM of IPTG when the OD is around 0.9. Expression of the polypeptide leads to approximately 30 mg of purified polypeptide / 1 of culture. The bacteria are broken by sonication (4x2min.) Avoiding heating the bacterial extracts. The polypeptide is then found as an inclusion body. These are recovered by centrifugation (for 30 min at 10000 g, at 4 ° C), then they are solubilized in a 50 mM Tris buffer at pH8 containing 6M urea and 500 mM NaCl. The solution is filtered through a 0.45 μm porosity filter (Millex HV, Millipore) before chromatography on a Nickel-Sepharose column (Hi-trap, Pharmacia). The polypeptide is loaded onto the column in the presence of 10 mM imidazole in the Tris-Urea buffer. The column is washed under the same conditions, then the purified polypeptide is eluted by injection of a 0.5M imidazole solution in the same buffer. The polypeptide is then dialyzed in a 50 mM formate buffer at pH 2.5 before chromatography on a reverse phase column in HPLC, the role of which is to eliminate residual endotoxins.

After loading the polypeptide, a gradient of 20 to 80% acetonitrile containing 0.1% of TFA circulates on the semi-preparative column (214TP510, Vydac). The polypeptide is eluted between 40 and 60% acetonitrile. The solvents are then removed by evaporation under vacuum, then by dialysis in formate buffer at pH 2.5. The polypeptide obtained, the purity of which is greater than 80%, is completely free of endotoxins. It is stored at -45 ° C. Example 2: Determination of humoral immunity after parenteral administration The polypeptide SEQ ID No. 4 was tested in guinea pigs, in rabbits and in the Cynomolgus macaque according to the protocols described below.

Guinea pigs: groups of 5 guinea pigs were injected 3 times, 3 weeks apart, into the thighs (biceps femoris muscle) with 20 μg per dose of antigen. On each injection, the animals received 0.5 ml of the formulation (0.25 ml in each thigh). The animal sera were taken for the analysis of the antibodies before immunization, then 3 and 2 weeks after the 2 ^nd and 3 ^rd immunizations, respectively.

The three compositions tested: antigen + alum (aluminum phosphate, 6 mg per dose); antigen + alginate and antigen in arginine + alginate buffer were prepared as follows: a- for formulations adjuvanted with aluminum phosphate: the antigen is in 50mM formate medium, pH 2.5. The formulations are obtained by adding alum to the antigen composition and incubation with gentle shaking for 30 minutes, the mixture is then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PB S buffer of so as to obtain 500 μl / dose in the end. Resuspension is carried out using an ultrasonic bath. b- For the alginate formulation: the antigen is in 50mM formate medium, pH 2.5. A filtered alginate solution, 1% (LVM grade, PRONOVA) in PBS buffer is added to be 1.4: 1 (vol. Antigen / vol. Alginate). After incubation at room temperature (5 minutes), the mixture is completed with a Tween 80 solution, 0.67% by weight in PBS buffer, so as to obtain 500 μl / dose in the end.

Homogenization is achieved by a slight vortex. c- For the formulation of arginine + alginate: the antigen is found in 1M arginine medium, PBS, pH 7.4. The preparation is the same as described in b-, with the use in this case of a ratio 2.75: 1 (vol. Antigen: vol. Alginate). • S Rabbits: groups of 2 rabbits were injected 3 times, 3 weeks apart, into the thighs with 40 μg per dose of antigen. At each injection, the animals received 1 ml of the formulation.

The sera of the animals were collected for analyzes antibodies before immunization, and then 3 and 2 weeks after the 2 ^nd and 3 ^rd immunizations, respectively. d- The composition tested here: antigen + alum (aluminum phosphate, 6 mg per dose); was prepared in the following manner: to the antigen, in 50 mM formate medium, pH 2.5, aluminum phosphate is added, the whole being incubated for 30 minutes at + 4 ° C. with gentle agitation (mobile wheel). The tubes containing these preparations are then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PBS buffer so as to obtain 1 ml / dose in the end. Resuspension is carried out using an ultrasonic bath.

Rhesus macaques (macaca fascicularis): Groups of 2 macaques were injected 3 times at 1 month intervals into the thighs (reclus femoris muscle) with 100 μg per dose of antigen adsorbed on 6 mg of alum (phosphate of aluminum). On each injection, the animals received 1 ml of the formulation.

The sera of the animals were collected for analyzes antibodies before immunization, and then 4 and 2 weeks after the 2 ^nd and 3 ^rd immunizations, respectively. The composition tested here: antigen + alum was prepared in the following manner: to the antigen, in 50 mM formate medium, pH 2.5, aluminum phosphate is added, the whole being incubated for 30 minutes at + 4 ° C. weak agitation (moving wheel). The tubes containing these preparations are then centrifuged (5 minutes at 3000 rpm), the supernatant being removed and replaced with PBS buffer so as to obtain 1 ml / dose in the end. Resuspension is carried out using an ultrasonic bath.

