EP1499732A2 - Essentielle und wichtige gene von pseudomonas aeruginosa und ihre verwendung zur konstruktion oder identifizierung antibakterieller agentien - Google Patents
Essentielle und wichtige gene von pseudomonas aeruginosa und ihre verwendung zur konstruktion oder identifizierung antibakterieller agentienInfo
- Publication number
- EP1499732A2 EP1499732A2 EP02807280A EP02807280A EP1499732A2 EP 1499732 A2 EP1499732 A2 EP 1499732A2 EP 02807280 A EP02807280 A EP 02807280A EP 02807280 A EP02807280 A EP 02807280A EP 1499732 A2 EP1499732 A2 EP 1499732A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- gene
- hypothetical protein
- protein
- essential
- test compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Definitions
- the present invention relates to the identification of essential and important genes in Pseudomonas aeruginosa, and the use thereof in screening assays and diagnostic methods to identify, evaluate or design antibacterial agents useful for the treatment of Pseudomonas infections. Such agents are particularly useful in preventing and treating opportunistic infections in immunocompromised individuals and for treating and preventing pulmonary infections in patients having cystic fibrosis disease. Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.
- Pseudomonas aeruginosa is a versatile Gram-negative bacterium that is able to adapt to and thrive in many ecological niches, from water and soil to plant and animal tissues.
- the bacterium is capable of utilizing a wide range of organic compounds as food sources, thus giving it an exceptional ability to colonize ecological niches where nutrients are limited, such as soil, marshes and coastal marine habitats.
- Hardalo, C. & Edberg, S. C. Pseudomonas aeruginosa assessment of risk from drinking water. Crit. Rev. Microbiol. 23, 47-75 (1997). It also forms biofilms on wet surfaces such as those of rocks and soil. Costerton, J. W., Stewart, P. S.
- P. aeruginosa is also a cause of a variety of different disorders including septicemia, urinary tract infections, pneumonia and chronic lung infections, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis.
- Cystic fibrosis is one of the most common fatal genetic disorders in the United States, affecting about 30,000 individuals. A comparable number of people in Europe also have CF. It is most prevalent in the Caucasian population, occurring in one of every 3,300 live births.
- the gene involved in cystic fibrosis was identified in 1989 and codes for a protein called the cystic fibrosis transmembrane conductance regulator (CFTR). This protein, normally produced in a number of tissues throughout the body, regulates the movement of salt and water in and out of these cells.
- CFTR cystic fibrosis transmembrane conductance regulator
- CF CF
- Pseudomonas aeruginosa having a propensity to live in warm, wet environments, is a particular problem for CF patients, whose lungs typically become colonized (inhabited long-term) by P. aeruginosa before their 10th birthday.
- antibiotics can decrease the frequency and duration of these attacks, resistant bacteria are quick to develop and the bacteria are never completely eradicated from the lung. More effective antibiotics are necessary for improving lung function and quality of life for CF patients for extended time periods.
- Pseudomonas aeruginosa is notorious for its resistance to antibiotics and is, therefore, a particularly dangerous and dreaded pathogen.
- Todor K. 2000 Pseudomonas aeruginosa, University of Wisconsin-Madison, http://www.bact.wisc.edu/microtextbook/disease/ pseudomonas.html, available on April 25, 2001.
- the permeability barrier afforded by its outer membrane LPS also contributes to its natural antibiotic resistance, as do the presence of two antibiotic resistance plasmids, both R-factors and RTFs, which are commonly transferred between cells by the bacterial processes of transduction and conjugation. Only a few antibiotics are effective against Pseudomonas, including tobramyocin (TOBI; Chiron), fluoroquinolone, gentamicin and imipenem, and even these antibiotics are not effective against all strains.
- TOBI tobramyocin
- Pseudomonas aeruginosa disease generally begins with some alteration or circumvention of normal host defenses and may involve several different virulence determinants. Todor, 2000, supra.
- the ultimate Pseudomonas infection may be seen as composed of three distinct stages: (1) bacterial attachment and colonization; (2) local invasion; (3) disseminated systemic disease.
- Particular bacterial determinants of virulence mediate each of these stages and are ultimately responsible for the characteristic syndromes that accompany the disease.
- Pseudomonas utilize fimbriae or pili to adhere to the epithelial cells, apparently via binding to specific galactose or mannose or sialic acid receptors on epithelial cells.
- Fimbrial adherence may be an important step in Pseudomonas keratitis and urinary tract infections, as well as infections of the respiratory tract.
- Mucoid strains which produce an a exopolysaccharide (alginate) have an additional or alternative adhesin which attaches to the tracheobronchial mucin (N-acetylglucosamine). Therefore, mucoid strains of P. aeruginosa are commonly seen in lung infections.
- Pseudomonas elastase cleaves collagen, IgG, IgA, and complement, and also lyses fibronectin to expose receptors for bacterial attachment on the mucosa of the lung.
- Alkaline protease interferes with fibrin formation and lyses fibrin.
- elastase and alkaline protease destroy the ground substance of the cornea and other supporting structures composed of fibrin and elastin.
- Elastase and alkaline protease together are also reported to cause the inactivation of gamma Interferon (IFN) and Tumor Necrosis Factor (TNF).
- IFN gamma Interferon
- TNF Tumor Necrosis Factor
- P. aeruginosa produces three other soluble proteins involved in invasion, including a cytotoxin (MW 25,000) and two hemolysins. Todor, 2000, supra.
- the cytotoxin is a pore-forming protein originally named leukocidin because of its effect on neutrophils, but it appears to be cytotoxic for most eukaryotic cells.
- the two hemolysins one is a phospholipase and the other is a lecithinase. They appear to act synergistically to break down lipids and lecithin.
- the cytotoxin and hemolysins contribute to invasion through their cytotoxic effects on eukaryotic cells.
- Pseudomonas aeruginosa also produces two extracellular protein toxins, Exoenzyme S and Exotoxin A.
- Exoenzyme S may act to impair the function of phagocytic cells in the bloodstream and internal organs to prepare for invasion by P. aeruginosa, and is typically produced by bacteria growing in burned tissue.
- Exotoxin A is partially identical to diphtheria toxin, and exhibits a necrotizing activity at the site of bacterial colonization and is thereby thought to contribute to the colonization process. Indirect evidence involving the role of exotoxin A in disease is seen in the increased chance of survival in patients with Pseudomonas septicemia that is correlated with the titer of anti-exotoxin A antibodies in the serum.
- While therapeutic measures aimed at any of the above virulence factors may help to slow the progression of an infection and may be useful in combined therapeutic regimens, given the variety of virulence factors of P. aeruginosa, antibacterial agents that inhibit growing bacteria by interacting with essential genes and essential gene products are necessary. Although, this is not to say that genes encoding virulence factors would not be essential to survival in particular niches or environments, emphasizing the importance of screening for gene essentiality in various pathogenic environments. See, e.g., Coulter et al., 1998, Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments, Mol. Microbiol. 30(2): 393-404. However, as P. aeruginosa becomes more and more resistant to existing antibacterial agents, new compounds are required.
- a newly emerging technique for identifying new antibacterial agents is to first identify gene sequences and proteins required for the proliferation of bacteria, or "essential" genes and proteins, and then conduct a biochemical and structural analysis of that target gene or protein in order to derive compounds that interact with the target.
- Such methodology employs molecular modeling techniques, combinatorial chemistry and other means to design candidate drugs, and offers a more directed alternative to merely screening random compounds with the hope that one might be suitable for a particular bacterium.
- Another group proposes the identification of growth conditional mutants, and more specifically temperature sensitive (ts) mutants, as a means to identify essential genes in Staphylococcus aureus. See Benton et al., U.S. Patent 6,037,123, issued March 14, 2000, herein incorporated by reference.
- Each gene is identified by isolating recombinant bacteria derived from growth conditional mutant strains, i.e., following introduction of a vector containing a library of nucleic acid sequences, which would grow under non-permissive conditions but which were not revertants. These recombinant bacteria were found to contain DNA inserts that encoded wild type gene products that replaced the function of the mutated gene under non-permissive growth conditions.
- GAMBIT transposon mutagenesis system for identifying essential genes
- GAMBIT genomic analysis and mapping by in vitro transposition
- GAMBIT involves first isolating and purifying specific genomic segments of approximately 10 kilobases using extended-length PCR, and creating a high density transposon insertion map of the isolated region using Himarl transposon mutagenesis. The transposon insertions are then transferred to the chromosome following transformation of the bacteria with the transposon containing vectors, and selection for the antibiotic resistance marker on the transposon.
- each transposon insertion with respect to a given PCR primer is then determined by genetic footprinting, i.e., by amplifying sub-PCR products using one of the original PCR primers and a primer that recognizes an internal site in the Himarl transposon.
- genetic footprinting i.e., by amplifying sub-PCR products using one of the original PCR primers and a primer that recognizes an internal site in the Himarl transposon.
- GAMBIT is a good technique for looking at a small region of the genome for essential genes, it would be extremely labor intensive to use this method for analyzing the entire genome. This is particularly true for P. aeruginosa, whose genome ( ⁇ 6 megabases) is about 70% greater in size than the H. influenzae genome (-1.8 megabases). Furthermore, GAMBIT would not be readily applicable to use in organisms that are less recombinogenic than H. influenzae. Indeed, while the H. influenzae genome contains about 1700 protein coding genes, P. aeruginosa contains about 5570. According to U.S. Patent 6,207,384, one would need to clone and mutagenize the 6 million base pair genome of P.
- the method further employs the methods of mutation exclusion and zero time analysis in order to monitor the fate of individual insertions after transformation in growing culture, which looks at individual insertions on a case- by-case basis. Again, such techniques would be extremely labor-intensive for the P. aeruginosa genome, which is 70% larger than the genome of H. influenzae.
- Wong and Mekalanos also proposed identifying essential genes in P. aeruginosa by starting with the knowledge of three essential genes in H. influenzae and using genetic footprint analysis to determine if the homologues of these genes are essential in P. aeruginosa. Of three homologues tested, only one was unable to accommodate a transposon insertion. See Wong and Mekalanos, supra. Such results underscore the fact that a gene that is shown to be essential in one species will not necessarily be essential in another, given that some gene products may fulfill different functional roles in different species. Furthermore, given the larger coding capacity of the P. aeruginosa genome relative to that of other bacteria, it would not be surprising for P. aeruginosa to possess an increase in redundant gene functions, thereby decreasing the actual number of essential genes, and making them more difficult to identify.
- TMDH Transposon Mediated Differential Hybridisation
- This method entails (i) providing a library of transposon mutants of the target organism; (ii) isolating polynucleotide sequences from the library which flank inserted transposons; (iii) hybridising said polynucleotide sequences with a polynucleotide library from said organism; and (iv) identifying a polynucleotide in the polynucleotide library to which said polynucleotide sequences do not hybridise in order to identify an essential gene of the organism.
- the problem with this methodology is that it has a high propensity to lead to false positives, and many essential genes will be missed.
- the method does not yield any detailed information regarding the loci disrupted by transposons, or whether they were hit more than once.
- the present inventors have devised a database of potential essential or otherwise important genes in P. aeruginosa, which may be used to verify essentiality and design antibacterial agents active against the targets thus identified.
- the inventors have isolated and mapped a library of at least about 5,000 to at least about 14,000 transposon insertions in the genome of P. aeruginosa, and more preferably a library of at least about 8000 to at least about 14,000 transposon insertions, and even more preferably a library of at least about 10,000 to at least about 14,000 transposon insertions, using the recently published P. aeruginosa gene sequence.
