EP1427853A2 - Structure bicouche supportee de presentation d'un acide nucleique associe a une proteine - Google Patents
Structure bicouche supportee de presentation d'un acide nucleique associe a une proteineInfo
- Publication number
- EP1427853A2 EP1427853A2 EP02759812A EP02759812A EP1427853A2 EP 1427853 A2 EP1427853 A2 EP 1427853A2 EP 02759812 A EP02759812 A EP 02759812A EP 02759812 A EP02759812 A EP 02759812A EP 1427853 A2 EP1427853 A2 EP 1427853A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- protein
- nucleic acid
- cell according
- linked
- layer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00596—Solid-phase processes
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00603—Making arrays on substantially continuous surfaces
- B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00603—Making arrays on substantially continuous surfaces
- B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
- B01J2219/00612—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports the surface being inorganic
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00603—Making arrays on substantially continuous surfaces
- B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
- B01J2219/00623—Immobilisation or binding
- B01J2219/00626—Covalent
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00603—Making arrays on substantially continuous surfaces
- B01J2219/00605—Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
- B01J2219/00632—Introduction of reactive groups to the surface
- B01J2219/00637—Introduction of reactive groups to the surface by coating it with another layer
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00583—Features relative to the processes being carried out
- B01J2219/00603—Making arrays on substantially continuous surfaces
- B01J2219/00659—Two-dimensional arrays
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/0068—Means for controlling the apparatus of the process
- B01J2219/00702—Processes involving means for analysing and characterising the products
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00718—Type of compounds synthesised
- B01J2219/0072—Organic compounds
- B01J2219/00722—Nucleotides
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
- B01J2219/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
- B01J2219/00274—Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
- B01J2219/00718—Type of compounds synthesised
- B01J2219/0072—Organic compounds
- B01J2219/00725—Peptides
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof
Definitions
- the present invention relates to new biostructures which can in particular serve as biosensors, in particular a support making it possible to present nucleic acids and to detect both the presence of nucleic acids in a sample, but also the interaction between proteins and said proteins. nucleic acids, as well as the binding between a ligand and a protein linked to a nucleic acid.
- DNA biosensors also called DNA chips
- DNA chips DNA biosensors
- the impact of such biosensors has mainly focused on sequencing, gene expression mapping, diagnostics (detection, damage, mutation %) and analysis of DNA-ligand interactions (hybridization %) .
- Most of the sensors used use techniques for immobilizing single-stranded nucleic acid molecules or ssDNA, the analysis being carried out using optical, electrochemical or piezoacoustic transduction systems.
- the analytical methods applied to the analysis of DNA-DNA biomolecular interactions are essentially based on the fixation of a single stranded DNA (ssDNA) within an area delimited on a substrate.
- the main techniques for producing DNA covalently attached to the substrate are the in situ synthesis of ssDNA on the support, the assembly of chemically modified ssDNA to allow grafting on the support or microdeposition on an adsorbent matrix (Boncheva et al ., 1999, Berney et al., 2000, Wittung-Stafshede P. et al., 2000).
- One of the characteristics of the present invention is to propose a new mode of presentation of nucleic acids on the surface of a substrate.
- the mode of presentation of the nucleic acids according to the invention has the originality of allowing mobility of the nucleic acids, and thus of being able to detect any change in the state of said nucleic acids by detecting a transition between two states having levels separate organizations.
- the subject of the present invention is a cell for the presentation of a nucleic acid comprising: a support which is substantially planar on the atomic scale, a protein III having a unique three-dimensional structure (stable and defined spatial organization), an IN nucleic acid linked to said protein III, the nucleic acid-protein assembly being mobile laterally with respect to said support, so that the hybridization of a target nucleic acid to said IN nucleic acid or the change in conformation of said IN nucleic acid is detectable or detected by the geometric reorganization of the nucleic acid - protein set.
- said protein III is chosen from the group consisting of proteins having a redox center and proteins having an anisotropic optical absorption property. Protein III will be described in more detail below.
- cell is meant a subset delimited laterally from the surface characterized by structural homogeneity and which can be reproduced in numerous identical or variant copies on the inorganic support.
- a cell can in particular be used for the detection of a specific type of nucleic acid (as will be seen below), different from the nucleic acid detected by the use of another cell.
- the present invention also relates to a support, having a plurality of cells according to the present invention.
- the term "Float” may be used to designate the assembly consisting of the protein mobile relative to the support, linked to the oligonucleotide.
