EP1432732A2

EP1432732A2 - Pharmaceutical composition for diagnosis, prevention or treatment of a tumorous state, comprising a modulator of the actin polymerisation state

Info

Publication number: EP1432732A2
Application number: EP02745538A
Authority: EP
Inventors: Christian Auclair; Valérie AMSELLEM; Martial Hervy; Frédéric SUBRA
Original assignee: Centre National de la Recherche Scientifique CNRS; Institut Gustave Roussy (IGR); Bioalliance Pharma SA; Ecole Normale Superieure de Cachan
Current assignee: Centre National de la Recherche Scientifique CNRS; Institut Gustave Roussy (IGR); Bioalliance Pharma SA; Ecole Normale Superieure de Cachan
Priority date: 2001-06-18
Filing date: 2002-06-18
Publication date: 2004-06-30
Also published as: CA2450845A1; FR2825928B1; US20040191230A1; WO2002102846B1; FR2825928A1; WO2002102846A3; AU2002317259A1; JP2005504521A; WO2002102846A2; JP4271026B2; US20090286720A1

Abstract

The invention relates to a pharmaceutical composition in the field of oncology, for diagnosis, prevention or treatment of a tumorous state, said pharmaceutical composition comprising an active agent capable of stabilising the actin network of the cellular cytoskeleton, in particular a DNA, coding for the zyxin gene. The invention also relates to a method for identification of compounds capable of stabilising the actin network of the cellular cytoskeleton and, furthermore, a diagnostic method for a tumorous state and a method for analysing the tumoral phenotype of a patient, based on quantification of the expression of zyxin by the cells.

Description

PHARMACEUTICAL COMPOSITION FOR THE DIAGNOSIS, PREVENTION OR TREATMENT OF A TUMOR PATHOLOGY, COMPRISING AN AGENT MODULATING THE POLYMERIZATION OF ACTIN.

The present invention relates to the field of oncology, it is based on observations of the modification of certain cellular phenotypic characteristics linked to the structure of the cytoskeleton, such as adhesion and motility, of cells when said cells evolve towards a phenotype. tumor.

These phenotypic characteristics are linked to the structure of the cytoskeleton of said cells, the stability of which is ensured by the polymerization of the actin networks which constitute it.

The invention is based on the correlation observed by the applicant between the under-expression of genes involved in the stabilization of the actin network of the cytoskeleton of cells, such as for example the under-expression of the zyxin gene and the phenotypic transformation d 'a normal phenotype versus a tumor phenotype of said cells.

The invention is also based on the demonstration, thanks to the experimental work carried out, that the administration of a pharmaceutical composition capable of stabilizing the actin network of the cytoskeleton of the cell, such as for example compounds inducing the overexpression of the discomfort of zyxin in a cell comprising a tumor phenotype causes the phenotypic reversion of said cell to a normal phenotype.

These results made it possible to understand that the structuring of the cytoskeleton via the dynamics of actin polymerization plays an essential role in the maintenance of the invasive tumor phenotype and that consequently a pharmacological action resulting in an increase in the amount of actin F in the stationary state in a tumor cell constitutes a means of reducing the invasiveness of the malignant cell, or even of restoring a normal phenotype.

Thus, the subject of the invention is the identification of compounds capable of modulating the state of polymerization of actin and the use of said compounds for the preparation of medicaments useful for the diagnosis, prevention and / or treatment of pathologies tumor.

Such compounds capable of stabilizing the actin network can for example be inhibitors of cofilin which is an enzyme known for its action on the depolymerization mechanism of actin F, in its active form (dephosphorylated cofilin) it induces rupture of propellers and promotes depolymerization of actin F.

The identification of the genes involved in tumor transformation and in the maintenance of the malignant phenotype is one of the prerequisites for the design of new therapeutic approaches for tumor pathologies. Relevant experimental approaches require the availability of biological materials made up in particular of pairs of the "normal line / tumor line" or "normal tissue / tumor tissue" type. These couples allow the realization of differential expression measurements.

However, these approaches have drawbacks, since the relevance of the results depends on the significance of the couples used. The lines must have a well-characterized phenotype. They must have an immortal non-tumor phenotype and the malignant transformation of the immortal lines should be induced by a single genetic event. Finally, we must be able to easily obtain phenotypic revertants.

The most relevant models are provided by tumor phenotypes induced by oncogenic fusion proteins such as BCR-Abl, PML-RAR which lead to leukemic phenotypes as well as EWS-Fli-

1, responsible for Ewing's sarcoma.

Ewing's sarcoma is a neuroectodermal tumor which is characterized by a chromosomal translocation involving the ql2 band of chromosome 22 reworked with the q24 band of chromosome 11: t (ll; 22) (q24; ql2) (Turc-Carel et al., 1984) leading to the formation of a chimeric gene associating the protooncogene EWS with a member of the ETS family of genes. The breakpoints associated with the majority translocation t (ll; 22) are located in a region of 7 kb belonging to the EWS gene for chromosome 22 and a region of 50 kb belonging to FLI-1 for chromosome 11 (Zucman et al. ., 1993). The result of this chromosomal translocation generates a derivative of chromosome 22 where the 5 'part of the EWS gene is associated with the 3' part of the FLI-1 gene (Delattre et al., 1992). The fusion gene expresses the chimeric protein

EWS-FLI-1 with oncogenic properties. Thus, the chimeric protein EWS-Fli-1 is capable of. transform murine fibroblasts of NIH3T3 type in culture (Ohno et al., 1993) and induce tumors in "nude" mice. The association of the N-terminal domains of EWS and C-terminal of FLI-1 is necessary for its transforming power (May et al., 1993).

In the context of the present invention, a study model has been developed consisting on the one hand of normal murine NIH3T3 fibroblasts, non-tumor immortals and on the other hand of fibroblasts expressing the EWS-Fli-1 fusion protein in a constitutive way and presenting a tumor phenotype in nude mice. This pair of cells makes it possible to carry out an evaluation of the differential expression characterizing the acquisition of the tumor phenotype.

This evaluation was carried out using the ^u cDNA micro-array "from Clontech, making it possible to simultaneously assess the expression of 588 genes.

In a second step, stable phenotypic revertants were obtained by infecting the transformed cells with retroviral vectors coding for antisense RNAs directed against the oncogenic fusion gene. A second pair of cells (tumor cells / non-tumor revertant cells) was thus obtained and could be the subject of a differential expression study.

The experiments carried out within the framework of the present invention have thus made it possible to identify genes whose variation of expression is linked to the expression of the oncogenic protein and to the nature of the phenotype, so as to provide new means of treatment. , prevention or diagnosis, cancers.

Among the experiments carried out within the framework of the present invention, the immunostaining of actin filaments on fibroblasts shows that the malignant transformation of said fibroblasts mediated by a chimeric protein EWS-Fli-1 results in a profound modification of the morphology of fibroblasts with in particular a reduction in focal points. This is accompanied by a reshaping of the cytoskeleton and in particular of the polymerized actin networks.

In particular, it has been demonstrated that the tumor phenotype is influenced by the level of expression of zyxin and that the under-expression of the zyxin gene is a sufficient condition to transform a normal fibroblast into a tumorigenic ibroblast.

It is known that zyxin is a protein comprising LIM domains present in the focal adhesion plates of fibroblasts and the lamellipods of higher eukaryotic cells. These LIM motifs, in the form of a zinc finger, are involved in protein-protein interactions. (Scheimechel et al. 1994. "The LIM domain a new structural motif found in zinc-printer-like proteins". Trends Genêt. 10: 315-320.

Zyxin is involved in regulating the polymerization of actin filaments and has structural and functional properties in common with ActA from Listeria (Golsteyn et al., 1997). Zyxin is supposed to act as an anchoring intermediary between the plasma membrane via α-actinin and the integrins and actin filaments. It is clearly involved in the architecture of the cytoskeleton, adhesion and cell motility (Crawford and Beckerle, 1991). Structurally, zyxin comprises an N-terminal region rich in proline, a nuclear export signal peptide (NES), as well as regions rich in amino acids Histidine and Cysteine forming the LIM motifs in the C-terminal part. (Sadler et al. 1992. "Zyxin and cCRP: Two interactive LIM domain proteins associated with the cytoskeleton". J.Cell.Biol. 119: 1573-1587).