- the map thus generated was used to form a database of approximately 1500 to 3000 open reading frames, or more preferably about 1500 to 2000 open reading frames, for which no transposon insertions could be obtained, each of which possibly represents an essential gene required for growth and proliferation of P. aeruginosa on rich media, or an important gene, the mutation of which results in an attenuated growth mutant. Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.
- one aspect of the invention is a database of putative essential or otherwise important genes, defined by the absence of transposon insertions in those genes in a High Throughput Transposon Insertion Map (HTTIM) database comprising about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa.
- HTTIM High Throughput Transposon Insertion Map
- such a database comprises approximately 1800 open reading frames (ORFs), each of which may be further tested for essentiality using a variety of tests disclosed herein.
- ORFs open reading frames
- predictions of essentiality or importance may be bolstered based on length of the ORF and predicted function and other statistical factors, thereby providing for more narrow databases of putative essential genes.
- the invention also includes databases that are more narrow and comprise only those genes for which essentiality or importance may be predicted with at least an 80% confidence level, and include at least about 850 to about 875 genes.
- the invention also includes databases assigned a confidence level of about 85% and including at least about 675 to about 700 genes.
- the invention further includes databases assigned a confidence level of about 90% including at least about 475 to about 500 genes.
- the invention includes databases assigned a confidence level of about 95% and including at least about 200 to 250 genes.
- the transposon insertion map and database of putative essential or otherwise important open reading frames (ORFs) obtained may be used to confirm the essentiality or importance of genes, for example by integration knock outs in the presence of chromosomal complementation or by integration and activation of a regulatable promoter.
- An "essential” gene is one that cannot be “knocked out,” i.e. for which null mutants having complete absence of the gene product are not viable. This does not mean, however, that such genes could not tolerate point mutations or truncations that preserve sufficient gene product function so as to enable cell growth and survival.
- Essential genes are to be distinguished from "important" genes, which are also included in the present invention, in that a "knock out" of an important gene does not lead to cell death but rather results in an attenuated growth mutant.
- Such genes may be included in the database of open reading frames not hit by random transposon mutagenesis as described herein, because attenuated growth colonies may be significantly smaller than the average P. aeruginosa colony and may have been overlooked when transposon insertion mutants were picked to generate the high throughput transposon insertion database (HTTIM).
- the invention also includes a database of attenuated growth mutants identified from the HTTIM transposon database.
- the genes marked by such mutations are of the same class of importance as the "important" genes identified in the no-hit database of genes, except that the growth attenuated nature of such transposon mutants was discovered at the transposon mutagenesis stage, rather than at the stage where essentiality is tested via targeted knock out.
- genes that when mutated confer attenuated growth may be identified from two sources: (1) from the library of open reading frames that did not receive a transposon insertion during HTTIM but were subsequently identified as an important gene when essentiality was tested via knock out and/or promoter swap strategies, and (2) from the HTTIM database itself when in the process of accumulating transposon insertion mutants it was observed that a particular insertion conferred an attenuated growth phenotype.
- Such attenuated mutants grow more slowly than wild type, and may grow more slowly due to reduced expression of an essential gene, i.e., transposon is in gene that regulates expression of an essential gene, or due to expression of a truncated form of an essential gene, i.e., transposon is in the essential gene itself and leads to expression of a truncated mRNA.
- mutants that show a higher drug susceptibility could be the result of insertions in a gene that potentiates resistance, such an efflux pump, or due to reduced expression of essential genes involved in the mechanism of action of the drug.
- mutated forms of essential and important genes may make the cell more susceptible to compounds that inhibit that particular gene or gene product, and may allow the identification of antibacterial agents with greater sensitivity. Furthermore, screening in whole cells overcomes the potential problems of uptake and efflux that are sometimes an issue for compounds identified via enzyme-based assays.
- the essential and important genes of the invention may be used to design, screen for and evaluate potential antibacterial agents for the purpose of developing new treatments for P. aeruginosa infection.
- Antibacterial agents identified according to the invention may have activity against the gene or against the corresponding gene product or metabolic pathways requiring the gene product.
- antibacterial agents according to the invention may include antisense nucleic acids or regulatory proteins that bind to open reading frames, to upstream polar sequences or to promoters that drive expression of the genes encoded by such open reading frames.
- Active agents according to the invention may also include antibodies or proteins that bind to proteins encoded by open reading frames, or to transcriptional or translational regulators of such genes or proteins, or to binding partners of such proteins.
- Agents may also be chemical compounds designed following molecular modeling of essential gene products according to the invention, or mutant proteins designed therefrom that compete with the essential wild type protein for reactive cell components or for interacting nutrients, as well as agents from random chemical.
- the present invention therefore includes methods and assays for identifying antibacterial agents having specificity for the essential or important open reading frames identified, or to genes and proteins that interact with such open reading frames or the products encoded thereby.
- antibacterial agents may be identified using the assays and methods described herein, or by any suitable assay.
- Such assays may vary depending on the function delineated for each essential locus, as would be apparent to those of skill in the art. For instance, enzyme assays may be designed based on the predicted function of essential and important genes in order to define classes of inhibitors to be tested. Also, random chemical libraries may be screened for activity against the isolated genes or gene products.
- Cell lines may be designed or isolated that demonstrate reduced expression of essential genes, thereby providing a sensitive screening tool for inhibitors that effect the activity of that gene or gene product as it functions in the cell.
- Such cell lines may be devised from cells having transposon insertions that lead to attenuated growth, or may be constructed by the promoter swap techniques described herein, by using a regulatable promoter that can be used to increase gene expression, allowing for confirmation of target specificity.
- the minimal inhibitory concentration of the inhibitor is directly related to the expression level of the target gene, such that under low expression, an attenuated growth cell is more susceptible to an inhibitor than the wild type strain, and as you raise the expression level, the minimum inhibitory concentration (MIC) increases. The MIC shift will be consistent when the inhibitor acts on the regulated target.
- Active agents and compounds can be formulated into pharmaceutical compounds and compositions, effective for treating and preventing Pseudomonas infections in accordance with the methods of the invention. Such therapy will be particularly useful in the hospital setting for preventing and treating nosocomial infections, and for administering to cystic fibrosis patients to improve lung function and quality of life.
- such agents could also be useful in treating all types of Pseudomonas infections ranging from bacteraemia and septicemia, urinary-tract infections, pneumonia and chronic lung infections, burn infections, cancer, AIDS, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis.
- the invention provides pharmaceutical compositions appropriate for use in methods of treating bacterial infections described above.
- Figure 1 Depiction of a single crossover recombination event resulting in integration of a plasmid into the bacterial chromosome. Isolation of such recombinants indicates that the targeted gene is not essential.
- Figure 2 Single crossover and integration of a plasmid resulting in the replacement of a wild type promoter with a regulatable promoter.
- FIG. 3 Depiction of the 'promoter swap' strategy, using transformation of pBEMlO into P. aeruginosa in order to replace the IpxC promoter with the arabinose r ⁇ BAD promoter, thereby allowing modulation of its IpxC expression by the use of a simple sugar, arabinose.
- Figure 4 Graph showing the susceptibility or non-susceptibility of various E. coli and P. aeruginosa strains to the inhibitor LI 61,240.
- Figure 5 Graph depicting the effect of tetracycline and LI 61,240 on the growth of P. aeruginosa strain PA01 with and without polymixin permeabilization.
- FIG. 6 Sensitivity of various E. coli and P. aeruginosa strains to inhibitor LI 61, 240 following promoter swap and transformation with vector expressing E. coli IpxC or P. aeruginosa IpxC.
- E. coli "swaps" refer to P. aeruginosa containing a vector comprising E. coli IpxC
- PA swaps refer to P. aeruginosa containing a vector comprising P. aeruginosa IpxC.
- Figure 7 Graph illustrating ORF coverage by Tn5 achieved in High- Throughput Transposon Insertion Mapping (HTTIM), wherein 30% of the genes in the genome are candidate essential genes where ORF size is not taken into account in predicting essentiality.
- HTTIM High- Throughput Transposon Insertion Mapping
- Figure 8 Graph depicting the probability of identifying an essential gene given no transposon insertion, as a function of gene size.
- Figure 9 A circular map of the P. aeruginosa genome showing distribution of transposon insertion sites constituting a HTTIM of the invention, and demonstrating the random nature of the transposon employed.
- the length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non- overlapping kilobase.
- Figure 10 Histogram depicting the number of ORFs in the P. aeruginosa genome of (a) up to 4000 base pairs and (b) from 4000 up to 16884 base pairs.
- Figure 11 Graph showing likelihood and accumulative likelihood gains.
- Figure 12 Trajectory of the algorithm projected in a subspace spanned by two gene sizes.
- the x-axis represents genes of sizes 151-160 DNA base-pairs and y-axis represents genes of sizes 171- 180 DNA base-pairs.
- the median gene size of each group is used as the gene size.
- the likelihood gain is maximum in the direction of increasing the number of nonessential genes by one for genes with size 171-180 DNA base-pairs.
- the largest likelihood gain is obtained in the direction of increasing one nonessential genes for genes of sizes 151-160 DNA base pair.
- moving backwards has a negative likelihood gain.
- Figure 13 More trajectories of the searching algorithm projected in different subspaces.
- Figure 14 Plot of likelihood for different initial values.
- Figure 15 Trajectories of the algorithm with different starting values projected in the subspace spanned by two gene sizes: 1101-1150 DNA base-pairs for X-axis and 921-930 DNA base-pairs for y-axis.
- FIG. 16 Top: (A) The top line is M , number of genes, the bottom line is 5 , the number of genes with at least one observed insertion; the line in the middle is N , the number of estimated nonessential genes. For demonstration purpose, a cubic spline smooth is applied to the data. Bottom: Histogram of resamples of ⁇ (B) and ⁇ (C).
- the doted line is the value of N M,. and the solid line is a moving average smooth.
- the essential and important open reading frames identified in the present invention were originally part of a library of putative nucleic acid sequences generated from P. aeruginosa strains PA01 and PAK. See Table 1. Nevertheless, it is expected that the genes identified will also be essential or important in related P. aeruginosa strains as well as other Pseudomonas species, given the low sequence diversity that exists between P. aeruginosa strains of widely diverse environments and the pronounced structural and functional homology of gene products.
- the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.
- the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 90 to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.
- ORFs Pseudomonas aeruginosa open reading frames
- the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration knock-out coupled with extra-chromosomal complementation.
- ORFs Pseudomonas aeruginosa open reading frames
- the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.
- ORFs Pseudomonas aeruginosa open reading frames
- the polynucleotides of the invention are recombinant.
- Recombinant polynucleotides of the invention include proteins of genomic, cDNA, semisynthetic, or synthetic origin, which, by virtue of its origin or manipulation (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; (2) is linked to a polynucleotide other than that to which it is linked in nature; or (3) does not occur in nature.
- the present invention includes a library of nucleic acid sequences consisting essentially of nucleic acid sequences having at least 70% sequence identity, or more preferably at least about 80 to 90 to 95% identity, to a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said library of nucleic acid sequences is employed to identify essential or otherwise important genes or to construct or isolate attenuated mutants in Pseudomonas.
- ORFs open reading frames
- a map of at least about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa (High- Throughput Transposon Insertion Database or HTTIM), wherein said map is useful for identifying genes that are essential or important for survival of said Pseudomonas aeruginosa, i.e., by permitting the generation of a database of open reading frames that do not contain a transposon insertion.