- the oligonucleotide linked to the Float may be called “Primer” in the present application.
- DMPC Dimyristoyl phosphatidyl choline
- DOGS 1,2 dioleoyl-sn-glycero-3 [( ⁇ (5-amino-l-carboxypentyl) iminodiacetic acid) succinyl]
- DOPC Dioleoyl phosphatidyl choline
- DPPC Dipalmitoyl phosphatidyl choline
- DsDNA double stranded DNA
- DTT Di thiothreitol
- Hb5 (His) 4 human cytochrome b5-histidine 4 fusion protein
- Hb5 (His) 4mut24 cysteine mutant (position 24) of Hb5 (His) 4
- oligonucleotide is not directly in contact with the support, which allows improved presentation to target nucleic acids or other elements interacting and modifying the conformation of the primer.
- the protein-nucleic acid assembly is mobile relative to the support, since the protein is itself mobile in a lipid layer itself fixed on the support.
- a lipid bilayer is used.
- this assembly consists of a lipid membrane reconstituted on a flat surface of an inorganic nature. We then speak of a supported lipid membrane.
- Such a model has properties similar to biological membranes in terms of compactness of the elements constituting it, compartmentalization, fluidity of the constituent elements of these models as well as most of the molecules incorporated or in interaction with this model (Heyse et al., 1998, Marchai et al., 1998).
- This property of membrane dynamics is at the origin of the lateral mobility of the proposed structures and of the reorganization allowing the formation of domain and signal transduction.
- the present invention relates to a cell for the presentation of a nucleic acid comprising:
- a monolayer II comprising phospholipids, a bridging molecule having a hydrophobic end capable of interacting with the monolayer II, and an end chemically functionalized so as to form a stable bond with a protein III,
- the protein is mobile in layer II (lipid sheet) ensures lateral dynamics, i.e. a possibility for the float assembly
- the supramolecular assembly thus produced is characterized by a high degree of modularity: each stage of production or destructuring of this assembly can be carried out in a reversible manner by controlled action of the solutes present in an aqueous phase or of the action of thermal conditions or electrostatic environment.
- the grafting of single-stranded nucleic acid onto the protein was carried out. In this way, the oligonucleotides are grafted onto blocks of protein nature floating on the upper lipid monolayer of the membrane model.
- nucleic acid nucleic or nucleic acid sequence, polynucleotide, oligonucleotide, polynucleotide sequence, nucleotide sequence, terms which may be used interchangeably in the present description, is intended to denote a precise sequence of natural or synthetic nucleotides, defining a fragment or a region of a nucleic acid and which can correspond as well to a DNA or a single, double or triple stranded RNA.
- the nucleic acid sequences according to the invention also include PNA (Peptid Nucleic Acid), or the like.
- the bonds between the different bases can be conventional phosphodiester bonds, or modified bonds, such as phosphorothioates, methylphosphonates.
- the oligonucleotides can also be chimeric, that is to say having different bonds and / or bases. The term thus encompasses any variant of a nucleic acid sequence exhibiting a recognition property by hybridization.
- the nucleic acid linked to the protein in the cell according to the invention is a single-stranded nucleic acid. Its size is not a determining parameter according to the present invention, and can be easily chosen using the general knowledge of a person skilled in the art.
- the nucleic acid is linked to said protein by a reversible bond. This reversible bond can also be covalent.
- the reversible connection can, in this particular case, be considered as a connection that can be easily broken.
- the nucleic acid is linked to said protein by a covalent bond.
- a covalent bond is known to a person skilled in the art and can in particular be produced using modified bases in the oligonucleotide allowing coupling to a functionalized chemical arm in order to be able to be specifically coupled to the protein of the float.
- the nature of the grafting can be of two kinds: one can carry out a related grafting so as to intimately attach the nucleic acid molecule to the protein or a grafting via a spacer molecular arm so as to offer greater conformational freedom of DNA vis-à-vis the float.
- a spacer arm is then preferably used which is unequivocally attached to said protein.
- the geometry of the float is perfectly defined.
- the spacer arm is connected to the protein at a precise site thereof.
- said spacer arm can then be a metal complex such as cis-platinum, trans-platinum, europium or another transition metal involving ligands originating from the very structure of the nucleic acid and one or more ligands originating from the very structure of protein III of the float.
- a metal complex such as cis-platinum, trans-platinum, europium or another transition metal involving ligands originating from the very structure of the nucleic acid and one or more ligands originating from the very structure of protein III of the float.