The mechanism of zyxin-dependent tumorigenesis involves changes in motility, adhesion and signaling related to cell-cell and cell-extracellular matrix interactions.

The analysis of differential expression profiles carried out with the above study model made it possible to verify that the morphological modifications dependent on the expression of a chimeric protein EWS-Fli- 1 are correlated with variations in the expression of the zyxin gene.

It has thus been found that the decrease in the expression of the zyxin gene, involved in the stabilization of the actin network involved in the organization of the cell cytoskeleton is directly linked to the acquisition and maintenance of the tumor phenotype and that the induction of the overexpression of said genes leads to the reversal of the tumor phenotype.

Thus, the object of the invention is to provide new pharmaceutical compositions for the treatment and prevention of cancers comprising compounds capable of stabilizing the actin network of the cytoskeleton of a cell for the preparation of a medicament intended for the treatment or cancer prevention.

The research carried out in the context of the invention has made it possible to develop a non-cytotoxic pharmaceutical composition useful for the treatment and / or prevention of cancers. Indeed, a composition according to the invention is capable of restoring a non-tumor phenotype unlike most of the compositions of the prior art which destroy st cells are therefore capable of inducing side effects.

This work has also led to the development of a method for identifying anti-tumor compounds capable of stabilizing the actin network of the cytoskeleton of a cell, based on the detection of the reversion of the tumor phenotype linked to the expression of zyxin.

The present invention therefore relates to a pharmaceutical composition for the treatment, prevention or diagnosis of a tumor pathology, characterized in that it comprises an active agent capable of stabilizing the actin network of the cytoskeleton of a selected cell in the group comprising: - the protein zyxin

- a nucleic acid molecule comprising or consisting of the zyxin gene, a fragment thereof or their complementary sequence, or an antisense nucleic acid thereof, a cell or a set of cells overexpressing the gene zyxin or a protein encoded by a fragment thereof.

- a cofilin inhibitor.

Definitions

In the context of the present invention, the term “zyxin fragment” is understood to mean any polypeptide fragment thereof capable of conserving the biological function of zyxin and in particular its function of stabilizing the actin network of the cytoskeleton.

The term “fragment of the zyxin gene” is intended to mean any fragment of the nucleic acid of zyxin and in particular the cDNAs of said gene coding for zyxin and / or the various functional domains thereof, such as those coding for:

- the N-terminal region of the proline-rich protein, - the nuclear export signal (NES)

- the regions forming the LIM patterns in the C-terminal part.

By derivative of the zyxin gene is meant any nucleic acid chemically modified, or by genetic recombination but retaining the function of said gene, in particular its capacity to code for a polypeptide, when it is expressed in an appropriate host, which retains biological functions of the protein zyxin and in particular its function of stabilizing the actin network of the cell cytoskeleton. Such modifications include, for example, modification, addition or removal of bases, by fusion with other acids nucleic acids, such as, for example, regulatory elements, or chimeric molecules comprising heterologous cDNAs obtained by fusion of the corresponding cDNAs according to techniques known to those skilled in the art.

The term “derivative of the zyxin protein” means any polypeptide modified, for example chemically by association with functional chemical groups, said functional chemical groups being chosen from groups capable of coupling said protein or a fragment thereof. to other molecules, such as, for example, markers, of carrier proteins for the production of an immunogen, enzymes, either on solid supports, such as mineral supports, or organic polymers.

A first embodiment of the invention relates to a pharmaceutical composition comprising the protein zyxin or a functional fragment thereof.

According to this first embodiment, the pharmaceutical composition of the invention comprises the protein zyxin or functional fragments thereof associated with transport vectors chosen from the group comprising:

- lipid systems such as anionic or neutral liposomes, and in particular liposomes based on phosphatidylcholoine (PC) or dioleylphosphatidylcoline (DPE), cationic liposomes, in particular liposomes based on dioctadecyldimethylam onium bromide (diodylylpropyl bromide) trimethylammonium (DOTMA), DOGS (Transfectam ^® ), DDPPES etc., cationic emulsions such as emulsions based on soybean oil and 1,2 diolcoyl-glycero-3-trimethylammonium propane (DOTAP), etc.

- particulate systems: by way of example and without limitation, there may be mentioned either microparticles based on co-glycolide polydactide acid) (PLG, cetylmethylammonium bromide (PLG-CTAB), PLG-PEI, or microparticles based on PLG-poly-L -Lysine etc., i.e. nanoparticles based on chitosan, nanoparticles of PLG, gelatin, etc.

polymer or polyplex systems based on poly-L-Lysine, poly-ethylene eimine (PEI), polyamidoamine dendrimers, cationic polymers such as chitosan, DEAE-dextran, TMAEM copolymers

(trimethylammonium ethylmetacrylate) and N-2-hydroxypropyl) methacrylamide (HPMA),

- peptide systems such as the RAWA peptide

- cationic polyene antibiotics such as cationic derivatives of Amphotericin B.

Advantageously, in the pharmaceutical composition of the invention, zyxin is associated with said intracellular transport vectors by covalent or non-covalent chemical bonds.

A second embodiment of the invention relates to a pharmaceutical composition comprising as active agent a nucleic acid molecule comprising a

CDNA of the zyxin gene, a fragment or a derivative thereof.

According to this second embodiment, the pharmaceutical composition comprises a nucleic acid comprising a cDNA of the zyxin gene, a fragment or a derivative thereof associated with a viral recombinant expression vector or with a non-viral transport vector of particulate type.

In the context of the invention, the expression “association between the active agent and the transport vector” means either the fixing of said active agent to the transport vector, such as for example by non-covalent bonds, for example of hydrophobic type, or by covalent chemical bonds by means of coupling agents or not, according to techniques well known in the art. person skilled in the art, that is to say the insertion of said active compound into a viral or bacterial recombinant expression vector. In the latter case, the active compound is brought to its target either by infection with viral particles expressing said active compound, or by transfection with recombinant expression vectors capable of expressing the active compound during their integration into said host cell.

Advantageously, the pharmaceutical composition of the invention comprises a recombinant viral expression vector comprising elements necessary for transcriptional control as well as for controlling the translation of the sequence of a cDNA of the zyxin gene when said expression vector is introduced into target cells.

Advantageously, the pharmaceutical composition of the invention comprises a recombinant viral expression vector comprising regulatory sequences, such as constitutive or inducible promoters, or even non-coding sequences of the zyxin gene, allowing the expression of zyxin in the cells of the host to which the composition of the invention is administered.

Advantageously, the pharmaceutical composition of the invention comprises a recombinant viral expression vector comprising regulatory sequences chosen from LTR sequences, such as for example the LTR sequences of the Moloney leukemia virus, under the dependence of a promoter of the LTR in 5 '.

Preferably, the pharmaceutical composition of the invention comprises as transport vector intracellular, any recombinant viral expression vector placed under the control of promoters of the host cell allowing the expression of zyxin in the host cell according to genetic recombination techniques well known to those skilled in the art.

By way of example and without limitation, there may be mentioned expression vectors derived from recombinant Adenoviruses, from viruses associated with recombinant Adenoviruses (AAV), from baculoviruses or from recombinant retroviruses, and most preferably a vector of the recombinant lentivirus type. .

Quite preferably, the pharmaceutical composition of the invention comprises a viral expression vector comprising promoter sequences, chosen for example and without limitation from the CMV promoter, the EF1 alpha promoter or the PGK promoter.

According to a particular mode of implementation, the pharmaceutical composition of the invention comprises as active agent a cell from a patient suffering from a tumor pathology genetically modified to express the discomfort of zyxin.

The pharmaceutical composition of the invention is useful for the preparation of a medicament intended for the treatment or prevention of tumor pathologies.

The pharmaceutical composition of the invention is useful for the preparation of a medicament intended for the treatment of pathologies such as malignant hemopathies associated with chromosomal abnormalities of the localization region of the zyxin 7q34 / q35 gene.

Also, the pharmaceutical composition of the invention is useful for the preparation of a medicament intended for the treatment or prevention of hepatocarcinomas, neuroectodermal cancers, Ewing's sarcoma.