- Figure 9 contains a circular map of the P. aeruginosa genome depicting 12,000 to 13,000 transposon insertion sites constituting a HTTIM of the invention, and demonstrates the random nature of the transposon employed.
- the length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non-overlapping kilobase.
- Table 3 contains a list of 13,515 specific Tn5 transposon insertion sites generated in either PAK or PA01, with the 473 mutants 12516-13043 being identified as attenuated for growth.
- the databases and libraries disclosed herein may be used to formulate useful subsets of these libraries and databases.
- the invention includes subsets of the databases and libraries disclosed. For instance, mutants 12516-13043 are identified as attenuated for growth and as such, the genes in this subset could be useful drug targets. Accordingly, this group of 473 mutants from the HTTIM database of 13,515 transposon hits provides a useful subset database for comparing homologies with essential genes of other organisms, for computer modeling of potential antibacterial agents, etc.
- a particularly useful database subset is one containing essential genes from P. aeruginosa that are also identified as essential in other Gram negative or Gram positive bacteria.
- genes that have essential homologs in other bugs are likely to provide useful targets for broad spectrum antibacterial agents, i.e., agents that have broad spectrum activity as an antibacterial agent.
- Genes in the putative essential or important gene database have already been identified via BLAST or other database analyses, and constitute an exemplary subset database of the present invention. See Table 4.
- the databases and subset databases of the present invention may also be used as comparative tools with other like databases or database subsets to identify broad spectrum.
- the database of putative essential and important genes identified in P. aeruginosa is cross- referenced with a similar database formed from S. aureus, wherein homologues present in both databases signal a potential target for a broad spectrum antibacterial agent.
- Cross-referencing between P. aeruginosa and S. aureus in particular will identify antibacterial targets for identifying broad spectrum antibiotics active against both Gram negative and Gram positive bacteria.
- databases derived from any bacteria could be employed in such comparisons, as well as databases formed from yeast, fungi, mycoplasma, and other potential pathogens.
- Also encompassed in the invention is the use of essential and important genes and the corresponding proteins expressed thereto in the design of vaccines for eliciting prophylactic or therapeutic immune responses against Pseudomonas aeruginosa.
- Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or variant thereof encoded by an essential gene. Additionally, such antigens will preferably be a protein expressed on the surface of the bacteria.
- Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or derivative thereof encoded by an essential or important gene.
- the protein antigen expressed from a recombinant polynucleotide.
- the invention is directed to a fragment of a protein encoded by an essential or important gene, said fragment is preferably at least 8 to 12 amino acids long, and even more preferably at least about 20 to 30 amino acids long.
- the fragment comprises either a B cell or a T cell epitope.
- the invention is directed to a derivative of a protein encoded by an essential or important gene
- said derivative contains one or more amino acid substitutions, additions or deletions.
- the amino acid substitutions are conservative amino acid replacements.
- Conservative amino acid replacements are those that take place within a family of amino acids that are related in their side chains.
- the polypeptide fragment or derivative is preferably immunologically identifiable with the polypeptide encoded by the essential or important gene.
- the polypeptide fragment or derivative is preferably immunogenic and is able to cause a humoral and/or cellular immune response, either alone or when linked to a carrier, in the presence or absence of an adjuvant.
- the polypeptide fragment or derivative may be fused to or incorporated into another polypeptide sequence.
- This other polypeptide sequence may include one or more other proteins, fragments or derivatives thereof encoded by an essential or important gene.
- the other polypeptide sequence may also include a polypeptide sequence which allows for presentation of the polypeptide fragment or derivative.
- the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.
- the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 90% to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.
- ORFs Pseudomonas aeruginosa open reading frames
- the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein the essentiality or importance of said nucleic acid sequence is determined by integration knock-out couple with extra-chromosomal complementation.
- ORFs Pseudomonas aeruginosa open reading frames
- the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identify, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.
- ORFs Pseudomonas aeruginosa open reading frames
- ligands that specifically bind antigens encoded by essential or important genes identified according to the invention, for use in, for instance, passive immunization.
- Preferred ligands are antibodies and antibody fragments that specifically bind the antigen encoded by the essential gene. Such antibodies may be polyclonal or monoclonal. Types of antibodies and antibody fragments include by way of examples murine antibodies, chimeric, antibodies, humanized antibodies, Fab fragments, Fab 2 fragments and human antibodies and scFv's. Methods for producing antibodies and antibody fragments by recombinant and non-recombinant methods are well known to those skilled in the art.
- the antigen used in such passive immunization may be attached to a cytotoxic moiety, e.g., a radionuclide or other agent that is cytotoxic against the bacteria.
- cells or viral vectors that express on their surface a Pseudomonas aeruginosa essential gene, fragment or variant identified according to the invention.
- the vaccine will comprise an immunogenic composition comprising a prophylactically effective amount of an antigen, antibody, cells or vector expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a protective immune response.
- the vaccine will comprise an immunogenic composition comprising a therapeutically effective amount of an antigen, antibody, cells or vectors expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a therapeutic immune response.
- Dosage effective amounts of prophylactic and therapeutic vaccines will be determined by known methods and will typically vary from about 0.00001 g/kg body weight to about 5-10 g/kg body weight.
- immunogenic compositions of the invention can be administered by known methods, i.e., mucosally or parenterally.
- Suitable routes of mucosal administration include oral, intranasal (IN), intragastric, pulmonary, intestinal, rectal, ocular, and vaginal routes.
- mucosal administration is oral or intranasal.
- the immunogenic composition is preferably adapted for mucosal administration.
- the composition may be in the form of tablets or capsules (optionally enteric- coated), liquid, transgenic plants, etc.
- the composition may be in the form of a nasal spray, nasal drops, gel or powder.
- the antigen composition is adapted for mucosal administration, it may further be formulated such that the antigen remains stable, for instance by the use of carriers and excipients.
- the immunogenic compositions of the invention can further comprise a mucosal adjuvant.
- Mucosal adjuvants suitable for use in the invention include (a) E.coli heat-labile enterotoxin ("LT”), or detoxified mutants thereof, such as the K63 or R72 mutants; (B) cholera toxin ("CT”), or detoxified mutants thereof; or (C) microparticles (i.e., a particle of ⁇ 100nm to ⁇ 150 ⁇ m in diameter, more preferably ⁇ 200nm to ⁇ 30 ⁇ m in diameter, and most preferably ⁇ 500nm to ⁇ 10 ⁇ m in diameter) formed from materials that are biodegradable and non-toxic (e.g.
- D a polyoxyethylene ether or a polyoxyethylene ester (see International patent application WO 99/52549);
- E a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (see International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (see International patent application WO 01/21152);
- F chitosan (e.g.
- Mutants of LT are preferred mucosal adjuvants, in particular the "K63” and “R72” mutants (e.g. see International patent application WO 98/18928), as these result in an enhanced immune response.
- Microparticles are also preferred mucosal adjuvants. These are preferably derived from a poly( ⁇ -hydroxy acid), in particular, from a poly(lactide) (“PLA”), a copolymer of D,L-lactide and glycolide or glycolic acid, such as a poly(D,L-lactide-co- glycolide) (“PLG” or "PLGA”), or a copolymer of D,L-lactide and caprolactone.
- PLA poly(lactide)
- PLA poly(lactide)
- PLA poly(D,L-lactide-co- glycolide)
- PAG poly(D,L-lactide-co- glycolide)
- caprolactone a copolymer of D,L-lactide and caprolactone.
- microparticles may be derived from any of various polymeric starting materials which have a variety of molecular weights and, in the case of the copolymers such as PLG, a variety of lactide: glycolide ratios, the selection of which will be largely a matter of choice, depending in part on the coadministered antigen.
- Antigen may be entrapped within the microparticles, or may be adsorbed to them.
- PLG microparticles are discussed in further detail in Morris et al., (1994), Vaccine, 12:5 - 11, in chapter 13 of Mucosal Vaccines, eds. Kiyono et al., Academic Press 1996 (ISBN 012410587), and in chapters 16 & 18 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X).
- LT mutants may advantageously be used in combination with microparticle- entrapped antigen, resulting in significantly enhanced immune responses.
- Suitable routes of parenteral administration include intramuscular (IM), subcutaneous, intravenous, intraperitoneal, intradermal, transcutaneous, and transdermal (see e.g., International patent application WO 98/20734) routes, as well as delivery to the interstitial space of a tissue.
- the immunogenic compositions of the invention may be adapted for parenteral administration (e.g., in the form of an injectable, which will typically be sterile and pyrogen-free).
- the immunogenic composition may further comprise a parenteral adjuvant.
- Parenteral adjuvants suitable for use in the invention include: (A) aluminum compounds (e.g. aluminum hydroxide, aluminum phosphate, aluminum hydroxyphosphate, oxyhydroxide, orthophosphate, sulfate etc. (e.g. see chapters 8 & 9 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X) (hereinafter "Vaccine design”), or mixtures of different aluminum compounds, with the compounds taking any suitable form (e.g.
- interferons e.g. interferon- ⁇
- macrophage colony stimulating factor tumor necrosis factor, etc.
- K microparticles (see above);
- a polyoxyethylene ether or a polyoxyethylene ester International patent application WO 99/52549
- P a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (International patent application WO 01/21152);
- Q an immunostimulatory oligonucleotide (e.g.
- the immunognic compositions of the invention may be administered in a single dose, or as part of an administration regime.
- the regime may include priming and boosting doses, which may be administered mucosally, parenterally, or various combinations thereof.
- the vaccines of the invention may comprise several antigens, fragments or variants encoded by essential genes identified according to the invention.
- the vaccine may further comprise antigens identified by other methods, or specific to other bacteria, e.g., in order to provide multivalent vaccines.
- a library of polynucleotides or a library of transposon insertion sites is a collection of sequence information, which information is provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer system and/or as part of a computer program).
- sequence information of the polynucleotides can be used in a variety of ways, for instance as a resource for gene discovery, i.e., for identifying and verifying essential and important genes in P.
- a polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, and accordingly such a polynucleotide library could be used to formulate corresponding RNA or amino acid libraries according to the sequences of the library members.
- the nucleotide sequence information of the library can be embodied in any suitable form, e.g., electronic or biochemical forms.
- a library of sequence information embodied in electronic form comprises an accessible computer data file (or, in biochemical form, a collection of nucleic acid molecules) that contains the representative nucleotide sequences of essential and important genes and/or insertion mutants that are differentially expressed (e.g., attenuated growth mutants).
- an accessible computer data file or, in biochemical form, a collection of nucleic acid molecules
- Biochemical embodiments of the library include a collection of nucleic acids that have the sequences of the genes or transposon insertion sites in the library, where the nucleic acids can correspond to the entire gene in the library or to a fragment thereof, as described in greater detail below.
- the polynucleotide libraries of the subject invention generally comprise sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence of any of the sequences in Tables 1-3.
- plurality is meant at least 2, usually at least 3 and can include up to all of the sequences included in these tables.
- the length and number of polynucleotides in the library will vary with the nature of the library, e.g., if the library is an oligonucleotide array, a cDNA array, a computer database of the sequence information, etc.
- the nucleic acid sequence information can be present in a variety of media.
- Media refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid.
- the nucleotide sequence of the present invention e.g. the nucleic acid sequences of any of the polynucleotides of Tables 1-3, can be recorded on computer readable media, e.g. any medium that can be read and accessed directly by a computer.
- Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.
- magnetic storage media such as a floppy disc, a hard disc storage medium, and a magnetic tape
- optical storage media such as CD-ROM
- electrical storage media such as RAM and ROM
- hybrids of these categories such as magnetic/optical storage media.