- a spacer arm connecting a thiol- or amino- function introduced onto the nucleic acid in particular via a base.
- the choice of the base being able to be any, that is to say that one can choose a base in 3 ', in 5' or inside the oligonucleotide, this alternative being able to present certain advantages, in particular to offer a greater degree of freedom than the oligonucleotide
- this second function is also a thiol function, carried for example by a cysteine.
- the IN nucleic acid is linked to said TJI protein via a compound chosen from:
- a metal complex such as cis-platinum, trans-platinum, europium, a complex of nickel, copper, or ruthenium coordinated on the one hand with a residue or a group of amino residues of said protein III and d on the other hand to one or more natural or modified bases of the nucleic acid IN,
- the protein in the cell according to the present invention has a unequivocally detectable geometry, that is to say a stable and defined spatial organization.
- This also means that bringing the cell into contact with external nucleic acids capable of interacting with the primers in a univocal manner will lead to a highly repetitive organization at the spatial level of the floats within the cell.
- external nucleic acids can lead to the association of floats in organized groups and these groups of floats can, thanks to their lateral mobility, interact with each other in a non-covalent manner so as to form within each cell a highly organized network of floats.
- the properties (physical, electrical, optical, quantum) of this highly organized network will then differ from the dynamic properties of disorganized floats within the cell in the absence of interaction with the external nucleic acid.
- the protein of the float will be chosen so that the variations in the spatial organization of the floats with respect to each other lead to a signal detectable by any process in particular electrical, optical or resonance. Proteins having this property will preferably be chosen from the group consisting of proteins having a redox center and / or an anisotropic optical absorption and / or intrinsic fluorescence property.
- cytochromes and more preferably human cytochrome b5, of yeast, or of any other origin, flavodoxins, ferridoxins, azurines and other proteins with blue copper, multihemic proteins of the class of bacterial cytochrome c which have both a redox center and anisotropic optical absorption properties.
- fluorescent proteins mention will preferably be made of green fluorescent protein (GFP) and its analogues obtained by mutagenesis or directed evolution.
- GFP green fluorescent protein
- said protein is water-soluble. It may also have undergone modifications, some of which are indicated below, provided that these modifications lead to a protein of stable and defined three-dimensional structure meeting the criteria as defined according to the present invention.
- said protein has undergone a modification which has allowed the introduction of a single site, in said protein, to effect said binding with said nucleic acid.
- a unique site is introduced into the protein according to the invention for the grafting of the nucleic acid thus makes it possible to strongly promote the uniqueness, the specificity and the unambiguous definition of the protein-nucleic acid bond.
- said modification consists of a mutation of said protein so as to leave only a single predetermined amino acid remaining or introducing it.
- the mutation can be introduced by mutation of the nucleic acid coding for the protein, it is the simplest method which will be favored by those skilled in the art.
- the unique nucleic acid grafting site will then be this unique predetermined amino acid.
- it is indeed within the reach of the skilled person to determine the amino acids to be modified, in order to leave none subsist only one, or introduce one that is not present in the native protein.
- the protein which is used is a cytochrome b5
- the modification in the protein is such that it facilitates the grafting of the nucleic acid, that is to say, that the acid amine used for said grafting is located at the periphery (on the surface) of said protein. It is within the reach of those skilled in the art, depending on the protein chosen, to determine the best location for the introduction of the modification into the protein. In cytochrome b5, the introduction of cysteine was thus exemplified by mutation of serine 24. However, alternative locations could easily have been chosen.
- a mammalian cytochrome b5 other than a human eg rat or bovine
- the amino acids to be modified so as to introduce only one cysteine into the protein sequence.
- the three-dimensional representation will make it possible to target the most peripheral amino acids of the protein, that is to say those promoting better reactivity with the modified nucleic acid.
- protein III is mobile with respect to layer II of the cell according to the invention. This also ensures the mobility of the IN nucleic acid linked to protein III in the cell, relative to the support according to the invention.
- the mobility of the protein in layer II can be obtained in various ways, in particular when said protein has a hydrophobic tail allowing it to be anchored in the IL layer.
- the sequences of the hydrophobic tails are known in the literature, and it is at scope of the skilled person to choose such a sequence and to modify the protein chosen by genetic engineering in order to introduce such an anchoring sequence. It is then advantageous to choose a hydrophobic tail which is short, so that it anchors only in the layer IL without penetrating into the layer I. This makes it possible in particular to improve the mobility of the protein in layer II, by reducing the phenomena of "friction" which can be observed if the hydrophobic tail is too large. The optimization of these elements remains within the reach of the skilled person.