The invention also relates to the non-viral and viral intracellular transfer vectors associated with the active agent, capable of being used in the above pharmaceutical composition.

Another subject of the invention relates to a viral vector capable of being used in a pharmaceutical composition defined above.

The subject of the invention is therefore a viral vector comprising a cDNA coding for the zyxin gene or a functional fragment thereof.

More particularly, the viral vector according to the invention is chosen from a recombinant vector derived from an Adenovirus, a virus associated with Adenoviruses (AAV) or a retrovirus.

A third embodiment of the invention relates to a pharmaceutical composition comprising as active agent a cell characterized in that it is genetically modified to overexpress the gene for zyxin or a functional fragment thereof.

Advantageously, the overexpression of the zyxin gene in said cell is obtained either by transfection of a cell with expression vectors comprising a cDNA of the zyxin gene or by infection of a cell with viral particles expressing said gene for the zyxin.

Preferably, the pharmaceutical composition according to the invention comprises, as active principle, a cell chosen from a stem cell, a cell of bone marrow, a hematopoietic cell or a hepatocarcinoma cell genetically engineered to overexpress the zyxin gene or a functional fragment thereof.

Preferably, the pharmaceutical composition of the invention comprises as active agent a CD34 + cell genetically modified to overexpress the discomfort of zyxin or a functional fragment thereof.

Most preferably, the pharmaceutical composition of the invention comprises as active agent a cell originating from a patient suffering from a tumor pathology genetically modified to express the zyxin gene or a functional fragment thereof.

The invention also relates to a genetically modified cell overexpressing the zyxin gene.

The invention also relates to a genetically modified cell under-expressing the zyxin gene.

Such a cell can be obtained, for example, using an antisense RNA targeting the AUG of zyxin and introduced into the cells via a synthetic oligonucleotide cloned in the shuttle comprising the transport vector. .

Preferably, the genetically modified cells according to the invention are chosen from a stem cell, a bone marrow cell, a hematopoietic cell or a hepatocarcinoma cell.

Advantageously, the genetically modified cells according to the invention are CD34 + cells.

According to a preferred embodiment, the genetically modified cells according to the invention are from a patient with a tumor pathology.

Another embodiment of the invention relates to a pharmaceutical composition comprising as active agent a compound binding the polymerized actin F with an affinity constant greater by at least two logs than the affinity constant with which said active agent binds unpolymerized actin G.

Preferably, the active agents of the composition of the invention have an affinity constant of the order of 10 ⁷ -10 ⁸ M ^"1 for the polymerized actin F.

According to a particular embodiment of the invention, the active agent binding the polymerized actin is a cyclic peptide.

The invention also relates to a non-human transgenic mammal comprising at least one genetically modified cell sub-expressing the zyxin gene or a functional fragment thereof.

The subject of the invention is also a non-human transgenic mammal comprising at least one genetically modified cell sub-expressing the gene for zyxin or a functional fragment thereof.

The invention also relates to a method for identifying compounds capable of stabilizing the actin network of the cytoskeleton of a cell, comprising detecting a phenotypic reversion of the expression of zyxin induced by said compounds, characterized in that it comprises the following stages: a) bringing the compounds to be tested into contact with said cell, b) quantifying the expression of zyxin in said cell. According to a particular implementation of the method of the invention, the quantification of the expression of zyxin is carried out by comparison of the expression of the messenger RNAs of zyxin in said cell in the presence and in the absence of said test compound.

According to another particular implementation of the method of the invention, the quantification of the expression of zyxin is carried out by comparison of the expression of the protein zyxin in said cell in the presence and in the absence of said compound to be tested

The invention also relates to a method for diagnosing a tumor pathology comprising the following steps: a) the removal of cells from a patient, b) the quantification of the expression of zyxin in the cells removed

According to a preferred embodiment of the diagnostic method of the invention, the quantification of the expression of zyxin is carried out by measuring the expression of the messenger RNAs of zyxin.

According to another form of implementation of the diagnostic method according to the invention, the quantification of the expression of zyxin is carried out by comparison of the expression of the protein zyxin of the cells sampled at different intervals.

Another subject of the invention is the use of the method for detecting a phenotypic reversion of zyxin expression to determine the effectiveness of an anti-tumor treatment in a patient by measuring the expression of the gene for zyxin in cells of said patient obtained at two different intervals during the patient's anti-tumor treatment. Thus, the subject of the invention is a method of analyzing a tumor phenotype of a patient, characterized in that it comprises the following stages: a) the removal of the cells from the patient at two different time intervals, b) the quantification of the expression of zyxin in the cells sampled at different intervals. c) comparing the two levels of expression in order to constitute a phenotypic differential profile of said patient.

According to one embodiment of the analysis method of the invention, the quantification of the expression of zyxin is carried out by comparison of the expression of the messenger RNAs of the cells sampled at different intervals.

According to one embodiment of the method of analysis of the invention, the quantification of the expression of zyxin is carried out by comparison of the expression of the zyxin protein of the cells sampled at different intervals.

Another subject of the invention relates to a method of screening for an active compound in the treatment of cancers, comprising the following steps: a) incubation of tumor cells with said active compound, b) measuring the stabilization of the polymerization of the actin network of said cells.

The invention also relates to the use of a substance capable of restoring the actin networks of a cell for the preparation of a non-cytotoxic anti-tumor medicament. Another subject of the invention is the use of such a substance for the preparation of a medicament intended for the treatment and / or prevention of a pathology resulting from a chromosomal abnormality in the long arm of chromosome 7, more particularly at the level of the region 7q34 / q35.

The invention also relates to the use of such a substance for the preparation of a medicament intended for the treatment of a malignant hemopathy associated with a chromosomal abnormality in the region of the gene of zyxin 7q34 / q35.

Another subject of the invention is the use of a substance for the preparation of a medicament intended for the treatment or prevention of hepatocarcinomas or neuroectodermal cancers.

Another subject of the invention is the use of a substance for the preparation of a medicament intended for the treatment or prevention of mesenchymal tumors, in particular sarcomas.

Another subject of the invention is the use of such a substance for the preparation of a medicament intended for the treatment or prevention of Ewing's sarcoma.

Other advantages of the invention will become apparent on reading the experimental work carried out by the applicant described in the Equipment and methods section below and in which reference is made to the appended figures in which:

- Figure 1 is a diagram of the interactions between zyxin and its cellular partners at the level of the plasma membrane. Figure 2 shows a diagram of the construction of the viral transport vector associated with zyxin.

- Figure 3 shows the images of the cellular structures revealed specifically. FIG. 3A shows actin filaments revealed by labeling the cells with a phalloidin probe coupled to the FITC. FIG. 2B shows the location of the zyxin revealed by labeling the cells with an anti-zyxin antibody revealed with an anti-mouse IgG antibody coupled to TRITC. - Figure 4A illustrates the results of the

Northern blot with the detection of zyxin mRNA, from 10 μg of total RNA, by the human zyxin probe of 250 bp.

FIG. 4B is a schematic representation of the retroviral shuttle containing the zyxin reading frame, mRNAs containing the open reading frame of human zyxin and of the neo / CMV and zyxin probes used for the revelation of the Northern blots.

FIG. 5 illustrates the results of the Northern blot with the detection of the mRNA originating from the 5 'LTR, from 10 μg of total RNA deposited on denaturing agarose gel, by the neo / CMV probe of 1081 bp.

- Figure 6 shows the Western blot and immunodetection images of the zyxin protein in the different cell lines from 60 μg of protein extracts from the different cell lines.

- Figure 7 illustrates the Western Blot images obtained after immunoprecipitation of the protein extracts the protein EWS-FLI-1 extracted from the clones E-F zyxin. - Figure 8A shows the sequence of

1 antisense.

- Figure 8B is a diagram of the construction of the retroviral shuttle expressing the antisense against the AUG of zyxin. - Figure 8C shows the detection by RTPCR of the antisense RNA directed against the AUG of zyxin.

- Figure 9 shows the Western blot and immunodetection images of the zyxin protein from 40μg of protein extract from different cell lines.