- electronic versions of the libraries of the invention can be provided in conjunction or connection with other computer-readable information and/or other types of computer-readable files (e.g., searchable files, executable files, etc, including, but not87 limited to, for example, search program software, etc.).
- computer-readable information e.g., searchable files, executable files, etc, including, but not87 limited to, for example, search program software, etc.
- nucleotide sequence By providing the nucleotide sequence in computer readable form, the information can be accessed for a variety of purposes.
- Computer software to access sequence information is publicly available.
- the gapped BLAST Altschul et al. Nucleic Acids Res. (1997) 25:3389-3402) and BLAZE (Brutlag et al. Comp. Chem. (1993) 17:203) search algorithms on a Sybase system can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.
- a computer-based system refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention.
- the minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means.
- CPU central processing unit
- input means input means
- output means output means
- data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.
- Search means refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information. Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif.
- a variety of known algorithms are publicly known and commercially available, e.g. MacPattern (EMBL), BLASTN and BLASTX (NCBI).
- a "target sequence” can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, preferably from about 10 to 100 amino acids or from about 30 to 300 nucleotides.
- a variety of comparing means can be used to accomplish comparison of sequence information from a sample (e.g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means.
- a skilled artisan can readily recognize that any one of the publicly available homology search programs can be used as the search means for the computer based systems of the present invention to accomplish comparison of target sequences and motifs.
- Computer programs to analyze expression levels in a sample and in controls are also known in the art.
- a "target structural motif,” or “target motif,” refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites.
- target motifs include, but arc not limited to, enzyme active sites and signal sequences.
- Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences and other expression elements such as binding sites for transcription factors.
- the present invention encompasses the use of the library of essential and important genes to search for polynucleotide and amino acid sequences in common among the essential and important genes. Such identified sequences can be used to design and develop antibacterial agents and vaccines against Pseudomonas aeruginosa.
- a variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention.
- One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile.
- the "library” as used herein also encompasses biochemical libraries of the polynucleotides of Tables 1-3, e.g., collections of nucleic acids representing the provided polynucleotides.
- the biochemical libraries can take a variety of forms, e.g., a solution of cD As, a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an array) and the like.
- a solution of cD As a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an array) and the like.
- nucleic acid arrays in which one or more of the sequences of Tables 1-3 is represented on the array.
- array is meant a an article of manufacture that has at least a substrate with at least two distinct nucleic acid targets on one of its surfaces, where the number of distinct nucleic acids can be considerably higher, typically being at least 10 nt, usually at least 20 nt and often at least 25 nt.
- array formats have been developed and are known to those of skill in the art.
- the arrays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis and the like, as disclosed in the above-listed exemplary patent documents.
- analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene corresponding to one or more of the sequences in Tables 1-3.
- homologous refers to genes whose expression results in expression products which have a combination of amino acid sequence similarity (or base sequence similarity for transcript products) and functional equivalence, and are therefore homologous genes. In general such genes also have a high level of DNA sequence similarity (i.e., greater than 80% identity when such sequences are identified among members of the same genus, but lower when these similarities are noted across bacterial genera), but are not identical.
- homologous gene serves to identify a homologous gene through the same relationships as indicated above, and can serve as a starting point to determine whether the homologous gene is also essential, whether it responds to the same antibacterial agents, etc.
- homologous genes are found in other bacterial species, especially, but not restricted to, closely related species. Due to the DNA sequence similarity, homologous genes are often identified by hybridizing with probes from the initially identified gene under hybridizing conditions that allow stable binding under appropriately stringent conditions.
- nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and lOXSSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC.
- Sequence identity can be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0.1XSSC (9 mM saline/0.9 mM sodium citrate).
- Hybridization methods and conditions are well known in the art, see, e.g., USPN 5,707,829.
- Nucleic acids that are substantially identical to the provided polynucleotide sequences e.g.
- allelic variants, genetically altered versions of the gene, etc. bind to the provided polynucleotide sequences under stringent hybridization conditions.
- probes particularly labeled probes of DNA sequences
- the equivalent function of the product is then verified using appropriate biological and/or biochemical assays.
- Specific genera of bacteria particularly appropriate for hybridization screening for the presence of homologues of essential and important genes include Escherichia, Hemoph ⁇ lus, Vibrio, Borrelia, Enterococcus, Heliobacter, Legionella, Mycobacterium, Mycoplasma, Neisseria, Staphylococcus, Streptococcus, etc.
- variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and can be greater than at least about 90% or more as determined by the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular).
- a preferred method of calculating percent identity is the Smith- Waterman algorithm, using the following.
- Global DNA sequence identity must be greater than 65% as determined by the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.
- Amino acid sequence variants are also included in the invention.
- naturally or non-naturally occurring protein variants have amino acid sequences which are at least 85%, 90%, or 95% identical to the amino acid sequences identified herein, or to a shorter portion of these sequences. More preferably, the molecules are 98% or 99% identical.
- Percent sequence identity is determined using the Smith- Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith- Waterman homology search algorithm is taught in Smith and Waterman, Adv. Appl. Math. (1981) 2:482-489.
- nucleic acid sequences and amino acid sequences identified herein are at least about 10 nucleotides, more preferably at least about 20 to 25 nucleotides, and more preferably at least about 50 to 100 nucleotides, and can include any fragment or variant of a fragment.
- nucleic acid fragments may be used as probes for identifying similar or substantially identical or identical nucleic acid sequences in other genera, or as tools in constructing nucleic acid vectors for knock out and promoter swap experiments.
- Such amino acid fragments are at least about four amino acids in length, more preferably at least about 8 to 12 amino acids in length, and more preferably at least about 20 to 30 amino acids in length, and may be used as agonists or antagonists to test binding interactions of the proteins disclosed herein, or alternatively as immunogens to isolate antibodies that recognize and bind to specific epitopes of a target protein.
- the invention also encompasses the identification of antibacterial agents that have specific activity against the essential or important genes or their gene products or the biochemical pathways in which they are involved.
- biochemical pathway refers to a connected series of biochemical reactions normally occurring in a cell, or more broadly a cellular event such as cellular division or DNA replication. Typically, the steps in such a biochemical pathway act in a coordinated fashion to produce a specific product or products or to produce some other particular biochemical action.
- Such a biochemical pathway requires the expression product of a gene if the absence of that expression product either directly or indirectly prevents the completion of one or more steps in that pathway, thereby preventing or significantly reducing the production of one or more normal products or effects of that pathway.
- an agent specifically inhibits such a biochemical pathway requiring the expression product of a particular gene if the presence of the agent stops or substantially reduces the completion of the series of steps in that pathway.
- Such an agent may, but does not necessarily, act directly on the expression product of that particular gene.
- An "expression product" of a gene means that, in a bacterial cell of interest, the gene is transcribed to form RNA molecules. For those genes that are transcribed into mRNAs, the mRNA is translated to form polypeptides. More generally, in this context, “expressed” means that a gene product is formed at the biological level that would normally have the relevant biological activity (i.e., RNA or polypeptide level).
- the invention includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against an essential or important bacterial gene identified by the methods herein.
- the invention also includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against a protein encoded by an essential bacterial gene identified herein, or active to inhibit the biochemical pathway that involves said protein.
- antibacterial agent refers to both naturally occurring antibiotics produced by microorganisms to suppress the growth of other microorganisms, and agents synthesized or modified in the laboratory which have either bactericidal or bacteriostatic activity. An "active" agent in this context will inhibit the growth of P. aeruginosa and possibly related species.
- inhibitors indicates that the rate of increase in the numbers of a population of a particular bacterium is reduced.
- the term includes situations in which the bacterial population increases but at a reduced rate, as well as situations where the growth of the population is stopped, as well as situations where the numbers of the bacteria in the population are reduced or the population even eliminated. If an enzyme activity assay is used to screen for inhibitors, one can make modifications in uptake/efflux, solubility, half life, etc. to compounds in order to correlate enzyme inhibition with growth inhibition.
- Assays may include any suitable method and may be expected to vary on the type of essential gene or protein involved. For instance, one embodiment is a method comprising the steps of:
- test compound a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said essential gene product or protein or fragment of said protein; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent. It is quite common in identifying antibacterial agents, to assay for binding of a compound to a particular polypeptide where binding is an indication of a compound which is active to modulate the activity of the polypeptide. Binding may be determined by any means according to the agent tested and techniques known in the art.
- agents that inhibit binding of two proteins or polypeptides may also be identified, for instance using a yeast two-hybrid system.
- a yeast two-hybrid system will entail cloning the genes encoding each protein and expressing each in a reporter cell system such that interaction between the two proteins is monitored by observing the expression of a reporter gene.
- cDNAs cloned in a yeast two-hybrid expression system Choen et al. (1991) Proc. Natl. Acad. Sci. (U.S.A.) 88: 9578; Zervos et al.
- Another embodiment is a method for evaluating a test agent for inhibition of expression of an essential gene identified according to the methods herein, comprising: a) contacting a cell expressing said essential gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.
- the exact determination method will be expected to vary depending on the characteristics of the expression product as would be readily apparent to one of ordinary skill in the art. Such methods can include, for example, antibody binding methods, enzymatic activity determinations, and substrate analog binding assays. Such level of expression could be monitored by monitoring the level of the product of the essential gene in the cell, i.e., by SDS-PAGE, or by colorimetric assays using, for example, a lacZ gene or protein fusion and detection on media using X-Gal or spectrophotometric detection.
- fusions may be designed using the chromosomal gene so long as the fusion does not disrupt the function of the essential gene, i.e., as with a gene fusion where lacZ is inserted just downstream of the essential gene and is expressed from the same promoter as the essential gene.
- lacZ is inserted just downstream of the essential gene and is expressed from the same promoter as the essential gene.
- a protein fusion i.e., where a portion of lacZ sufficient to be detected with a colorimetric test is fused in frame with the coding region of the essential gene such that a fusion protein is obtained.
- Other detectable or measurable proteins commonly used in the art may be used as an alternative to lacZ, for instance, phoA, Lux/luciferase, etc.
- Another method of the invention for evaluating an potential antibacterial agent comprises the steps of: a) providing a bacterial strain comprising a mutant or normal form of the essential or important gene, wherein said mutant form of the gene confers a growth conditional phenotype; b) contacting bacteria of said bacterial strain with a test compound in semi- permissive or permissive growth conditions; and c) determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.
- a "mutant form" of a gene is a gene which has been altered, either naturally or artificially, changing the base sequence of the gene, which results in a change in the amino acid sequence of an encoded polypeptide.
- the change in the base sequence may be of several different types, including changes of one or more bases for different bases, small deletions, and small insertions. Mutations may also include transposon insertions that lead to attenuated activity, i.e., by resulting in expression of a truncated protein.
- a normal form of a gene is a form commonly found in a natural population of a bacterial strain. Commonly a single form of a gene will predominate in natural populations.
- such a gene is suitable as a normal form of a gene, however, other forms which provide similar functional characteristics may also be used as a normal gene.
- a normal form of a gene does not confer a growth conditional phenotype on the bacterial strain having that gene, while a mutant form of a gene suitable for use in these methods does provide such a growth conditional phenotype.
- the term "growth conditional phenotype" indicates that a bacterial strain having such a phenotype exhibits a significantly greater difference in growth rates in response to a change in one or more of the culture parameters than an otherwise similar strain not having a growth conditional phenotype.
- a growth conditional phenotype is described with respect to a single growth culture parameter, such as temperature.