- said protein is linked to a phospholipid of layer II, and in a particular case to an artificial phospholipid preferably introduced in small proportion (that is to say in proportion less than 10%, of preferably less than 5%, more preferably about 2%).
- the mobility of the protein relative to layer II is then similar to the mobility of phospholipids in said layer. Such mobility is generally greater than when the protein has a hydrophobic tail. This improves the performance of the cell according to the invention, as will be seen.
- a person skilled in the art has several methods at his disposal for achieving a protein-phospholipid bond. Mention may in particular be made, among the covalent bonds, of acylation, farnesylation, the use of a GPI anchor sequence
- glycosylphosphatidylinositol or the incorporation of a phospholipid or fatty acid into a specific residue of protein III by any artificial process.
- a reversible bond that is to say which can be broken in the presence of reagents or under special conditions, but stable under the conditions or in the presence of the usual working reagents (hybridization of nucleic acids, link study between biological elements ).
- a person skilled in the art can use all known methods making it possible to link a protein to a liposome, for example, insofar as the liposomes generally consist of phospholipids.
- an arm capable of binding a metal chelate on one side and an amino acid on the other by using, in layer II, a modified phospholipid, said phospholipid having a zone for fixing a chelate .
- a preferred phospholipid according to the invention is DOGS or 1,2 dioleoyl-sn-glycero-3 (N (5-amino-1-carboxypentyl) iminodiacetic acid) succinyl)].
- This phospholipid is a synthetic phospholipid having an iminodiacetate residue complexing a divalent nickel cation.
- the phospholipids of said layer II are chosen so that they have hydrophobic tails chosen so that said layer is not in the crystalline state, but in the fluid state at operating temperature.
- This operating temperature obviously depends on the use that one wishes to make of the sensor. Thus, when looking for hybridization, the temperature of use may be different from that used when studying the binding of a protein to a nucleic acid.
- the transition between fluid and gel states can be strategic in the context of a detection technique based on imagery of superstructures such as atomic force microscopy (AFM).
- AFM atomic force microscopy
- the fluidity of layer II is sought. ambient temperature.
- phospholipids having hydrophobic tails having a chain length greater than or equal to 14 carbon atoms are preferably chosen, said chain possibly having unsaturations, such that said layer II is in the fluid state at temperature d 'use.
- C14 elements are generally fluid at a temperature above 23 ° C, while Cl 6 are only at 37 ° C, and Cl 8 above 50-55 ° C.
- Cl 8 tails, but having unsaturations makes it possible to reduce the phase transition temperature (crystalline state - fluid state).
- it may be preferred that the layer II is not fluid at ambient temperature but only at higher temperatures.
- this mode will be preferred if one wishes to "memorize" the state of organization of the floats, by using the lowering of temperature to freeze the structure after a higher temperature organization phase. This will be particularly the case if the detection technique (near field microscopy for example), or the analysis conditions (dehydration for example) may alter the structure.
- the unmodified phospholipids of layer II do not have any particular characteristics apart from the mobility properties already described, however, it is preferable that they have polar heads, chosen from the group consisting of neutral polar heads not carrying charges, globally neutral with opposite charges (zwitterionic), or with a negative overall charge.
- the choice of the charge carried by the phospholipids may prove to be interesting, in particular to reduce the phenomena of non-specific absorption of the test nucleic acids on the layer, which are reduced when the charge of the phospholipid heads is negative.
- the use of neutral heads (either uncharged or carrying several opposite charges) is also envisaged.
- Layer II is assembled on layer I, in a conventional manner, by the interactions existing between two hydrophobic elements in an aqueous medium. We can therefore speak of a self-assembled layer.
- a suitable catalyst called a fusogenic agent will be used to facilitate this fusion.
- a fusogenic agent such agents as the Ca 1 "4" cations, the ethylene glycol polymer (PEG) and the detergents will be used according to protocols known to those skilled in the art.
- Layer I for its part, comprises hydrophobic elements, having a chain length of approximately 2 to 2.5 nm, for example between 12 and 20 carbon atoms, preferably between 14 and 18 carbon atoms.
- the length of the chains of the elements of layer I is preferably long enough for the union of the two layers I and II to form a true bilayer.