The results are given in the tables below:

As shown in Table 1, the polypeptide induces significant, homogeneous and specific levels of ELIS A antibodies against the polypeptide according to the invention and gpl60 MN / LAI-2 (hybrid glycoprotein in which the gpl20 subunit derives from 'isolate \ TH-1 MN and the gp41 subunit derives from the isolate VEH-1 LAI). These IgG responses almost reach a plateau from the ^2nd injection (table 1). The alginate formulation appears to be 10 times less effective, in terms of the level of specific antibodies induced, than the alum formulation.

Table 1 - Guinea pig test - Antibody responses in ELISA

* Geometric mean + standard deviation (logio)

NB: all the pre-immune sera tested are below the detection threshold (i.e. 1.9 log for ELISA anti-gpl60 and 1.0 log for ELISA anti-polypeptide).

The neutralizing activity of the post-3rd immunization sera was then evaluated in a ¹ time with respect to the laboratory strain HIV-1 MN on individual sera (at DC Montefiori). As the results show, no neutralization of the MN strain was observed

The neutralizing activity of post-3 sera was also evaluated with respect to primary VEH-1 strains (laboratories of C. Moog and D. Montefiori) (Table 2). The analysis was carried out on individual sera. Interestingly, contrary to what was observed for the MN strain, the guinea pigs showed significant neutralizing activities against several of the viral strains tested. Table 2 - Guinea pig test - Anti-HTV-1 neutralizing antibody responses

§ Lab. D. Montefiori: results given for post-3 sera (arithmetic value or%) α Lab. C. Moog: results given for post-3 sera (arithmetic value)

NT: not tested

NB: all the pre-immune sera tested are below the positivity threshold (either, according to the methods: <20 for the strain ^" VTH-1 MN and <80% or <4 for the primary isolates).

Table 3 - Rabbit test - ELIS A antibody responses

Table 4 - Macaque test - ELISA antibody responses

NB: the pre-immune sera tested are found to be below the positivity threshold (1.0 logio). The results given above clearly show that the polypeptide according to the invention is capable of inducing significant specific ELISA antibody levels in all the animal species tested. These IgG responses increased slightly between the ^2nd and the ^3rd injection

These antibodies, which have the property of neutralizing primary isolates, make the polypeptide according to the invention a valuable candidate for immunization in humans.

Example 3: Determination of the humoral immunogenicity of the polypeptide according to the invention administered by mucous route.

The polypeptide SEQ ID No. 4 was tested in BALB / c mice according to the protocol described below.

^• S BALB / c mice: groups of 6 to 7 mice were administered by intraoral or intragastric route 3 times, 2 weeks apart, and 1 time 1 month later, with 50 μg per dose of antigen alone or formulated with 5 μg of cholera toxin (CT). Gpl60 MN / LAI-2 was added as a control formulated with 5 μg of cholera toxin (CT). At each administration, the animals received either 20 μl, for the intraoral route, or 500 μl, for the intragastric route, of the formulation.

The compositions tested were prepared as follows: for the gp 160 antigen: the necessary volume of a CT solution at 2 mg / ml of H ₂ O is added, which is completed with PBS buffer so as to have 20 or 500μl / dose in the end. The antigen SEQ ID No. 4, in 50mM formate medium, pH 2.5, is first diluted in 50mM formate and then added with a CT solution at 2 mg / ml of H ₂ O so as to have 20 or 500 μl / dose in the end.

Sera and vaginal secretions of animals were collected for analysis of antibodies before immunization and 2 weeks after the 4 ^th immunization.

The IgG and IgA responses induced in the vaginal secretions, specific for the polypeptide, were evaluated by ELISA, and normalized respectively by the total IgG and IgA contained in these mucous samples. The polypeptide-specific IgG antibody responses induced in the sera were also evaluated by ELISA. As shown in Table 5 below, the polypeptide according to the invention induced specific serum IgG responses after administration by the gastric or buccal route. For these 2 routes, the antibody titers are approximately 10 times higher when the polypeptide is administered in the presence of CT compared to the antigen alone. However, it is interesting to note that, even in the absence of CT, a significant humoral response is induced by the polypeptide. The buccal route was found to be more immunogenic overall than the gastric route. Unlike the polypeptide, gpl60 MNLAI-2 in the presence of CT did not or almost not induce antibodies against the various antigens tested (polypeptide, gpl20 MN [produced by Agmed] and V3 MN), whatever the route of immunization.

Table 5 - Mouse test - ELISA antibody responses in sera

* Geometric mean + standard deviation (logio); NT: not tested NB: all the pre-immune sera tested are below the detection threshold (ie 1.9 log for ELISA anti-gpl20 and 1.0 log for ELISA anti-polypeptide and anti-V3).

As shown in Table 6 below, the polypeptide according to the invention elicited specific IgA and / or IgG responses in the mucous secretions tested. In terms of vaginal secretions, the polypeptide administered either by the buccal route or by the gastric route, was able, with or without CT, to elicit IgA and IgG responses, the responses being however more frequent in the presence of CT. It can be noted that the gpl60 MN / LAI-2 + CT has elicited little or no mucosal responses, as observed at the serum level.

