EP1497657A2 - Method for characterizing primary tumors - Google Patents

Method for characterizing primary tumors

Info

Publication number
EP1497657A2
EP1497657A2 EP03725055A EP03725055A EP1497657A2 EP 1497657 A2 EP1497657 A2 EP 1497657A2 EP 03725055 A EP03725055 A EP 03725055A EP 03725055 A EP03725055 A EP 03725055A EP 1497657 A2 EP1497657 A2 EP 1497657A2
Authority
EP
European Patent Office
Prior art keywords
tumor
cells
dna
cell clusters
pbs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03725055A
Other languages
German (de)
French (fr)
Inventor
Burkhard Hermann Brandt
Nicola Tidow
Hartmut Schmidt
Axel Semjonow
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of EP1497657A2 publication Critical patent/EP1497657A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a method for characterizing primary tumors or individual areas thereof from peripheral blood. Such methods are required to make an assessment of the degree of malignancy, the invasiveness or the metastasis potential of primary tumors.
  • Such methods are required for all types of tumors, in particular for breast cancers, ovarian cancers, colon cancers, gastric cancers, prostate cancers and bladder cancers.
  • Prostate cancer is one of the most common causes of malignant death in the western world.
  • Three types of prostate carcinoma can be derived according to prognostic criteria: (1) the small painless carcinoma, which does not grow into a clinically conspicuous or metastatic carcinoma during the patient's life span; (2) the slowly growing carcinoma, which is regionally lymphatic at the beginning and only late in the Skeleton metastasized; (3) early metastatic carcinoma, which affects the entire prostate diffusely and metastasizes directly into the skeleton.
  • curative therapy is only possible for early, ie organ-limited tumor stages. Radical prostatectomy or radiation treatment are available for this. However, the optimal type of treatment is still under discussion.
  • prostate carcinomas removed by radical prostatectomy show characteristics similar to those found in asymptomatic autopsy and appear to be relatively benign, ie organ-limited and well differentiated with a small tumor volume. Although the natural course of these cancers is not yet well known, it is believed that these cancers may not require treatment. However, about half of all prostate preparations after radical prostatectomy show a higher proportion of poorly differentiated life-threatening carcinomas than could be predicted from the preoperative biopsies. This illustrates the poor predictability of the degree of malignancy, so that the active treatment of clinically classified as insignificant carcinomas might be the right decision. There are no parameters to distinguish between potentially life-threatening prostate carcinomas and those with a relatively benign or even asymptomatic course before treatment.
  • the clinically established tumor marker PSA has also not proven to be a metastatic marker. (Jhaveri et al. Urology 1999 Nov.; 54 (5): 884-90; Pound et al. JAMA 1999 May 5; 281 (17) .1591-7; Wolff et al. Eur Urol 1998; 33 (4): 376-81). Another serum parameter is now available with the free PSA. However, this did not improve patient staging (Lin et al. Urology 1998 Sep; 52 (3): 366-71). RT-PCR to determine PSA mRNA has become the most widely used method for the detection of circulating prostate cancer cells.
  • PSMA prostate-specific membrane antigen
  • PSM prostate-specific membrane antigen
  • a complementary parameter for the detection of PSA mRNA could be the determination of the mRNA of human glandular kallikrein (hK2).
  • the protein is expressed specifically for the prostate and has a structural homology of 80% with the PSA.
  • a third of the PSA-positive patients were also positive for hK2, while in 50% of the hK2-positive samples the PSA-RT-PCR was negative (Corey et al., Urology 50, 184-188, 1997 ).
  • the present invention has the object to provide a method for the characterization of primary tumors or individual areas of primary tumors, with which a reliable staging and a reliable prognosis of the tumors can be determined.
  • the method according to the invention is advantageously based on the analysis of short, simple, repetitive sequences, the DNA, in particular but not exclusively so-called microsatellite DNA.
  • Tumors can be characterized as to whether they are proliferative, non-proliferative or apoptotic.
  • the degree of malignancy, the invasiveness, for example with regard to organ overshoot, and metastasis can be determined on the basis of the method according to the invention by genotyping cells from cell clusters.
  • tumor cells isolated from blood samples can be assigned to individual areas of a multifocal tumor, i.e. their clonality will be determined. Such a grading enables the prognosis to be assessed and the primary tumors to be finely classified.
  • micro-satellites which is stated in claim 4, has proven to be particularly advantageous are.
  • a multiplex PCR was developed for amplifying the DNA, as specified in claim 6, the selection of the microsatellites and the primers for the multiplex PCR, as specified in claim 8, in particular causing the microsatellites of each multiplex PCR extracts are distributed over as many chromosomes as possible and the amount of amplified fragments differs between the individual microsatellites in such a way that separation, for example by means of subsequent capillary electrophoresis, is possible without problems.
  • the PCR can be separated and evaluated, for example, on an automated system, such as the ABI Prism 310 Genetic Analyzer TM. Reproducible amplification patterns are possible in a concentration range from 100 ng down to 1 ng of used DNA.
  • the investigated genomic alterations of the microsatellite DNA concern the so-called LOH value (loss of heterozygosity) and the RER value (replication error).
  • LOH Score peak area allele 2 tumor x peak area allele 1 normal tissue / peak area allele 1 tumor x peak area allele 2 normal tissue used.
  • the formula is based on test results that were determined using an analog genetic analysis system. The ratio of the peak areas of the alleles in one run is included in the calculation. Table 1 shows, using the example of the marker D13S153, that the quotients of the peak areas with a low coefficient of variation can be determined.
  • the multiplex PCR protocols according to the invention thus allow a reproducible and sensitive determination of an LOH. are.
  • a multiplex PCR was developed for amplifying the DNA, as specified in claim 6, the selection of the microsatellites and the primers for the multiplex PCR, as specified in claim 8, in particular causing the microsatellites of each multiplex PCR extracts are distributed over as many chromosomes as possible and the amount of amplified fragments differs between the individual microsatellites in such a way that separation, for example by means of subsequent capillary electrophoresis, is possible without problems.
  • the PCR can be separated and evaluated, for example, on an automated system, such as the ABI Prism 310 Genetic Analyzer TM. Reproducible amplification patterns are possible in a concentration range from 100 ng down to 1 ng of used DNA.
  • the investigated genomic alterations of the microsatellite DNA concern the so-called LOH value (loss of heterozygosity) and the RER value (replication error).
  • LOH Score peak area allele 2 tumor x peak area allele 1 normal tissue / peak area allele 1 tumor x peak area allele 2 normal tissue used.
  • the formula is based on test results that were determined using an analog genetic analysis system. The ratio of the peak areas of the alleles in one run is included in the calculation.
  • Table 1 shows, using the example of the marker D13S153, that the quotients of the peak areas can be determined with a low coefficient of variation. The multiplex PCR protocols according to the invention thus allow a reproducible and sensitive determination of an LOH.
  • Table 1 Comparison of the quotients for alleles 1 and 2 in MCF-7 cells
  • the length of the fragments is also included in the calculation of a "replication error" (RER) using a factor which represents the center of gravity of the peak distribution.
  • RER replication error
  • the lower detection limit for multiplex PCR with three primer pairs was determined both on DNA from the cell lines SK-BR-3 and LNCaP and on patient DNA (comparison of tumor DNA and leukocyte DNA).
  • a reproducible band pattern was achieved for all polymorphic markers up to a concentration of> 1 ng DNA. This corresponds to a number of approximately 50 cells.
  • the tumor cells to be examined are advantageously isolated or enriched from a sample, for example a blood sample, in which epithelial cells are first enriched by means of density gradient centrifugation and then immunomagnetic isolation or enrichment of cytokeratin-positive and / or PSA- positive cell cluster is carried out. Magnetic beads are used for this purpose, to which corresponding antibodies are bound.
  • the density gradient centrifugation is advantageously carried out as in Brandt and Griwatz, Clin. Chem. 42, No. 11 1996, pp. 1881-1882. This publication is hereby incorporated into the present application with regard to its entire disclosure content.
  • the immunomagnetic cell isolation is advantageously carried out as in Griwatz et al. , J. Immunol. Meth.
  • the following antibodies were also used as primary antibodies: rabbit-mouse anti-PSA, mouse anti-cytokeratin biotinylated, mouse anti-cFas, mouse anti-M30, mouse anti-Mibl and mouse anti-Hl / H3 histone proteins and as Secondary antibodies the following antibodies: anti-rabbit and anti-mouse marked with Alexa-488 and -594 or FITC, Cy5, Cy3, RPE.
  • cells isolated by this method are predominantly cell clusters that are positive for the detection of PSA and cytokeratin. All patients with prostate cancer had such cell clusters, while the control samples for the detection of such cells were negative.
  • the size of the clusters ranges from 2 to 70 cells, with the number 10
  • the heap in 20 ml of peripheral blood was between 1 and 5400. However, about 90% of the patients have more than 100 cells (and the detection limit is therefore exceeded).
  • two classes of cell clusters could be distinguished based on the cell morphology and the nuclear staining. Heaps of dysmorphic cells were found in large numbers. In some cases, small round nucleated cells were included. In addition, 25 of the 74 patients with prostate cancer examined had clusters that consisted only of small, round and nucleated cells with a diameter of approx. 5 to 7 ⁇ m. Most of the patients (approx. 60%) had fewer than 10 such cell clusters in 20 ml of blood. In three cases, however, up to 200 such cell clusters were detectable.
  • Both groups of cell clusters differ in their detection of the apoptosis markers c-Fas and M30, as well as the proliferation markers Mib-1 and H1 / H3.
  • the dysmorphic cell clusters were positive for the cFas and M30 markers, while the group of small, round, nucleated cell clusters was negative.
  • FIG. 1 shows in partial image A the cell diameter before the cells were suspended by suspension in a hyperosmolar buffer for density gradient centrifugation. The cell diameter averages 8.02 ⁇ m.
  • FIG. 2B shows the cell diameter after being taken up in a hyperosmolar buffer such as Nycoprep or Polymorphprep. The average diameter decreased to 4.97 ⁇ m.
  • cell isolation is given as an example for different cell and tumor types.
  • Cell suspensions of the tumor are prepared as described in the procedure in V.
  • a cell suspension isolated from a breast or ovarian carcinoma as described under V. is incubated for 10 min at room temperature (RT) in PABB buffer (saturates binding sites),
  • fractions are centrifuged off and resuspended in 1% PBS / BSA
  • centrifuge epifuge, 10 min, 1500 rpm, discard supernatant, ice compartment (- 20 ° C)
  • immunomagnetic beads e.g. MACS Bead ® anti-mouse AK or, for example, also anti-rabbit, 16
  • PABB 5 ml AB serum 10% (v / v) + 50 ⁇ l BSA-C 0.1% (v / v) + 45 ml PBS
  • the ratio of tumor cells / monocytes in the first positive fraction (+) is significantly shifted, often only single monocytes are found and thus a high degree of purity of the tumor cells.
  • PBS / BSA 1 g BSA (Bovine Albumine) / 100 ml PBS
  • Antibody mouse anti-cytokeratin antibody working concentration 1:50 (in PABB) (C7, C20 or PAN) secondary antibody: anti-mouse Alexa 594 antibody working concentration 1: 100 (in PABB) isotype control in 10% AB- serum
  • Antibody Anti-PSA antibody working concentration 1:50 (in PABB) secondary antibody: Anti-Rabbit Alexa 488 antibody working concentration 1: 100 (in PABB)
  • Invasion medium (Dulbecco's Modified Eagle Medium) 1% (v / v) 2 mM L-glutamine
  • Tissue pieces from freshly operated breast carcinomas, benign breast diseases or prostate carcinomas are placed in sterile tubes with standard medium by the surgeon and placed on ice until disaggregation (at the latest 4 hours after removal). Approximately half of each piece of tissue is removed for later expression analysis and preserved in liquid nitrogen. The other half is disaggregated using a mechanical method. A medimachine (company Dako, Hamburg) is used for this. For disaggregation, the breast tissue is cut into 3 to 10 mm 2 pieces with a scalpel and placed in a Medicon together with 1.5 ml of invasive medium. The tissue is then aggregated within 2 to 3 minutes within the medimachine to form a cell suspension which contains single cells and cell aggregates (cell clusters) of up to approx. 30 cells.
  • the cells are counted microscopically in a Neubauer counting chamber and the number of living cells is determined using the trypan blue exclusion test, which is based on the fact that certain dyes (e.g. trypan blue) cannot enter the cell interior of living cells, while dead cells deal with the relevant dye stain (Kaltenbach et al., 1958; Lindl and Bauer, 1994).
  • the isolated cell clusters are genotyped for the purpose of their assignment to areas in the primary tumor by means of PCR.
  • the PSA and cytokeratin positive tumor cells and tumor cell clusters and non-positive monocytes as a negative control (or reference for the LOH calculation) are microdissected with a sterile fine needle and placed in 1.5 ml sterile reaction vessels (Eppendorf Biopure) transferred.
  • Eppendorf Biopure 1.5 ml sterile reaction vessels
  • the cells are taken up in 10-200 ⁇ l LTE buffer (10 mM Tris / HCl, 1 mM EDTA, pH 7.5) and with 1-20 ⁇ l proteinase K (> 600mAU / ml ) incubated in a thermoblock or water bath at 50-56 ° C for 1-10 h and then placed on ice for 5 min. The samples are then centrifuged for 1 min at 10,000 rpm. The samples are then adjusted to a 70% solution with 99.8% ethanol pa (Roth). After briefly vortexing, the samples are centrifuged off at 15,000 rpm for 20 min, the supernatant is discarded and the DNA pellet is dried at room temperature. The DNA is then resuspended in 10-200 ⁇ l LTE buffer or double distilled water, incubated at room temperature for 1 h (rehydration) and frozen at -20 ° C. until the PCR is carried out. 28
  • DNA isolation from fresh and formalin-fixed or paraffin-embedded tissue from the primary tumors of one or more foci is carried out according to the protocols of the commercially available QIAmp DNA Mini Kit (from Qiagen, Hilden) or a comparable system from other manufacturers.
  • This kit contains QlAamp DNA Mini Spin Columns (columns), Proteinase K for the proteolytic digestion of the tissue, the lysis buffers AL and ATL, the ethanol-containing washing buffers AW1 and AW2 and the elution buffer AE.
  • Fresh tissue from a primary tumor is mechanically disrupted with a scalpel or tissue shredding machines (e.g. medomachine, DACO) provided for this purpose before tissue lysis.
  • a scalpel or tissue shredding machines e.g. medomachine, DACO
  • tissue sections embedded in paraffin dewaxing with 100% xylene is carried out before the actual DNA isolation.
  • the samples are first incubated in 1 ml xylene in 1.5 ml Eppendorf reaction vessels in a commercially available thermoblock at 70 ° C for 1 h. The supernatant was then centrifuged for 3 minutes and the process repeated twice. The tissue is then washed three times with 99.8% ethanol (Roth), then dried and transferred to the lysis buffer. The isolation is then carried out according to the manufacturer's protocols.
  • DNA isolation from EDTA-anticoagulated whole blood is carried out with the QIAmp DNA Blood Mini Kit (Qiagen, Hilden) according to the known protocols or comparable methods from other manufacturers.
  • the whole blood is incubated for 10 min with buffer AL and proteinase K to lyse the cells at 54 ° C in a thermoblock, then mixed with ethanol and the mixture is added to the column (QIAmp DNA Mini Spin Columns). The samples are washed with AW1 and then with AW2 and eluted with the elution buffer AE.
  • Solutions are measured photometrically at 260, 280 and 320 nm, adjusted to 10 ng / ⁇ l and frozen at -20 ° C.
  • the PSA- and cytokeratin-positive tumor cells and tumor cell clusters are microdissected with a sterile fine needle on an inverse light microscope (Leitz Diavert) and transferred to a 1.5 ml sterile reaction vessel (Eppendorf Biopure).
  • the RNA isolation is carried out strictly according to the protocols of the RNeasy Purification Kit for total RNA minipreparation (Qiagen, Hilden), consisting of: RNeasy Mini Spin Colums, Collection tubes 1.5 and 2 ml, buffer RTL, buffer RWI, buffer RPE and RNase-free water).
  • carcinoma-specific genetic changes and mRNA expressions by means of microsatellite PCR, multiplex microsatellite PCR and TaqMan TM RT-PCR is now described below by way of example.
  • a total of three multiplex PCRs are used, which consist of microsatellite combinations No. 1: D7S522 D8S258, D16S400, No. 2: NEFL, D13S153, D17S855 and No. 3 D10S541, D16S402, D16S422.
  • the principle of these PCRs is based on the co-amplification of different DNA sections in one reaction vessel.
  • the primer sequences were set in such a way that there was no overlap in the lengths of the amplification products in the capillary electrophoretic separation. All primers are labeled with fluorescent dyes that are excited at 488 nm (see Table 3). All other commercially available fluorescent labels can also be used. Furthermore 30
  • All PCRs can be in commercially available 0.2 ml or 0.5 ml reaction tubes or in 96-well plates from different manufacturers (e.g. Eppendorf, Hamburg) on an Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg), a Gene AmpR PCR System 9700 (PE Applied Biosystems, Rothstadt) or a commercially available, comparable thermal cycler from other manufacturers.
  • the reaction volume can be 12 ⁇ l to 100 ⁇ l.
  • the PCR reaction mixture consists of 5U / 100 ⁇ l AmpliTaq Gold TM or a qualitatively comparable polymerase and (hot start polymerases have proven successful) 1 x GeneAmp R dNTP, 2mM MgCl 2 , 30pm from each primer, 200 ⁇ M GeneAmp R buffer (all reagents from PE Applied Biosystems, Rothstadt) and 500 pg to 200 ng genomic DNA. The following temperature gradients are run for the PCR.
  • microsatellite analysis is carried out on the capillary electrophoresis devices (four color laser-induced fluorescence capillary electrophoresis system) ABI Prism 310 gene 31
  • the polymers POP4, POP5 and POP6 are used as separation medium and are suitable for the corresponding devices.
  • the length standard used is Genescan-500TM TAMRA 500 or a comparable length standard that is suitable for the capillary electrophoresis devices mentioned. The analysis and evaluation was carried out with the Genescan software.
  • Vials 0.2 ml vials from any manufacturer, suitable for PCR machines 32
  • the PSA- and cytokeratin-positive tumor cells and tumor cell clusters are microdissected with a sterile fine needle on an inverted light microscope (Leitz Diavert) and transferred to a 1.5 ml sterile reaction vessel (Eppendorf Biopure).
  • the RNA isolation is carried out strictly according to the protocols of the RNeasy purification kit for total RNA minipreparation (from Qiagen, Hilden), consisting of: RNeasy Mini Spin Colums, Collection tubes 1.5 and 2 ml, buffer RTL, buffer RW1, buffer RPE and RNase-free water).
  • the RNA is transcribed into cDNA in a two-tube reaction.
  • the reaction volume is 20 ⁇ l.
  • the reaction mixture consists of RT 1 x buffer, dNTPs (0.5 mM each) 1 ⁇ M oligo-dT primer, 10 units RNase inhibitor, 4 units Omniscript Reverse Transcriptase and RNase-free water.
  • dNTPs 0.5 mM each
  • RNase inhibitor 10 units
  • Omniscript Reverse Transcriptase 4 units
  • RNase-free water for the RT-PCR, the RNA samples are first denatured at 65 ° C for 5 min and then placed on ice.
  • RT-PCR can be performed on an Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg), a Gene Amp R PCR System 9700 (PE Applied Biosystems) or a commercially available, comparable thermal cycler from other manufacturers.
  • the PCR consists of a 37 ° C incubation step for 60 min followed by a 93 ° C denaturation step.
  • the RNA isolations and the RT-PCR can furthermore be carried out using all commercially available methods which are suitable for small amounts of tissue, e.g. the ExpressDirect TM Kit For mRNA Capture And RT System For RT-PCR (Pierce Rockford).
  • Real-time PCR can be performed on an ABI Prism 9700 HT Sequence Detection System (PE Applied Biosystems, Rothstadt) in 96 or 384 well plates, sealed with an optically transparent film (ABI PRISM TM optical adhesive 36
  • the reactions are usually carried out in double or triple determinations according to the regulations for TaqMan PCR according to PE Applied Biosystems (Weiterstadt).
  • the reaction mixture consists of a TaqMan R Universal PCR Master Mix, plus each
  • the temperature gradient consists of an initial 50 ° C incubation step for 2 min followed by a 95 ° C denaturation step for 10 min; 40-60 cycles are then run, which consist of a 95 ° C denaturation step for 15 seconds and a 60 ° C amplification step for 1 minute.
  • the run and the evaluation took place with the SDS software (PE Applied Biosystems, Rothstadt). Primer and TaqMan probe as well as the TaqMan mastermix can be used by different providers.
  • RNA was isolated from cells of an LNCaP cell culture that is known to express PSA. Lymphocytes from women serve as a negative control.
  • the microscopic marker in the DNA of PSA-positive epithelial cells isolated from peripheral blood and from individual foci of the primary tumor was determined using the described method.
  • the microsatellite markers were determined according to the protocol as described under 4. from DNA, which was obtained according to protocols 1 and 2.
  • the prostate preparations were isolated before DNA isolation according to the Schmid et al. (Schmid HP et 37
  • the method described in large area sections at a distance of 3 to 4 mm was systematically processed and a detailed cartographic recording of the carcinoma extension was created.
  • the tumor size, the position of the tumor in relation to the pseudocapsule of the prostate (infiltration or penetration of the capsule) and the reaching or exceeding of the surgical margins in the carcinoma were documented. Histologically confirmed tumor tissue was then obtained from the paraffin-embedded material of the primary tumor. 7 shows a so-called tumor map in which the removal sites are marked.
  • Table 5 Comparison of the genetic alterations between different foci of a primary tumor and the circulating tumor cell clusters isolated from blood
  • FIG. 5 The cluster with the marker D10S541, which is associated with early metastasis, is also preferably found in the cell clusters of the blood. In contrast, changes in the marker D8S258 prevent the cells from being sown into the peripheral blood (FIG. 6). The evaluation of the disease-free interval shows that a change in this polymorphic DNA marker is associated with a good prognosis (FIG. 6).
  • PCa prostate cancer
  • BPH benign prostate tissue

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for identifying and characterizing primary tumors or individual areas of primary tumors, according to which cell clusters of tumor cells, which are contained in sample material, are isolated or enriched, whereupon genetic modifications of the isolated cell clusters are analyzed.