- the elements of layer I are linear or branched and optionally bear unsaturations. It is important that this layer I is homogeneous, insofar as it serves as a support for the deposition of the layer IL
- Layer I is connected to the support of the cell according to the invention in a covalent manner, or by strong non-covalent bonds. This mode of connection to the support is not of great importance for the implementation of the invention.
- said layer I comprises phospholipids linked to said support via their polar heads.
- said layer I comprises hydrophobic elements linked to said support via a covalent bond, for example an alkyl-thiol bond or an alkyl-siloxane bond, depending on the nature of the support.
- a support link - layer I which is covalent, in order to allow easier reuse of the cell according to the invention.
- the nucleic acid is linked to the protein, and the protein is linked to layer II by reversible bonds, one can easily regenerate the cell by action of the elements (or conditions) allowing the rupture of the nucleic acid bonds.
- - protein and protein - layer II and remove layer II by the action of an appropriate detergent. It is therefore easy to imagine that a non-reversible covalent bond between layer I and the support makes it possible to reconstruct a cell. It is obvious that if the layer I is linked to the support by a reversible bond, we can start again to prepare the cell, but with an additional step.
- the reuse of the support can prove to be very interesting, insofar as it must have an almost flatness at the atomic level, and moreover can include all or part of the system for detecting the state of the cells, which can pose certain manufacturing constraints and increase the production costs of the cell according to the invention.
- the flatness of said support is such that the difference in height between two distant zones of less than 100 nm is less than or equal to 10 nm, preferably less than or equal to 3 nm, more preferably less than or equal to 2 nm.
- Different materials can be chosen to make the base of the cell according to the invention, in particular a material chosen from the group consisting of glass covered with a layer of gold, cleaved mica, silicon or any other monocrystalline material.
- Monocrystalline silicon is a very interesting material, insofar as it is effectively plane on the atomic scale, and that it can easily undergo microgravures, and various chemical modifications, which makes it possible to manufacture a support having a plurality of cells according to the invention. Furthermore, silicon has conductive or optical properties which can prove to be very advantageous as regards the detection of biological events taking place on the cell according to the invention.
- the cell according to the invention can comprise several identical or different proteins, linked to identical or different nucleic acids.
- a target nucleic acid complementary to two primers will be able to bind the two corresponding floats, which will accentuate its interaction with the support and initiate a change in the spatial organization of the floats within the cell.
- nucleic acid IN - protein III and protein III - layer II links are reversible, it is possible, by means of agents competing in the Float-Support interaction (Histidine, Imidazole, EDTA), to easily differentiate degrees of hybridization.
- Histidine, Imidazole, EDTA agents competing in the Float-Support interaction
- the aspect of two-dimensional reorganization of the Float and Primer nano-objects on the flat membrane surface, obtained by the fluidity of layer II, is in the field of the self-organization of biological molecules and physical phenomena. -chemicals that arise from these collective movements.
- this organization is extremely sensitive to the geometric conformation of the nucleic acid and therefore to any factor (mismatch, protein binding, chemical agent) capable of interacting with the conformation or structure of the nucleic acid.
- any factor mis, protein binding, chemical agent
- studying the binding of any protein or ligand to a nucleic acid (single strand or double strand) linked to the protein anchored in layer II, or when studying the binding of an effector molecule on a protein (of the transcription factor type) linked to a nucleic acid, on a cell according to the invention we then observe (due to the arrival of these elements), a modification of the structure (by curvature of the nucleic acid) and of the balance of the system which can then be easily observed by various methods capable of detecting the change in the organization of the cell, and in particular by means of an optical system (absorbance, fluorescence), electrical, electronic, surface plasmon resonance, energy transfer, radiolabelling, diffraction (optical, electronic, X-ray, neutron)
- the principle of the invention is therefore the mobility of the protein anchored in layer II, allowing a reorganization of the system and the fact that the protein-nucleic acid unit is unique and not random, which makes it possible to detect said reorganization.
- nucleic acid a single target nucleic acid molecule in the test sample will allow reorganization which can then be detected.
- An example of carrying out such a method would be to pre-organize the cell with a nucleic acid of the same nature as that to be detected but having on the one hand a lower affinity for the primer than the nucleic acid to be tested (mod base, mismatch), on the other hand whose geometry (size, curvature) would different from the nucleic acid to be tested.
- the exchange of a single nucleic acid (external competitive molecule) within a pre-organized cell will then lead to a local structural defect.
- the hybridization as such is not detected, but rather the changes induced in the cell according to the invention.