- a temperature (or heat-sensitive) mutant i.e., a bacterial strain having a heat-sensitive phenotype
- Such mutants preferably also show intermediate growth rates at intermediate, or semi-permissive, temperatures. Similar responses also result from the appropriate growth changes for other types of growth conditional phenotypes.
- a growth conditional phenotype can also be conferred by cloning an essential or important gene behind a regulatable promoter, for instance, a promoter that is only active, or only leads to transcription, under particular environmental conditions or in response to a specific environmental stimulus.
- a regulatable promoter for instance, a promoter that is only active, or only leads to transcription, under particular environmental conditions or in response to a specific environmental stimulus.
- Such growth conditional promoter mutants may be isolated according to the promoter swap strategies described herein.
- “Semi-permissive conditions” are conditions in which the relevant culture parameter for a particular growth conditional phenotype is intermediate between permissive conditions and non-permissive conditions. Consequently, in semi- permissive conditions the bacteria having a growth conditional phenotype will exhibit growth rates intermediate between those shown in permissive conditions and non- permissive conditions. In general, such intermediate growth rate is due to a mutant cellular component which is partially functional under semi-permissive conditions, essentially fully functional under permissive conditions, and is non-functional or has very low function under non-permissive conditions, where the level of function of that component is related to the growth rate of the bacteria.
- method of screening means that the method is suitable, and is typically used, for testing for a particular property or effect in a large number of compounds. Therefore, the method requires only a small amount of time for each compound tested; typically more than one compound may be tested simultaneously (as in a 96-well microtiter plate, or in a series of replica plates), and preferably significant portions of the procedure can be automated.
- Method of screening also refers to determining a set of different properties or effects of one compound simultaneously.
- the invention also encompasses vectors comprising the nucleic acid sequences, open reading frames and genes of the invention, as well as host cells containing such vectors. Because the essential genes identified herein can be readily isolated and the encoded gene products expressed by routine methods, the invention also provides the polypeptides encoded by those genes, as well as genes having at least about 50%, or more preferably about 60%, or more preferably about 70%, or more preferably about 80%, or more preferably about 90%, or most preferably about 95% protein sequence identity.
- this invention provides a method of screening for an antibacterial agent by contacting a polypeptide encoded by one of the identified essential or important genes, or a biologically active fragment of such a polypeptide, with a test compound, and determining whether the test compound binds to the polypeptide or polypeptide fragment.
- the invention provides a method for identifying or evaluating an agent active on one of the identified essential genes. The method involves contacting a sample containing an expression product of one of the identified genes with the known or potential agent, and determining the amount or level of activity of the expression product in the sample.
- antibodies to essential and important gene products are anticipated to be suitable diagnostic binding and antibacterial agents.
- antibodies to the proteins encoded by the essential and important genes identified by the methods described herein are also included in the invention.
- Such antibodies may be isolated according to well known techniques in the art, i.e., Kohler and Milstein for monoclonal antibodies.
- polyclonal antibodies and antibody fragments such as Fv, Fab and Fab 2 fragments, as well as chimeric and humanized antibodies, and human antibodies, i.e., made using a Xeno mouse.
- this invention provides a method of diagnosing the presence of a bacterial strain having one of the genes identified above, by probing with an oligonucleotide at least 15 nucleotides in length, which specifically hybridizes to a nucleotide sequence which is the same as or complementary to the sequence of one of the bacterial genes identified above.
- an oligonucleotide at least 15 nucleotides in length, which specifically hybridizes to a nucleotide sequence which is the same as or complementary to the sequence of one of the bacterial genes identified above.
- it is practical to detect the presence of a particular bacterial strain by direct hybridization of a labeled oligonucleotide to the particular gene.
- this invention provides a method of diagnosing the presence of a bacterial strain by specifically detecting the presence of the transcriptional or translational product of the gene.
- a transcriptional (RNA) product is detected by hybridizing a labeled RNA or DNA probe to the transcript.
- Detection of a specific translational (protein) product can be performed by a variety of different tests depending on the specific protein product. Examples would be binding of the product by specific labeled antibodies and, in some cases, detection of a specific reaction involving the protein product. Diagnostic assays find particular use in assaying tissue and fluid samples of patients suspect of having a Pseudomonas infection.
- Antibacterial agents identified according to the methods of the invention may be employed in pharmaceutical compositions. Such compositions may be administered to patients in order to treat an infection by or involving P. aeruginosa, either alone or in combination with secondary agents targeted at, for instance virulence factors of P. aeruginosa, or other bacteria that may be present in addition to P. aeruginosa.
- administration or “administering” refers to a method of giving a dosage of an antibacterial pharmaceutical composition to a mammal, where the method is, e.g., topical, oral, intranasal, inhaled, intravenous, transdermal, intraperitoneal, or intramuscular.
- the preferred method of administration can vary depending on various factors, e.g., the components of the pharmaceutical composition, the site of the potential or actual bacterial infection, the bacterium involved, and the severity of an actual bacterial infection.
- hybridize has its usual meaning from molecular biology. It refers to the formation of a base-paired interaction between nucleotide polymers. The presence of base pairing implies that at least an appreciable fraction of the nucleotides in each of two nucleotide sequences are complementary to the other according to the usual base pairing rales. The exact fraction of the nucleotides which must be complementary in order to obtain stable hybridization will vary with a number of factors, including nucleotide sequence, salt concentration of the solution, temperature, and pH.
- DNA molecule should be understood to refer to a linear polymer of deoxyribonucleotides, as well as to the linear polymer, base-paired with its complementary strand, forming double-strand DNA (dsDNA).
- dsDNA double-strand DNA
- the term is used as equivalent to "DNA chain” or "a DNA” or “DNA polymer” or “DNA sequence”, so this description of the term meaning applies to those terms also.
- the term does not necessarily imply that the specified "DNA molecule” is a discrete entity with no bonding with other entities.
- the specified DNA molecule may have H-bonding interactions with other DNA molecules, as well as a variety of interactions with other molecules, including RNA molecules.
- the specified DNA molecule may be covalently linked in a longer DNA chain at one, or both ends.
- Any such DNA molecule can be identified in a variety of ways, including, by its particular nucleotide sequence, by its ability to base pair under stringent conditions with another DNA or RNA molecule having a specified sequence, or by a method of isolation which includes hybridization under stringent conditions with another DNA or RNA molecule having a specified sequence.
- references to a "portion" of a DNA or RNA chain mean a linear chain which has a nucleotide sequence which is the same as a sequential subset of the sequence of the chain to which the portion refers. Such a subset may contain all of the sequence of the primary chain or may contain only a shorter sequence. The subset will contain at least 15 bases in a single strand. However, by “same” is meant “substantially the same”; deletions, additions, or substitutions of specific nucleotides of the sequence, or a combination of these changes, which affect a small percentage of the full sequence will still leave the sequences substantially the same. Preferably this percentage of change will be less than 20%, more preferably less than 10%, and even more preferably less than 3%. "Same” is therefore distinguished from “identical”; for identical sequences there cannot be any difference in nucleotide sequences.
- nucleotide sequences As used in reference to nucleotide sequences, "complementary" has its usual meaning from molecular biology. Two nucleotide sequences or strands are complementary if they have sequences that would allow base pairing between the strands according to the usual pairing rales. This does not require that the strands would necessarily base pair at every nucleotide; two sequences can still be complementary with a low level of base mismatch such as that created by deletion, addition, or substitution of one or a few (up to 5 in a linear chain of 25 bases) nucleotides, or a combination of such changes.
- Transposon insertions were generated using an improved transposon system for P. aeruginosa that utilizes a mini-Tn5-type transposon on a delivery vector that does not replicate in Pseudomonas.
- the delivery vector contains a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions. Weinreich et al., 1994, Evidence that cis preference of the Tn5 transposase is caused by nonproductive multimerization, Genes Dev. 8(19): 2363-74.
- the Tn5 transposase was placed under control of a lac promoter and the complete transposable element was minimized to 1.7 kilobases in length, including a tetracycline resistance marker and transcription terminator to prevent read-through into the genome.
- the transposon vector is delivered to P. aeruginosa via conjugation from a suitable E. coli host (e.g. SMlt ⁇ ir). Following conjugation, transposon mutants are selected by resistance to tetracycline conferred by the trasnposable element.
- Precise transposon insertion sites were determined by an anchored, semi- random PCR method for amplification of the transposase/genome junction region.
- the technique, HTTIM uses both Tn5 specific and semi-random primers with conserved primer tails.
- a small aliquot of transposon mutant liquid culture is used as a template and amplification of a fragment containing an insertion site is achieved in a two-step process.
- the PCR product is then sequenced and the insertion site is entered into an Oracle database for analysis. To date, more than 10,000 to 14,000 insertions have been mapped, each insertion representing the disruption of a gene or intergenic region that is not essential for survival on rich media.
- Open reading frames were tentatively assigned names prior to being identified pursuant to HTTIM analysis, as disclosed in the Pseudomonas genome project, and reported in Stover et al., Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen, August 21, 2000, Nature 406: 959-964, herein incorporated by reference in its entirety.
- Pseudomonas Community Annotation Project Pseudomonas Community Annotation Project
- ORFs The genome project was able to assign a functional class to 54.2% of ORFs. As in other bacterial genomes, a large proportion of the genome (45.8% of ORFs) consists of genes for which no function could be determined or proposed (confidence level 4). Of these, nearly a third (769 ORFs) possess homology to genes of unknown function predicted in other bacterial genomes, and the remainder (32% of ORFs) do not have strong homology with any reported sequence. The 372 ORFs from the entire genome analysis that are known P.
- aeruginosa genes with demonstrated functions are primarily genes encoding lipopolysaccharide biosynthetic enzymes, virulence factors, such as exoenzymes and the systems that secrete them, and proteins involved in motility and adhesion.
- ORFs with strong homology to genes in other organisms with demonstrated functions include those required for DNA replication, protein synthesis, cell-wall biosynthesis and intermediary metabolism.
- ORFs that provided the most new information about P. aeruginosa biology via the genome annotation were those that could be assigned a probable function on the basis of similarity to established sequence motifs, but could not be assigned a definite name (confidence level 3; 1,590 ORFs). Most of these genes encode products that are in one of three functional classes: putative enzymes (405 genes), transcriptional regulators (341 genes) or transporters of small molecules (408 genes). In some cases genomic context provided additional information, allowing us to identify loci that appear to encode systems such as metabolic pathways and secretion systems, although the substrates for such systems could not be identified. The system for assigning name and putative function to each essential or important gene was gleaned from the Pseudomonas genome project data already available.
- the open reading frames listed in Table 1 are also presented in Table 2, wherein the ORFs are listed in order of length of base pairs from longest to shortest. Also listed in Table 2 is the probability of essentiality assigned to each of the open reading frames. Probability correlates with length of the ORF, such that the longer the ORF, the higher the probability of hitting the ORF in a random transposon mutagenesis experiment, and the higher the confidence level that the ORF represents an essential or an important gene given that no transposon insertions therein were isolated. Statistical confidence levels in essentiality or importance can help narrow the focus in the screening of specific genes, thereby shortening the verification process and the subsequent identification of antibacterial agents specific for that gene or gene product. Thus, one of the benefits of the HTTIM approach is that it is a quantitative approach that lends itself well to statistical analysis.
- the High-Throughput Transposon Insertion Mapping (HTTIM) strategy utilizes a transposon, which is a small, mobile DNA element that randomly inserts into the chromosome.
- HTTIM was performed using a Tn5 transposon, any transposon may be employed so long as its insertion into the chromosome is random, i.e., devoid of hot spots.