Description

Verfahren zur Charakterisierung von Primärtumoren Methods for characterizing primary tumors
Die vorliegende Erfindung bezieht sich auf ein Verfahren zur Charakterisierung von Primärtumoren bzw. einzelnen Bereichen hiervon aus dem peripheren Blut. Derartige Verfahren werden benötigt, um eine Einschätzung des Maligni- tätsgrades, der Invasivität bzw. des Metastasierungspo- tentials von Primärtumoren zu erstellen.The present invention relates to a method for characterizing primary tumors or individual areas thereof from peripheral blood. Such methods are required to make an assessment of the degree of malignancy, the invasiveness or the metastasis potential of primary tumors.
Derartige Verfahren werden für alle Arten von Tumoren, insbesondere für Mammakarzinome, Ovarialkarzinome, Kolonkarzinome, Magenkarzinome, Prostatakarzinome und Blasenkarzinome benötigt .Such methods are required for all types of tumors, in particular for breast cancers, ovarian cancers, colon cancers, gastric cancers, prostate cancers and bladder cancers.
Das Prostatakarzinom (PCa) ist eines der häufigsten ma- lignombedingten Todesursachen in der westlichen Welt. Nach prognostischen Kriterien lassen sich drei Typen des Prostatakarzinoms ableiten: (1) das kleine schmerzlose Karzinom, das während der Lebensspanne des Patienten nicht zu einem klinisch auffälligen oder metastasierenden Karzinom heranwächst; (2) das langsam wachsende Karzinom, das zu Beginn regionallymphatisch und erst spät in das Skelett metastasiert ; (3) das früh metastasierende Karzinom, das die ganze Prostata diffus befällt und unmittelbar in das Skelett metastasiert. Derzeit besteht nur für frühe, d.h. noch organbegrenzte Tumorstadien, die Möglichkeit einer kurativen Therapie. Hierfür stehen die radikale Prostatektomie oder Strahlenbehandlung zur Verfügung. Die optimale Behandlungsart ist jedoch noch Gegenstand der Diskussion. Etwa 15% der durch radikale Prostatektomie entfernten Prostatakarzinome zeigen Charake- ristika wie bei asymptomatischen Autopsiebefunden und erscheinen relativ gutartig zu sein, d.h. organbegrenzt und gut differenziert bei kleinem Tumorvolumen. Obwohl der natürliche Verlauf dieser Karzinome noch nicht ausreichend bekannt ist, wird vermutet, daß diese Karzinome möglicherweise keiner Behandlung bedürfen. Etwa die Hälfte aller Prostatapräparate nach radikaler Prostatektomie zeigen jedoch einen höheren Anteil schlecht differenzierter lebensbedrohlicher Karzinome als dies an Hand der präoperativen Biopsien vorhersagbar wäre. Dies verdeutlicht damit die schlechte Vorhersagbarkeit des Maligni- tätsgrades, so daß die aktive Behandlung von klinisch als unbedeutend eingestuften Karzinomen möglicherweise doch die richtige Entscheidung sein könnte. Es fehlen Parameter, um vor einer Behandlung zwischen potentiell lebensgefährdenden Prostatakarzinomen und solchen mit relativ gutartigem oder sogar asymptomatischem Verlauf unterscheiden zu können.Prostate cancer (PCa) is one of the most common causes of malignant death in the western world. Three types of prostate carcinoma can be derived according to prognostic criteria: (1) the small painless carcinoma, which does not grow into a clinically conspicuous or metastatic carcinoma during the patient's life span; (2) the slowly growing carcinoma, which is regionally lymphatic at the beginning and only late in the Skeleton metastasized; (3) early metastatic carcinoma, which affects the entire prostate diffusely and metastasizes directly into the skeleton. At present, curative therapy is only possible for early, ie organ-limited tumor stages. Radical prostatectomy or radiation treatment are available for this. However, the optimal type of treatment is still under discussion. About 15% of prostate carcinomas removed by radical prostatectomy show characteristics similar to those found in asymptomatic autopsy and appear to be relatively benign, ie organ-limited and well differentiated with a small tumor volume. Although the natural course of these cancers is not yet well known, it is believed that these cancers may not require treatment. However, about half of all prostate preparations after radical prostatectomy show a higher proportion of poorly differentiated life-threatening carcinomas than could be predicted from the preoperative biopsies. This illustrates the poor predictability of the degree of malignancy, so that the active treatment of clinically classified as insignificant carcinomas might be the right decision. There are no parameters to distinguish between potentially life-threatening prostate carcinomas and those with a relatively benign or even asymptomatic course before treatment.
Auch der klinisch etablierte Tumormarker PSA hat sich nicht als Metastasierungsmarker erwiesen. (Jhaveri et al . Urology 1999 Nov. ; 54 (5) : 884-90 ; Pound et al . JAMA 1999 May 5;281(17) .1591-7; Wolff et al . Eur Urol 1998;33(4) :376-81) . Inzwischen ist mit dem freien PSA ein weiterer Serumparameter verfügbar. Eine Verbesserung des Stagings der Patienten konnte damit jedoch nicht erzielt werden (Lin et al . Urology 1998 Sep; 52 (3) : 366-71) . Die RT-PCR zur Bestimmung der PSA mRNA ist inzwischen die am meisten verbreitete Methode zum Nachweis zirkulierender Prostatakarzinomzellen. Erste klinische Studien ergaben eine höhere diagnostische Sensitivität und Spezifität für das präoperative Staging mit Hilfe der PSA-RT-PCR im Vergleich zu bildgebenden Verfahren, PSA im Serum und hi- stologischer Klassifikation (Katz et al . , Cancer 75, 1642-1648, 1995) . Die weiteren Studien zeigten, daß der PSA-mRNA-Nachweis bei ca. einem Sechstel der Patienten mit organbegrenztem Tumor (pT2) und etwa einem Viertel der Patienten mit extrakapsulärer Ausbreitung (pT3- Tumoren) positiv ist (Melchior et al . Clin Cancer Res 1997 Feb;3 (2) :249-56) . Allerdings entwickelte nicht jeder Patient mit positivem PSA-mRNA-Nachweis eine progrediente Erkrankung .The clinically established tumor marker PSA has also not proven to be a metastatic marker. (Jhaveri et al. Urology 1999 Nov.; 54 (5): 884-90; Pound et al. JAMA 1999 May 5; 281 (17) .1591-7; Wolff et al. Eur Urol 1998; 33 (4): 376-81). Another serum parameter is now available with the free PSA. However, this did not improve patient staging (Lin et al. Urology 1998 Sep; 52 (3): 366-71). RT-PCR to determine PSA mRNA has become the most widely used method for the detection of circulating prostate cancer cells. Initial clinical studies showed a higher diagnostic sensitivity and specificity for preoperative staging using PSA-RT-PCR in comparison to imaging methods, PSA in serum and histological classification (Katz et al., Cancer 75, 1642-1648, 1995 ). The further studies showed that PSA-mRNA detection is positive in about a sixth of patients with organ-limited tumor (pT2) and about a quarter of patients with extracapsular spread (pT3 tumors) (Melchior et al. Clin Cancer Res 1997) Feb; 3 (2): 249-56). However, not every patient with positive PSA mRNA detection developed a progressive disease.
Einen weiteren möglichen Parameter für das molekulare Staging stellt die mRNA des prostata-spezifische Membranantigen (PSMA oder PSM) dar (Israeli et al . , J Urol . 153, 573-577, 1995 ) . Bei PSA-negativen, anaplastischen Tumoren und Knochenmetastasen konnte eine hohe PSM-Expression nachgewiesen werden. Da die cDNA-Sequenz des PSM bekannt ist, konnten Studien mit der, RT-PCR zum Nachweis zirkulierender PSM positiver Zellen im peripheren Blut durchgeführt werden (Israeli et al . , Cancer Res. 53, 227-230, 1993; Israeli et al . Cancer Res. 54, 1807-1811, 1994b; Israeli et al . , J Urol. 153, 573-577, 1995; Loric et al . bestätigten mittels RT-PCR des PSM, daß eine hämatogene Aussaat von Prostatakarzinomzellen bereits bei lokal begrenzten Tumoren (pT2a und pT2b) stattfindet (Loric et al., Clin. Chem. 41, 1698-1704, 1995). In einigen Studien wurde eine höhere Sensitivität der PSM-RT-PCR gegenüber der PSA-RT-PCR bei prostatektomierten Patienten gefunden (Isreali et al . , Cancer Res. 54, 1807-1811, 1994b. Andere Autoren berichten, daß der Marker bei metastasierenden Prostatakarzinomen weniger sensitiv war (Cama et al . , J Urol. 153, 1373, 1995) und von falsch-positiven Ergebni- sen der PSM-RT-PCR bei gesunden Kontrollpersonen (Lintula et al . , J Urol. 2, 155, 693A, 1996). Die klinische Relevanz auch der PSM-RT-PCR muß deshalb in weiteren Studien geklärt werden.Another possible parameter for molecular staging is the mRNA of the prostate-specific membrane antigen (PSMA or PSM) (Israeli et al., J Urol. 153, 573-577, 1995). A high PSM expression was found in PSA-negative, anaplastic tumors and bone metastases. Since the cDNA sequence of the PSM is known, studies with RT-PCR for the detection of circulating PSM positive cells in peripheral blood could be carried out (Israeli et al., Cancer Res. 53, 227-230, 1993; Israeli et al. Cancer Res. 54, 1807-1811, 1994b; Israeli et al., J Urol. 153, 573-577, 1995; Loric et al. Confirmed by RT-PCR of the PSM that haematogenic sowing of prostate carcinoma cells is already possible in locally limited tumors (pT2a and pT2b) takes place (Loric et al., Clin. Chem. 41, 1698-1704, 1995). In some studies, PSM-RT-PCR was found to be more sensitive than PSA-RT-PCR in prostatectomized patients ( Isreali et al., Cancer Res. 54, 1807-1811, 1994b. Other authors report that the marker was less sensitive to metastatic prostate cancer (Cama et al., J Urol. 153, 1373, 1995) and of false positive results - the PSM-RT-PCR in healthy control persons (Lintula et al. , J Urol. 2, 155, 693A, 1996). The clinical relevance of PSM-RT-PCR must therefore be clarified in further studies.
Ein komplementärer Parameter zum Nachweis der PSA-mRNA könnte die Bestimmung der mRNA des humanen glandulären Kallikrein (hK2) sein. Das Protein wird prostataspezifisch exprimiert und weist zum PSA eine Strukturhomologie von 80% auf. In der Studie von Corey et al . wurde nur bei einem Drittel der PSA-positiven Patienten auch ein positiver Nachweis für hK2 geführt, während bei 50% der für das hK2 positiven Proben die PSA-RT-PCR negativ waren (Corey et al . , Urology 50, 184-188, 1997).A complementary parameter for the detection of PSA mRNA could be the determination of the mRNA of human glandular kallikrein (hK2). The protein is expressed specifically for the prostate and has a structural homology of 80% with the PSA. In the study by Corey et al. only a third of the PSA-positive patients were also positive for hK2, while in 50% of the hK2-positive samples the PSA-RT-PCR was negative (Corey et al., Urology 50, 184-188, 1997 ).
Neben den Problemen, die durch eine illegitime und eine physiologische, aber nicht tumorspezifische, Expression von Genen, entstehen, kann von der biologische Rationale her festgestellt werden, daß der Nachweis zirkulierender Tumorzellen mittels RT-PCR der mRNA von organspezifischen Markern der Prostata keine Aussagen über die Anzahl der Zellen und ihre Fähigkeit zu metastasieren erlaubt. Deshalb ergibt sich die Notwendigkeit, nach weiteren molekularen Markern zu suchen.In addition to the problems caused by illegitimate and physiological, but not tumor-specific, expression of genes, it can be determined from the biological rationale that the detection of circulating tumor cells by means of RT-PCR of the mRNA of organ-specific markers of the prostate does not provide any information about the number of cells and their ability to metastasize allowed. Therefore, there is a need to look for more molecular markers.
Insgesamt fehlen also prognoserelevante Parameter, die präoperativ den Typ des Karzinoms erkennen lassen. Deshalb bleibt die Kontroverse über den Sinn der Frühdiagnostik und den Stellenwert der operativen Therapie des Prostatakarzinoms bestehen. Damit bleibt auch die Frage nach der Fähigkeit der Prostatakarzinomzellen zu metastasieren, denn 20% der Patienten mit organbegrenztem Karzinome und negativem Knochenszintigramm bekommen Metastasen trotz der völligen operativen Entfernung des Primärtumors. Andererseits werden 50% der Patienten mit einem o- perablen Prostatakarzinom voraussichtlich nicht an ihrem Karzinom sterben. Ausgehend von diesem Stand der Technik stellt sich die vorliegende Erfindung die Aufgabe, ein Verfahren zur Charakterisierung von Primärtumoren bzw. einzelner Bereiche von Primartumoren zur Verfügung zu stellen, mit dem ein zuverlässiges Staging und eine zuverlässige Prognose der Tumoren bestimmt werden kann.Overall, therefore, there are no prognostic parameters that indicate the type of carcinoma preoperatively. Therefore, the controversy about the meaning of early diagnosis and the importance of surgical therapy for prostate cancer remains. This also leaves the question of the ability of the prostate carcinoma cells to metastasize, because 20% of patients with organ-limited carcinomas and negative bone scintigrams get metastases despite the complete surgical removal of the primary tumor. On the other hand, 50% of patients with operable prostate cancer are unlikely to die from their cancer. Starting from this prior art, the present invention has the object to provide a method for the characterization of primary tumors or individual areas of primary tumors, with which a reliable staging and a reliable prognosis of the tumors can be determined.
Diese Aufgabe wird durch das Verfahren nach Anspruch 1 und die Verwendungen nach Anspruch 15 gelöst. Vorteilhafte Weiterbildung des erfindungsgemäßen Verfahrens werden in den abhängigen Ansprüchen sowie den auf Verwendungen des erfindungsgemäßen Verfahrens gerichteten Ansprüchen gegeben.This object is achieved by the method according to claim 1 and the uses according to claim 15. Advantageous developments of the method according to the invention are given in the dependent claims and the claims directed to uses of the method according to the invention.
Das vorliegende erfindungsgemäße Verfahren beruht vorteilhafterweise auf der Analyse kurzer einfacher repete- tiver Sequenzen, der DNS, insbesondere aber nicht ausschließlich so genannter Microsatelliten-DNS.The method according to the invention is advantageously based on the analysis of short, simple, repetitive sequences, the DNA, in particular but not exclusively so-called microsatellite DNA.
Es gilt als wissenschaftlich anerkannt, dass die Bildung und Ausbreitung von malignen Tumoren mit einer Akkumulation von multiplen genetischen Veränderungen, die z.B. Gene der Zellzykluskontrolle oder der Zelldifferenzierung betreffen, verbunden ist. Kurze polymorphe DNS-Sequenzen, angefangen bei einer Base Länge, können als empfindliche Marker dieser Veränderungen dienen. Eine sehr gut untersuchte Gruppe dieser polymorphen Sequenzen sind die sogenannten Mikrosatelliten, die aus 10 bis 60 repetetiven Sequenzen von 2 bis 5 Basenpaaren bestehen und eine Länge von < 1 kb haben. Hierzu gibt es eine vielfältige Literatur. Loeb L.A., Cancer Res. 51:3075-3079, 1991; Fearon E.R., Vogelstein B. Cell 61:759-767, 1990; Peltomaki P. et al., Science 260:810-812, 1993; Isaacs, W. B. Carter, B. S. Cancer Survival 11: 15-24, 1991; Kunimi, K. et al . , Genomics, 11: 530-536, 1991; Suzuki, H. ; Komiya, A. ; Aida, S.; Akimoto, S . ; Shiraishi, T.; Yatani, R. ; Igara- shi, T. ; Shimazaki, J. , Cancer Res., 6: 956-61, 1995,; Uchida, T. et al . , Oncogene 10: 1019-1022, 1995; Berthon, P. et al., Br. J. Cancer 72: 946-51, 1995; Carter, B. S. et al., PNAS 87: 8751-5, 1990; Egawa, S. et al . , Cancer Research 55: 2418 - 2421, 1995; MacGrogan, D. et al . , Genes, Chromosomes and Cancer 10: 151-9, 1994; Macoska, J. A. et al . , Cancer Research 54: 3824 - 3830, 1994; Bova, G. S. et al . , Cancer Research 53: 3869 - 3873, 1993; Gao, X. et al . , Cancer Research, 55: 1002 1005, 1995; Macoska J A et al . , Cancer Research 55: 5390 - 5395, 1995; Suzuki H et al . Genes, Chromosomes and Cancer, 13: 168-74, 1995; Trapman J et al . , Cancer Research, 54: 6061 - 6064, 1994; Vocke C D et al,, Cancer Research, 56: 2411 - 2416, 1996; Cheng L et al . , J Nad Cancer Inst 1998 Feb 4 ; 90 (3) : 233-7; Takimoto Y et al . , Cancer 2001 Jan 15;91 (2) :362-70.It is scientifically recognized that the formation and spread of malignant tumors is associated with an accumulation of multiple genetic changes that affect genes of cell cycle control or cell differentiation, for example. Short polymorphic DNA sequences, starting from a base length, can serve as sensitive markers of these changes. A very well investigated group of these polymorphic sequences are the so-called microsatellites, which consist of 10 to 60 repetitive sequences of 2 to 5 base pairs and have a length of <1 kb. There is a wide range of literature on this. Loeb LA, Cancer Res. 51: 3075-3079, 1991; Fearon ER, Vogelstein B. Cell 61: 759-767, 1990; Peltomaki P. et al., Science 260: 810-812, 1993; Isaacs, WB Carter, BS Cancer Survival 11: 15-24, 1991; Kunimi, K. et al. , Genomics, 11: 530-536, 1991; Suzuki, H.; Komiya, A.; Aida, S .; Akimoto, S. ; Shiraishi, T .; Yatani, R.; Igara-shi, T.; Shimazaki, J., Cancer Res., 6: 956-61, 1995; Uchida, T. et al. , Oncogene 10: 1019-1022, 1995; Berthon, P. et al., Br. J. Cancer 72: 946-51, 1995; Carter, BS et al., PNAS 87: 8751-5, 1990; Egawa, S. et al. , Cancer Research 55: 2418-2421, 1995; MacGrogan, D. et al. , Genes, Chromosomes and Cancer 10: 151-9, 1994; Macoska, JA et al. , Cancer Research 54: 3824-3830, 1994; Bova, GS et al. , Cancer Research 53: 3869-3873, 1993; Gao, X. et al. , Cancer Research, 55: 1002 1005, 1995; Macoska JA et al. , Cancer Research 55: 5390-5395, 1995; Suzuki H et al. Genes, Chromosomes and Cancer, 13: 168-74, 1995; Trapman J et al. , Cancer Research, 54: 6061-6064, 1994; Vocke CD et al, Cancer Research, 56: 2411-2416, 1996; Cheng L et al. , J Nad Cancer Inst 1998 Feb 4; 90 (3): 233-7; Takimoto Y et al. , Cancer 2001 Jan 15; 91 (2): 362-70.