- the cell according to the invention or the support having a plurality of cells
- the cell according to the invention can be used for the detection of a target in a sample, without it being necessary to mark or manipulate excessively said sample .
- This is another important advantage, since it is thus possible to detect the presence of mRNA without having to transform it first into cDNA.
- ssDNA and dsDNA are so different that it results in very distinct physicochemical properties.
- this effect can be detected in particular by a change in the electronic conductivity of the cell according to the invention. This is particularly easy when the protein according to the invention also has a redox center.
- Hybridization can also be detected by surface plasmon resonance, or by an optical method, which is facilitated by the presence of a protein with anisotropic optical absorption.
- the invention therefore also relates to a support having a plurality of cells according to the invention.
- the different cells can be separated from each other by microgravure on the support, or by the presence between two cells of a hydrophobic layer made up of elements having a chain length different (preferably less) than the chain length of the elements of layer I, for example less than or equal to 5 carbon atoms (“differential patterning” Cheng et al., 2000). These elements having a low carbon chain can be deposited on the support using the masking techniques common in microelectronics.
- the support according to the invention is advantageously supplemented by the installation of a system allowing the measurement of the current, the impedance or the potential, allowing the detection of the events happening on each of the cells.
- the support has a surface alternating conductive and reflective areas and non-conductive and transparent areas.
- Such a network comprising transparent zones of size clearly less than the wavelength of visible light has been described as having a light transmission function as a function of the wavelength in the form of a "comb" (Ebbesen et al, 1998).
- the optical transmission properties of such a structure must be altered by the state of the neighboring cells, which provides a possible means of reading.
- the support according to the invention comprises between each cell an integrated optical device (laser-photodiode pair for example) capable of measuring the absorbance of a cell in two crossed directions and of deducing its state of organization (anisotropy) or disorganization (isotropy).
- an integrated optical device laser-photodiode pair for example
- a reading of the state of organization of each cell by a sensitive laser optical scanning device.
- a sensitive laser optical scanning device capable of reading cells of submicron size is commonly used at the general public level in mini-disc readers and rewritable CD-ROM readers.
- the variation in polarization of the reflected light normally provided in magneto-optical discs by a reorganization of the crystal lattice of a rare earth salt (europium, and other compounds of the same transition series from the Mendeléeiv table ) by a magnetic field and laser heating would be in the system described in the invention by the variation of spatial organization in the cell of the protein and or its cofactor which are optically active objects in terms of polarization, d ellipticity (differential absorption of polarized light) and optical absorption.
- the invention also relates to a method for identifying the presence of a test nucleic acid in a sample, comprising the steps of: a) bringing said sample into contact with a cell according to the invention, under conditions allowing hybridization from said test nucleic acid to a nucleic acid linked to a protein of said cell, b) detecting the hybridization of said test nucleic acid to said nucleic acid linked to said protein. Detection can be carried out by any of the means mentioned above. If the test sample has been marked, the detection can be carried out according to said marking. However, it may be preferred to detect the presence of the target nucleic acid by changing the conformation of the system. Thus, the cell according to the invention allows detection without the need to mark the test sample.
- the invention also relates to a method for identifying the binding of a protein to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) bringing said protein into contact with a nucleic acid linked to a protein, in a cell according to the invention, b) detecting the binding of said protein to said nucleic acid and / or its activity on the conformation of said nucleic acid.
- Said nucleic acid can be single strand, double strand or triplex, when a nucleic acid has already been attached to one of the nucleic acids (primers) of the cell. It is clear that the choice of certain bases for the primer can lead to the formation of a triplex nucleic acid, said formation then being considered, within the meaning of the invention as a hybridization.
- Detection can also be carried out in several ways, and in particular by changing the conformation of the system.
- the invention also relates to a method of identifying the binding of a ligand to a protein attached to a nucleic acid attached to a protein in a cell according to the invention, comprising the steps of: a) bringing said ligand into contact with said protein, b) detecting the binding of said ligand to said protein.
- the binding can be direct or indirect, and involve for example the binding of the ligand to a receptor which will then bind to a protein or a protein complex already associated with the DNA of the cell.
- the binding of the ligand to the protein can be observed in particular by a change in the conformation of the system.
- the invention relates to a method for identifying the binding of a compound to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) contacting said compound with a nucleic acid linked to a protein, in a cell according to the invention, b) detecting the binding of the compound to said nucleic acid and / or its activity on the conformation of said nucleic acid.