FIG. 10 is a graphic representation of the comparative study of the variations in gene expression rates, carried out by macro-arrays, between the line NIH3T3 and the lines EWS-FLI, as zyxine 1 and as zyxine 2.

- Figure 11 illustrates the in vitro measurement of actin polymerization by fluorescence anisotropy.

FIGS. 12A to 12G show the results of the study of the morphological modification of the NIH3T3 and EWS-Fli cells in the presence of Dolastatin (DU: Untreated NIH3T3 cells (FIG. 12A); NIH3T3 cells transfected with EWS-Fli (Figs 12B , 12C); (NIH3T3 cells transfected with EWS-Fli incubated in the presence of 10 μM (Figure 12D) or 100 μM (Figure 12E) of Jasplakinolide or incubated with 10 μM (Figure 12F) or 20 μM (Figure 12G) of DU.

- Figure 13 shows the results of the study of the toxicity of Dolastatin 11 (DU) on NIH3T3 and EWS / Fli cells. FIG. 14 shows the results of the study of the development of tumors in nude mice in the presence of Dolastatin 11.

- Figure 15 shows the results of the study of the cell displacement speed by phase contrast microscopy.

- Figure 16A shows the chemical structure of Dolastatin 11

- Figure 16B shows the chemical structure of Jasplakinolide

Material and methods

I - Correlation between tumor phenotype and under-expression of zyxin.

1- Description and cell culture All of the cell lines are cultivated at 37 ° C. in a humid atmosphere containing 5% of CO ₂ . Aside from the GP + envAml2, they are maintained in DMEM environment

(GIBCO) supplemented with 10% newborn calf serum (GIBCO) and antibiotics (penicillin lOOUI / mL and streptomycin lOOμg / mL).

The EWS-FLI line contains a cDNA encoding the EWS-FLI-1 fusion protein in its genome. The expression of this protein is selected using 2.5 μg / ml of puromycin.

The AS-A line, produced by M. Hervy et al. , produces a small antisense RNA directed against the mRNA encoding the protein EWS-Fli-1. This line is selected, in addition to puromycin, lmg / ml of geneticin. Geneticin makes it possible to select the cells which produce the small antisense RNA directed against the mRNA coding for the protein EWS-FLI-1. NIH3T3 AS zyxin lines are cells that produce a small antisense RNA directed against the AUG of mRNA encoding zyxin. They are cultivated in a medium supplemented with geneticin at 1 mg / ml in order to select the expression of the antisense. GP + env Am12 cells are transcomplementing cells capable of providing in trans the proteins coded by the gag and pol genes, carried on a plasmid, and env carried by another plasmid. This line is capable of producing amphotropic viral particles. This line is cultivated in a medium containing DMEM and 10% fetal calf serum (GIBCO) supplemented with penicillin and streptomycin. These cells are selected using a mixture of three compounds (200 μg / ml of hygromycin B, 15 μg / ml of hypoxanthine, 250 μg / ml of mycophenolic acid) for two weeks before transfection with the retroviral shuttle.

immunofluorescence

The cells are seeded on glass slides until they adhere (from 24H to 48H). the cells are fixed with a 3% paraformaldehyde solution rinsed with PBS and permeabilized with a PBS / 0.2% triton X100 solution. The permeabilized cells are saturated with a PBS / 2% BSA solution. In the case of immunostaining of the protein zyxin, the cells are incubated with the primary antibody (anti-zyxin from J. Wehland) diluted twice for 40 min, rinsed 3 times 5 min with PBS and then incubated with the secondary anti-mouse IgG antibody coupled to Texas Red (TRITC) for 40 min. For actin immunostaining, the cells are incubated directly with phalloidin coupled to FITC for 40 min. The coverslips are observed under a fluorescence microscope.

3 - Construction:

3.1 - Generation of the vector pLNCX ADA (adapter) from pLNCX.

The retroviral vector pLNCX contains, on the one hand, the LTR sequences and the psi sequence originating from the Moloney murine leukemia virus (MoMLV) and, on the other hand, the resistance gene to neomycin, conferring resistance to geneticin, under the dependence of the promoter of the LTR in 5 ′. This vector also contains a multicloning site (MCS) directly dependent on the early promoter of the cytomegalovirus (pCMV). The vector pLNCX is digested with HindIII / ClaI at the level of the MCS in order to insert therein a sequence containing two adapters which are capable of self-associating in a complementary manner. Between these two adapters, this sequence contains other unique restriction sites including Nsil and Sali.

3.2 - Generation of a retroviral vector coding for human zyxin.

The plasmid pzyxine GFP contains the cDNA coding for human zyxin coupled in phase to the gene for the "green fluorescent protein" GFP (given by M. Beckerle). It is digested with Hind III and BamH I then cloned into the vector PLNCX at the level of the MCS (HindH I / BglII); BamHI and BglII are compatible sites. Digestion with Hind II / BglII eliminates one of the two adapters, this preventing self-association of the RNA coding for the zyxin produced by this vector.

The result of this construction is a retroviral vector named pLNCX ADA zyxin, coding for human zyxin under the direct influence of pCMV.

3.3 - Generation of a vector producing an antisense directed against zyxin: pLNCX ADA as zyxin pLNCX ADA sa zyxin is a vector which has the capacity to produce a small RNA in rod-loop structure directed against the AUG of the mRNA coding for zyxin, directly dependent on the pCMV promoter.

The construction of the vector is carried out by inserting at the level of the Nsil and Sal I sites of the MCS a small sequence directed against the AUG of the mRNA of zyxin.

4 - Transfection

The vector retroviral shuttle is transformed into the corresponding virus by transfecting the retroviral vector into a transcomplementing cell line GP + envAM12 (GPA). The GPA transcomplementing line is transfected by the retroviral shuttle (pLNCX zyxine or PLNCX ADA as zyxine) in the presence of Superfect (Qiagen) according to the supplier's recommendations.

The cells expressing the neo ^r gene are selected in a medium containing lμg / ml of G418. Resistant cells are collected, amplified and seeded in a 75cm ² bottle at a rate of 2.10 ⁶ cells. Two days later, the medium is replaced by a non-selective medium. The supernatant is collected every 24 hours for 3 days, pooled, aliquoted and frozen. The retroviral titer is evaluated on NIH3T3 cells after selection of cells with geneticin (1 mg / ml). The viral supernatant of the GPA cells is then used to infect the desired cells with a multiplicity of infection of the order of 0.1. Three days after infection, the cells are selected with lμg / mL of G418. Only cells that have integrated the retroviral shuttle resist G418 and form clones that are isolated and amplified to produce permanent cell lines.

5- Immunoprecipitation.

The adherent cells are trypsinized, pelletized and rinsed with PBS. The cells are lysed with cold RIPA (10 mM Tris-HCL pH7.4, 100 mM NaCl, ImM EDTA, 1% Triton X100, 0.5% Na deoxycholate, 0.1% SDS) in the presence of a mixture of protease (Boehringer) . After 20 min of incubation on a wheel at 4 ° C, the samples are centrifuged for 15 min at 14,000 rpm. The supernatants are recovered and the protein concentration is estimated by the Bradford test. An aliquot containing 1.5 mg of total protein extract is incubated for 1 hour 30 minutes at 4 ° C. with 0.2 μg of antibody directed against terminal C dominor of Fli-1.

(Santa Cruz SC-356) and then 1 hour with 20 μL of a mixture of agarose beads coupled to protein A and beads coupled to protein G (Sigma). After three washes with cold RIPA, the beads are resuspended in 20 μL of Laemmli 2X buffer and are brought to the boil for 10 min. The samples are then analyzed by a conventional immunoblot using, for incubation of the primary antibody, a solution containing lμg of anti-Fli-1 in 5mL of TBS-0.1% (v / v) Tween. 6 - Western blot

The analysis of the rate of production of the zyxin protein is carried out by Western blot on a total cell extract using as primary antibody, the anti-zyxin monoclonal mouse antibody given by J. Wehland directed against the region between the NES and the LIM domains. This membrane is revealed by a chemiluminescent reagent (Immunostar: Biorad).

7 - Analysis of RNAs.