Erfindungsgemäß werden nun Alterationen derartiger Mikro- satelliten-DNS untersucht und so unter Zuhilfenahme der Darstellung genetischer Veränderungen ein Nachweis, eine Charakterisierung, Quantifizierung und eine Prognoseabschätzung für Tumoren durchgeführt. Dabei können Tumoren dahingehend charakterisiert werden, ob sie proliferativ, nicht-proliferativ oder apoptotisch sind. Der Maligni- tätsgrad, die Invasivität, beispielsweise bezüglich Organüberschreitung, und Metastasierung können aufgrund des erfindungsgemäßen Verfahrens durch die Genotypisierung von Zellen aus Zellhaufen bestimmt werden. Insbesondere können beispielsweise aus Blutproben isolierte Tumorzellen einzelnen Bereichen eines multifokalen Tumors zugeordnet werden, d.h. ihre Klonalität bestimmt werden. Über ein derartiges Grading ist eine Prognoseeinschätzung und eine Feinklassifizierung der Primärtumoren möglich.According to the invention, alterations of such microsatellite DNA are now being investigated and, with the aid of the representation of genetic changes, detection, characterization, quantification and prognosis estimation for tumors are carried out. Tumors can be characterized as to whether they are proliferative, non-proliferative or apoptotic. The degree of malignancy, the invasiveness, for example with regard to organ overshoot, and metastasis can be determined on the basis of the method according to the invention by genotyping cells from cell clusters. In particular, for example, tumor cells isolated from blood samples can be assigned to individual areas of a multifocal tumor, i.e. their clonality will be determined. Such a grading enables the prognosis to be assessed and the primary tumors to be finely classified.
Dies ist insbesondere möglich, wenn Zellhaufen von Tumorzellen aus Blutproben, Nippleaspiratflüssigkeit der weiblichen Brust, Urin- oder Gewebeproben isoliert werden.This is particularly possible if cell clusters of tumor cells are isolated from blood samples, nipple aspirate fluid from the female breast, urine or tissue samples.
Als besonders vorteilhaft hat sich die Analyse der Mikro- satelliten herausgestellt, die im Anspruch 4 angegeben sind. Für einige dieser Mikrosatelliten wurden wie in Anspruch 6 angegeben, eine Multiplex-PCR zur Amplifikation der DNS entwickelt, wobei insbesondere durch die Auswahl der Mikrosatelliten und der wie in Anspruch 8 angegebenen Primer für die Multiplex-PCR bewirkt wird, daß die Mikrosatelliten jedes Multiplex-PCR-Ausatzes über möglichst viele Chromosomen verteilt sind und die Menge der ampli- fizierten Fragmente sich zwischen den einzelnen Mikrosatelliten derart unterscheiden, daß eine Auftrennung, beispielsweise mittels anschließender Kapillarelektrophorese, problemlos möglich ist.The analysis of the micro-satellites, which is stated in claim 4, has proven to be particularly advantageous are. For some of these microsatellites, a multiplex PCR was developed for amplifying the DNA, as specified in claim 6, the selection of the microsatellites and the primers for the multiplex PCR, as specified in claim 8, in particular causing the microsatellites of each multiplex PCR extracts are distributed over as many chromosomes as possible and the amount of amplified fragments differs between the individual microsatellites in such a way that separation, for example by means of subsequent capillary electrophoresis, is possible without problems.
Die Trennung und Auswertung der PCR kann beispielsweise auf einem automatisierten System, wie beispielsweise dem ABI Prism 310 Genetic Analyzer™ erfolgen. Reproduzierbare Amplifikationsmuster sind dabei in einem Konzentrati- onsbereich von 100 ng bis herab zu 1 ng eingesetzter DNS möglich. Die untersuchten genomischen Alterationen der Mikrosatelliten-DNS betreffen zum einen den sogenannten LOH-Wert (Loss Of Heterozygosity) und zum anderen den RER-Wert (Replikationsfehler) .The PCR can be separated and evaluated, for example, on an automated system, such as the ABI Prism 310 Genetic Analyzer ™. Reproducible amplification patterns are possible in a concentration range from 100 ng down to 1 ng of used DNA. The investigated genomic alterations of the microsatellite DNA concern the so-called LOH value (loss of heterozygosity) and the RER value (replication error).
Für die Berechnung des Loss of Heterozygosity (LOH) wird die publizierte Formel Canzian et al . Cancer Res 1996 Jul 15;56(14) :3331-7To calculate the loss of heterozygosity (LOH), the published formula Canzian et al. Cancer Res 1996 Jul 15; 56 (14): 3331-7
LOH Score = Peakfläche Allel 2 Tumor x Peakfläche Allel 1 Normalgewebe / Peakfläche Allel 1 tumor x Peakfläche Allel 2 Normalgewebe verwendet. Die Formel basiert auf Untersuchungsergebnissen, die mit einem analogen genetischen Analysesystem ermittelt wurden. In die Berechnung geht das Verhältnis der Peakflachen der Allele in einem Lauf ein. In Tabelle 1 ist am Beispiele des Markers D13S153 gezeigt, daß die Quotienten der Peakflächen mit niedrigem Variationskoeff- zienten bestimmbar sind. Damit erlauben die erfindungsgemäßen Multiplex-PCR-Protokolle eine reproduzierbare und sensitve Bestimmung eines LOHs . sind. Für einige dieser Mikrosatelliten wurden wie in Anspruch 6 angegeben, eine Multiplex-PCR zur Amplifikation der DNS entwickelt, wobei insbesondere durch die Auswahl der Mikrosatelliten und der wie in Anspruch 8 angegebenen Primer für die Multiplex-PCR bewirkt wird, daß die Mikrosatelliten jedes Multiplex-PCR-Ausatzes über möglichst viele Chromosomen verteilt sind und die Menge der ampli- fizierten Fragmente sich zwischen den einzelnen Mikrosatelliten derart unterscheiden, daß eine Auftrennung, beispielsweise mittels anschließender Kapillarelektrophorese, problemlos möglich ist.LOH Score = peak area allele 2 tumor x peak area allele 1 normal tissue / peak area allele 1 tumor x peak area allele 2 normal tissue used. The formula is based on test results that were determined using an analog genetic analysis system. The ratio of the peak areas of the alleles in one run is included in the calculation. Table 1 shows, using the example of the marker D13S153, that the quotients of the peak areas with a low coefficient of variation can be determined. The multiplex PCR protocols according to the invention thus allow a reproducible and sensitive determination of an LOH. are. For some of these microsatellites, a multiplex PCR was developed for amplifying the DNA, as specified in claim 6, the selection of the microsatellites and the primers for the multiplex PCR, as specified in claim 8, in particular causing the microsatellites of each multiplex PCR extracts are distributed over as many chromosomes as possible and the amount of amplified fragments differs between the individual microsatellites in such a way that separation, for example by means of subsequent capillary electrophoresis, is possible without problems.
Die Trennung und Auswertung der PCR kann beispielsweise auf einem automatisierten System, wie beispielsweise dem ABI Prism 310 Genetic Analyzer™ erfolgen. Reproduzierbare Amplifikationsmuster sind dabei in einem Konzentrationsbereich von 100 ng bis herab zu 1 ng eingesetzter DNS möglich. Die untersuchten genomischen Alterationen der Mikrosatelliten-DNS betreffen zum einen den sogenannten LOH-Wert (Loss Of Heterozygosity) und zum anderen den RER-Wert (Replikationsfehler) .The PCR can be separated and evaluated, for example, on an automated system, such as the ABI Prism 310 Genetic Analyzer ™. Reproducible amplification patterns are possible in a concentration range from 100 ng down to 1 ng of used DNA. The investigated genomic alterations of the microsatellite DNA concern the so-called LOH value (loss of heterozygosity) and the RER value (replication error).
Für die Berechnung des Loss of Heterozygosity (LOH) wird die publizierte Formel Canzian et al . Cancer Res 1996 Jul 15;56(14) :3331-7To calculate the loss of heterozygosity (LOH), the published formula Canzian et al. Cancer Res 1996 Jul 15; 56 (14): 3331-7
LOH Score = Peakfläche Allel 2 Tumor x Peakfläche Allel 1 Normalgewebe / Peakfläche Allel 1 tumor x Peakfläche Allel 2 Normalgewebe verwendet. Die Formel basiert auf Untersuchungsergebnissen, die mit einem analogen genetischen Analysesystem ermittelt wurden. In die Berechnung geht das Verhältnis der Peakflachen der Allele in einem Lauf ein. In Tabelle 1 ist am Beispiele des Markers D13S153 gezeigt, daß die Quotienten der Peakflachen mit niedrigem Variationskoeff- zienten bestimmbar sind. Damit erlauben die erfindungsgemäßen Multiplex-PCR-Protokolle eine reproduzierbare und sensitve Bestimmung eines LOHs . Tabelle 1: Vergleich der Quotienten für die Allele 1 und 2 bei MCF-7-ZellenLOH Score = peak area allele 2 tumor x peak area allele 1 normal tissue / peak area allele 1 tumor x peak area allele 2 normal tissue used. The formula is based on test results that were determined using an analog genetic analysis system. The ratio of the peak areas of the alleles in one run is included in the calculation. Table 1 shows, using the example of the marker D13S153, that the quotients of the peak areas can be determined with a low coefficient of variation. The multiplex PCR protocols according to the invention thus allow a reproducible and sensitive determination of an LOH. Table 1: Comparison of the quotients for alleles 1 and 2 in MCF-7 cells
Mittelwert 0,991 Standardabw. 0,10082438Mean 0.991 standard deviation 0.10082438
In die Berechnung eines "replication errors" (RER) geht auch die Länge der Fragmente über einen Faktor ein, der den Schwerpunkt der Peakverteilung repräsentiert.The length of the fragments is also included in the calculation of a "replication error" (RER) using a factor which represents the center of gravity of the peak distribution.
Die untere Nachweisgrenze bei der Multiplex-PCR mit drei Primerpaaren wurde sowohl an DNA aus den Zellinien SK-BR- 3 und LNCaP als auch an Patienten-DNA (Vergleich Tumor- DNA Leukozyten-DNA) bestimmt. Ein reproduzierbares Bandenmuster wurde für alle polymorphen Marker bis zu einer Konzentration von > 1 ng DNA erzielt. Das entspricht einer Zahl von ca. 50 Zellen.The lower detection limit for multiplex PCR with three primer pairs was determined both on DNA from the cell lines SK-BR-3 and LNCaP and on patient DNA (comparison of tumor DNA and leukocyte DNA). A reproducible band pattern was achieved for all polymorphic markers up to a concentration of> 1 ng DNA. This corresponds to a number of approximately 50 cells.
Vorteilhafterweise werden die zu untersuchenden Tumorzellen aus einer Probe, beispielsweise einer Blutprobe, isoliert bzw. angereichert, in dem zuerst mittels Dichtegra- dienten-Zentrifugation epitheliale Zellen angereichert werden und anschließend eine immunomagnetische Isolierung bzw. Anreicherung Zytokeratin-positiver und/oder PSA- positiver Zellhaufen durchgeführt wird. Hierzu werden magnetische Beads verwendet, an die entsprechende Antikörper gebunden sind. Die Dichtegradienten-Zentrifugation erfolgt dabei vorteilhafterweise wie in Brandt und Gri- watz, Clin. Chem. 42, Nr. 11 1996, S. 1881-1882 beschrieben. Diese Druckschrift wird hiermit bezüglich ihres gesamten Offenbarungsgehaltes in die vorliegende Anmeldung aufgenommen. Die immunomagnetische Zellisolierung erfolgt vorteilhafterweise wie in Griwatz et al . , J. Immunol . Meth. 183, 1995, S. 251-265 beschrieben. Auch als Primärantikörper wurden die folgenden Antikörper verwendet : rabbit-mouse anti-PSA, mouse anti-Zytokeratin- biotinyliert , mouse anti-cFas, mouse anti-M30, mouse an- ti-Mibl und mouse anti-Hl/H3-Histonproteine und als Sekundärantikörper die folgenden Antikörper: anti-rabbit und anti-mouse mit Alexa-488 und -594 oder FITC, Cy5 , Cy3, RPE, markiert.The tumor cells to be examined are advantageously isolated or enriched from a sample, for example a blood sample, in which epithelial cells are first enriched by means of density gradient centrifugation and then immunomagnetic isolation or enrichment of cytokeratin-positive and / or PSA- positive cell cluster is carried out. Magnetic beads are used for this purpose, to which corresponding antibodies are bound. The density gradient centrifugation is advantageously carried out as in Brandt and Griwatz, Clin. Chem. 42, No. 11 1996, pp. 1881-1882. This publication is hereby incorporated into the present application with regard to its entire disclosure content. The immunomagnetic cell isolation is advantageously carried out as in Griwatz et al. , J. Immunol. Meth. 183, 1995, pp. 251-265. The following antibodies were also used as primary antibodies: rabbit-mouse anti-PSA, mouse anti-cytokeratin biotinylated, mouse anti-cFas, mouse anti-M30, mouse anti-Mibl and mouse anti-Hl / H3 histone proteins and as Secondary antibodies the following antibodies: anti-rabbit and anti-mouse marked with Alexa-488 and -594 or FITC, Cy5, Cy3, RPE.
Entscheidend bei der vorliegenden Isolierungsmethode ist dabei, daß für das molekulare Staging letztlich nur Zellhaufen ausgewertet werden, die durch das genannte Verfahren isoliert werden. Als besonders vorteilhaft hat sich dabei herausgestellt, wenn während der Dichtegradienten- Zentrifugation mit hyperosmolaren Medien gearbeitet wird. Dadurch schrumpfen die Zellen der Zellenhaufen, so daß bei der anschließenden immunomagnetischen Zellisolierung die verwendete Säule nicht durch die Zellhaufen verstopft wird. Dies führt zu einer erheblich erhöhten Ausbeute an Tumorzellen aus der Blutprobe, so daß fast ausschließlich Tumorzellen auf dem Objektträger zu finden sind.It is crucial in the present isolation method that ultimately only cell clusters that are isolated by the method mentioned are evaluated for molecular staging. It has turned out to be particularly advantageous when working with hyperosmolar media during the density gradient centrifugation. As a result, the cells of the cell clusters shrink, so that during the subsequent immunomagnetic cell isolation, the column used is not clogged by the cell clusters. This leads to a considerably increased yield of tumor cells from the blood sample, so that almost exclusively tumor cells can be found on the slide.
Es stellte sich heraus, daß nach diesem Verfahren isolierte Zellen überwiegend als Zellhaufen vorliegen, die positiv auf den Nachweis von PSA und Zytokeratin sind. Alle Patienten mit einem Prostatakarzinom wiesen derartige Zellhaufen auf, während die Kontrollproben für den Nachweis derartiger Zellen negativ waren. Die Größe der Haufen reicht dabei von 2 bis 70 Zellen, wobei die Anzahl 10It was found that cells isolated by this method are predominantly cell clusters that are positive for the detection of PSA and cytokeratin. All patients with prostate cancer had such cell clusters, while the control samples for the detection of such cells were negative. The size of the clusters ranges from 2 to 70 cells, with the number 10
der Haufen in 20 ml peripherem Blut zwischen 1 und 5400 betrug. Allerdings weisen etwa 90 % der Patienten mehr als 100 Zellen auf (und damit wird die Nachweisgrenze ü- berschritten) .the heap in 20 ml of peripheral blood was between 1 and 5400. However, about 90% of the patients have more than 100 cells (and the detection limit is therefore exceeded).
Es konnten aufgrund der Zellmorphologie und der Kernfärbung prinzipiell zwei Klassen von Zellhaufen unterschieden werden. In großer Zahl wurden Haufen bestehend aus dysmorphen Zellen gefunden. In einzelnen Fällen waren in diese kleine runde kernhaltige Zellen eingeschlossen. Daneben wiesen 25 der untersuchten 74 Patienten mit Prostatakarzinom Haufen auf, die nur aus kleinen, ca. 5 bis 7 μm Durchmesser aufweisenden, runden und kernhaltigen Zellen bestanden. Die meisten der Patienten (ca. 60 %) hatten weniger als 10 derartige Zellhaufen in 20 ml Blut nachweisbar. In drei Fällen waren jedoch bis zu 200 derartige Zellhaufen nachweisbar.In principle, two classes of cell clusters could be distinguished based on the cell morphology and the nuclear staining. Heaps of dysmorphic cells were found in large numbers. In some cases, small round nucleated cells were included. In addition, 25 of the 74 patients with prostate cancer examined had clusters that consisted only of small, round and nucleated cells with a diameter of approx. 5 to 7 μm. Most of the patients (approx. 60%) had fewer than 10 such cell clusters in 20 ml of blood. In three cases, however, up to 200 such cell clusters were detectable.
Beide Gruppen von Zellhaufen unterscheiden sich bezüglich ihres Nachweises auf die Apoptosemarker c-Fas und M30, sowie die Proliferationsmarker Mib-1 und H1/H3. Die dysmorphen Zellhaufen waren für die Marker cFas und M30 positiv, während die Gruppe der kleinen, runden, kernhaltigen Zellhaufen negativ war.Both groups of cell clusters differ in their detection of the apoptosis markers c-Fas and M30, as well as the proliferation markers Mib-1 and H1 / H3. The dysmorphic cell clusters were positive for the cFas and M30 markers, while the group of small, round, nucleated cell clusters was negative.
Fig. 1 zeigt in Teilbild A den Zelldurchmesser, bevor die Zellen durch Suspension in einen hyperosmolaren Puffer für die Dichtegradienten-Zentrifugation suspendiert wurden. Der Zelldurchmesser beträgt dabei im Durchschnitt 8,02 μm. Fig. 2B zeigt demgegenüber den Zelldurchmesser nach Aufnahme in einen hyperosmolaren Puffer wie Nycoprep bzw. Polymorphprep . Der Durchschnittsdurchmesser verringerte sich hierbei auf 4,97 μm.1 shows in partial image A the cell diameter before the cells were suspended by suspension in a hyperosmolar buffer for density gradient centrifugation. The cell diameter averages 8.02 μm. In contrast, FIG. 2B shows the cell diameter after being taken up in a hyperosmolar buffer such as Nycoprep or Polymorphprep. The average diameter decreased to 4.97 μm.