Table 6 - Mouse test - ELISA antibody responses in mucous secretions

* Average of the ratios of the mice of each group × 10 ³ , the ratio being defined as the anti-polypeptide IgG or IgA titer (in arbitrary units) divided by the total IgG or IgA titer (in ng / ml), respectively.

The above examples show that the polypeptide according to the invention is capable of inducing, in all the animal species tested after parenteral administration, significant specific serum IgG responses with respect to the polypeptide and gpl60 MN / LAI-2. The antibodies induced have an activity capable of neutralizing several primary isolates of HTV. The above examples also show that the polypeptide according to the invention is capable of inducing, after administration by the mucous route, serum IgG antibodies and mucosal IgG and IgA antibodies at the level of vaginal secretions. Example 4: Determination of the humoral immunogenicity of plasmid DNA vectors coding for a polypeptide according to the invention administered intramuscularly.

Four different plasmids were prepared and tested to determine their immunogenicity. These plasmids are:

PCA TPA gp41 PK (antigen tested from N- to C-terminal: AA1-AA157- GGRERDRDRSGGGGS)

PCA TPA gp41 SPF PK (tested antigen from N- to C- terminal: AA25-AA157- GGRERDRDRSGGGGS) PCA TPA gp41 (tested antigen from N- to C- terminal: AA1-AA157)

PCA TPA gp41 SPF (antigen tested from N- to C- terminal: AA25-AA157)

with TPA for: signal sequence of human tPA, SPF for: without fusion peptide, PK for: the Kennedy neutralizing epitope ie ERDRD located in the intracytoplasmic portion of gp41 at position 746-750, within the sequence known as' peptide Kennedy 'located between residues 731-752 [(Kennedy et al, 1986, Science, 231: 1556-59; (Vella et al, 1993, J General Virology, 74: 2603-07]

The sequences coding for the tested polypeptides were amplified by PCR and cloned into a derivative of the expression vector pCAMycHis (Invitrogen). The modified vector used is obtained by replacing the existing polylinker with a different "polylinker" containing the restriction sites Xbal and BamHI into which is inserted the sequence coding for the antigen tested. The expression of the cloned gene is under the control of the CMV promoter. The DNA is prepared after transformation of a strain of E coli XL-1 blue. A culture of 2 liters (LB medium + Carbenicillin at 100 mg / ml) makes it possible to obtain approximately 10 mg of plasmid. After alkaline lysis, the plasmid is purified on a Qiagen column (Gigaprep) according to the protocol indicated by the supplier.

The immunogenicity of the constructions thus obtained is evaluated in guinea pigs according to the following protocol: Groups of 5 guinea pigs were injected 4 times, 1 month apart, in the thighs (biceps femoris muscle) with 200 μg per dose of plasmid . On each injection, the animals received 1 ml of the formulation (0.5 ml in each thigh). The sera of the animals were taken for analysis of antibodies before immunization, and 1 month after the 4 ^th immunization.

The results are given in the tables below:

As shown in Table 7, the PCA plasmid TPA gp41 SPF PK was found to be the most immunogenic, capable of inducing significant levels of antibodies specific for the polypeptide according to the invention, also recognizing gpl60 MN / LAI-2. The humoral responses induced by the other constructs tested were found to be weaker. These results indicate that the absence of fusion peptide and the addition of the Kennedy peptide neutralizing epitope both seem to play an important role in the humoral immunogenicity of the plasmid.

Table 7 - Guinea pig test - Antibody responses in ELISA

* Geometric mean ± standard deviation (log ^)

NB: all the pre-immune sera tested are below the detection threshold (i.e. 1.9 log for ELISA anti-gpl60 and 1.0 logw for ELISA anti-polypeptide).

The results of neutralization of primary isolates indicated in Table 8 below show that the PCA TPA gp41 SPF PK plasmid is the most efficient in terms of neutralization. The best results being obtained with the constructions devoid of the fusion peptide of gp41. Table 8 - Guinea pig test - Anti-HTV-1 neutralizing antibody responses

his Lab. C. Moog: results given for post-3 sera (arithmetic value)

NT: Not tested.

Claims

Claims.

1. Use of a polypeptide represented by the formula: N-L-C

In which :

N represents the amino acid sequence 25-81 of gp41, C represents the amino acid sequence 112-157 of gp41, and L represents a flexible binding sequence comprising from 2 to 30 amino acids, for the preparation of a pharmaceutical composition for the induction of antibodies neutralizing primary HIV isolates.

2. The use according to claim 1 in which N represents SEQ ID No.1 and C represents SEQ ID No.2.

3. The use according to claim 1 or 2 in which the polypeptide has the sequence SEQ ID N ⁰ 3.

4. The use according to any one of the preceding claims, in which the polypeptide further comprises a sequence containing the ERDRD epitope at its end.

N or COOH-terminal.

5. The use according to claim 4, in which the polypeptide has the sequence SEQ ID No. 4.

6. An expression vector comprising the DNA sequence coding for the polypeptide according to claim 4.