7.1 - Northern blot

The extraction of total RNA from the various cell lines is carried out using the RNAplus lysis solution (Quantum Biotechnology) according to the supplier's recommendations. An aliquot of 10 μg of total RNA is denatured in a solution containing 0.04 M MOPS pH7, 0.01M of sodium acetate, 2.2 M formaldehyde and 50% formamide. The samples are analyzed on agarose gel denatured with formaldehyde and transferred to a charged nylon membrane (Hybond N +: Amersham Pharmacia). The membrane is hybridized with a cDNA probe radiolabeled with [ ³² P] dCTP by random priming (Prime-a-gene ^® labeling System: Promega) in a prehybridization solution containing 5X SSC, 5X Denhart's, 0, 1 mg / mL of salmon sperm DNA, 0.1 mg / mL of yeast t-RNA, 0.1% SDS, 25 M pH7 KH ₂ P0 ₄ and 50% formamide at 42 ° C overnight. The next day the membrane is rinsed three times with SSC2X / 0.1% SDS at room temperature and once or twice at 42 ° C with 0.5 X SSC / 0.1% SDS. The membrane signals are then observed at the phospholmager.

7.2 - RT-PCR

Total RNAs are produced by the same technique described above. The quality and cleanliness of the RNA is checked on denaturing gel. The retrotranscription is carried out using the Omniscript ™ kit from Qiagen specifically using a 20-sea LTR primer. The conditions used are 10 ng of LTR primer, 2.5 mM dNTP, Iμg of total RNA supplemented with 2OU of RNase inhibitor

(RNAsin ^® ), RT buffer and 40U reverse transcriptase. The mixture is incubated for one hour at 37 ° C and 5 min at 94 ° C. The RT products of specific cDNAs which are amplified by PCR using two other primers named as 1 and as 2.

The reaction conditions are 0.25 mM dNTP, lOOng of each of the primers and ^{1/20 is} the product of RT, l.5mM

MgCl ₂ , Taq pol buffer and 1U of Taq pol enzyme (Perkin Elmer

N801-0060). The cycles used are 4 min 94 ° C and 30cycles (30s 94 ° C, 45s 61 ° C, 1 min 72 ° C) and 10 min at 72 ° C.

LTR: AGATATCCTGTTTGGCCAT AS1: GCCGTGCATCATCCTGACTG AS2: CTGTTCCTGACCTTGATCTG

8 - Tumorigenicity test

The cells from the different clones to be tested are trypsinized, pelletized and resuspended in sterile PBS at the rate of 5.10 ⁶ cells per ml. An aliquot of 200 μL of cells is injected subcutaneously into nude mice aged 6 to 8 weeks, irradiated the day before at 5 Gray. The mice are reared in a sterile, air-conditioned atmosphere. Observation of tumor development is carried out every week for 5 to 6 weeks.

9 - Macro-array experience

The "Atlas cDNA expression Arrays" cDNA expression card (Clontech) is produced according to the supplier's recommendations. Two identical nylon membranes (No. 7741-1) on which are deposited 588 mouse cDNA samples, corresponding to 588 genes, makes it possible to hybridize cDNAs from two different cell lines in parallel. Information concerning the 588 genes is available on the Clontech site (http://www.clontech.com/atlas.genelist/search.htlm). The preparation of the radiolabelled cDNA probes is carried out by retrotranscription with [ ³² P] dATP using the Clontech kit. Hybridization is performed according to the instructions from the supplier. The signals are observed at the Phospholmager.

RESULTS

1 - Study of the role of zyxin in cell transformation induced by the EWS-FLI fusion protein.

1.1 - Establishment of EWS-FLI lines overexpressing zyxin

The overexpression of zyxin in NIH3T3 cells expressing the EWS-Fli fusion protein (EWS-FLI) was achieved by infection using the retroviral shuttle pLNCX. The open reading frame corresponding to zyxin, derived from the plasmid pZyxin-GFP (FIG. 2), is introduced into the use site of the plasmid pLNCX located downstream of the CMV promoter. Thus, there was obtained the plasmid called pLNCX-zyxin which contains the two LTR sequences (5 'and 3'), the PSI + sequence necessary for

1 encapsidation of retroviral RNA, the Neo ^R gene responsible for resistance to geneticin under the dependence of LTR5 'and the reading framework for human zyxin under the influence of the CMV promoter (Figure 2).

The production of virus is obtained by transfection of this plasmid into an amphotropic murine packaging line called GPA. EWS-FLI cells are infected using the viral supernatant produced by GPA cells and selected in the presence of Geneticin.

The clones thus obtained are called E-F / Zyxin. The study by fluorescence microscopy (Figure 3) shows that the EWS-FLI cells have lost the bundles of actin microfilament and the ability to spread, characteristics typical of transformed fibroblasts (Pollack, R et al; 1975, Maness, P, E; 1981). In contrast, the cells of the EF / Zyxin clones partially recovered the structure of the actin microfilaments as well as the spreading capacity of the NIH3T3 cells (FIG. 4). In addition, these cells no longer have the growth capacity in multilayers, typical of transformed cells. In parallel with these structural modifications, a relocation of zyxin is observed at the level of the adhesion plates, in the intercellular junctions and along the stress cables (FIG. 3).

2 - Expression of zyxin mRNA in zyxin E-F cells.

Analysis by Northern Blot shows that the RNA coding for zyxin is more weakly expressed in the tumorigenic line EWS-FLI than in the line NIH3T3 (FIG. 4). This result confirms the difference in expression observed previously, by microarrays, between the NIH3T3 and EWS-FLI cells. The expected size of the human zyxin mRNA from the retroviral shuttle and expressed from the CMV promoter (2.2 kb) (FIG. 4B) is identical to that of the endogenous zyxin mRNA. It is therefore very likely that the increase in the intensity of the band that is observed in the three E-F / zyxin clones is due to the expression of the zyxin RNA expressed from the retroviral shuttle. Furthermore, another RNA larger than 4.7 kb is represented only in the RNAs from the E-F / zyxin clones. This RNA has a size between 5.5 and 6 kb compatible with an RNA which would be expressed from the promoter located in the U3 region of the 5 'LTR (5.7 kb) of the retroviral shuttle (FIG. 4B).

To verify this hypothesis, a second

Northern blot was carried out using a 108lbp (neo / CMV) probe, corresponding to a restriction fragment derived from the plasmid pLNCX ADA zyxin, capable of detecting only the RNA derived from the 5 'LTR (FIG. 5).

The result presented in FIG. 5 reveals a hybridization only in the EF zyxin clones. Referring to the position of the 28S RNA, observable by UV, the detected band is positioned at the same level as the indeterminate band present in the Northern blot using the zyxin probe. It can therefore be concluded that the retroviral shuttle produces two RNAs containing the zyxin sequence, one from the CMV promoter and the other from the promoter present in the 5 'LTR.

3 - Study of the overexpression of the exogenous zyxin protein.

To determine whether the zyxin E-F clones containing the zyxin RNA derived from the retroviral shuttle are capable of producing the corresponding protein, a Western blot immunorevelated with an anti-zyxin antibody was carried out. The results of this experiment are presented in FIG. 6. For all of the lines, a specific and unique band of a protein of molecular mass slightly greater than 80 kDa is detected. This molecular mass is in agreement with the apparent molecular mass of zyxin (82 kDa) described by Schmeichel et al. , 1998. The under-expression of zyxin mRNA in the EWS-Fli line compared to the NIH3T3 line results in a decrease in the corresponding protein.

In the same way, the overexpression of zyxin at the RNA level of the EF zyxin clones 1, 2 and 3 results in a restoration of the level of the protein zyxin close to that of the line NIH3T3. These results therefore show a correlation between the level of RNA produced by the cells and the level of protein expressed. In conclusion, the introduction of the cDNA coding for zyxin in the transformed cells EWS-FLI, makes it possible to restore the level of expression of this protein to a comparable level see even higher than that of the parental cells NIH3T3. The overexpression of the zyxin protein is most probably due to the RNA expressed from the CMV promoter. In fact, in the case of the minority RNA derived from the 5 'LTR, the reading frame for the APH (3') II phosphotransferase (Davies and Smith, 1978), which confers on cells resistance to geneticin, is translated. Lack of internal sequence initiation of translation therefore prevents the open reading frame of human zyxin, downstream, from being translated.