Im Folgenden wird die Zellisolierung beispielhaft für verschiedene Zeil- und Tumortypen angegeben.In the following, cell isolation is given as an example for different cell and tumor types.
I. Isolierung von Zellen aus einem Mamma- bzw. Ovarial- 11I. Isolation of cells from a breast or ovary 11
karzinomcarcinoma
A: Proben-VorbereitungA: Sample preparation
1. Es werden Zellsuspension des Tumors, wie nach dem Verfahren in V. beschrieben, präpariert. Eine wie unter V. beschrieben aus einem Mamma- bzw. Ovarial- karzinom isolierte Zellsuspension wird 10 min bei Raumtemperatur (RT) in PABB-Puffer inkubiert (sättigt Bindungsstellen ab) ,1. Cell suspensions of the tumor are prepared as described in the procedure in V. A cell suspension isolated from a breast or ovarian carcinoma as described under V. is incubated for 10 min at room temperature (RT) in PABB buffer (saturates binding sites),
2. zentrifugieren (10 min, 1500 rpm)2.centrifuge (10 min, 1500 rpm)
3. in lOOOμl PABB-Puffer resuspendieren, mindestens 30 min bei RT auf Schüttler inkubieren,3. Resuspend in 100 μl PABB buffer, incubate on shaker for at least 30 min at RT,
4. 20 μl ErbB-2-Antikörper (Ab-2, anti-mouse gegen menschliches ErbB-2) hinzufügen, mindestens 30 min bei RT inkubieren,4. add 20 μl ErbB-2 antibody (Ab-2, anti-mouse against human ErbB-2), incubate at RT for at least 30 min,
5. 2 ml 1 % PBS/BSA hinzufügen, mischen und zentrifugieren. In 70 μl PABB-Puffer resuspendieren und ca. 15 min bei RT inkubieren,5. Add 2 ml 1% PBS / BSA, mix and centrifuge. Resuspend in 70 μl PABB buffer and incubate at RT for approx. 15 min.
6. 10 μl an Magnetkügelchen gekoppelte Antikörper (IgGl Kaninchen gegen Maus-Antikörper, 1 : 10-Verdünnung) dazugeben, mindestens 30 min bei RT inkubieren (20 μl für 107 Zellen, Inkubationsvolumen 80 μl)6. Add 10 μl of antibodies coupled to magnetic beads (IgGl rabbit against mouse antibody, 1:10 dilution), incubate at RT for at least 30 min (20 μl for 10 7 cells, incubation volume 80 μl)
7. mit 1 ml PABB-Puffer waschen, abzentrifugieren (10 min, 1500 rpm)7. wash with 1 ml PABB buffer, centrifuge (10 min, 1500 rpm)
8. in 500 μl 1 % PBS/BSA resuspendieren 128. Resuspend in 500 μl 1% PBS / BSA 12
B : SäuleB: pillar
MS-Säulen (Miltenyi Biotec GmbH) , Kapazität 107 Zellen verwendenUse MS columns (Miltenyi Biotec GmbH), capacity 10 7 cells
1. Säule mit 500 μl 1 % PBS/BSA waschenWash 1st column with 500 μl 1% PBS / BSA
2. Die mit 1 % PBS/BSA verdünnte Zellsuspension (s. Punkt I A) auf die Säule geben und die Negativfraktion auffangen, anschließend die Säule mit 1,5 ml 1% PBS/BSA spülen und ebenfalls auffangen.2. Add the cell suspension diluted with 1% PBS / BSA (see point I A) to the column and collect the negative fraction, then rinse the column with 1.5 ml 1% PBS / BSA and also collect.
3. mit Hilfe einer 10 ml Einwegspritze und eines darauf installierten Dreiwegehahns blasenfrei ca. 3 ml PBS/BSA von unten durch die Säule spülen, so daß Zellen erneut die Säule passieren können. Wiederum als Negativkontrolle auffangen. Falls die 1 Säule verstopft, d.h. die Fließgeschwindigkeit geringer wird, sofort die Säule mit PBS/BSA von unten durchspülen und das übrige Probenmaterial auf eine neue Säule geben.3. Using a 10 ml disposable syringe and a three-way tap installed on it, flush approx. 3 ml PBS / BSA from below through the column so that cells can pass through the column again. Again, catch as a negative control. If the 1 pillar is blocked, i.e. the flow rate becomes lower, immediately flush the column with PBS / BSA from below and transfer the remaining sample material to a new column.
4. Um die Positivfraktion aufzufangen, die Säule vom Magneten entfernen und auf ein weiteres 10 ml- Röhrchen setzen.4. To collect the positive fraction, remove the column from the magnet and place on another 10 ml tube.
5. Die Säule mit 1 ml 1 % PBS/BSA ausspülen und die Fraktion auffangen, anschließend erneut die Säule mit 1 ml 1 % PBS/BSA füllen und mit dem Stempel die Positivfraktion durch die Säule drücken5. Rinse the column with 1 ml of 1% PBS / BSA and collect the fraction, then fill the column again with 1 ml of 1% PBS / BSA and press the positive fraction through the column with the stamp
C: ZytospinsC: Cytospins
1. Die Fraktionen werden abzentrifugiert und in 1 % PBS/BSA resuspendiert1. The fractions are centrifuged off and resuspended in 1% PBS / BSA
2. Zytospins (8 min, 400 rpm) von positiven und negativen Fraktionen anfertigen 132. Prepare cytospins (8 min, 400 rpm) of positive and negative fractions 13
3. Zellpunkt auf Zytospin mit Fett-Stift markieren, 20 min mit 4% PFA fixieren, anschließend 2 x 5 min mit 1 % PBS/BSA waschen, bei 4 °C in feuchter Kammer aufbewahren3. Mark the cell point on the cytospin with a fat stick, fix for 20 min with 4% PFA, then wash 2 x 5 min with 1% PBS / BSA, store at 4 ° C in a moist chamber
II. Isolierung von Tumorzellen aus Blutproben zur Zellcharakterisierung von Mamma- und OvarialkarzinomenII. Isolation of tumor cells from blood samples for cell characterization of breast and ovarian carcinomas
1. Gradiententrennung wie unter III.1 beschrieben1. Gradient separation as described under III.1
2. Probenvorbereitung der angereicherten Tumorzellen wie unter I.A beschrieben, wobei von dem unter II.1. hergestellten Zellpellet ausgegangen wird.2. Sample preparation of the enriched tumor cells as described under I.A, whereby of the under II.1. produced cell pellet is assumed.
III. Isolierung von Tumorzellen aus Blutproben zum Nachweis und zur Zellcharakterisierung von Prostata, Blasen-, Kolon- oder MagenkarzinomenIII. Isolation of tumor cells from blood samples for the detection and cell characterization of prostate, bladder, colon or gastric cancer
Hierzu werden die nachfolgend genauer erläuterten Schritte durchgeführt :The following steps are explained in more detail:
1. Gradiententrennung mit Polymorphprep und Nycoprep1. Gradient separation with polymorph prep and Nycoprep
2. Magnetische Zellseparation2. Magnetic cell separation
a) Vorbereitung b) Säulena) Preparation b) Pillars
3. Cytospins für die Färbung3. Cytospins for staining
4. Färbung4. Coloring
1: Gradiententrennung (hier beispielhaft Zentrifugation mit Prostata-Ca-Patientenblut)1: gradient separation (here, for example, centrifugation with prostate Ca patient blood)
a) 3ml Polymorphprep (Gradient) vorlegen (Dichte 1.113, Fa . Nycomed) 14a) Present 3ml polymorph prep (gradient) (density 1.113, Nycomed) 14
b) mit 3ml Nycoprep (Gradient ) vorsichtig überschichtenb) Carefully overlay with 3ml Nycoprep (gradient)
(Dichte 1 . 068)(Density 1.068)
c) ohne Durchmischung mit 4 ml EDTA-Patientenblut überschichtenc) Cover with 4 ml EDTA patient blood without mixing
d) zentrifugieren (30 min, 1500 rpm)d) centrifuge (30 min, 1500 rpm)
e) Serum abpipettieren (gleichmäßig verteilen)e) Pipette off the serum (distribute evenly)
f) Monozytenfraktion incl . Tumorzellen (M) sowie die Leucozytenfraktion (L) in PP-Röhrchen bringen, auf insges. ca. 4 PP-Röhrchen verteilen, anschließend mit der doppelten Menge PBS pH 7,4 mischen (waschen) , abzentrifugieren (20 min, 1500 rpm) , Überstand verwerfenf) monocyte fraction incl. Place tumor cells (M) and the leucocyte fraction (L) in PP tubes, spread over a total of approx. 4 PP tubes, then mix (wash) with double the amount of PBS pH 7.4, centrifuge (20 min, 1500 rpm) , Discard the supernatant
g) Erythrozytenfraktion verwerfeng) Discard the erythrocyte fraction
h) Monozytenpellet mit insgesamt 2-5 ml PFA (Parafor- maldehyd in PBS) 4% fixierenh) Fix the monocyte pellet with a total of 2-5 ml PFA (paraformaldehyde in PBS) 4%
i) Leukozytenpellet in insgesamt 1 ml PBS aufnehmen und in 2 Eppendorfcups überführen (sammeln)i) Take up the leukocyte pellet in a total of 1 ml PBS and transfer it to 2 Eppendorf cups (collect)
j) abzentrifugieren (Epifuge, 10 min, 1500 rpm, Überstand verwerfen, Eisfach (- 20 °C)j) centrifuge (epifuge, 10 min, 1500 rpm, discard supernatant, ice compartment (- 20 ° C)
2. Magnetische Zellseparation mit Mikrobeads zur Anreicherung von Tumorzellen2. Magnetic cell separation with microbeads for the enrichment of tumor cells
Im folgenden wird immer nur mit dem Pellet weitergearbeitet, der Überstand wird nach jedem Waschvorgang verworfen. 15In the following, only the pellet is used, the supernatant is discarded after each wash. 15
Vorbereitung :Preparation :
a) das mit PFA (Paraformaldehyd) verdünnte Pellet abzentrifugieren, Überstand verwerfena) centrifuge the pellet diluted with PFA (paraformaldehyde), discard the supernatant
b) Dilutionspuffer lx (Waschpuffer PBS/BSA) vorbereitenb) Prepare dilution buffer lx (wash buffer PBS / BSA)
(36 ml H2Odest + 4 ml Dilutions Buffer 10 x = Diluti- onspuffer 1 x)(36 ml H 2 O d e st + 4 ml dilution buffer 10 x = dilution buffer 1 x)
c) Pellet in 5 ml PBS/BSA aufnehmen, dann in 35 ml Dilutionspuffer aufnehmen/Konzentration: 1 g/100 ml, anschließend 5 ml Permeabilisierungslδsung für Zellen (P-Lsg) dazu geben (Permeabilisierung) ,c) Take up the pellet in 5 ml of PBS / BSA, then take up in 35 ml of dilution buffer / concentration: 1 g / 100 ml, then add 5 ml of permeabilization solution for cells (P solution) (permeabilization),
5 min stehen lassen, vorher 1-2 x schwenken (sonst evtl. Zellen kaputt), auf drei 15 ml-PP-Röhrchen (Greiner Cell Star) verteilen, zentrifugieren (10 min, 1200 rpm) ohne Bremse, Überstand verwerfen.Let stand for 5 min, swivel 1-2 times beforehand (otherwise cells may be broken), spread over three 15 ml PP tubes (Greiner Cell Star), centrifuge (10 min, 1200 rpm) without brake, discard the supernatant.
d) 5 ml Fixierungslδsung für Zellen (F-Lsg) + 45 ml PBS (= Markierungslösung) , 30 ml abnehmen, davon 1-5 ml zum resuspendieren des Pellets verwenden, mit den restlichen 25 ml resuspendieren, umfüllen in zwei 15 ml-PP-Röhrchen, zentrifugieren (10 min, 1200 rpm) , Überstand verwerfend) 5 ml fixation solution for cells (F-solution) + 45 ml PBS (= marking solution), take 30 ml, use 1-5 ml of it to resuspend the pellet, resuspend with the remaining 25 ml, transfer into two 15 ml-PP -Tube, centrifuge (10 min, 1200 rpm), discard the supernatant
e) Pellet in 10 ml Fixierungs-Lösung resuspendieren, erneut zentrifugieren (10 min, 1200 rpm) , Überstand verwerfene) Resuspend the pellet in 10 ml fixative solution, centrifuge again (10 min, 1200 rpm), discard the supernatant
f) Pellet in 600 μl Fixierungs-Lösung resuspendierenf) Resuspend the pellet in 600 μl fixation solution
g) 200 μl Blockierungsreagenz für (PABB) dazugeben und mischeng) Add 200 μl blocking reagent for (PABB) and mix
h) 200 μl Immunomagnetische Kügelchen (z.B. MACS Bead ® anti-mouse-AK oder beispielsweise auch anti-rabbit, 16h) 200 μl immunomagnetic beads (e.g. MACS Bead ® anti-mouse AK or, for example, also anti-rabbit, 16
-goat, -sheep, -pig (Kaninchen, Ziege, Schaf, Schwein) dazugeben und mischen (Cytokeratin- Markierung für die Färbung-goat, -sheep, -pig (rabbit, goat, sheep, pork) and mix (cytokeratin marker for staining
i) 45 min inkubieren bei RTi) Incubate for 45 min at RT
j) 4 ml Fixierungs-Lösung dazu geben, mischen, zentrifugieren (10 min, 1200 rpm') , Überstand verwerfenj) Add 4 ml of fixation solution, mix, centrifuge (10 min, 1200 rpm '), discard the supernatant
k) Pellet in ca. 1 ml PBS/BSA aufnehmen, zum Aufheben fixieren in ca. 1 ml PFA 4%k) Take up the pellet in approx. 1 ml PBS / BSA, fix it in approx. 1 ml PFA 4%
MagnetSeparationmagnetic separation
1) die in 4% PFA-fixierte Monozytenfraktion (incl. Tumorzellen) zentrifugieren, 10 min 1200 rpm Überstand verwerfen1) centrifuge the monocyte fraction (incl. Tumor cells) fixed in 4% of PFA, discard 1200 rpm supernatant for 10 min
m) die Säule mit 3 ml PABB absättigen (spülen von oben mit Pipette)m) saturate the column with 3 ml PABB (rinse from above with pipette)
n) das Pellet zunächst in mindestens 12 ml PBS/BSA (je nach Pelletgrδße individuell anpassen) aufnehmen (waschen) , dabei schrittweise verdünnen, anfangen mit 3 ml im PP-Röhrchen, dann durchmischen, anschließend nach und nach auf die Säule geben (weitere Verdünnung also direkt auf die Säule) , dabei die Negativfraktion als Negativkontrolle auffangen. Die Fließgeschwindigkeit muß konstant bleiben!n) first take up (wash) the pellet in at least 12 ml PBS / BSA (adjust it individually depending on the pellet size), gradually diluting it, starting with 3 ml in the PP tube, then mixing, then gradually adding to the column (further Dilution directly onto the column), collecting the negative fraction as a negative control. The flow rate must remain constant!
o) mit Hilfe einer 10 ml Einwegspritze und eines darauf installierten Dreiwegehahns blasenfrei ca. 3 ml PBS/BSA von unten durch die Säule spülen, so daß Zellen erneut die Säule passieren können. Wiederum als Negativkontrolle auffangen. Falls die 1 Säule verstopft, d.h. die Fließgeschwindigkeit geringer wird, sofort die Säule mit PBS/BSA von unten durchspülen und das übrige Probenmaterial auf eine neue 17o) Using a 10 ml disposable syringe and a three-way tap installed on it, flush approx. 3 ml PBS / BSA from below through the column so that cells can pass through the column again. Again, catch as a negative control. If the 1 column becomes blocked, ie the flow rate slows down, immediately flush the column with PBS / BSA from below and the remaining sample material onto a new one 17
Säule geben.Give pillar.
p) die Säule mit weiteren 5-10 ml PBS/BSA nach und nach spülen und in der Negativkontrolle auffangen (alle Negativzellen sollten jetzt runtergespült worden sein. Die Positivzellen sollten dagegen in der Säule hängengeblieben sein. Sie sind durch die Bindung eines anti-Zytokeratin-Antikörpers und eines mageti- sierbaren Kügelchens magnetisierbar geworden.p) Gradually rinse the column with another 5-10 ml of PBS / BSA and collect it in the negative control (all negative cells should now have been flushed down. The positive cells should, however, have got stuck in the column. They are due to the binding of an anti-cytokeratin -Antibody and a magnetizable bead become magnetizable.
q) bei langsamer Durchlaufgeschwindigkeit die Säule erneut von unten mit PBS/BSA durchspülenq) If the flow rate is slow, rinse the column again from below with PBS / BSA
r) die Säule vorsichtig aus dem Magneten nehmen und zunächst ohne Stempel die Positivfraktion (+) mit 5-6 ml PBS/BSA ausspülenr) Carefully remove the column from the magnet and first rinse the positive fraction (+) with 5-6 ml PBS / BSA without a stamp
s) erneut die Säule mit 3-4 ml PBS/BSA füllen und mit dem Stempel die Positivfraktion (++) durch die Säule drückens) Fill the column again with 3-4 ml PBS / BSA and press the positive fraction (++) through the column with the stamp
PABB: 5 ml AB-Serum 10% (v/v) + 50μl BSA-C 0,1% (v/v) + 45 ml PBSPABB: 5 ml AB serum 10% (v / v) + 50μl BSA-C 0.1% (v / v) + 45 ml PBS
PBS/BSA: 1 g BSA auf 100 ml PBS, pH 7 , 4 = -> 1% (v/v) 0,1 % Triton: Triton X100 mit PBS pH 7,4 1:1000 verdünnen,PBS / BSA: 1 g BSA to 100 ml PBS, pH 7.4 = -> 1% (v / v) 0.1% Triton: Triton X100 with PBS pH 7.4 1: 1000,
In der Regel ist im Vergleich in der ersten Positivfraktion (+) das Verhältnis Tumorzellen/Monozyten deutlich verschoben, häufig finden sich nur noch einzelne Monozy- ten und damit ein hoher Reinheitsgrad der Tumorzellen.As a rule, the ratio of tumor cells / monocytes in the first positive fraction (+) is significantly shifted, often only single monocytes are found and thus a high degree of purity of the tumor cells.
t) Abzentrifugieren und Zellpellet in 1-2 ml PBS aufnehmen 18t) Centrifuge and take up cell pellet in 1-2 ml PBS 18
3. Cytospins für die Färbung3. Cytospins for staining
a) 200 μl verdünnte Probe/Spin auf Objektträger aufbringen (Pipette, Filter, Trichter, leere Referenz) : +- und ++-Kontrollen auf einen Objektträger, Negativ (-) -Kontrolle auf einen weiteren Objektträger aufbringen, jeweils zwei von jedem zur Kontrolle, falls die Färbung nicht funktioniert, Objektträger beschriften (+, ++, -, Datum, Name Patient, vor Mgnetseparation)a) Apply 200 μl of diluted sample / spin to a slide (pipette, filter, funnel, empty reference): + and ++ controls on one slide, negative (-) control on another slide, two of each for each Check, if the staining does not work, label the slide (+, ++, -, date, name patient, before Mgnet separation)
b) Zentrifugieren 8 min, (400 Umdrehungen )b) centrifugation 8 min, (400 revolutions)
c) Spot mit Fettstift umzeichnen,c) Draw the spot with bold pencil,
Zellen auf Objektträger werden mit 30 μl PFA/Spot für ca. 20 min fixiert.Cells on slides are fixed with 30 μl PFA / spot for approx. 20 min.
d) 10 min mit 30 μl pro Spin mit PBS/BSA waschen, abklopfen, bei 4 °C aufbewahrend) Wash for 10 min with 30 μl per spin with PBS / BSA, tap, store at 4 ° C
e) die restlichen verdünnten Proben abzentrifugieren (10 min, 1000 rpm) , Überstand verwerfen, Pellet zur Fixierung in ca. 2 ml PFA aufnehmen und bei 4 °C aufbewahrene) centrifuge the remaining diluted samples (10 min, 1000 rpm), discard the supernatant, take up the pellet for fixation in approx. 2 ml PFA and store at 4 ° C
4. Färbung (mit Streptavidin, mit Antikörper mit Fluoreszenzfarbstoffen konjugiert Alexa-488/584 , FITC, RPE etc.)4. Staining (with streptavidin, conjugated with antibody with fluorescent dyes Alexa-488/584, FITC, RPE etc.)