- said nucleic acid can be single strand, double strand or triplex, when a nucleic acid has already been fixed on one of the nucleic acids of the cell.
- connection is detected in particular by change of conformation of the system, as has been explained above.
- the detection of the geometry or of the disturbance of the geometry of the Float-Primer-Target assemblies can be advantageously carried out thanks to the contribution of atomic force microscopy technologies in a liquid environment.
- the potential applications of this type of characterization relate to the study of the impact of the interaction of all molecules or macromolecules with nucleic acids (regulation, transcription factors, drugs, drugs, especially for chemotherapy ...) .
- the device according to the invention offers molecular and supramolecular contiguity involving a lipid membrane, redox proteins and nucleic acids.
- This assembly of electro- and opto-active biomolecules within microsystems originating from microelectronics can prove to be potentially of strong impact in the fields of electronic transductions (conductors, semiconductors, biomolecular circuits) and non-linear optics (anisotropy).
- double-stranded DNA unlike ssDNA, has electron transfer properties according to an electronic conduction process by covering the Pi orbitals.
- hybridization reaction between two molecules of ssDNA specific.
- the cell according to the invention has an original biomolecular architecture which is positioned in the field of nano-bioengineering, that is to say the development of new types of nanostructures having properties of:
- DNA has the properties of molecular and mechanical recognition to be integrated into microcircuits.
- the intrinsic electronic properties of this macromolecule seem insufficient to be used directly (Braun et al., 1998).
- One of the most promising lines of research in the use of potential for transporting electrical charges along the DNA duplex is represented by the use of electrocatalytic processes (Boon et al., 2000).
- Such a signal transduction device can completely be integrated into the device according to the invention thanks to the use of additional redox molecules.
- the presence of the floats composed of redox proteins having electroactive groups and / or different and modular redox potentials makes it possible to ensure a dense electronic environment in terms of recovery of the electronic orbitals.
- redox macromolecules considered then as relay centers
- such a structure could be at the origin, of an electronic doping of DNA, to jumps of electrons between proteins or energy transfer processes.
- a cell according to the invention can have other modes of use than the simple detection methods which have been mentioned above.
- the invention also relates to a method for preparing a cell according to the invention comprising the step of: - placing, on a support which is substantially planar on the atomic scale, of a protein III having a unique three-dimensional structure ( stable and defined spatial organization), linked to an IV nucleic acid, so that the nucleic acid - protein assembly is movable laterally with respect to said support, so that the hybridization of a target nucleic acid to said IV nucleic acid or the change in conformation of said nucleic acid IV is detectable by the geometric reorganization of the nucleic acid - protein assembly.
- the invention also relates to a method for preparing a cell according to the invention comprising the steps of:
- a protein III having a unique three-dimensional structure
- said protein III being movable laterally in said layer II, by means of a bridging molecule having a hydrophobic end capable of interacting with monolayer II, and one end chemically functionalized so as to form a stable bond with a protein III, said protein III being unequivocally linked to an IN nucleic acid, preferably by a molecular arm.
- Figure 1 Construction of the hybrid bilayer and characterization by resonance surface plasmon analysis.
- A the recorded signal corresponds to the baseline of the metal support covered with a dense monolayer of OM in the environment of the working buffer (conventionally phosphate buffer, 50mM, pH7.5).
- B The signal variation corresponds to the injection into the fluid circuit of a mixed DMPC-DOGS vesicular solution made in water.
- the increase in signal corresponds to the kinetics of fusion of the vesicles on the support so as to obtain a compact lipid monolayer.
- This value corresponds to that of a lipid hemimembrane.
- C A procedure for treating the membrane with a sodium hydroxide solution
- 50 RU is a surface covering rate of 7pmole.cm " .
- Figure 3 Diagram of the membrane biosensor, construction / regeneration of the supramolecular assembly Construction:
- An inorganic surface (ex: gold) is functionalized by a dense monolayer of octadecyl mercaptan. This surface is conducive to the fusion of lipid vesicles (liposomes) until a dense monolayer of phospholipids is obtained above the support.
- the presence of 10% (mol / mol) of modified phospholipids allows the anchoring of b5 cytochromes so as to obtain a dense monolayer of proteins.