4 - Study of the expression of EWS-FLI-1 in the E-F zyxin clones

In parallel, it has been verified that the E-F zyxin clones studied retain the expression of the EWS-FLI-1 protein, responsible for the tumorigenic character.

To do this, a study of the expression of the EWS-FLI-1 protein is carried out by Western blot after immunoprecipitation of the protein extracts of the E-F zyxin clones (FIG. 7). The results, presented in FIG. 7, show a specific detection of a protein with a molecular mass greater than 61 kDa. This mass is compatible with the apparent molecular mass of the expected EWS-FLI-1 protein (68 kDa). Below this band, other bands appear. They correspond to the denaturation product of the antibody used for immunoprecipitation (heavy chains (50 kDa) of the anti Fli-1 antibody).

The difference in intensity detected in the presence of two different amounts of protein extracts shows that the amount of antibody used is not limiting. In order to be able to compare the intensity of the bands corresponding to the EWS-FLI-1 protein, the amount of EWS-FLI-1 immunodetected by the amount of anti-Fli-1 antibody detected has been corrected. The results presented in the form of a histogram (FIG. 7B) indicate the absence of the EWS-FLI-1 protein in the NIH3T3 line and an under expression in the AS-A line (expressing an antisense directed against the EWS-FLI junction sequence ) compared to the EWS-FLI line. For the E-F zyxin clones, the amount of EWS-FLI-1 protein is clearly greater than the amount of protein detected in the non-tumorigenic AS-A line and remains comparable to the amount present in tumorigenic EWS-FLI cells.

Presumably these cells retain a sufficient amount of EWS-FLI-1 protein to induce subcutaneous tumors in nude mice. Thus, the possible loss of tumorigenicity of the EF zyxin clones will not be due to a reduction in the expression of the EWS-FLI-1 protein.

5 - Study of tumorigenicity of the E-F zyxin clones

The determination of the induction of a loss of a malignant phenotype loss in nude mice by the overexpression of zyxin in the EWS-FLI line is illustrated in Table 1 below.

Table 1

These results correspond to the study of the number of tumors developed in nude mice after subcutaneous injection of 10 ⁶ cells from different cell lines during 5 weeks. The cells are injected 24 hours after the irradiation of the mice at 5 Gray

The injection of NIH3T3 cells does not cause tumor development. This line is used as a negative control since it is known to be non-tumorigenic. On the other hand, for the EWS-FLI line, known to be tumorigenic, all the mice developed tumors between the 2 ^nd and 3 ^rd week. As regards the study of the tumorigenicity of the EF zyxin clone, two cases may arise, either there is no tumor development (three out of five mice) or there is a delay in tumor development of about two to three weeks (two out of five mice). Analysis of these tumors shows that the DNA of the retroviral shuttle is still present, however, the exogenous RNA coding for zyxin could not be detected. It therefore appears that the development of delayed tumors in mice is due to a loss of expression of the exogenous protein zyxin.

6 - Study of the under expression of zyxin in the acquisition of the tumor phenotype.

6.1 - Establishment of NIH3T3 lines under-expressing zyxin. Given the importance of the level of expression of zyxin in maintaining the tumor phenotype of NIH3T3 cells transformed by the fusion protein EWS-FLI, the Applicant wanted to determine the consequences of a forced reduction of this protein in lines non-tumorigenic cells. To do this, a small antisense RNA targeting the AUG of zyxin was used (FIG. 8 A). This antisense RNA was introduced into the cells via a synthetic oligonucleotide cloned into the pLNCX shuttle at the Nsil / Sali restriction sites (FIG. 8B)

In the three clones selected (in the presence of G418 1 mg / ml) and which have been designated AS-ZYX 1, 2 and 3, the expression of the antisense (FIG. 8C) is accompanied by a decrease in the protein Zyxin (Figure 9). This decrease in expression is of the same order as that which was detected in NIH3T3 cells transformed by the EWS-FLI fusion protein.

This decrease in the level of expression of zyxin in NIH3T3 cells results in a significant morphological change in the cells. We can thus observe a significant loss of cytoplasmic and adhesion expansions as well as modifications notable structure of actin filaments (Figure 3). These morphological changes, typical of transformed cells, are also accompanied by modifications in the multiplication characteristics of these cells. Thus, the doubling time of these cells (20-22 hours) is intermediate between that of the transformed EWS-FLI cells (17-18 hours) and that of the parental NIH3T3 cells (24-26 hours). These data also indicate that AS-zyxin cells, like EWS-FLI cells, have lost contact inhibition.

6.2 - Study of tumorigenicity of AS-zyxin clones.

The tumor development tests in nude mice corroborate the morphological changes and the growth modifications observed between the cells expressing the antisense directed against zyxin and the parental NIH3T3 cells (Table 2). There is a slight delay in the appearance of tumors from the AS-zyxin clones compared to that observed from the EWS-FLI tumor line, but the three clones develop tumors. The rate of tumor development after the injection of EWS-FLI cells is also faster than that observed following the injection of the AS-Zyxin clones. These two observations probably result from the intrinsic rate of multiplication of cells.

Table 2

Table 2: Tumorigenicity test: study of the number of tumors developed after subcutaneous injection in nude mice of 10 ⁶ cells from different cell lines for six weeks.

7 - Comparison of the gene expression profile between the NIH3T3 line and AS-zyxin. The comparative study of gene expression, using the "cDNA expression Arrays" technique, between NIH3T3 cells and AS-zyxin 1 or 2 clones, shows that the inhibition of zyxin disrupts gene expression. Ten and thirteen genes respectively were identified in the AS-zyxin 1 and 2 clones whose expression is modified compared to the NIH3T3 cells (FIG. 10). Among these different genes, nine are common to the two clones.

These genes can be grouped into four families: tumor suppressors (EGR1 and p53), proteins involved in repair (ERCC-1), proteins playing a role in cell differentiation and growth (ADAP, IGFBP-4, ICE) and the proteins involved in the cell matrix (TIMP2, PN-1 and urokinase plasminogen activator). In addition, nine of these genes had been identified during the analysis of the expression profiles between the parental NIH3T3 line and the line transformed by EWS-FLI (FIG. 10). These results show very clearly that the level of expression of zyxin, in the cells used, influences the process of genetic regulation.

8. Pharmacological approach to the treatment of cancers by stabilization of the actin network.

8.1 In vitro measurement of actin polymerization by fluorescence anisotropy.

Cell extracts of NIH3T3 cells or EWS-Fli are placed in the presence of actin Alexa 488 in a buffer G (4.3 μM Tris pH 8.1; 170 μM CaCl ₂ ; 170 μM DTT; 170 μM ATP). The polymerization reaction is triggered by the addition of a P buffer (51 mM KC1, 1 mM MgCl ₂ and 0.5 mM ATP). Dolastatin (μM) is added to the cellular extracts of EWS-Fli cells at the same time as the buffer P. The actin polymerization is followed by anisotopy of fluorecence on a Beacon 2000. The results obtained are illustrated in FIG. 11.

8.2 Study of the morphological modification of NIH3T3 and EWS-Fli cells in the presence of Dolastatin (DU). The cells (5 × 10 ³ ) are seeded on 10 mm diameter glass slides and cultured for 24 hours. After fixation (paraformaldehyde 3%) and permeabilization (TritonXlOO 0.2%) the actin filaments of the cells are immunostained by means of phalloidin coupled to FITC. NIH3T3 untreated cells; NIH3T3 transfected with EWS-Fli (EF); (EF) incubated in the presence of 10 μM or 100 μM of Jasplakinolide; EF, incubated with 10 μM or 20 μM DU. (Figure 12)

These results show that the effect of these two active agents, Jasplakinolide or Dolastatin-11 on the cytoskeleton.

8 3 Study of the toxicity of Dolastatin 11 (DU) on NIH3T3 and EWS / Fli cells.

Cells (10 ⁴ per well) are seeded in 96-well plates in the presence of different concentrations of DU. Monitoring the toxicity of DU as a function of time was carried out by means of an MTT test on NIH3T3 (A) and EWS-Fli (B) cells. The results are illustrated in Figure 13.