a) die fixierten Pellets auf dem Objektträger (s. letzter Punkt in 3. Cytospin) mit 0,1% Triton pro Spin für 10 min in Feuchtekammer permeabilisierena) Permeabilize the fixed pellets on the slide (see last point in 3rd cytospin) with 0.1% Triton per spin for 10 min in a moisture chamber
b) 20 min mit PABB absättigenb) Saturate for 20 min with PABB
c) 15 μl sekundärer Antikörper (Alexa 594 Streptavidin) pro Spin für 30 min (verdünnen 1:100 mit PABB in Ep- pendorf, z.B. 396 + 4/99 + 1 etc.), abklopfen 19c) Tap 15 μl secondary antibody (Alexa 594 streptavidin) per spin for 30 min (dilute 1: 100 with PABB in Ependorf, eg 396 + 4/99 + 1 etc.) 19
d) 2 x je 5 min (oder 1 x 10 min) mit 30 μl PBS/BSA pro Spin waschen, abklopfend) Wash 2 x 5 min (or 1 x 10 min) with 30 μl PBS / BSA per spin, tap
e) 20 min mit 20 μl PABB absättigen, abklopfene) Saturate for 20 min with 20 μl PABB, tap
f) 45 min versetzen mit 15 μl PSA (Antikörper DP033, verdünnen 1: 100), abklopfenf) Mix with 15 μl PSA (antibody DP033, dilute 1: 100) for 45 min, tap
g) waschen mit PBS 10 ming) wash with PBS for 10 min
h) 30 min mit 15 μl sekundärer Antikörper (Alexa 488 goat anti rabbit 11008, verdünnen 1: 100) inkubieren, abklopfenh) Incubate for 30 min with 15 μl secondary antibody (Alexa 488 goat anti rabbit 11008, dilute 1: 100), tap
i) waschen mit PBS 10 mini) wash with PBS for 10 min
j) 30 min waschen mit 30 μl H20bidest abklopfenj) Wash for 30 min with 30 μl H 2 0bidest
IV. Isolierung von Zellen eines Tumors aus UrinprobenIV. Isolation of tumor cells from urine samples
Hierzu wurden die nachfolgend genauer erläuterten Schritte durchgeführt :The steps detailed below were carried out:
1. Urinproben nehmen1. Take urine samples
2. Dichtebestimmung, Mengenbestimmung (ml), zentrifugieren und Pelletgröße bestimmen2. Determine density, determine quantity (ml), centrifuge and determine pellet size
3. Cytospins für die PAP-Färbung3. Cytospins for PAP staining
4. PAP-Färbung4. PAP staining
5. ggf . Magnetseparation a) Vorbereitung b) Säulen5. if necessary Magnetic separation a) preparation b) columns
6. Cytospins für die Antikörper-Färbung 2 06. Cytospins for antibody staining 2 0
7 . Cytokerat in- Färbungen7. Cytokerate-in stains
1. Probennahme1. Sampling
2. Dichtebestimmung, Mengenbestimmung2. Density determination, quantity determination
a) Urin in PP-Röhrchen umfüllena) Transfer urine into PP tubes
b) Urin in Messzylinder umfüllen, Dichte bestimmen, extra protokollierenb) Transfer urine into measuring cylinder, determine density, record it separately
c) Zentrifugieren in PP-Röhrchen (10 min bei 1.000 Umdrehungen = rpm) , Überstand verwerfenc) Centrifugation in PP tubes (10 min at 1,000 revolutions = rpm), discard the supernatant
d) Pelletgrδße schätzend) Estimate pellet size
e) zum Aufbewahren Pellet in ca. 2 ml PFA aufnehmen (fixieren) je nach Größe des Pellets auch mehr PFAe) to store the pellet in approx. 2 ml PFA (fix) depending on the size of the pellet also more PFA
3. Cytospins für PAP-Färbung3. Cytospins for PAP staining
a) Pellet mit PBS/BSA verdünnen (keine Trübung) , mit ca. 3 ml je nach Größe des Pellets, anfangena) Dilute the pellet with PBS / BSA (no clouding), start with approx. 3 ml depending on the size of the pellet
b) 200 μl verdünnte Probe/Spin auf Objektträger aufbringen (Pipette, Filter, Trichter)b) Apply 200 μl of diluted sample / spin to a slide (pipette, filter, funnel)
c) Zentrifugation 8 min, (400 U/min) 2 x gc) centrifugation 8 min, (400 rpm) 2 x g
d) Spin anschauen, ob die Zellen einzeln auf dem Objektträger liegen, sonst Probe weiter verdünnen und c) wiederholend) Look at the spin to see whether the cells lie individually on the slide, otherwise dilute the sample further and repeat c)
e) Zellen auf Objektträger fixieren (Fettstift großzügig umkreisen) , 30 μl PFA/Spin (Pipette) für ca, 20 min (Deckel zu) , abklopfen, kühl lagern oder weitergeben (Punkt 4) 21e) Fix cells on slides (generously circle fat pen), 30 μl PFA / Spin (pipette) for approx. 20 min (cover closed), tap, store cool or pass on (point 4) 21
f) die restlichen verdünnten Proben abzentrifugierenf) centrifuge the remaining diluted samples
(10 min, 1000 rpm) , Überstand verwerfen, Pellet zur(10 min, 1000 rpm), discard the supernatant, pellet for
Fixierung in ca . 2 ml PFAFixation in approx. 2 ml PFA
(Paraformaldehyd+Formalin) aufnehmen und aufbewahren bei 4 °CAbsorb (paraformaldehyde + formalin) and store at 4 ° C
PFA: Paraformaldehyd + 37 % Formalin 1:10 oder mit PBS verdünnenPFA: Dilute paraformaldehyde + 37% formalin 1:10 or with PBS
PBS/BSA: 1 g BSA (Bovine Albumine) /100 ml PBSPBS / BSA: 1 g BSA (Bovine Albumine) / 100 ml PBS
4. PAP-Färbung und erste Charakterisierung (Kontrollfärbung)4. PAP staining and first characterization (control staining)
a) Zellen auf dem Objektträger nach Paparicolaau färben . oder andere Kontrollfärbungena) Stain cells on the slide according to Paparicolaau. or other control stains
5. Magnetassoziierte ZeilSortierung mit magentisierba- ren Mikrobeads korrigiert auf Anti-Maus-Antikörper5. Magnetically associated cell sorting with magnetizable microbeads corrected for anti-mouse antibodies
Immer nur mit dem Pellet arbeiten, Überstand nach jedem Waschvorgang verwerfen!Always work with the pellet, discard the supernatant after each washing process!
Vorbereitungpreparation
a) das mit PFA verdünnte Pellet abzentrifugieren, Überstand verwerfen, 2 ml/PBS/BSA zum Pellet geben, zentrifugieren (7 x g 10 min, ca. 900 rpm) , Überstand abhebena) centrifuge the pellet diluted with PFA, discard the supernatant, add 2 ml / PBS / BSA to the pellet, centrifuge (7 x g 10 min, approx. 900 rpm), lift off the supernatant
b) Dilutionspuffer lx (Waschpuffer) vorbereitenb) Prepare dilution buffer lx (wash buffer)
(36 ml H2Odest + 4 ml Dilutions Buffer 10 x = Diluti- onspuffer 1 x)(36 ml H 2 O est d + 4 ml Dilutions Buffer 10 x = Diluti- onspuffer 1 x)
c) Pellet in 5 mL PBS/BSA aufnehmen, dann 35 mL Diluti- onspuffer dazugeben, anschließend 5 mL P-Lösung dazu, 5 min stehenlassen, vorher 1-2 x schwenken, auf drei 15 ml-PP-Röhrchen (z.B. Greiner Cell Star) verteilen, zentrifugieren 22c) Take up the pellet in 5 mL PBS / BSA, then add 35 mL dilution buffer, then add 5 mL P solution for 5 min, swirl 1-2 times beforehand, on three 15 ml PP tubes (eg Greiner Cell Distribute the star), centrifuge 22
(10 min, 900 rpm) , Überstand verwerfen(10 min, 900 rpm), discard the supernatant
d) 5 ml F-Lösung (entspricht PABB, + 45 ml PBS (= Markierungslösung) ) , 30 ml abnehmen, davon insgesamt 1- 5 ml zum Auflösen des Pellets verwenden, in ein Röhrchen bringen, dann mit den restlichen 25 ml suspendieren, umfüllen in zwei 15 ml-PP-Röhrchen, zentrifugieren (10 min, 900 rpm) , Überstand verwerfend) Take 5 ml F solution (corresponds to PABB, + 45 ml PBS (= marking solution)), 30 ml, use a total of 1- 5 ml to dissolve the pellet, put in a tube, then suspend with the remaining 25 ml, Transfer to two 15 ml PP tubes, centrifuge (10 min, 900 rpm), discard the supernatant
e) Pellet in insgesamt 10 ml F-Lösung resuspendieren, erneut zentrifugieren (7 x g 10 min, 900 rpm) , Überstand verwerfene) Resuspend the pellet in a total of 10 ml of F solution, centrifuge again (7 x g 10 min, 900 rpm), discard the supernatant
f) Pellet in 500-1000 μl (Minimum: 200 μl) verdünntem Cytokeratin 7 aufnehmen (1:50 mit PABB verdünnenf) Take up the pellet in 500-1000 μl (minimum: 200 μl) diluted cytokeratin 7 (dilute 1:50 with PABB
(z.B. 490 μl PABB + 10 μl Zytokeratin 7), 30 min inkubieren, zentrifugieren (10 min, 900 rpm 7 x g) , Überstand abheben(e.g. 490 μl PABB + 10 μl cytokeratin 7), incubate for 30 min, centrifuge (10 min, 900 rpm 7 x g), remove the supernatant
g) mit 5-10 ml PABB waschen, zentrifugieren (10 min, 900 rpm) , Überstand verwerfeng) wash with 5-10 ml PABB, centrifuge (10 min, 900 rpm), discard the supernatant
h) Pellet in 600 μl F-Lösung resuspendierenh) Resuspend the pellet in 600 μl F solution
i) 200 μl FCR-Blockierungs-Reagenz unverdünnt dazugeben und mischeni) Add 200 μl FCR blocking reagent undiluted and mix
j) 200 μl magnetisierbare Mikro-Beads konjugiert mit Anti-Maus-Antikörper unverdünnt dazugeben und mischenj) Add 200 μl of magnetizable micro-beads conjugated with anti-mouse antibody undiluted and mix
k) 45 min inkubieren bei Zimmertemperaturk) Incubate for 45 min at room temperature
1) 4 ml F-Lösung dazu geben, mischen, zentrifugieren (10 min, g 900 rpm) , Überstand verwerfen1) Add 4 ml of F solution, mix, centrifuge (10 min, g 900 rpm), discard the supernatant
m) Pellet in ca. 1 ml PBS/BSA aufnehmen, Aufbewahrung 23m) Take up the pellet in approx. 1 ml PBS / BSA, storage 23
der Zellen ca. 1 ml PBS 4% bei 4 °Cthe cells approx. 1 ml PBS 4% at 4 ° C
Modifizierte Zellseparation mit TrennsäulenModified cell separation with separation columns
a) die in 4% PFA-fixierte oder in PBS/BSA-aufgenommene Monocytenfraktion (incl. Tumorzellen) zentrifugierena) centrifuge the monocyte fraction (incl. tumor cells) fixed in 4% PFA or taken up in PBS / BSA
(10 min, 900 rpm) , Überstand verwerfen b) die Säule mit 3ml PABB absättigen (PABB von oben mit Pipette auf die Säule geben)(10 min, 900 rpm), discard the supernatant b) saturate the column with 3ml PABB (add PABB from above with a pipette onto the column)
c) das Pellet in PBS/BSA schrittweise verdünnen, anfangen mit 10 ml im PP-Röhrchen, dann durchmischen, anschließend nach und nach auf die Säule geben, dabei durchlaufende Suspension als Negativkontrolle auffangen.c) Gradually dilute the pellet in PBS / BSA, start with 10 ml in the PP tube, then mix, then gradually pour onto the column, collecting continuous suspension as a negative control.
d) mit Hilfe einer 10 ml Einwegspritze und eines darauf installierten Dreiwegehahns blasenfrei ca. 3 ml PBS/BSA von unten durch die Säule spülen, so daßd) With the help of a 10 ml disposable syringe and a three-way valve installed on it, flush approx. 3 ml of PBS / BSA from below through the column so that
'Zellen erneut die Säule passieren können. Wiederum durchlaufende Suspension als Negativkontrolle auffangen. ' Cells can pass the column again. Collect the continuous suspension as a negative control.
e) die Säule mit weiteren 5-10 ml PBS/BSA nach und nach spülen und in der Negativontrolle auffangen (alle Negativzellen sollten jetzt abgespült, die Positivzellen dagegen in der Säule hängengeblieben sein. Zellen, die durch Anti-Zytokeratin-Antikörper und magnetisches Mikrobead magnetisierbar sind, bleiben in der Säule hängen)e) Gradually rinse the column with another 5-10 ml PBS / BSA and collect it in the negative control (all negative cells should now be rinsed off, the positive cells, however, should have remained in the column are magnetizable, get stuck in the column)
f) bei langsamer Durchlaufgeschwindigkeit die Säule erneut von unten mit PBS/BSA durchspülenf) If the flow rate is slow, rinse the column again from below with PBS / BSA
g) die Säule vorsichtig aus dem Magneten nehmen und die erste Positivfraktion (+) mit 5-6 ml PBS/BSA aus der Säule spülen in ein PP-Röhrchen 24g) Carefully remove the column from the magnet and rinse the first positive fraction (+) with 5-6 ml PBS / BSA from the column into a PP tube 24
h) erneut die Säule mit 3-4 ml PBS/BSA füllen und mit einem Stempel durch die Säule drücken. Man erhält die zweite Positivfraktion (++) , die in einem zweiten PP-Röhrchen aufgefangen wird.h) Fill the column again with 3-4 ml PBS / BSA and press it through the column with a stamp. The second positive fraction (++) is obtained, which is collected in a second PP tube.
In der Regel finden sich im Vergleich zu der ersten Positivfraktion (+) in der (++) Fraktion nur noch Tumorzellen und nur noch einzelne Leukozyten, E- rythrozyten, Urothelzellen.As a rule, only tumor cells and only individual leukocytes, erythrocytes, urothelial cells are found in the (++) fraction compared to the first positive fraction (+).
i) zentrifugieren (10 min, 900 rpm) , Überstand verwerfen,i) centrifuging (10 min, 900 rpm), discarding the supernatant,
6. Cytospins für die Antikörper-Färbung6. Cytospins for antibody staining
a) Pellets aus 5 PBS/BSA verdünnen. Je nach Umfang des Pellets in 400 μl bis 2000 μla) Dilute pellets from 5 PBS / BSA. Depending on the size of the pellet, in 400 μl to 2000 μl
b) 200 μl verdünnte Positiv-Fraktionen mittels Zytro- zentrifuge ebenfalls auf Objektträger aufbringen. Negativ (-) -Kontrolle ebenfalls auf einen Objektträger zentrifugierenb) Apply 200 μl of diluted positive fractions to slides using a cytocentrifuge. Centrifuge negative (-) control also on a slide
c) Zentrifugationsbedingungen:c) Centrifugation conditions:
8 min (set time 8/enter) , 400 Umdrehungen = 2 x g (set speed 40/enter, Start) zentrifugierenCentrifuge for 8 min (set time 8 / enter), 400 revolutions = 2 x g (set speed 40 / enter, start)
d) Zellen auf Objektträger mit 30 μl PFA pro Spot für ca. 20 min in Feuchtekammer fixieren. Anschließend abklopfen, ggf. kühl aufbewahrend) Fix the cells on slides with 30 μl PFA per spot for approx. 20 min in the moisture chamber. Then tap and keep cool if necessary
7. Färbung der Zytokeratine7. Staining of the cytokeratins
Reagenzien:reagents:
4 % PFA (Paraformaldehyd: 37 % Formalin + PBS 1:10 verdünnen)4% PFA (paraformaldehyde: 37% formalin + PBS dilute 1:10)
0.1 % Triton X 100 (in PBS) 250.1% Triton X 100 (in PBS) 25
10% AB-Serum (5 ml AB-Serum Biotest AG + 50 μl BSA-c + 45 ml PBS/BSA) 1 % PBS/BSA10% AB serum (5 ml AB serum Biotest AG + 50 μl BSA-c + 45 ml PBS / BSA) 1% PBS / BSA
1.Antikörper : Maus-Anti-Zytokeratin-Antikδrper Arbeitskonzentration 1:50 (in PABB) (C7, C20 oder PAN) sekundärer Antikörper: Anti-Maus Alexa 594- Antikörper Arbeitskonzentration 1:100 (in PABB) Isotypenkontrolle in 10% AB-Serum1. Antibody: mouse anti-cytokeratin antibody working concentration 1:50 (in PABB) (C7, C20 or PAN) secondary antibody: anti-mouse Alexa 594 antibody working concentration 1: 100 (in PABB) isotype control in 10% AB- serum
evtl. bei Protatakarzinompatienten:possibly in protate cancer patients:
1. Antikörper: Anti-PSA-Antikörper Arbeitskonzentration 1:50 (in PABB) sekundärer Antikörper: Anti-Rabbit Alexa 488- Antikörper Arbeitskonzentration 1:100 (in PABB)1. Antibody: Anti-PSA antibody working concentration 1:50 (in PABB) secondary antibody: Anti-Rabbit Alexa 488 antibody working concentration 1: 100 (in PABB)
a) die fixierten Pellets auf dem Objektträger (s. letzter Punkt vom Cytospin) mit 30 μl 0.1 %Triton X 100 pro Spin für 10 min permeabilisieren, anschließend abklopfena) Permeabilize the fixed pellets on the slide (see last point of the cytospin) with 30 μl 0.1% Triton X 100 per spin for 10 min, then tap
b) mit 30 μl 10% PABB-Serum für 20 min blockieren, abklopfenb) Block with 30 μl 10% PABB serum for 20 min, tap
c) 15 μl verdünnter 1.Antikörper (Maus Anti-Zytokera- tin-Antikörper : gilt für die Spezifitäten C7, C20, PAN) pro Spin für 30 min, anschließend abklopfenc) 15 μl of diluted 1st antibody (mouse anti-cytokeratin antibody: applies to the specificities C7, C20, PAN) per spin for 30 min, then tap
d) waschen mit 30 μl PBS/BSA pro Spin fürd) wash with 30 μl PBS / BSA per spin for
10 min, abklopfen, Vorgang zweimal wiederholen10 min, tap, repeat twice
e) 15 μl verdünnter sekundärer Antikörper (Anti-Maus Alexa 594, Antikörper) pro Spin für 30 min abklopfene) Tap 15 μl of diluted secondary antibody (anti-mouse Alexa 594, antibody) per spin for 30 min
f) waschen mit 30 μl PBS/BSA pro Spin für 10 min, abklopfen, Vorgang zweimal wiederholen 26f) wash with 30 μl PBS / BSA per spin for 10 min, tap, repeat twice 26
V. Herstellung von Zellsuspensionen aus solidem humanem Tumorgewebe (zum Beispiel eines Mamma- oder Prostatakarzinoms)V. Production of cell suspensions from solid human tumor tissue (for example a breast or prostate carcinoma)
Reagenzien:reagents:
Invasionsmedium (Dulbecco's Modified Eagle Medium) 1% (v/v) 2 mM L-GlutaminInvasion medium (Dulbecco's Modified Eagle Medium) 1% (v / v) 2 mM L-glutamine
1% (v/v) Antibiotic/antimycotic Solution 0,1% (w/v) bovines Rinderserumalbumin (BSA) im Invasionsmedium Trypanblau-Lösung (0,4 % (Gew/Vol) Fa. Sigma, Deisenhofen1% (v / v) Antibiotic / antimycotic Solution 0.1% (w / v) bovine bovine serum albumin (BSA) in the invasion medium trypan blue solution (0.4% (w / v) from Sigma, Deisenhofen
Durchführung :Execution :
Gewebestückchen von frisch operierten Mammakarzinomen, benignen Brusterkrankungen bzw. Prostatakarzinomen werden vom Operateur in sterile Röhrchen mit Standardmedium gegeben und bis zur Disaggregation (spätestens 4 h nach der Entnahme) auf Eis gestellt. Von jedem Gewebestück wird ca. die Hälfte für die spätere Expressionsanalyse) abgetrennt und in flüssigem Stickstoff konserviert. Die andere Hälfte wird mit einer mechanischen Methode disaggre- giert . Dazu wird eine Medimachine (Firma Dako, Hamburg) verwendet. Zur Disaggregation wird das Mammagewebe mit einem Skalpell in 3 bis 10 mm2 große Stücke geschnitten und zusammen mit 1,5 ml Invasionsmedium in ein Medicon gegeben. Das Gewebe wird dann innerhalb der Medimachine in 2 bis 3 min zu einer Zellsuspension dlsaggregiert, die Einzelzellen und Zellaggregate (Zellhaufen) von bis zu ca. 30 Zellen enthält. Die Zellen werden in einer Neubauer-Zählkammer mikroskopisch ausgezählt und die Lebendzellzahl mit Hilfe des Trypanblau-Exklusionstests bestimmt, der darauf beruht, daß bei lebenden Zellen bestimmte Farbstoffe (z.B. Trypanblau) nicht in das Zellinnere gelangen können, während tote Zellen sich mit dem betreffenden Farbstoff anfärben (Kaltenbach et al . , 1958; Lindl und Bauer, 1994) . 27Tissue pieces from freshly operated breast carcinomas, benign breast diseases or prostate carcinomas are placed in sterile tubes with standard medium by the surgeon and placed on ice until disaggregation (at the latest 4 hours after removal). Approximately half of each piece of tissue is removed for later expression analysis and preserved in liquid nitrogen. The other half is disaggregated using a mechanical method. A medimachine (company Dako, Hamburg) is used for this. For disaggregation, the breast tissue is cut into 3 to 10 mm 2 pieces with a scalpel and placed in a Medicon together with 1.5 ml of invasive medium. The tissue is then aggregated within 2 to 3 minutes within the medimachine to form a cell suspension which contains single cells and cell aggregates (cell clusters) of up to approx. 30 cells. The cells are counted microscopically in a Neubauer counting chamber and the number of living cells is determined using the trypan blue exclusion test, which is based on the fact that certain dyes (e.g. trypan blue) cannot enter the cell interior of living cells, while dead cells deal with the relevant dye stain (Kaltenbach et al., 1958; Lindl and Bauer, 1994). 27