- the Tn5 derivative employed here contained a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions (see supra), the frequency of insertion is generally quite low.
- mutants with even one insertion occur at a rate of only 1 in 10 5 or IO 6 bacteria, and must be specifically selected from a background of cells with no insertions. Because the frequency of a single insertion is so low, the frequency of a double insertion is so low as to be insignificant.
- transposon insertion disrupts one of the 5570 genes in the Pseudomonas genome, the function of that gene is lost. If the disrupted gene is essential for growth, the transposon insertion mutant dies and cannot be characterized. If the transposon disrupts a gene that is non-essential, the mutant survives, grows and the transposon insertion site is mapped. By examining the insertion sites of a large number of transposon mutants, all, of the non-essential P. aeruginosa genes can be identified, and by implication, all of the essential genes may be identified as well.
- a Bayessian statistical model for truncated counting data was applied to the candidate essential gene set, and permitted a determination that 16 to 17 percent of P. aeruginosa genes are essential. Such a model may therefore be utilized to increase the statistical confidence that a given gene in the candidate subset is essential.
- An exemplary statistical model is provided in Example 1.
- PCR is used to amplify a small (200-500 base pairs) portion of the coding sequence, or open reading frame (ORF) of the gene of interest.
- ORF open reading frame
- This gene fragment must be centrally located within the ORF— it cannot include either termini of the gene's coding region.
- This fragment is cloned into a plasmid vector that can replicate in E. coli, but not in Pseudomonas.
- the vector used should have a drug resistance marker that is suitable for selection in Pseudomonas, and an origin for conjugal transfer. This feature allows the plasmid to be transferred by conjugation from a suitable E.
- the co-cultured mixture is harvested and plated on media which selects against the E. coli donor and for Pseudomonas which contain the plasmid. Since the plasmid is incapable of extra-chromosomal replication in Pseudomonas, colonies that arise are the result of homologous recombination between the Pseudomonas chromosome and the cloned gene fragment on the plasmid. This is referred to as single-crossover recombination; a single recombination event takes place between the plasmid and the chromosome. The result is integration of the plasmid into the bacterial chromosome and disruption of the gene from which the fragment was amplified (Fig. 1).
- Variations of this approach are possible. For instance, one could clone out the entire locus and isolate transposon insertion mutants in E.coli using known techniques, i.e., by transposition from the E. coli genome, selecting plasmid insertions by mobilizing the vector into a recipient cell that does not contain the transposon or the antibiotic resistance marker encoded by the transposon, and screening the plasmid for insertions in the cloned gene. Thereafter, a similar assay could be performed by screening for double crossover events in P. aeruginosa that result in recombination of the transposon into the chromosomal locus from a suicide vector.
- This variation of the above method provides more convincing data when the target gene is essential. It employs the same type of non-replicating integration plasmid described above, but recombinations are performed in strains already carrying a second copy of the target gene on an extra-chromosomal plasmid. This second copy can then supply the essential function when the chromosomal copy is disrupted. If disruptions can only be obtained when a complementing plasmid is present and not when a control plasmid is present, this is rather strong evidence that the target gene is essential. The advantage of this method is that you obtain colonies even when your gene is essential. The disadvantage is that construction and sequencing of the complementation plasmid takes additional time.
- This approach also involves selecting for chromosomal integration of non- replicating plasmids via homologous recombination.
- the design of the integrating plasmid is different.
- the N-terminal coding sequence (300-500 base pairs) of the target gene is PCR amplified and cloned into a vector downstream of a regulatable promoter, i.e., a lac promoter, which is inducible in the presence of IPTG, or an arabinose promoter (pABD), inducible in the presence of arabinose.
- a regulatable promoter i.e., a lac promoter, which is inducible in the presence of IPTG, or an arabinose promoter (pABD), inducible in the presence of arabinose.
- the activity of the promoter can be modulated by the presence of a specific inducer molecule.
- the plasmid is conjugated into Pseudomonas and integration selected for under conditions where the regulatable promoter is active.
- the resulting chromosomal integration replaces the target gene's natural promoter with the regulatable promoter from the plasmid (Fig. 2). If the target gene is essential, recombinants can only survive when the inducer molecule is present in their growth media to stimulate gene expression. If the gene is non-essential, the recombinant's growth is independent of the addition of the inducer.
- the advantage of this strategy is that it requires only amplification of a short stretch of DNA followed by a single cloning step before recombination experiments can be performed. Examples: Essential Genes Identified
- Example 1 A Bayessian Statistical Model for Increasing Statistical Confidence of Essentiality
- the data set consists of 5570 genes with 881 different sizes ranging from 72 to 16884 DNA base-pairs.
- the distribution of the gene sizes are extremely skewed to the right with majority of the genes being smaller than 2000 DNA base-pairs as shown in Figure 10.
- R be a measurable subset of the probability space ⁇ such that a random variable X is observable only if Xe ⁇ R.
- Xe Xe ⁇ R.
- the set R consists of a single element ⁇ 0 ⁇ . 1.
- the Bayesian model consists of the conditional model (2.4) and a prior distribution of the parameter N.
- N the number of nonessential genes
- M the total number of genes of size ⁇ , which is known
- ⁇ the portion of nonessential genes which is unknown and is independent of gene size
- N (N i ,N 2 ,---,N g ) from (3.7) in such a high dimensional parameter space is a very difficult task both theoretically and computationally.
- This algorithm searches the ML estimator in a high dimensional space (881 in our study) along a path such that at each iteration, it moves in a direction (that is, increases the number of nonessential genes in this size group by one) along which the likelihood gain is maximum among all possible directions. Because the searching algorithm prohibits reversal of previous moves at any later iteration, it moves towards the ML estimator along the shortest path with the deepest ascending (maximum likelihood gain) at each step.
- Table 5 and Figures 11 and 12 show the values of likelihood gains in each iteration. With very few exceptions where the monotonous is violated only at the fourth or fifth decimal places that probably can be attributed to rounding errors, the likelihood gain is a monotonously decreasing function.
- THEOREM 1 if
- ⁇ ,3 * (N)- ⁇ ,3 * (N- ⁇ ,) ( ⁇ (
- THEOREM 3 Under (4.9), for any l ⁇ j ⁇ g and 1 ⁇ k ⁇ K' . .
- K' max ⁇ k * ⁇ 0 : G(k) ⁇ forallO ⁇ k ⁇ k * ⁇ ,
- N n®K (4.12)
- Theorem 3 guarantees that the trajectory of the searching algorithm follows the shortest path in the sense that a reversal of a previous move (that is, removal of a previously added nonessential gene of any gene size) at any later state will result in a loss of likelihood.
- Figure 4 shows the trajectory of the searching algorithm projected in a subspace spanned by two different gene sizes.
- genes are grouped into 143 groups by grouping genes with similar sizes together to increase the length of the trajectory.
- Figure 13 shows more trajectories projected in different subspaces.
- JV° ® 0 JV°, 0 ⁇ £ ⁇
- N°®k ⁇ N° ®(k-i))®l for k ⁇ l.
- Algorithm (4.13) preserves all the properties of algorithm (4.7) and it searches the ML estimator the same way as that of algorithm (4.7) with two exceptions.
- algorithm (4.7) which uses fi as initial values of N and at each iteration, the number of nonessential genes is increased by one in gene groups of size ⁇ ; to find the maximum likelihood gain, this algorithm uses N° as initial values of N which can be greater than the ML estimator. Therefore, at each iteration, the number of nonessential genes in a group with size ⁇ ; can be either increased or decreased by one such that the likelihood gain is maximum.
- the prior ⁇ plays an important role in enforcing the fact that the essentialness of a gene is independent of its size. It also made possible to estimate the number of essential genes where data are very sparse. However, for small genes where data are extremely sparse, the prior ⁇ becomes the dominating source of information. In order to moderate the dominance of the prior on small genes with sparse observations, we grouped the genes into 143 groups according to their sizes, using the median size of each group as the gene size. Table 7 is a sample of estimated N based on grouped and exact gene sizes. In the table, m is the number of unique sizes in each group; Ni is estimated using grouped data and N 2 is estimated using ungrouped data. Table 7: Estimated N with Grouped and Exact Gene Sizes
- the proportion of truncated nonessential genes can be calculated as
- ⁇ is the set of nonessential genes, which can be approximated by the set of all untruncated genes.
- model does not depend on gene size, which can happen for example, when we study a subset of genes with a fixed size, or in other settings where the distribution is identical, model (2.6) reduces to (2.5).
- Blumenthal, Dayhiya, and Gross (1978) studies estimations of complete sample size from an incomplete Poisson sample using conditional, unconditional, and modified maximum likelihood functions. The modified likelihood estimation weights the likelihood function and maximizes it.
- This approach is similar to providing priors to ⁇ and N.
- Table 9 presents four types of estimations of N using data randomly selected from the 143 grouped genes.
- M and n are number of genes and number of genes with at least one observed transposon insertions.
- N m-b is a subset of N t in Table 7, which is estimated using model (2.6) with grouped data; N b is estimated with model (2.5); N c and N u are conditional and unconditional estimates of N as described in Blumenthal., Dayhiya, and Gross (1978).
- estimations from the three univariate models are very similar. For fairly large genes, estimations from the multivariate model are similar to those of the univariate models. However, for small genes with high trancation rate, estimations from the multivariate model are larger than estimations from the univariate models. In the univariate models, only the information related to a particular gene size is used and the estimations are obtained separately for each gene size. This approach tends to underestimate N for small genes with sparse observations.
- the multivariate model uses a prior to enforce the fact that the essentialness of a gene is independent of its size and maximizes the likelihood jointly for all genes. Therefore, it alleviates the underestimation of N for small genes with high truncation rate.
- Lipid A constitutes the outer layer of the outer membranes of gram-negative bacteria and is essential for bacterial growth. This makes all the enzymes involved in the biosynthesis of this molecule essential for bacterial growth, and therefore ideal targets for drug design.
- a series of synthetic molecules was previously identified that inhibited the first committed step in lipid A biosynthesis. Onishi H. R., B. A. Pelak, L. S. Gerckens, L. L. Silver, F. M Kahan, M-H Chen, A. A. Patchett, S. M. Galloway, S. A. Hyland, M. S. Anderson, and C. R. H. Raetz. 1996. Science. 274: 980-982. This step is catalyzed by a unique deacetylase (UDP-3-O -[R -3-hydroxymyristoyl]-Glc Ac deacetylase), LpxC.
- UDP-3-0 -[R -3-hydroxymyristoyl]-GlcNAc deacetylase is a deacetylase that catalyzes the first committed step of lipopolysaccharide (LPS) biosynthesis in gram negative bacteria. This is the second step following the first acylation of N-Acetylglucosamine (GlcNAc). This enzyme functions to deacetylate the UDP-3-0 -[R -3-hydroxymyristoyl]-GlcNAc. This step was shown to be essential for growth in E. coli wherein a point mutant (EnvAI) expresses an LpxC protein that has reduced activity.
- EndAI point mutant
- Previously identified inhibitors are chiral hydroxamic acids that had unique hydrophobic aromatic moieties, and were suspected to bind a metal in the active site of the deacetylase.
- the most potent inhibitor, L-161,240 displayed a minimal inhibitory concentration of about 1 microgram per milliliter against E. coli, caused three logs of bacterial killing in 4 hours, and cured mice infected with a lethal intraperitoneal dose of E. coli.