8.4 Study of tumor development in nude mice in the presence of Dolastatin 11. Twenty four hours after irradiation (5 Gy) of the mice, the EWS-Fli cells (10 ⁶ ) are seeded subcutaneously. Mice are then separated into two batches, the first batch corresponds to the untreated mice and the second batch to mice intravenously, three injection of dolastatin 11 (10 mcg / kg) at 5, 8 and n ^th day after injection of EWS-Fli cells. The measurements of the development of the tumors were carried out on the 28 ^th day, they are illustrated in FIG. 14.

8.5 Study of the cell displacement speed by phase contrast microscopy.

The cells are seeded (20% of confluence) on glass slides 20 mm in diameter. Three days after sowing, the glass slides are placed in airtight chambers, regulated in temperature (37 ° C) and in C0 ₂ (5%). The motility measurement of the cells is carried out by taking a photograph by optical phase contrast microscopy every 4 minutes for 24 hours. The motility analyzes, carried out using the “metamorph” program, are carried out for each cell type, on ten cells. The results are illustrated in Figure 15.

8.6 Analysis of results

The studies of actin polymerization, by fluorescence anisotropy (FIG. 11), carried out by the applicant from extracts either of non-tumor cells (NIH3T3) or of EWS-Fli tumor cells show that the extracts of NIH3T3 cells have a much greater ability to polymerize actin than extracts from EWS-Fli cells. However, the addition of Dolastatin 11 (R Bai et al; Molecular "Pharmacology: 2001) in the polymerization buffer for extracts of EWS-Fli cells makes it possible to partially compensate for this deficit of EWS-Fli cells (FIG. 11).

Based on these results obtained on extracts, the Applicant has analyzed whether this ability of Dolastatin 11 (DU) to stabilize the polymerized actin could lead to a morphological reversion identical to that which was observed when the level of expression of the protein zyxin was restored in these EWS-Fli tumor cells.

The treatment of EWS-Fli cells with 10 or 20 nM of Dolastatin 11 not only makes it possible to restore the stress fibers of the cells, with a morphology which approximates that of NIH3T3 cells, but it also makes it possible to restore the contact structures between cells (Figure 12).

On the other hand, the same concentrations of Dolastatin 11 do not in any way modify the morphology of the NIH3T3 cells (FIG. 12). In addition, quite surprisingly, for these low concentrations of Dolastatin 11, no effect of cytotoxicity or cytostaticity is observed on the two cell lines (FIG. 13). The experiments carried out on nude mice confirm the results obtained in vitro. The development of tumors due to the subcutaneous injection of EWS-Fli cells is significantly delayed by the intravenous injection of Dolastatin 11 (Figure 14). These experiments are all the more interesting since they were carried out with a concentration of Dolastatin 11 (10 μg / kg) five times lower than the dose which does not affect the survival of the mice.

Although other compounds in the dolastatin family, such as D10 and D15 which target tubulin filaments, have been the subject of several studies, where they are used as active compounds for tumor treatment, they still have been used as a cytotoxic agent to kill the tumor cell. The necessary doses therefore cause numerous undesirable side effects.

In contrast, pharmaceutical compositions of the invention require, for the phenotypic reversal of the tumor phenotype, doses much lower than those known from one prior art.

L ^x These results show that it is possible to use a pharmacological approach, non-cytotoxic, for restoring the actin cytoskeleton of tumor cells under induced tumors, including an under expression of zyxin.

One of the families of cancers capable of being treated with the pharmaceutical compositions of the invention is the family of melanomas, in which the applicant has characterized the under-expression of the zyxin gene.

To obtain these results, the Applicant has characterized the expression of several genes in a murine melanoma line, compared to the expression of these same genes in a non-tumor line.

B16 / F10 cells are a very aggressive murine melanoma line. They are compared to the non-tumorigenic NIH3T3 line. The total RNA of the two cell lines are amplified and radiolabeled by RT PCR. RT PCR products (cDNA) are incubated with Atlas ^® Mouse cDNA Expression Array Clontech membranes (ref 7741-1). The membranes are then exposed and the image is analyzed with MicroArray ^® software.

The results of this characterization are illustrated in Table 3 below.

TABLE 3

B16 / F10 cells are a melanoma line

These results show that the zyxin gene is under-expressed in melanomas.

Discusion

The experimental work carried out within the framework of the present invention made it possible to establish a relationship between the level of expression of zyxin in the cells and the acquisition or the maintenance of the tumor phenotype. The study of the role of zyxin in neoplastic transformation was carried out following several indirect observations:

A) the acquisition of the tumor phenotype of NIH3T3 cells, following the expression of the EWS-FLI fusion protein in these cells, as well as the loss of tumorigenicity, due to the extinction of this oncogenic protein, is accompanied significant morphological changes (Figure 3).

B) The fact that the malignant transformation generally results in modifications of the capacities of adhesion and motility. These modifications are always linked to a destructuring of the actin filaments. C) Among the ten genes identified as being directly dependent on the oncogenic protein EWS-FLI, zyxin is the only one which plays a role in the structure of the cytoskeleton, adhesion and cell motility.

In order to establish a direct link between zyxin and the malignant transformation, on the one hand a vector making it possible to restore the expression of zyxin was introduced into a tumor line (EWS-FLI) and on the other hand a vector expressing an antisense directed against the AUG of zyxin was introduced into a non-tumorigenic line (NIH3T3). The results obtained show that the restoration of the expression of zyxin in the tumor lines (FIG. 6) makes it possible to considerably decrease the tumorigenic power of these cells. Since zyxin is a very conserved protein (97% homology between man and mouse) the sequence difference between human and murine zyxin is very probably not at the origin of this phenomenon.

In addition, the selective inhibition of the expression of zyxin in non-tumorigenic NIH3T3 fibroblasts

(Figure 9), leads to the malignant transformation of these cells. Several other data indicate that there is a direct link between the effect observed on malignant transformation and the rate of. expression of zyxin. Some mice injected with EWS-FLI cells overexpressing human zyxin have developed tumors. Analysis of these tumors shows that the vector for expressing zyxin is still present, however the RNA coding for human zyxin is no longer detected (experiment not presented). The comparative analysis of microarrays between the parental line NIH3T3 and the clones which are derived therefrom and which under express zyxin does not make it possible to detect changes in the expression of other proteins of the microfilament such as α-actinin, tropomyosin, actin or vinculin or cytoskeletal proteins like tubulin or vimentin (Figure 10).

The results obtained clearly show that there is a direct link between the level of expression of zyxin and the malignant transformation, although the mechanism is not established. The actin cytoskeleton, in association with the plasma membrane, is organized into specialized areas capable of performing specific functions in motility (lamelipod), adhesion

(adhesion plate) or the interaction between the cells

(junction plate). Fluorescence microscopy studies (Figure 3) show that the decrease expression of zyxin in cells results in the establishment of a lamelipod-type domain to the detriment of adhesion and junction plates. Actin filaments play an essential role in the formation and maintenance of these different, particularly dynamic areas, which require the formation and concomitant disassembly of different structures. Under these conditions, it is obvious that the deregulation of one of the elements involved in these structures is sufficient to disturb the whole system. Zyxin is an essential structural component of microfilaments and adhesion plates and it influences the organization of these microfilaments (Crawford, A. W et al .; 1992) as well as the adhesion properties (Macalma. T et al. ; 1996) and motility (Drees. B. E, et al .; 1999) cells. It is therefore possible that the changes in cell structure, observed when zyxin is under-expressed, are enough to make these cells tumorigenic. Changes in cell adhesion parameters translate into changes in cell / environment interactions, resulting in reprogramming the expression of key genes responsible for phenotypic changes. It has thus been observed that the acquisition of the tumor phenotype induced, in NIH3T3 cells, by a decrease in the protein zyxin, leads to a modification of the expression of genes characterizing the invasive phenotype, in particular an under expression of the TIMP2 and TIMP3 and Protease nexin-1 (PN-1) and overexpression of the plasminogen activating urokinase (Figure 10). Consequently, these genes and their expression product can be used, as described above with respect to zyxin, for the preparation of pharmaceutical compositions useful for the diagnosis, prevention or treatment of cancers, or even for the screening of compounds. .