Nach Durchführung der so dargestellten Zellisolierungen erfolgt nun die Genotypisierung der isolierten Zellhaufen zum Zwecke ihrer Zuordnung zu Bereichen im Primärtumor mittels PCR.After performing the cell isolations shown in this way, the isolated cell clusters are genotyped for the purpose of their assignment to areas in the primary tumor by means of PCR.
Im folgenden wird beispielhaft die Nukeinsäureisolierung aus verschiedenen verwendeten Zellmaterialien beschrieben.The following is an example of the nucleic acid isolation from various cell materials used.
1. DNA von aus peripherem Blut isolierten Zellhaufen und mikrodisektierten entparafinierten fixierten- gefärbten Tumorgewebeschnitten1. DNA from cell clusters isolated from peripheral blood and microdisected, dewaxed, fixed-stained tumor tissue sections
Auf einem inversen Lichtmikroskop (Leitz Diavert) werden die PSA und Cytokeratin positiven Tumorzellen und Tumor- zellkluster sowie nicht positive Monozyten als Negativkontrolle (bzw. Referenz für die LOH-Berechnung) mit einer sterilen feinen Nadel mikrodissektiert und in je 1,5 ml sterile Reaktionsgefäße (Eppendorf Biopure) überführt. Bei kleinen multifokalen Tumorarealen können nach der gleichen Vorgehensweise auch verschiedene Foci multifokaler Tumore aus bereits gefärbten und pathologisch untersuchten Schnitten einzelner Areale vom Objektträger mikrodisektiert werden. Je nach Zellzahl (ca. 50-1000 Zellen) werden die Zellen in 10-200 μl LTEPuffer (10 mM Tris/HCI, 1 mM EDTA, pH 7,5) aufgenommen und mit 1-20 μl Proteinase K (>600mAU/ml) im Thermoblock oder Wasserbad bei 50-56 °C für 1-10 h inkubiert und anschließend für 5 min auf Eis gestellt. Anschließend werden die Proben für 1 min bei 10000 rpm zentrifugiert . Daraufhin werden die Proben mit 99,8% Ethanol p.a. (Roth) auf eine 70%ige Lösung eingestellt. Nach kurzem vortexen werden die Proben bei 15000 rpm für 20 min abzentrifugiert, der Überstand verworfen und das DNA-Pellet bei Raumtemperatur getrocknet. Die DNA wird anschließend in 10-200 μl LTE-Puffer oder doppelt destillierten Wasser resuspendiert, bei Raumtemperatur für 1 h inkubiert (Rehydratisierung) und bis zur Durchführung der PCR bei -20 °C tiefgefroren. 28On an inverse light microscope (Leitz Diavert), the PSA and cytokeratin positive tumor cells and tumor cell clusters and non-positive monocytes as a negative control (or reference for the LOH calculation) are microdissected with a sterile fine needle and placed in 1.5 ml sterile reaction vessels (Eppendorf Biopure) transferred. In small multifocal tumor areas, different foci of multifocal tumors from already stained and pathologically examined sections of individual areas can be microdisected from the slide using the same procedure. Depending on the cell number (approx. 50-1000 cells), the cells are taken up in 10-200 μl LTE buffer (10 mM Tris / HCl, 1 mM EDTA, pH 7.5) and with 1-20 μl proteinase K (> 600mAU / ml ) incubated in a thermoblock or water bath at 50-56 ° C for 1-10 h and then placed on ice for 5 min. The samples are then centrifuged for 1 min at 10,000 rpm. The samples are then adjusted to a 70% solution with 99.8% ethanol pa (Roth). After briefly vortexing, the samples are centrifuged off at 15,000 rpm for 20 min, the supernatant is discarded and the DNA pellet is dried at room temperature. The DNA is then resuspended in 10-200 μl LTE buffer or double distilled water, incubated at room temperature for 1 h (rehydration) and frozen at -20 ° C. until the PCR is carried out. 28
2. DNA aus konserviertem Tumorgewebe mit mono- und multifokalen Herden2. DNA from preserved tumor tissue with mono- and multifocal foci
Die DNA-Isolierung aus frischem sowie formalinfixiertem bzw. in Parafin eingebettetem Gewebe der Primärtumore einer oder mehrerer Foci erfolgt nach den Protokollen des kommerziell erhältlichen QIAmp DNA Mini Kit (Fa. Qiagen, Hilden) oder einem vergleichbaren System anderer Hersteller. Dieser Kit enthält QlAamp DNA Mini Spin Columns (Säulen) , Proteinase K für den proteolytischen Verdau des Gewebes, die Lysispuffer AL und ATL, die Ethanol enthaltenden Waschpuffer AW1 und AW2 und den Elutionspuffer AE . Frisches Gewebe eines Primärtumores wird vor der Gewebe- lysis mechanisch mit einem Skalpell oder dafür vorgesehene Gewebezerkleinerungsmaschienen (z.B. Medimaschine, DA- KO) aufgeschlossen. Für die in Paraffin eingebetteten Gewebeschnitte wird vor der eigentlichen DNA-Isolierung eine Entparaffinierung mit 100% Xylol vorgenommen. Dazu werden die Proben zunächst in 1 ml Xylol in 1,5 ml Eppen- dorf-Reaktionsgefäßen in einem handelsüblichen Thermoblock auf 70 °C für 1 h inkubiert. Anschließend für 3 min zentrifugiert der Überstand verworfen und dieser Prozess zwei Mal wiederholt. Anschließend wird das Gewebe drei Mal mit 99,8 % Ethanol (Roth) gewaschen, anschließend getrocknet und in den Lysispuffer überführt. Danach erfolgt die Isolation nach den Protokollen der Hersteller.DNA isolation from fresh and formalin-fixed or paraffin-embedded tissue from the primary tumors of one or more foci is carried out according to the protocols of the commercially available QIAmp DNA Mini Kit (from Qiagen, Hilden) or a comparable system from other manufacturers. This kit contains QlAamp DNA Mini Spin Columns (columns), Proteinase K for the proteolytic digestion of the tissue, the lysis buffers AL and ATL, the ethanol-containing washing buffers AW1 and AW2 and the elution buffer AE. Fresh tissue from a primary tumor is mechanically disrupted with a scalpel or tissue shredding machines (e.g. medomachine, DACO) provided for this purpose before tissue lysis. For the tissue sections embedded in paraffin, dewaxing with 100% xylene is carried out before the actual DNA isolation. For this purpose, the samples are first incubated in 1 ml xylene in 1.5 ml Eppendorf reaction vessels in a commercially available thermoblock at 70 ° C for 1 h. The supernatant was then centrifuged for 3 minutes and the process repeated twice. The tissue is then washed three times with 99.8% ethanol (Roth), then dried and transferred to the lysis buffer. The isolation is then carried out according to the manufacturer's protocols.
Die DNA-Isolierung aus EDTA-antikoaguliertem Vollblut erfolgt mit dem QIAmp DNA Blood Mini Kit (Qiagen, Hilden) nach den bekannten Protokollen oder vergleichbaren Verfahren anderer Hersteller.DNA isolation from EDTA-anticoagulated whole blood is carried out with the QIAmp DNA Blood Mini Kit (Qiagen, Hilden) according to the known protocols or comparable methods from other manufacturers.
Wenn nötiq wird das Vollblut für 10 min mit Puffer AL und Proteinase K zur Lyse der Zellen bei 54 °C im Thermoblock inkubiert, anschließend mit Ethanol versetzt und das Gemisch auf die Säule (QIAmp DNA Mini Spin Columns) gegeben. Die Proben werden mit AW1 und anschließend mit AW2 gewaschen und mit dem Elutionspuffer AE eluiert . Die DNA- 29If necessary, the whole blood is incubated for 10 min with buffer AL and proteinase K to lyse the cells at 54 ° C in a thermoblock, then mixed with ethanol and the mixture is added to the column (QIAmp DNA Mini Spin Columns). The samples are washed with AW1 and then with AW2 and eluted with the elution buffer AE. The DNA 29
Lösungen werden zur Konzentrationsbestimmung photometrisch bei 260, 280 und 320 nm gemessen auf 10 ng/μl eingestellt und bei -20 °C eingefroren.Solutions are measured photometrically at 260, 280 and 320 nm, adjusted to 10 ng / μl and frozen at -20 ° C.
3. Isolierung RNA von aus peripherem Blut isolierten Zellen3. Isolation of RNA from cells isolated from peripheral blood
Auf einem inversen Lichtmikroskop (Leitz Diavert) werden die PSA- und Cytokeratin-positiven Tumorzellen und Tumor- Zellhaufen mit einer sterilen feinen Nadel mikrodissek- tiert und in ein 1,5 ml steriles Reaktionsgefäß (Eppen- dorf Biopure) überführt. Die RNA- Isolierung wird strikt nach den Protokollen des RNeasy Purification Kit for total RNA minipreparation (Fa. Qiagen, Hilden) durchgeführt, bestehend aus: RNeasy Mini Spin Colums, Collection tubes 1,5 und 2 ml, Puffer RTL, Puffer RWI , Puffer RPE und RNase-freiem Wasser) .The PSA- and cytokeratin-positive tumor cells and tumor cell clusters are microdissected with a sterile fine needle on an inverse light microscope (Leitz Diavert) and transferred to a 1.5 ml sterile reaction vessel (Eppendorf Biopure). The RNA isolation is carried out strictly according to the protocols of the RNeasy Purification Kit for total RNA minipreparation (Qiagen, Hilden), consisting of: RNeasy Mini Spin Colums, Collection tubes 1.5 and 2 ml, buffer RTL, buffer RWI, buffer RPE and RNase-free water).
Im folgenden wird nun beispielhaft die erfindungsgemäße Detektion karzinom-spezifischer, genetischer Veränderungen und mRNA-Expressionen mittels Mikrosatelliten-PCR, Multiplex Mikrosatelliten-PCR und TaqMan™ RT-PCR beschrieben.The detection of carcinoma-specific genetic changes and mRNA expressions by means of microsatellite PCR, multiplex microsatellite PCR and TaqMan ™ RT-PCR is now described below by way of example.
4. Mikrosatelliten- und Multiplex-Mikrosatelliten-PCR4. Microsatellite and multiplex microsatellite PCR
Insgesamt werden drei Multiplex-PCRs verwendet, die aus den Mikrosatellitenkombinationen Nr. 1: D7S522 D8S258, D16S400, Nr.2: NEFL, D13S153, D17S855 und Nr.3 D10S541, D16S402, D16S422 bestehen. Das Prinzip dieser PCRs beruht auf der Coamplifikation verschiedener DNA-Abschnitte in einem Reaktionsgefäß. Dabei wurden die Primersequenzen derart gesetzt, dass in der kapillarelektrophoretischen Trennung keine Überschneidungen der Längen der Amplifika- tionsprodukte auftreten. Alle Primer sind mit Fluoreszenzfarbstoffen markiert, die bei 488 nm angeregt werden (siehe Tabelle 3) . Alle anderen handelsüblichen Fluoreszenzmarkierungen sind ebenfalls anwendbar. Des weiteren 30A total of three multiplex PCRs are used, which consist of microsatellite combinations No. 1: D7S522 D8S258, D16S400, No. 2: NEFL, D13S153, D17S855 and No. 3 D10S541, D16S402, D16S422. The principle of these PCRs is based on the co-amplification of different DNA sections in one reaction vessel. The primer sequences were set in such a way that there was no overlap in the lengths of the amplification products in the capillary electrophoretic separation. All primers are labeled with fluorescent dyes that are excited at 488 nm (see Table 3). All other commercially available fluorescent labels can also be used. Furthermore 30
wurden die PCR-Reaktionsbedingungen für 10 CA-repeats innerhalb des EGFR-Gens und ein CA-repeat innerhalb des p53 Gens neu entwickelt und optimiert .the PCR reaction conditions for 10 CA repeats within the EGFR gene and one CA repeat within the p53 gene were newly developed and optimized.
Alle PCRs können in handelsüblichen 0,2 ml oder 0,5 ml Reaktionsgefäßen oder in 96-Well-Platten verschiedener Hersteller (z.B. Eppendorf, Hamburg) auf einem Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg) , einem Gene AmpR PCR System 9700 (PE Applied Biosystems, Weiterstadt) oder einem handelsüblichen, vergleichbaren Thermocycler anderer Hersteller durchgeführt werden .All PCRs can be in commercially available 0.2 ml or 0.5 ml reaction tubes or in 96-well plates from different manufacturers (e.g. Eppendorf, Hamburg) on an Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg), a Gene AmpR PCR System 9700 (PE Applied Biosystems, Weiterstadt) or a commercially available, comparable thermal cycler from other manufacturers.
Das Reaktionsvolumen kann 12 μl bis 100 μl betragen. Das PCR Reaktionsgemisch besteht aus 5U/100 μl AmpliTaq Gold™ oder einer qualitativ vergleichbaren Polymerase und (bewährt haben sich hot start Polymerasen) 1 x Ge- neAmpR dNTP, 2 mM MgCl2, 30pM von jedem Primer, 200 μM Ge- neAmpR buffer (alle Reagenzien von PE Applied Biosystems, Weiterstadt) und 500 pg bis 200 ng genomischer DNA. Für die PCR werden folgende Themperaturgradienten gefahren. Begonnen wird mit einem 95 °C Denaturierungsschritt , gefolgt von 30-45 Zyklen bestehend aus einem 95 °C Denaturierungsschritt für 30s, einem 56 °C-62 °C Annea- lingschritt (je nach Primer, alle Multiplex-PCRs werden einheitlich mit 56 °C durchgeführt) und einem Elongati- onsschritt bei 72 °C. Nach diesen Zyklen wird ein 72 °C Extensionsschritt für 7 min angeschlossen und anschließend die Proben bei 4 °C bis zur Probenentnahme gekühlt aufbewahrt .The reaction volume can be 12 μl to 100 μl. The PCR reaction mixture consists of 5U / 100 μl AmpliTaq Gold ™ or a qualitatively comparable polymerase and (hot start polymerases have proven successful) 1 x GeneAmp R dNTP, 2mM MgCl 2 , 30pm from each primer, 200μM GeneAmp R buffer (all reagents from PE Applied Biosystems, Weiterstadt) and 500 pg to 200 ng genomic DNA. The following temperature gradients are run for the PCR. It starts with a 95 ° C denaturation step, followed by 30-45 cycles consisting of a 95 ° C denaturation step for 30s, a 56 ° C-62 ° C annealing step (depending on the primer, all multiplex PCRs are standardized at 56 ° C) and an elongation step at 72 ° C. After these cycles, a 72 ° C extension step is connected for 7 min and the samples are then stored at 4 ° C in a cool place until the sample is taken.
Für den Mikrosatelliten p53 werden die gleichen Reaktionsbedingungen und Thermozyklen benutzt wie für die Multiplex-PCRs (siehe Tabelle 2) .The same reaction conditions and thermal cycles are used for the microsatellite p53 as for the multiplex PCRs (see Table 2).
Die Mikrosatellitenanalyse erfolgt auf den Kapillarelektrophoresegeräten (four colorlaser-induced fluorescen- ce capillary electrophoresis System) ABI Prism 310 Gene- 31The microsatellite analysis is carried out on the capillary electrophoresis devices (four color laser-induced fluorescence capillary electrophoresis system) ABI Prism 310 gene 31
tic Analyzer oder ABI 3700 DNA Analyser (PE Applied Bio- systems, Weiterstadt) oder einen vergleichbaren Genetic Analyzer anderer Hersteller. Als Trennmedium dienen die Polymere POP4 , POP5 und POP6 die für die entsprechenden Geräte geeignet sind. Als Längenstandard dient Genescan- 500TM TAMRA 500 oder ein vergleichbarer Längenstandard, der für die genannten Kapillarelektrophoresegeräte geeignet ist. Die Analyse und Auswertung erfolgte mit der Genescan Software.tic analyzer or ABI 3700 DNA analyzer (PE Applied Biosystems, Weiterstadt) or a comparable genetic analyzer from other manufacturers. The polymers POP4, POP5 and POP6 are used as separation medium and are suitable for the corresponding devices. The length standard used is Genescan-500TM TAMRA 500 or a comparable length standard that is suitable for the capillary electrophoresis devices mentioned. The analysis and evaluation was carried out with the Genescan software.
Verwendeteused
Reagenzien: Volumen :Reagents: Volume:
Wasser bis zu 25pl 10*PCR Puffer II (PE) 2 , 5pfWater up to 25pl 10 * PCR buffer II (PE) 2, 5pf
25mM MgCl2 Lösung (PE) 2 μl dATP, 10 mM (PE) 0,25 μl dCTP, 10 mM (PE) 0,25 μl dGTP, 10 mM (PE) 0,25 μl dTTP, 10 mM (PE) 0,25 μl25mM MgCl 2 solution (PE) 2 μl dATP, 10 mM (PE) 0.25 μl dCTP, 10 mM (PE) 0.25 μl dGTP, 10 mM (PE) 0.25 μl dTTP, 10 mM (PE) 0 , 25 ul
5' -3' -Primer 10 μM 0,5 μl 15 '-3' primer 10 μM 0.5 μl 1
3' -5' -Primer 10 μM 0 , 5 μl3 '-5' primer 10 µM 0.5 µl
AmpliTaq Gold (PE) oder 0,25 μlAmpliTaq Gold (PE) or 0.25 μl
AmpliTaq DNA Polymerase 0,25 μlAmpliTaq DNA polymerase 0.25 ul
Total: 25 μlTotal: 25 μl
Thermocycler: PE 9700,Thermal cycler: PE 9700,
Gefäße: 0,2 ml Gefäße jeder Hersteller, für PCR-Maschinen geeignet 32Vials: 0.2 ml vials from any manufacturer, suitable for PCR machines 32
Tabelle 2 :Table 2:
Temperaturzyklen für die Mikrosatelliten-PCR:Temperature cycles for microsatellite PCR:
Für D7S2429, BBl/2, CAII, D7S2550, CAIII, CAIV, CAVI,For D7S2429, BBl / 2, CAII, D7S2550, CAIII, CAIV, CAVI,
D7S2467, D7 D7S2552 :D7S2467, D7 D7S2552:
95 °C - 4 Min.95 ° C - 4 min.
62 °C - 1 Min.62 ° C - 1 min.
72 °C - 1 Min.72 ° C - 1 min.
95 °C - ■ 1 Min.95 ° C - ■ 1 min.
31 Zyklen 62 °C ■ - 1 Min.31 cycles 62 ° C ■ - 1 min.
72 °C - - 1 Min.72 ° C - - 1 min.
72 °C - 8 Min.72 ° C - 8 min.
4 °C - ■ unendlich4 ° C - ■ infinite
Für D7S494 :For D7S494:
95°C - 4 Min. 58 °C - 1 Min. 68 °C - 1 Min.95 ° C - 4 min. 58 ° C - 1 min. 68 ° C - 1 min.
95 °C - 1 Min.95 ° C - 1 min.
31 Zyklen 58 °C - 1 Min.31 cycles 58 ° C - 1 min.
68 °C - 1 Min.68 ° C - 1 min.
68 °C - 8 Min. 4 °C - unendlich68 ° C - 8 min. 4 ° C - infinite
Für D7S499:For D7S499:
95 °C - 4 Min. 56 °C - 1 Min. 68 °C - 1 Min.95 ° C - 4 min. 56 ° C - 1 min. 68 ° C - 1 min.