- L-161,240 displayed a minimal inhibitory concentration of about 1 microgram per milliliter against E. coli, caused three logs of bacterial killing in 4 hours, and cured mice infected with a lethal intraperitoneal dose of E. coli.
- P. aeruginosa enzymes it was initially presumed that an inhibitor of the E. coli enzyme might also inhibit the P. aeruginosa enzyme.
- this molecule inhibited LpxC from P.
- P. aeruginosa IpxC was one nucleic acid identified as being unable to accommodate a transposon insertion in the library depicted in Table 1 (PA4406).
- P. aeruginosa IpxC we first tested the sensitivity of P. aeruginosa transformants expressing E. coli LpxC following a "promoter swap" integration. Using this technique, we completely shut off expression of the native P. aeruginosa IpxC, while expressing only the E. coli enzyme encoded on a plasmid. This strategy resulted in a P. aeruginosa mutant that was more sensitive to L-161,240.
- Pseudomonas aeruginosa PAO1 was grown at 37°C in Luria- Bertani (LB) broth (Difco) or plated on sheep blood agar (Remel). Tetracycline at 100 ⁇ g/ml in LB media was used to maintain the selection of the integrated plasmid pBEMlO in PAO1. LB broth or agar with 10 ⁇ g/ml of tetracycline was used for growing E.
- Plasmids pPS 72 and pBADHisB were from Promega and Invitrogen, respectively.
- EDTA, bis-tri buffer, sucrose, arabinose, and DMSO were purchased from Sigma as Ultrapure agents.
- Yeast extract and Tryptone were obtained from Difco. Restriction enzymes, and T4 DNA Ligase, and their reaction buffers were from New England Biolabs.
- Polymixin B nonapeptide was from Sigma.
- the antibiotics, tetracycline, ampicillin, carbenicillin, gentamicin, and kanamycin were all purchased from Sigma.
- DNA and deduced amino acid information were analyzed using a family of programs included in the Dnastar package.
- BLASTP was used to search for amino acid similarities among a host of protein databases available on-line through the National Library of Medicine (USA). Altschul, T. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment tool. J. Mol. Biol. 215: 403-410.
- the PCR products were purified with the Qiaquick PCR Purification Kit from Qiagen (according to the manufacturer's instructions) and digested with Ndel and EcoRI restriction enzymes at sites introduced by the primer sequences. Bands of the correct sizes predicted for the IpxC genes were separated by gel electrophoresis, and the excised D ⁇ A purified using the Qiaquick Gel Extraction Kit from Qiagen (according to the manufacturer's instructions). The purified D ⁇ A was ligated into the T7 expression vector (Studier, F. W., A. H. Rosenberg, J.J. Dunn, and J. W. Dubendorff. 1990. Use of T7 R ⁇ A polymerase to direct expression of cloned genes.
- the tetR marker was amplified using a forward primer that introduced a BgKl site (5'- AGATCTCAAGGGTTGGTTTGCGCA-3') and a reverse primer that introduced an EcoRI site (5'-
- the ⁇ r BAD promoter and araC gene were amplified as one piece from the pB AD HisB vector.
- the forward primer introduced an /r ⁇ l site (5'-CTCGAGGCATGCATAATGTGCCTGTC-3') and the reverse primer introduced a Hindlll site (5'-
- rbs was altered from its original AGGAG to CTTCT.
- the following primer set was used to make these changes and introduced an upstream BssHll site (5'- GCGCGCGGACGAAAGTAAACCCAC
- the 'promoter swap' scheme is a homologous recombination strategy, whereby transformation of pBEMlO into P. aeruginosa removed the native IpxC promoter and placed the tightly regulated ar ⁇ BAD promoter upstream of the chromosomal copy of IpxC, allowing modulation of its expression by the use of a simple sugar, arabinose ( Figure 3). In the absence of arabinose the IpxC was effectively shut off, and expression was inducible by addition of arabinose. Such mutants were selected in the presence of arabinose, and if IpxC is essential, these mutants would not be viable in media that is not supplemented with arabinose, but fully capable of growth in the presence of arabinose.
- Intrinsic resistance to inhibitors of fatty acid biosynthesis in Pseudomonas aeruginosa is due to efflux: application of a novel technique for generation of unmarked chromosomal mutations for the study of efflux systems.
- Antimicrob. Agents Chemother. 42: 394-398) were all grown at 37°C. In the cases where temperature sensitive JBK strains were being assayed, the cultures were grown at 42° C for both the overnight and the time course cultures.
- Polymixin B nonapeptide (Sigma) was prepared as a suspension in DMSO at 3 mg/ml final concentration. Erythromycin and Tetracycline were resuspended in DMSO to a final concentration of 250 mg/ml and 125 mg/ml, respectively. L-161,240 was prepared as above in DMSO to a final concentration of lOmg/ml. These DMSO antibiotic solutions were individually added to LB to the appropriate final concentration and mixed. Polymixin B nonapeptide was then added to the appropriate samples and mixed. DMSO was added to each sample to keep the final concentration of DMSO equivalent between samples. A stationary phase overnight culture of PAOl was added to each sample to bring the final concentration to 0.1 OD 6 oo. Samples were removed for OD 6 oo determinations every 1-2 hours for 6.5 hours and the data from these time points were plotted.
- MIC determinations for 'promoter swapped' mutants Single colonies of DH5 ⁇ , PAOl and each promoter swap strain were picked and grown in LB at 37°C with shaking for approximately 4 hours. Assuming that an OD 6 oo reading of 1.0 is equivalent to 10 9 cells/ml, dilutions were made of all cultures to 5x10 s cells/ml. 200 ⁇ l of each diluted culture was added to each well where a two-fold serial dilution of inhibitor had been placed. The 96-well plates were incubated at 37°C overnight and their OD 6 oo determined using the Spectramax Plus (Molecular Devices) plate reader.
- LpxC is essential for growth in P. aeruginosa. Since the hydroxamate inhibitor was effective in preventing growth of E. coli, but completely ineffective against P. aeruginosa, there was a possibility that LpxC was not essential in P. aeruginosa. This could be as a result of the presence of another enzyme that catalyzed a similar function. If that were the case, elimination of the LpxC function should be possible without inhibiting bacterial growth. A thorough analysis of the P. aeruginosa genome sequence revealed only one LpxC homologue.
- E. coli expressing LpxC from P. aeruginosa is more resistant to L-161, 240.
- the E. coli strain JBK-1 /pKD6 contains the chromosomal IpxC gene disrupted with a kan element and a wild type copy of E. coli IpxC on the temperature-sensitive replicon pKD6.
- the strain was constructed as described by Sorensen et al, 1996. Since IpxC is essential for growth, this strain is not viable at 42° C because the functional copy is on the temperature sensitive replicon. Transforming JBK-1 /pKD6 with IpxC from either E. coli or P.
- L-161, 240 is a substrate for the major drug efflux pump of P. aeruginosa.
- the completed P. aeruginosa genome reveals genes for at least nine homologous, multicomponent, multidrug efflux systems (Stover et al., 2000, Complete genome sequence of Pseudomonas aeruginosa PAOl, an opportunistic pathogen, Nature 406: 959-64).
- MexAB-OprM MexAB-OprM (Kohler, T., M. Michea-Hamzehpour, and U. Henze. 1997. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol.
- mutants of this efflux system can be used to evaluate the consequences of diminished efflux pump activity. These mutants would be expected to be highly sensitive to a number of antibiotics.
- Such a mutant, PAO 200 has been isolated (Schweizer, 1998, supra), and whereas it shows a higher level of sensitivity to a number of antibiotics (Westbrock- Wadman, S. D. R. Sherman, M. J. Hickey, S. N. Coulter, Y. Q. Zhu, P. Warrener, L. Y. Nguyen, R. M. Shawar, K. R. Folger, and C. K. Stover . 1999.
- P. aeruginosa is not less permeable to L-161,240.
- Low permeability of the outer membrane is a major contributing factor to the observed high levels of intrinsic drug resistance in P. aeruginosa (Nikaido, H. 1998. The role of outer membrane and efflux pumps in the resistance of gram-negative bacteria. Can we improve access? Drug Resistance Updates. 1: 93-98).
- This low permeability is due to the fact that P. aeruginosa lacks the homolog of the relatively efficient, trimeric porins like OmpF. P.
- aeruginosa has, instead, OprF, the OmpA homolog, which produces channels only when it is folded into a rare conformation, and only a small fraction of these channels occurs in the open conformation.
- OprF the OmpA homolog
- the reason L-161,240 was ineffective against P. aeruginosa was the lack of permeability of the outer membrane to this inhibitor.
- Polymixin B nonapeptide (PMBN) a derivative of Polymixin B that lacks the fatty acid tail, is capable of binding to the polyanionic LPS molecules and disrupting the bilayer structure, thus increasing the permeability of the outer membrane.
- PMBN has been used this way to permeabilize the outer membrane of many gram-negative bacteria (Vaara, M.
- P. aeruginosa expressing only E. coli LpxC is more sensitive to L161-240 than wild type.
- 'promoter swapped 1 P. aeruginosa was transformed with either vector containing P. aeruginosa IpxC ("PA Swap #1"), or vector containing E. coli IpxC ("PA Swap #2'). The transformants were then exposed to various concentrations of L- 161,240 for MIC determination. Transformants expressing the E.
- coli enzyme is also a metalloenzyme is that the envAl mutation, which has one of the conserved Histidines (His 19) replaced by a Serine, is sensitive to EDTA. It was because of these observations that these investigators suggested that the E. coli enzyme has a more stably bound metal than that of the EnvAl mutant protein, and thus it is less accessible to EDTA than the wild type P. aeruginosa enzyme. These observations suggest that the Histidine 'patch' that is involved in the metal coordination is not similar between the two enzymes. It is conceivable therefore that since the inhibitor works by chelating the metal cofactor away from the enzyme, each 'patch' has unique features that result in disparate reactivities towards the inhibitor.
- LpxA the first enzyme of lipid A biosynthesis
- E. coli LpxA prefers R-3-hydroxymyristoyl-ACP to R- 3-hydroxydecanoyl-ACP
- P. aeruginosa LpxA prefers the opposite.
- the products of the LpxA reaction therefore differ in the carbon chain length of their lipid moieties between the two bacteria.
- Examples 3-7 ispA, ispB, uppS, aroC, aroK, and metK
- the regions were (numbering from the start codon): ispA, 283-594; ispB, 319-610; uppS, 103-402; metK, 415-732; aroC, 385-684; aroK, 175- 375.
- the pPW120 vector carries an E. coli origin of replication, but not a Pseudomonas origin of replication, making it a suicide vector. It also carries an origin of conjugal transfer and antibiotic resistance genes for tetracycline and ampicillin.
- An E. coli donor strain (SM10) carrying the pPW120 knockout constructs was incubated with Pseudomonas strain PAOl to allow conjugal transfer, and recombinants were selected by plating onto media containing tetracycline at 100 ⁇ g/mL and chloramphenicol at 10 ⁇ g/mL. Pseudomonas recombinants will be resistant to this antibiotic mixture while wild-type PAOl and the E.
- Aromatic amino acid recombinants (aroC and aroK) were then tested for auxotrophy by plating onto minimal media with and without phenylalanine, tryptophan, tyrosine, and folic acid at 100 ⁇ g/mL while maintaining tetracycline selection.
- the genes ispB, uppS and metK did not yield recombinants, demonstrating that they are essential genes in all media conditions, while ispA yielded slow-growing recombinants (suggesting that this gene may nevertheless be an "important" gene according to the invention).