Claims

1) Pharmaceutical composition for the treatment, prevention or diagnosis of a tumor pathology, characterized in that it comprises an active agent capable of stabilizing the actin network of the cell cytoskeleton.

2) Pharmaceutical composition according to claim 1, characterized in that it comprises an active agent chosen from the group comprising: the zyxin protein or a polypeptide fragment thereof

- a nucleic acid molecule comprising or consisting of the cDNA of the zyxin gene, a fragment thereof or their complementary sequence, or an antisense nucleic acid thereof, a cell or a set of cells overexpressing the zyxin gene or a functional fragment thereof.

- a cofilin inhibitor.

3) Pharmaceutical composition according to claim 1, characterized in that said active agent binds the polymerized actin F with an affinity constant greater by at least two logs than the affinity constant with which said active agent binds actin non-polymerized G.

4) Pharmaceutical composition according to claim 3 characterized in that said active actin-binding agent is a cyclic peptide.

5) Pharmaceutical composition according to claim 1 or 2, characterized in that it comprises as active agent the zyxin protein or a polypeptide fragment thereof 6) Pharmaceutical composition according to claims 1 or 2, characterized in that it comprises as active agent a nucleic acid molecule comprising or consisting of the cDNA of the zyxin gene, a fragment thereof or their complementary sequence .

7) Pharmaceutical composition according to claim 1 or 2, characterized in that it comprises as active agent a cell or a set of cells overexpressing the zyxin gene or a functional fragment thereof.

8) Pharmaceutical composition according to claims 1 or 2, characterized in that it comprises as active agent a cofilin inhibitor.

9) Pharmaceutical composition according to one of claims 1 to 8 characterized in that the active agent is associated with an intracellular transport vector.

10) Pharmaceutical composition according to claim 9, characterized in that the intracellular transport vector is chosen from a viral recombinant expression vector or a non-viral transport vector.

11) Pharmaceutical composition according to any one of claims 9 or 10, characterized in that the non-viral intracellular transport vector is chosen from a lipid, particulate, micro or nanoparticulate vector, polymer or polyplex, or cationic antibiotic.

12) Pharmaceutical composition according to any one of claims 9 to 11, characterized in that the association between the active agent and the intracellular transport vector is effected by means of non-covalent bonds. 13) Pharmaceutical composition according to any one of claims 9 to 11, characterized in that the association between the active agent and the intracellular transport vector is effected by means of covalent chemical bonds.

14) Pharmaceutical composition according to any one of claims 9 or 10, characterized in that the intracellular transport vector is a viral recombinant expression vector and in that the association between the active agent and said intracellular transport vector is an integration of said active compound into said viral expression vector.

15) Pharmaceutical composition according to claim 14, characterized in that the viral recombinant expression vector is chosen from an Adenovirus, a virus associated with Adenoviruses (AAV) or a retrovirus.

16) Pharmaceutical composition according to claim 14 or 15, characterized in that the viral recombinant expression vector is a lentivirus or an oncovirus.

17) Pharmaceutical composition according to any one of claims 1, 2 or 7 characterized in that the cell genetically modified to overexpress the zyxin gene or a functional fragment thereof is chosen from a stem cell, a marrow cell bone, a hematopoietic cell, a hepatocarcinoma cell.

18) Pharmaceutical composition according to claim 1, 2, 7 or 17, characterized in the cell genetically modified to overexpress the zyxin gene or a functional fragment thereof is a CD34 + cell.

19) Pharmaceutical composition according to any one of claims 1, 2, 7, 17 or 18, characterized in that the cell genetically modified to overexpress the zyxin gene or a functional fragment thereof is derived from a patient with a tumor pathology.

20) A non-viral intracellular transport vector characterized in that it is associated with an active agent defined in any one of claims 9 to 13.

21) An intracellular transport vector according to claim 20 characterized in that the active agent is associated with said transport vector by means of non-covalent bonds.

22) An intracellular transport vector characterized in that it is constituted by a viral recombinant expression vector comprising a cDNA coding for the zyxin gene or a functional fragment thereof.

23) An intracellular transport vector according to claim 22 characterized in that the viral recombinant expression vector is chosen from an Adenovirus, a virus associated with Adenoviruses (AAV) or a retrovirus.

24) A cell characterized in that it is genetically modified to overexpress the zyxin gene.

25) A cell characterized in that it is genetically modified to under-express the zyxin gene. 26) A cell according to claims 24 or 25, characterized in that it is chosen from a stem cell, a bone marrow cell, a hematopoietic cell or a hepatocarcinoma cell.

27) A cell according to any one of claims 2 ^r or 26, characterized in that it is a CD34 + cell.

28) A cell according to any one of claims 25 to 27 characterized in that it comes from a patient suffering from a tumor pathology.

29) A non-human transgenic mammal characterized in that it comprises at least one genetically modified cell under-expressing the zyxin gene or a functional fragment thereof.

30) Method for identifying compounds capable of stabilizing the actin network of the cytoskeleton of a cell, consisting in detecting a phenotypic reversion of expression of zyxin induced by said compounds, characterized in that it comprises the following steps : a) bringing the test compounds into contact with said cell, b) quantifying the expression of zyxin in said cell.

31) Identification method according to claim 30 characterized in that the quantification of the expression of zyxin is carried out by comparison of the expression of the messenger RNAs of zyxin in said cell in the presence and in the absence of said compound to be tested.

32) Identification method according to claim 30, characterized in that the quantification of the expression of zyxin is carried out by comparison expression of the zyxin protein in said cell in the presence and absence of said test compound

33) Method for diagnosing a tumor pathology characterized in that it comprises the following steps: a) the removal of cells from a patient, b) the quantification of the expression of zyxin in the cells removed

34) A diagnostic method according to claim 31, characterized in that the quantification of the expression of zyxin is carried out by measuring the expression of the messenger RNAs of zyxin.

35) A diagnostic method according to claim 33, characterized in that the quantification of the expression of zyxin is carried out by comparison of the expression of the zyxin protein of the cells sampled at said different intervals.

36) Method for analyzing a tumor phenotype of a patient, characterized in that it comprises the following steps: a) the removal of cells from the patient at two different intervals, b) the quantification of the expression of the zyxin in cells taken from different intervals. c) comparing the two levels of expression in order to constitute a phenotypic differential profile of said patient.

37) Method of analysis according to claim 36, characterized in that the intervals correspond to two different periods during the anti-tumor treatment of a patient. 38) Method of analysis according to claim 37, characterized in that the quantification of the expression of zyxin is carried out by comparison of the expression of the messenger RNA of the cells sampled at different intervals.

39) Method according to claim 35, characterized in that the quantification of the expression of zyxin is carried out by comparison of the expression of the protein zyxin of the cells sampled at different intervals.

40) Method of screening for an active compound in the treatment of cancers, characterized in that it comprises the following stages: a) the incubation of tumor cells with said active compound, b) the measurement of the stabilization of the polymerization of the actin network of said cells.

41) Use of a compound capable of restoring the structure of the actin networks of a cell for the preparation of a non-cytotoxic anti-tumor medicament.

42) Use of a compound capable of restoring the structure of the actin networks of a cell for the preparation of a medicament intended for the treatment and / or prevention of a pathology resulting from a chromosomal abnormality at the level of long arm of chromosome 7, more particularly in the region 7q34 / q35.

43) Use according to claim 42 characterized in that the pathology resulting from a chromosomal abnormality in the long arm of chromosome 7 is a malignant hemopathy associated with a chromosomal abnormality in the region of the discomfort of zyxin 7q34 / q35. 44) Use according to claim 41, for the preparation of a medicament intended for the treatment or prevention of hepatocarcinomas.

45) Use according to claim 41, for the preparation of a medicament intended for the treatment or prevention of mesenchymal tumors, in particular sarcomas.

46) Use according to claim 41 for the preparation of a medicament intended for the treatment or prevention of neuroectodermal cancers.

47) Use according to claim 38 for the preparation of a medicament for the treatment or prevention of Ewing's sarcoma.