95 °C - 1 Min.95 ° C - 1 min.
31 Zyklen 56 °C - 1 Min. 68 °C - 1 Min.31 cycles 56 ° C - 1 min. 68 ° C - 1 min.
68 °C - 8 Min. 4 °C -unendlich 3368 ° C - 8 min. 4 ° C - infinite 33
Tabelle 3 :Table 3:
Probenvorbereitung ABI Prism 3700: Fragmentanalyse (Ge- neScan)Sample preparation ABI Prism 3700: fragment analysis (GeneScan)
Pipettierschema :Pipetting scheme:
Standard: GeneScan-500 TAMRA Size Standard PE BiosystemsStandard: GeneScan-500 TAMRA Size Standard PE Biosystems
Proben denaturieren: im Thermoblock für 2 Min. bei 80- 90 °C Denature samples: in a thermoblock for 2 minutes at 80-90 ° C
3434
Tabelle 4 Sequenzen der verwendeten Primer, Genloci und Fragmentlänge des PCR-ProduktesTable 4 Sequences of the primers used, gene loci and fragment length of the PCR product
35 35
5. TaqMan® RT-PCR5. TaqMan ® RT-PCR
Auf einem inversen Lichtmikroskop (Leitz Diavert) werden die PSA- und Cytokeratin-positiven Tumorzellen und Tumor- Zellhaufen mit einer sterilen feinen Nadel mikrodissek- tiert und in ein 1,5 ml steriles Reaktionsgefäß (Eppendorf Biopure) überführt. Die RNA-Isolierung wird strikt nach den Protokollen des RNeasy purification kit for total RNA minipreparation ( Fa. Qiagen, Hilden) durchgeführt, bestehend aus: RNeasy Mini Spin Colums, Collection tubes 1,5 und 2 ml, Puffer RTL, Puffer RW1, Puffer RPE und RNase-freiem Wasser) . Die RNA wird in einer two-tube- Reaktion in cDNA umgeschrieben. Dies wird genau nach den Protokollen für den Omniscript Reverse Transcriptase Kit (Fa. Qiagen, Hilden) durchgeführt. Das Reaktionsvolumen beträgt 20 μl . Das Reaktionsgemisch besteht aus RT 1 x Puffer, dNTPs (je 0,5 mM) 1 μM Oligo-dT primer, 10 Einheiten RNase Inhibitor, 4 Einheiten Omniscript Reverse Transcriptase und RNase-freiem Wasser. Für die RT-PCR werden die RNA-Proben zunächst bei 65 °C für 5 min denaturiert und anschließend auf Eis gestellt.The PSA- and cytokeratin-positive tumor cells and tumor cell clusters are microdissected with a sterile fine needle on an inverted light microscope (Leitz Diavert) and transferred to a 1.5 ml sterile reaction vessel (Eppendorf Biopure). The RNA isolation is carried out strictly according to the protocols of the RNeasy purification kit for total RNA minipreparation (from Qiagen, Hilden), consisting of: RNeasy Mini Spin Colums, Collection tubes 1.5 and 2 ml, buffer RTL, buffer RW1, buffer RPE and RNase-free water). The RNA is transcribed into cDNA in a two-tube reaction. This is carried out exactly according to the protocols for the Omniscript Reverse Transcriptase Kit (Qiagen, Hilden). The reaction volume is 20 μl. The reaction mixture consists of RT 1 x buffer, dNTPs (0.5 mM each) 1 μM oligo-dT primer, 10 units RNase inhibitor, 4 units Omniscript Reverse Transcriptase and RNase-free water. For the RT-PCR, the RNA samples are first denatured at 65 ° C for 5 min and then placed on ice.
Die RT-PCR kann auf einem Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg) , einem Gene Amp R PCR System 9700 (PE Applied Biosystems) oder einem handelsüblichen, vergleichbaren Thermocycler anderer Hersteller durchgeführt werden. Die PCR besteht aus einem 37 °C Inkubationsschritt für 60 min gefolgt von einem 93 °C Denaturierungsschritt . Die RNA-Isolierungen und die RT-PCR können des weiteren mit allen handelsüblichen Verfahren durchgeführt werden, die für geringe Gewebemengen geeignet sind, z.B. dem ExpressDirect ™ Kit For mRNA Capture And RT System For RT-PCR (Pierce Rockford) .RT-PCR can be performed on an Eppendorf Mastercycler, Eppendorf Mastercycler Gradient (Eppendorf, Hamburg), a Gene Amp R PCR System 9700 (PE Applied Biosystems) or a commercially available, comparable thermal cycler from other manufacturers. The PCR consists of a 37 ° C incubation step for 60 min followed by a 93 ° C denaturation step. The RNA isolations and the RT-PCR can furthermore be carried out using all commercially available methods which are suitable for small amounts of tissue, e.g. the ExpressDirect ™ Kit For mRNA Capture And RT System For RT-PCR (Pierce Rockford).
Die Echtzeit PCR kann auf einem ABI Prism 9700 HT Sequen- ce Detection System (PE Applied Biosystems, Weiterstadt) in 96 oder 384 well Platten, abgedichtet mit einer optisch durchlässigen Folie (ABI PRISM TM optical adhesive 36Real-time PCR can be performed on an ABI Prism 9700 HT Sequence Detection System (PE Applied Biosystems, Weiterstadt) in 96 or 384 well plates, sealed with an optically transparent film (ABI PRISM TM optical adhesive 36
Covers, Foster City) , durchgeführt werden. Die Reaktionen werden üblicherweise in Doppel- oder Dreifachbestimmungen nach den Vorschriften für TaqMan-PCR nach PE Applied Biosystems (Weiterstadt) durchgeführt. Das Reaktionsgemisch besteht aus einem TaqMan R Universal PCR Master Mix, plus jeCovers, Foster City). The reactions are usually carried out in double or triple determinations according to the regulations for TaqMan PCR according to PE Applied Biosystems (Weiterstadt). The reaction mixture consists of a TaqMan R Universal PCR Master Mix, plus each
90 nM der beiden PSA spezifischen Primer (forward 5'- TTCACCCTCAGAAGGTGACCA- TaqMan-Sonde (5'-90 nM of the two PSA-specific primers (forward 5'- TTCACCCTCAGAAGGTGACCA- TaqMan probe (5'-
CCAGCGTCCAGCACACAGCATGA) . Der Temperaturgradient besteht aus einem anfänglichen 50 °C Inkubationsschritt für 2 min gefolgt von einem 95 °C Denaturierungsschritt für 10 min; anschließend werden 40-60 Zyklen gefahren, die aus einem 95 °C Denaturierungsschritt für 15 sec und einem 60 °C Amplifikationsschritt für 1 min bestehen. Der Lauf und die Auswertung erfolgten mit der SDS-Software (PE Applied Biosystems, Weiterstadt) . Primer und TaqMan-Sonde sowie der TaqMan Mastermix können von verschiedenen Anbietern genutzt werden.CCAGCGTCCAGCACACAGCATGA). The temperature gradient consists of an initial 50 ° C incubation step for 2 min followed by a 95 ° C denaturation step for 10 min; 40-60 cycles are then run, which consist of a 95 ° C denaturation step for 15 seconds and a 60 ° C amplification step for 1 minute. The run and the evaluation took place with the SDS software (PE Applied Biosystems, Weiterstadt). Primer and TaqMan probe as well as the TaqMan mastermix can be used by different providers.
Als Positivkontrolle und zur Etablierung der TaqMan-PCR wurde RNA aus Zellen einer LNCaP Zellkultur isoliert, die dafür bekannt ist, dass sie PSA exprimieren. Als Negativkontrolle dienen Lymphozyten von Frauen.As a positive control and to establish the TaqMan PCR, RNA was isolated from cells of an LNCaP cell culture that is known to express PSA. Lymphocytes from women serve as a negative control.
6. Beispiele für die Zuordnung der zirkulierenden Zellen zu Bereichen des Primärtumors6. Examples of the assignment of the circulating cells to areas of the primary tumor
a) Untersuchung einzelner Patientena) Examination of individual patients
Bei einzelnen Patienten wurde nach dem beschriebenen Verfahren die Mirkosatellitenmarker in der DNA von aus dem peripheren Blut isolierten PSA-positiven e- pithelialen Zellen und aus einzelnen Foci des Primärtumors bestimmt. Die Mikrosatellitenmarker wurden nach dem Protokoll wie unter 4. beschrieben aus DNA bestimmt, die nach den Protokollen 1 und 2 gewonnen wurde . Die Prostatapräparate wurden vor der DNA- Isolierung nach dem von Schmid et al . (Schmid HP et 37In individual patients, the microscopic marker in the DNA of PSA-positive epithelial cells isolated from peripheral blood and from individual foci of the primary tumor was determined using the described method. The microsatellite markers were determined according to the protocol as described under 4. from DNA, which was obtained according to protocols 1 and 2. The prostate preparations were isolated before DNA isolation according to the Schmid et al. (Schmid HP et 37
al . , Akt Urologie 1993) beschriebenen Verfahren in Großflächenschnitten im Abstand von 3 bis 4 mm systematisch aufgearbeitet und eine detaillierte kartographische Erfassung der Karzinomausdehnung wurde erstellt. Hierbei wurde nach Farbmarkierung des operativen Schnittrandes die Tumorgröße, die Lage des Tumors im Verhältnis zur Pseudokapsel der Prostata (Infiltration oder Penetration der Kapsel) und das Heranreichen oder Überschreiten der operativen Schnittränder in der durch das Karzinom dokumentiert. Histologisch gesichertes Tumorgewebe wurde dann aus dem paraffineingebetteten Material des Primärtumors gewonnen. Die Fig. 7 zeigt eine sogenannte Tumorlandkarte in der die Entnahmeorte markiert sind.al. , Akt Urologie 1993), the method described in large area sections at a distance of 3 to 4 mm was systematically processed and a detailed cartographic recording of the carcinoma extension was created. After color marking of the surgical margin, the tumor size, the position of the tumor in relation to the pseudocapsule of the prostate (infiltration or penetration of the capsule) and the reaching or exceeding of the surgical margins in the carcinoma were documented. Histologically confirmed tumor tissue was then obtained from the paraffin-embedded material of the primary tumor. 7 shows a so-called tumor map in which the removal sites are marked.
Das Alter der Patienten, das Stadium und histopatho- logische Parameter des Tumors sind in der folgenden Tabelle zusammengefaßt :The age of the patients, the stage and histopathological parameters of the tumor are summarized in the following table:
38 38
Tabelle 5: Vergleich der genetischen Alterationen zwischen verschiedenen Foci eines Primartumores und den aus Blut isolierten zirkulierenden Tumor-ZellhaufenTable 5: Comparison of the genetic alterations between different foci of a primary tumor and the circulating tumor cell clusters isolated from blood
hom. = Homozygot AI Allel 1 hom. = homozygous AI allele 1
LOH = Loss of Heterozygosity A2 Allel 2 39LOH = loss of heterozygosity A2 allele 2 39
Damit ist nachgewiesen, daß mittels der Analyse von Mikrosatelliten DNS zirkuliertende Zellen bestimmten Foci eines Primärtumors unmittelbar zugewiesen werden können.This proves that by means of the analysis of microsatellite DNA cells circulating certain foci of a primary tumor can be assigned directly.
Damit ist es auch möglich, durch Untersuchung der im Blut zirkulierenden Tumorzellhaufen zu ermitteln, in welchem Stadium sich der Primärtumor befindet bzw. welchen Verlauf die Erkrankung bzw. eine therapeutische Maßnahme nimmt .It is thus also possible to determine, by examining the tumor cell clusters circulating in the blood, the stage in which the primary tumor is located or the course of the disease or a therapeutic measure.
b) Untersuchung eines Patientenkollektivsb) Examination of a patient collective
Weiterhin wurde die DNA des organbegrenzt-wachsenden Prostatakarzinoms von 204 Patienten mittels der dargestellten Verfahren zur Bestimmung von Veränderungen in polymorphen DNS-Sequenzen untersucht. Eine Kopplung zwischen der Veränderung in einem polymorphen Marker und einem Funktionsgenen konnte gezeigt werden. Es wurde daher in Prostatakarzinomen die Marker D7S522, p 53, D8S522, NEFL, D10S541, D13S153, D16S400, D16S402, D16S422, D17S855 aus 6 chromosomalen Lokalisationen untersucht. Mit Hilfe einer non-parametrisehen multivariaten statistischen Methode (hierarchic-agglomerative cluster analy- sis) wurden Klassen von Tumoren mit spezifischen MS Mutationen gebildet („pattern recognition") (Fig. 2) .Furthermore, the DNA of organ-growing prostate cancer from 204 patients was examined using the presented methods for determining changes in polymorphic DNA sequences. A link between the change in a polymorphic marker and a functional gene could be shown. The markers D7S522, p 53, D8S522, NEFL, D10S541, D13S153, D16S400, D16S402, D16S422, D17S855 from 6 chromosomal locations were therefore investigated in prostate carcinomas. With the help of a non-parametric multivariate statistical method (hierarchic-agglomerative cluster analysis), classes of tumors with specific MS mutations were formed (“pattern recognition”) (FIG. 2).
Durch die mathematische Clusteranalyse wurden 3 Subgrup- pen mit bis zu 4 spezifischen DNS-Veränderungen herausgearbeitet: 1. p53, D16S402 oder D16S400 (n=10) ; 2. D8S258 und/oder NEFL, D13S153, D16S402 (n=9) 3. D10S541, D7S522, D13S153, D16S400 (n=ll) . Eine eher seltene Kombination aus p53 und D13S153 (n=6) wurde in Tumoren Patienten mit signifkant früherem Erkrankungsalter im Vergleich zu allen anderen Patienten gefunden (X=59 Jahre; STD=4 ; X=64 Jahre; STD=4 ; p=0.02). Die meisten Rezidive wurde hingegen in der Subgruppe 3 gefunden (4/9) . 40The mathematical cluster analysis worked out 3 subgroups with up to 4 specific DNA changes: 1. p53, D16S402 or D16S400 (n = 10); 2. D8S258 and / or NEFL, D13S153, D16S402 (n = 9) 3. D10S541, D7S522, D13S153, D16S400 (n = ll). A rather rare combination of p53 and D13S153 (n = 6) was found in tumors patients with a significantly earlier age compared to all other patients (X = 59 years; STD = 4; X = 64 years; STD = 4; p = 0.02 ). Most recurrences, however, were found in subgroup 3 (4/9). 40
Man kann zusammenfassend sagen, dass multiple genetische Entwicklungs- und Progressionswege für das Prostatakarzinom existieren müssen, die sich mit Hilfe der Kombination der untersuchten Marker indizieren lassen (Fig. 3) . Es ist festzuhalten, dass die Tumorprogression mit einer absoluten Zunahme an DNS-Veränderungen in polymorphen Sequenzen einher geht. Trotzdem läßt sich an Hand der vorliegenden Studienergebnisse eine Hierarchie der Genmutationen ableiten, die zur Ausbildung klinisch bestimmbaren Subtypen des Prostatakarzinoms führen (Fig. 3) . So kann man bei p53, D10S541 und NEFL bzw. D8S258 von Initiationsmutationen sprechen und bei denen auf Chromosom 16q und 13q von Verstärkermutationen, die nicht primär eine Tumorprogression einleiten.In summary, it can be said that multiple genetic development and progression pathways for prostate cancer must exist, which can be indicated with the aid of the combination of the investigated markers (FIG. 3). It should be noted that tumor progression is associated with an absolute increase in DNA changes in polymorphic sequences. Nevertheless, a hierarchy of the gene mutations that lead to the development of clinically determinable subtypes of prostate cancer can be derived from the available study results (FIG. 3). Thus one can speak of initiation mutations in p53, D10S541 and NEFL or D8S258 and in those on chromosome 16q and 13q one may speak of amplifier mutations which do not primarily initiate tumor progression.
Dieser Ansatz wurde auf den Vergleich der Veränderungen von polymorphen DNS-Sequenzen zwischen dem Primärtumor und den zirkulierenden Zellen an 24 Patienten übertragenThis approach was applied to the comparison of changes in polymorphic DNA sequences between the primary tumor and the circulating cells in 24 patients
(Fig. 4) . Dabei wurde gefunden, daß die Freisetzung von Tumorzellen aus dem primären Tumor mit bestimmten Veränderungen in den polymorphen DNS-Sequenzen verbunden ist(Fig. 4). It was found that the release of tumor cells from the primary tumor is associated with certain changes in the polymorphic DNA sequences
(Fig. 5) . Der Cluster mit dem Marker D10S541, der mit einer frühen Metastasierung in Zusammenhang steht wird auch bevorzugt in den Zellhaufen des Blutes gefunden. Dagegen stehen Veränderungen in dem Marker D8S258 einer Aussaat der Zellen in das periphere Blut entgegen (Fig. 6) . Die Auswertung des krankheitsfreien Intervalls zeigt, das eine Veränderung dieses polymorphen DNS-Markers mit einer guten Prognose assoziiert ist (Fig. 6) .(Fig. 5). The cluster with the marker D10S541, which is associated with early metastasis, is also preferably found in the cell clusters of the blood. In contrast, changes in the marker D8S258 prevent the cells from being sown into the peripheral blood (FIG. 6). The evaluation of the disease-free interval shows that a change in this polymorphic DNA marker is associated with a good prognosis (FIG. 6).
c) Beispiele für den Nachweis eines Prostatakarzinoms über den Nachweis von Zellclustern im peripheren Blut der Patienten und die Vorhersage des Ergebnisses einer Prostatabiopsiec) Examples of the detection of prostate cancer by the detection of cell clusters in the peripheral blood of the patient and the prediction of the result of a prostate biopsy
Bei 19 Patienten wurden vor transrektal-sonographisch gesteuerte Prostatabiopsie je 50 ml Blut entnommen. Nach dem hier beschriebenen Verfahren wurden Zytokeratin- und 41In 19 patients, 50 ml of blood were drawn before a transrectal-sonographically controlled prostate biopsy. According to the procedure described here, cytokeratin and 41
PSA-positive intakte kleinzellige Zellhaufen isoliert.PSA-positive intact small cell clusters isolated.
Bei 8 Patienten ergab die Biopsie ein Prostatakarzinom (PCa) und bei 11 benignes Prostatagewebe (BPH) . Die Patienten wiesen folgende Serum-PSA und Prostatavolumina auf:The biopsy revealed prostate cancer (PCa) in 8 patients and benign prostate tissue (BPH) in 11. The patients had the following serum PSA and prostate volumes:
Während t-PSA und f/t-PSA im Serum keine sichere Vorhersage des Biopsieergebnisses erlaubten, ermöglichte die Untersuchung der Zellhaufen eine korrekte Vorhersage in 14 von 19 der untersuchten Patienten (Effizienz der Untersuchung 74%) . While t-PSA and f / t-PSA in the serum did not allow a reliable prediction of the biopsy result, the examination of the cell clusters made a correct prediction possible in 14 out of 19 of the examined patients (efficiency of the examination 74%).