- ispA, ispB, uppS, and metK the conjugation procedure was also done in the presence of the complementing plasmid pBAD/HisP.
- This plasmid has both E. coli and Pseudomonas origins of replication, an antibiotic resistance gene for carbenicillin, and an arabinose-inducible copy of the full-length wild-type gene. In this way, recombinants with the chromosomal copies of ispA, ispB, uppS, and metK knocked out could be isolated since the vector copy would provide complementation.
- the genes ispB, uppS, and metK are novel with regard to P. aeruginosa.
- the gene ispB (PA4569, ranging from 5116864 to 5117832 in the genome), has 67% similarity/52% identity to IspB in E. coli, and was assigned to the function class concerned with biosynthesis of cofactors, protein groups and carriers, and energy metabolism, with a confidence level of 2. It is thought to be involved in the pathway of ubiquinone biosynthesis.
- the gene uppS (PA3652, ranging from 4091654 to 4090899), coding for undecaprenyl pyrophosphate synthetase, has 69% similarity/57% identity to the uppS gene in E. coli, and was assigned to the function class involved in biosynthesis of cofactors, protein groups and carriers, cell wall and capsule, with a confidence level of 2. It is separated by one gene (cdsA) from dxr, which is involved in the synthesis of isopentenyl diphosphate, a precursor of undecaprenol phosphate.
- the gene metK (PA0546, ranging from 604896 to 603706) had never been characterized in P. aeruginosa, although it is 82% similar/72% identical to MetK in E. coli.
- the gene encodes methionine adenosyltransferase (adomet synthetase) which is involved specifically in methionine metabolism, and was originally assigned to a function class of amino acid biosynthesis and metabolism and central intermediate metabolism with a confidence level of 2.
- the rr/gene encodes ribosome recycling factor, alternatively known as ribosome releasing factor, assigned to the functional class pertaining to translation, post-translational modification and degradation with a confidence level of 1. Although this gene was previously known in Pseudomonas aeruginosa, confirming the essentiality of known genes using the methods disclosed herein will reveal new utilities for such genes as targets for the identification and design of new antibacterial drugs.
- PA0937 9946842 conserved hypothetical protein iyaiL
- PA1478 9947432 i hypothetical protein pfcyt2 ccmD cycX ie ⁇ D s
- PA 1480 9947434 ⁇ cytochrome C-type biogenesis protein CcmF ccmF cycK; cell
- PA1532 9947490 DNA polymerase subunits gamma and tau dnaX
- PA1581 9947544 succinate dehydrogenase (C subunit) sdhC jcybA
- PA1582 9947545 succinate dehydrogenase (D subunit) sdhD
- PA1583 9947546 succinate dehydrogenase (A subunit) sdhA
- PA1584 9947547 succinate dehydrogenase (B subunit) sdhB
- PA1588 9947552 succinyl-CoA synthetase beta chain sucC
- PA1589 9947553 succinyl-CoA synthetase alpha chain ;sucD
- PA2331 9948366 hypothetical protein __ ,_
- PA2553 9948612 probable acyl-CoA thiolase
- PA2554 9948613 probable short-chain dehydrogenase
- PA2606 9948671 conserved hypothetical protein jyheM
- PA2615 9948681 cell division protein FtsK ftsK
- PA2721 9948797 '.hypothetical protein
- PA3523 9949671 iprobable RND efflux membrane fusion protein; 'PA3528 “" 9949677.
- ribonuclease T Hit ⁇ PA3530 " 9949679 j conserved hypothetica I prote i n_ , bfd •
- PA3550 99497021 alginate o-acetyltransferase AlgF _ algF
- PA3558 99497101 hypothetical protein IPA3566 9949719
- PA4210 9950423 probable phenazine biosynthesis protein rphzA1_ PA4211 " 9950424' probable phenazine biosynthesis protein IphzBI ⁇ PA4212 ' 9950425 i phenazine biosynthesis protein PhzC fphzcT ! PA4215 9950428 iprobable phenazine biosynthesis protein phzF1
- PA5128 9951427isecretion protein SecB secB ' PA5129 " 9951428 iglutaredoxin grx ;PA5130 " 9951429 i conserved hypothetical protein yibN PA5131 " 9951430 iphosphoglycerate mutase ⁇ pgm ,yibO
- PA5347 99516671 hypothetical protein JPA5350 " 9951670 jrubredoxin >PA5351 " 995167l1rubredoxin
- PA5364 9951685iprobable two-component response regulator 'PA5381 " 9951704 'hypothetical protein
- N utilization substance protein A hypothetical protein probable flavin-binding monooxygenase conserved hypothetical protein
- GTP-binding protein Obg ⁇ j probable FAD-depende nt monooxygenase hypothetical protein phenazine biosynthesis protein PhzC probable type II secretion system protein probable MFS transporter conserved hypothetical protein nitrate transporter probable cytochrome b hypothetical protein
- LPS biosynthesis protein WbpG hypothetical protein tRNA methyltransferase probable acyl-CoA dehydrogenase conserved hypothetical protein conserved hypothetical protein still frameshift type 4 fimbrial biogenesis protein PilC cytochrome c oxidase, subunit II conserved hypothetical protein riboflavin-specific deaminase/reductase probable glycosyltransferase WbpH 1 glycine cleavage system protein T2 * muconate cycloisomerase 1 j
- D-lactate dehydrogenase (fermentative) sulfate transport protein CysA probable nucleoside hydrolase pyridoxal phosphate biosynthetic protein PdxA probable transmembrane sensor jDNA polymerase III, deita prime subunit
- L-asparaginase I hypothetical protein probable bacteriophage integrase lipoate synthase hypothetical protein conserved hypothetical protein hypothetical protein probable transcriptional regulator conserved hypothetical protein conserved hypothetical protein delta 2-isopentenylpyrophosphate transferase octaprenyl-diphosphate synthase , hypothetical protein
- FdhE protein j hypothetical protein hypothetical protein conserved hypothetical protein probable ATP-binding component of ABC transporter probable cytochrome c probable transcriptional regulator hypothetical protein probable transcriptional regulator probable permease of ABC transporter hypothetical protein probable transcriptional regulator probable transcriptional regulator probable transcriptional regulator
- GTP-binding protein Era probable transcriptional regulator pyrroloquinoline quinone biosynthesis protein
- B probable cytochrome c oxidase assembly factor hypothetical protein hypothetical protein probable short chain dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein
- UDP-3-O-acyl-N-acetylglucosamine deacetylase probable transcriptional regulator probable transcriptional regulator conserved hypothetical protein probable binding protein component of ABC transporter dTDP-4-dehydrorhamnose reductase conserved hypothetical protein probable transcriptional regulator hypothetical protein_ hypothetical protein probable transcriptional regulator probable transferase probable two-component response regulator probable transcriptional regulator hypothetical protein cysteine synthase B probablejjlycosyj transferase .hypothetical protein
- conserved hypothetical protein iprobable transcriptional regulator lconserved hypothetical protein iprobable exopolysaccharide transporter probable ATP-binding component of ABC transporter hypothetical protein probable short-chain dehydrogenase conserved hypothetical protein
- GTP cyclohydrolase II hypothetical protein heme acquisition protein HasAp probable transcriptional regulator probable peptide chain release factor probable ribosomal protein
- BCCP carboxyl carrier prote n
- DNA-binding protein Fis hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein sarcosine oxidase delta subunit hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein transcriptional regulator PrtN
- NADH dehydrogenase I chain K conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein probable transporter hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein s salicylate biosynthesis protein PchB hypothetical protein conserved hypothetical protein
- Glu-tRNA(Gln) amidotransferase subunit C hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protein integration host factor beta subunit hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein probable DNA binding protein peptidyl-prolyl cis-trans isomerase C2 hypothetical protein hypothetical protein hypothetical protein pyrroloquinoline quinone biosynthesis protein D peptidyl-prolyl cis-trans isomerase C1 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein
- hypothetical protein i hypothetical protein hypothetical protein i probable cold-shock protein 1 cold acclimation protein B s hypothetical protein > conserved hypothetical protein 1 probable transcriptional regulator j probable transcriptional regulator I type III export protein PscE I conserved hypothetical protein j conserved hypothetical protein ( hypothetical protein J conserved hypothetical protein hypothetical protein j conserved hypothetical protein j hypothetical protein ! hypothetical protein j hypothetical protein ; hypothetical protein *
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US37209502P | 2002-04-15 | 2002-04-15 | |
| US372095P | 2002-04-15 | ||
| PCT/US2002/035518 WO2003089572A2 (en) | 2002-04-15 | 2002-11-05 | Essential and important genes of pseudomonas aeroginosa and the use thereof to design or identify antibacterial agents |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1499732A2 true EP1499732A2 (de) | 2005-01-26 |
| EP1499732A4 EP1499732A4 (de) | 2005-11-16 |
Family
ID=30115476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP02807280A Withdrawn EP1499732A4 (de) | 2002-04-15 | 2002-11-05 | Essentielle und wichtige gene von pseudomonas aeruginosa und ihre verwendung zur konstruktion oder identifizierung antibakterieller agentien |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP1499732A4 (de) |
| WO (1) | WO2003089572A2 (de) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101548981B1 (ko) * | 2013-07-30 | 2015-09-02 | 연세대학교 산학협력단 | 녹농균 감염증의 예방 또는 치료용 물질의 스크리닝 방법 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0793370A (ja) * | 1993-09-27 | 1995-04-07 | Hitachi Device Eng Co Ltd | 遺伝子データベース検索システム |
| DE69526377T2 (de) * | 1994-12-09 | 2002-11-07 | Microscience Ltd | Virulenzgene in der VGC2-Region von Salmonella |
| US6037137A (en) * | 1997-02-20 | 2000-03-14 | Oncoimmunin, Inc. | Fluorogenic peptides for the detection of protease activity |
| CA2450658A1 (en) * | 2001-06-15 | 2002-12-27 | Chiron Corporation | Essential and important genes of pseudomonas aeruginosa and the use thereof to design or identify antibacterial agents |
-
2002
- 2002-11-05 EP EP02807280A patent/EP1499732A4/de not_active Withdrawn
- 2002-11-05 WO PCT/US2002/035518 patent/WO2003089572A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2003089572A3 (en) | 2004-01-15 |
| EP1499732A4 (de) | 2005-11-16 |
| WO2003089572A2 (en) | 2003-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8974798B2 (en) | Anti-bacterial vaccine compositions with a mutated yleA gene | |
| JP2011097938A (ja) | 抗菌性ワクチン組成物 | |
| US7629141B2 (en) | Essential and important genes of Pseudomonas aeruginosa and the use thereof to design or identify antibacterial agents | |
| AU2002240033A1 (en) | Anti-bacterial vaccine compositions | |
| US8173363B2 (en) | Random transposon insertion in Staphylococcus aureus and use thereof to identify essential genes | |
| WO2003089572A2 (en) | Essential and important genes of pseudomonas aeroginosa and the use thereof to design or identify antibacterial agents | |
| AU2007242960B2 (en) | Anti-bacterial vaccine compositions | |
| US20070160986A1 (en) | Method for identification of novel virulence associated genes | |
| Buchrieser et al. | What Genomics Has Taught Us about Intracellular Pathogens: the Example of Listeria monocytogenes | |
| Pacheco | Identification of Campylobacter Jejuni Secreted Proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20041108 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20051005 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 07K 14/21 B Ipc: 7G 06F 19/00 B Ipc: 7G 06F 7/00 A |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC. |
|
| 17Q | First examination report despatched |
Effective date: 20080430 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20081111 |