Claims

4242
Patentansprücheclaims
1. Verfahren zum Nachweis und zur Charakterisierung von Primärtumoren bzw. einzelner Bereiche von Primärtumore , dadurch • g e k e n n z e i c h n e t , daß aus Probenmaterial darin befindliche Zellhaufen von Tumorzellen isoliert bzw. angereichert und anschließend genetische Veränderungen der isolierten Zellhaufen analysiert werden.1. A method for the detection and characterization of primary tumors or individual areas of primary tumors, by means of the fact that cell clusters therein are isolated or enriched from tumor cells from sample material and then genetic changes in the isolated cell clusters are analyzed.
2. Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß als Probenmaterial Zellkulturen, Blut, Urin, Nippleaspiratflüssig- keit der weiblichen Brust oder Gewebeproben aus2. The method according to the preceding claim, characterized in that the sample material is cell cultures, blood, urine, nipple aspirate fluid from the female breast or tissue samples
■ Primärtumoren verwendet werden. ■ primary tumors are used.
3. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß polymorphe DNS des Primärtumors oder einzelner Bereiche des Primärtumors bzw. Veränderungen hiervon erfaßt und mit entsprechender polymorpher DNS der Zell- haufen bzw. Änderungen hiervon verglichen werden.3. The method according to any one of the preceding claims, characterized in that polymorphic DNA of the primary tumor or individual areas of the primary tumor or changes thereof are detected and compared with corresponding polymorphic DNA of the cell clusters or changes thereof.
4. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß die DNS der polymorphen Sequenzen D7S522, D8S133, D8S258, D8S298, D8S265, NEFL, D10S541, D10S1765,4. The method according to any one of the preceding claims, characterized in that the DNA of the polymorphic sequences D7S522, D8S133, D8S258, D8S298, D8S265, NEFL, D10S541, D10S1765,
'D10S579, D13S153, D16S400, D16S402, D16S413, D16S422, p53, BB1, BB2 , CAII, CAIII, CAIV, CAV und/oder D17S855 analysiert werden. 43 ' D10S579, D13S153, D16S400, D16S402, D16S413, D16S422, p53, BB1, BB2, CAII, CAIII, CAIV, CAV and / or D17S855. 43
Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß die polymorphe DNS vor der Analyse vervielfältigt wird.Method according to one of the preceding claims, characterized in that the polymorphic DNA is duplicated before the analysis.
Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß die polymorphe DNS jeweils dreier polymorpher Sequenzen D7S522, D8S258, D16S400 oder NEFL, D13S153, D17S855 oder D10S541, D16S402, D16S422 gemeinsam analysiert und/oder vervielfältigt wird.Method according to the preceding claim, characterized in that the polymorphic DNA of three polymorphic sequences D7S522, D8S258, D16S400 or NEFL, D13S153, D17S855 or D10S541, D16S402, D16S422 is analyzed and / or reproduced together.
Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß die polymorphe DNS vor der Analyse mittels Polymerase-Kettenreaktion (PCR) vervielfältigt wird.Method according to the preceding claim, characterized in that the polymorphic DNA is multiplied before the analysis by means of polymerase chain reaction (PCR).
Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß die polymorphen DNS unter Verwendung der folgenden Primerpaare vervielfältigt wird:Method according to the preceding claim, characterized in that the polymorphic DNA is duplicated using the following primer pairs:
GCAGGACATGAGATGACTGA und GTTATGCCACTCCCTCACAC ( für D7S522) ;GCAGGACATGAGATGACTGA and GTTATGCCACTCCCTCACAC (for D7S522);
GTTTGAAGAATTTGAGCCAACC und TTCTTCTGCACACTTGGCAC ( für BB1+2) ;GTTTGAAGAATTTGAGCCAACC and TTCTTCTGCACACTTGGCAC (for BB1 + 2);
CTCGAGGTCTCATCCTCTTTCC und GCAGAGGTGCACAAAGGAGTAA ( für CAII) ;CTCGAGGTCTCATCCTCTTTCC and GCAGAGGTGCACAAAGGAGTAA (for CAII);
AGGCCCACAGAGGAGATAACAG und CAGGTGTGGTAGATGCCAAAGA (für CAIII) ;AGGCCCACAGAGGAGATAACAG and CAGGTGTGGTAGATGCCAAAGA (for CAIII);
GCAACTTATCCAAACCCTGACC und AGAGTGGACTAGGAAATGCTAGGAG (CAIV) ;GCAACTTATCCAAACCCTGACC and AGAGTGGACTAGGAAATGCTAGGAG (CAIV);
AGTTCCTGACTGGGAATTCGAT und TTGGCCAAATTACACACCTTTG (für CAV) ;AGTTCCTGACTGGGAATTCGAT and TTGGCCAAATTACACACCTTTG (for CAV);
TTCCATTTGTCTCGGTT und AGTCTCCTCGTCTCACACCT (für D7S2550) ; CAGTGCTGGAGTTGTTCAAG und CTGGGAGTCAAGTGTTTTGG (für 44TTCCATTTGTCTCGGTT and AGTCTCCTCGTCTCACACCT (for D7S2550); CAGTGCTGGAGTTGTTCAAG and CTGGGAGTCAAGTGTTTTGG (for 44
D7S2429 ) ;D7S2429);
TGCTAAGTCTTGATTTTGCC und AACGGTCATCTGTGTTCG (für D7S2467) ;TGCTAAGTCTTGATTTTGCC and AACGGTCATCTGTGTTCG (for D7S2467);
GGTGTTTGTGTCATTACGCT und TTTGCTGTAGAGGATGCAAT (für D7S478) ;GGTGTTTGTGTCATTACGCT and TTTGCTGTAGAGGATGCAAT (for D7S478);
TTCGGGCTCTCTGTTATAAA und CCGAAGCAGGATTTTATTTC (für D7S670) ;TTCGGGCTCTCTGTTATAAA and CCGAAGCAGGATTTTATTTC (for D7S670);
AGCTGCCAGGAATCAACTGAGAG und GATGCTCACATAAAGGAGGGAGG (für D8S258) ;AGCTGCCAGGAATCAACTGAGAG and GATGCTCACATAAAGGAGGGAGG (for D8S258);
CCAATACCTGCAGTAGTGCC und GAGCTGCTTAACACATAGGG (für NEFL) ; CACCACAGACATCTCACAACC und CCAGTGAATAGTTCAGGGATGG (für D10S541) ;CCAATACCTGCAGTAGTGCC and GAGCTGCTTAACACATAGGG (for NEFL); CACCACAGACATCTCACAACC and CCAGTGAATAGTTCAGGGATGG (for D10S541);
AGGGTTATGTATAACCGACTCC und GTCTAAGCCCTCGAGTTGTGG (für D13S153) ;AGGGTTATGTATAACCGACTCC and GTCTAAGCCCTCGAGTTGTGG (for D13S153);
GGTTCACAATTGGACAGTAT und GAACCCTCCATGCTGACATT (für D16S400) ;GGTTCACAATTGGACAGTAT and GAACCCTCCATGCTGACATT (for D16S400);
GTACCCATGTACCCCCAATA und CAAAGCACCACATAGACTAA (für D16S402) ;GTACCCATGTACCCCCAATA and CAAAGCACCACATAGACTAA (for D16S402);
GAGAGGAAGGTGGAAATACA und GTTTAGCAGAATGAGAATAT (für D16S422) ;GAGAGGAAGGTGGAAATACA and GTTTAGCAGAATGAGAATAT (for D16S422);
AATAAATTCCCACTGCCACTC und ATCCCCTGAGGGATACTATTC (für' p53) ; ' GGATGGCCTTTTAGAAAGTGG und ACACAGACTTGTCCTACTGCC (für D17S855) .AATAAATTCCCACTGCCACTC and ATCCCCTGAGGGATACTATTC (for 'p53);'' GGATGGCCTTTTAAAAAGTGG and ACACAGACTTGTCCTACTGCC (for D17S855).
9. Verfahren nach einem der Ansprüche 5 bis 8, dadurch gekennzeichnet, daß die erzeugten vervielfältigten DNS-Fragmente mittels Kapillarelektrophorese getrennt und analysiert werden.9. The method according to any one of claims 5 to 8, characterized in that the reproduced DNA fragments generated are separated and analyzed by means of capillary electrophoresis.
10. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß zur Isolierung bzw. Anreicherung von Tumorzellen aus dem Probenmaterial Cytokeratin-positive und/oder für gewebsspezifische Proteine positive epitheliale 4510. The method according to any one of the preceding claims, characterized in that for the isolation or enrichment of tumor cells from the sample material cytokeratin-positive and / or epithelial positive for tissue-specific proteins 45
Zellen isoliert bzw. angereichert werden.Cells are isolated or enriched.
11. Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, aus dem Probenmaterial, gegebenenfalls nach Homogenisierung in einem Lösungsmittel , mittels Dichtegradientenzentrifugation epitheliale Zellen angereichert werden und von den angereicherten Zellen mittels immuno- magnetischer Zellisolierung Cytokeratin-positive und/oder für gewebsspezifische Proteine positive Zellhaufen abgetrennt werden.11. The method according to the preceding claim, characterized in that epithelial cells are enriched from the sample material, optionally after homogenization in a solvent, by means of density gradient centrifugation and cytokeratin-positive and / or cell clusters positive for tissue-specific proteins are separated from the enriched cells become.
12. Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß als Medium für die Dichtegradientenzentrifugation ein hyperosmola- res Medium verwendet wird .12. The method according to the preceding claim, characterized in that a hyperosmolar medium is used as the medium for the density gradient centrifugation.
13. Verfahren nach dem vorhergehenden Anspruch, dadurch gekennzeichnet, daß als hyperosmolarer Puffer mindestens eines der folgenden Medien 13,8 % (Gew/Vol) Natriumdiatrizoat und 8 % (Gew/Vol) Dextran 500 in H20 (Polymorphprep) o- der13. The method according to the preceding claim, characterized in that as hyperosmolar buffer at least one of the following media 13.8% (w / v) sodium diatrizoate and 8% (w / v) dextran 500 in H 2 0 (polymorph prep) or
13 % (Gew/Vol) Nycodenz, 0,58 % (Gew/Vol) NaCl und 5 mM Tricine-NaOH pH 7,4 in H20 (NycoPrep) verwendet wird.13% (w / v) Nycodenz, 0.58% (w / v) NaCl and 5 mM Tricine-NaOH pH 7.4 in H 2 0 (NycoPrep) is used.
14. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß die genetischen Veränderungen der isolierten Zellhaufen mittels Clusteranalyse analysiert werden.14. The method according to any one of the preceding claims, characterized in that the genetic changes in the isolated cell clusters are analyzed by means of cluster analysis.
15. Verwendung eines Verfahrens nach einem der vorhergehenden Ansprüche zur molekularen Charakte- 4615. Use of a method according to one of the preceding claims for molecular character 46
risierung von Tumoren oder Tumorbereichen oder zur Bestimmung der Klonalität von aus Probenmaterial isolierten Zellhaufen sowie zum Nachweis eines Tumors zur Bestimmung des Tumorstadiums , des Metastasierungspotentials, der Therapiebedürftigkeit, der Therapierbarkeit eines Tumors oder eines Bereiches eines Tumors sowie der Verlaufsprognose der Erkrankung bzw. einer Therapie .Rization of tumors or tumor areas or to determine the clonality of cell clusters isolated from sample material and to detect a tumor to determine the tumor stage, the metastasis potential, the need for therapy, the ability to treat a tumor or an area of a tumor and the prognosis of the progression of the disease or therapy.
16. Verwendung nach dem vorhergehenden Anspruch zum Nachweis und/oder zur Charakterisierung von Tumoren oder Tumorbereichen von Mammakarzinomen, Ovarialkarzinomen, Kolonkarzinomen, Magenkarzinomen, Prostatakarzinomen und/oder Blasenkarzinomen. 16. Use according to the preceding claim for the detection and / or for the characterization of tumors or tumor areas of breast cancer, ovarian cancer, colon cancer, gastric cancer, prostate cancer and / or bladder cancer.
EP03725055A 2002-04-17 2003-04-17 Method for characterizing primary tumors Withdrawn EP1497657A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10217102A DE10217102B4 (en) 2002-04-17 2002-04-17 Method for the characterization of primary tumors
DE10217102 2002-04-17
PCT/EP2003/004037 WO2003087405A2 (en) 2002-04-17 2003-04-17 Method for characterizing primary tumors

Publications (1)

Publication Number Publication Date
EP1497657A2 true EP1497657A2 (en) 2005-01-19

Family

ID=29224530

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03725055A Withdrawn EP1497657A2 (en) 2002-04-17 2003-04-17 Method for characterizing primary tumors

Country Status (5)

Country Link
US (2) US20060147911A1 (en)
EP (1) EP1497657A2 (en)
AU (1) AU2003227645A1 (en)
DE (1) DE10217102B4 (en)
WO (1) WO2003087405A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011004404A1 (en) * 2009-07-10 2011-01-13 Decode Genetics Ehf Genetic variants for predicting risk of glaucoma
DE102010060964A1 (en) 2010-12-02 2012-06-06 Universitätsklinikum Hamburg-Eppendorf Method for predicting the therapeutic efficacy of EGFR inhibitors
CN112921097A (en) * 2021-04-20 2021-06-08 四川大学华西医院 Gene detection kit for fibroblast/myofibroblast tumors and application thereof
KR102615053B1 (en) * 2022-03-03 2023-12-20 서울대학교산학협력단 A biomarker for diagnosing BCR-ABL-independent tyrosine kinase inhibitor resistance comprising FAM167A and a composition for preventing or treating chronic myeloid leukemia targeting FAM167A

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000047998A1 (en) * 1999-02-10 2000-08-17 Cell Works Inc. Class characterization of circulating cancer cells isolated from body fluids and methods of use

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU702726B2 (en) * 1994-08-31 1999-03-04 Johns Hopkins University School Of Medicine, The Detection of hypermutable nucleic acid sequence in tissue
US5925519A (en) * 1996-06-03 1999-07-20 The Regents Of The University Of California Genetic alterations associated with prostate cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000047998A1 (en) * 1999-02-10 2000-08-17 Cell Works Inc. Class characterization of circulating cancer cells isolated from body fluids and methods of use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WEISS LEONARD: "Heterogeneity of cancer cell populations and metastasis", CANCER AND METASTASIS REVIEWS, vol. 19, no. 3-4, 2000, pages 351 - 379, ISSN: 0167-7659 *

Also Published As

Publication number Publication date
AU2003227645A8 (en) 2003-10-27
US20060147911A1 (en) 2006-07-06
DE10217102B4 (en) 2005-04-14
WO2003087405A2 (en) 2003-10-23
AU2003227645A1 (en) 2003-10-27
WO2003087405A3 (en) 2004-06-17
US20090035774A1 (en) 2009-02-05
DE10217102A1 (en) 2003-11-13

Similar Documents

Publication Publication Date Title
Weiss et al. Comparative genomic hybridisation.
Bauer et al. Detection of epithelial cells in dried blood stains by reverse transcriptase-polymerase chain reaction
DE69737398T2 (en) Genetic changes related to prostate cancer
Ambros et al. Intratumoural heterogeneity of 1p deletions and MYCN amplification in neuroblastomas
WO2005085471A2 (en) Method and means for differential diagnosis of thyroid tumours
CN100471861C (en) Rapid extraction of RNA from cells and tissues
DE10143776A1 (en) Selection and determination of specific cells, useful particularly for diagnosis and monitoring of tumors, by antibody-mediated selection then detecting specific mRNA
DE19833738A1 (en) Process for isolating cancer cells from cell-containing body fluids and kits for performing this process
DE19904267A1 (en) Method for the enrichment of tumor cells from a body fluid and a suitable kit for this
EP1532444B1 (en) Method for analyzing body fluids for the presence of cancer cells and corresponding analysis kits
Forte et al. The potential for liquid biopsies in the precision medical treatment of breast cancer
US20090136942A1 (en) Analysis of Extracellular RNA
US7785842B2 (en) Comparative analysis of extracellular RNA species
CN111187842A (en) Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer
Glöckner et al. Amplification of growth regulatory genes in intraductal breast cancer is associated with higher nuclear grade but not with the progression to invasiveness
US20220214346A1 (en) Circulating tumor cell based biomarker composition for diagnosis and prognosis of metastatic prostate cancer
EP1448792A1 (en) Diagnosis kit, dna chip, and methods for diagnosing or supervising the treatment of testicular cancer
DE10217102B4 (en) Method for the characterization of primary tumors
Ojopi et al. Comparative genomic hybridization detects novel amplifications in fibroadenomas of the breast
CN111690746A (en) Platelet RNA marker related to lung cancer and application thereof
WO2003023059A2 (en) Method and kit for the diagnosis or treatment control of intestinal carcinoma
EP1409746A2 (en) Method and kit for diagnosing or controlling the treatment of breast cancer
WO2004023110A1 (en) Method for the immunocytological or molecular detection of disseminated tumor cells in a body fluid and kit that is suitable therefor
DE60316464T2 (en) NEW REAL-TIME RT-PCR METHOD FOR SENSITIVELY DETECTING MULTIPLE MAGE GEN TRANSCRIPTS
Hoon et al. [27] Assessment of genetic heterogeneity in tumors using laser capture microdissection

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041116

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

17Q First examination report despatched

Effective date: 20060831

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080412