- Figure 4 Characterization of the b5-cis-Pt-DNAb complex, Polyacrylamide SDS gel (15%) of Hb5 (His) 4 platinized and coupled with an oligonucleotide of sequence CTATCATTTGCTTACTATTC (SEQ ID N ° 13)
- FIG. 4.A Autoradiogram of a gel into which Hb5 (His) 4-cisPt was injected (well 1); the oligonucleotide radiolabelled with P (well 2) and the b5-cis-Pt-ssDNA complex (well 3) makes it possible to demonstrate the appearance of an additional radioactivity signal in well 3 compared to well 2.
- FIG . 4.B Use of a polyacrylamide gel (15%) under denaturing conditions (SDS).
- Cross characterization of the b5-cis-Pt-ssDNA complex said complex injected on lane 3 has a band which makes it possible to confirm the existence of a population whose molecular weight is close to 20000 Dalton, ie the theoretical molecular weight.
- FIG. 5 Spectral characterization of the Hb5 (His) complex 4- CTATCATTTGCTTACTATTC via a ponta e s-Pt [(NH 3 ) 2 (H 2 O) 2 ] 2+
- Two reconstitution procedures of the Hb5 (his) complex 4-cisPt- SsDNAs are characterized by spectrophotometry in a 240-600nm window. Cytochrome b5 has a maximum absorption at 412nm while ssDNA has a maximum at 260nm.
- the spectral profile of two samples as well as the relative quantification of each species thanks to the molar extinction coefficients makes it possible to highlight:
- Figure 6 Determination of the melting temperature of 20-mer DNA and 20-mer DNA bridged with platinized Hb5 (His) 4.
- the determinations of the melting temperatures were carried out by spectral measurements of hyperchromicity after melting of the complementary strand at high temperature (80 ° C.). A decrease in steps of 1 ° C makes it possible to spectrally follow the evolution of dsDNA. • The absorption results as a function of temperature for the free ssDNA makes it possible to obtain a curve whose inflection point corresponds to the melting temperature. The Tm for the ssDNA is evaluated at 45 ° C.
- Cytochrome b5 has a maximum absorption at 412nm while the
- SsDNA has a maximum at 260nm.
- the NaCI gradient allows the gradual elution of all populations:
- Figure 8 Elution profile and supramolecular composition of cytochrome b5-ssDNA complexes
- the molar quantification of the isolated species after separation on DEAE is represented in the form of a histogram: • populations 1 and 2 of Hb5 (His) 4mut24 characterized in FIG. 7 do not present any ssDNA component measured at 260nm. These two populations correspond to the monomeric form (which did not react during the incubation) and to the dimeric form (resulting from a cystine bridge between two proteins).
- Figure 9 Detection by surface plasmon resonance of the association kinetics of a ssDNA complementary to the ssDNA primer in interaction with the biosensor
- FigurelO Diagram of the assembly as a DNA biosensor ⁇
- the arrow represents the flow of biomolecules from the test sample.
- Figure 11 Diagram of the assembly as nanostructures with dynamic and conformational properties
- a set of different floating blocks can be presented on the surface of the biosensor, the injection of a potentially hybridizing oligonucleotide on part of the floating blocks must allow inter-block bridging.
- the character of lateral mobility of the elements must favor this process until obtaining phenomena of supramolecular reorganization on the surface of the cell.
- the solid support used consists of a glass plate coated with a gold film marketed by the company BIAcore ® as Jl chip name.
- Such supports have also been manufactured by the inventors. They consist of the use of planed glass strips (thickness 0.4mm, 22 * 10mm, Prolabo) undergoing successively a vaporization of 2.6nm of chromium then a vaporization of 48nm of gold under a vacuum of 2.10 mm of Hg.
- the metal interface is covered by self-assembly of octadecyl mercaptan or OM molecules from Aldrich.
- the OM solution is used at ImM in a 4/1 (v / v) ethanol / water mixture. After two hours of incubation, the slides are washed with chloroform, methanol and then with water and are dried under a stream of nitrogen.
- the method used to prepare the liposomes is based on a double sonication / extrusion procedure.
- the dimyristoyl and / or dipalmitoyl phosphatidyl choline phospholipids from Sigma, main constituents of the vesicles, are dissolved in an organic solution of chloroform.
- a lipid film is then deposited in scintillation glass tubes by evaporation of the chloroform under a stream of nitrogen. This film is re-suspended in an aqueous solution (ultra pure or buffered water) to a final concentration of ImM. This mixture is then sonicated:
- the last manufacturing step consists of extrusion through a polycarbonate membrane (Avestin, 19mm diameter and pore diameter 50nm or 100nm) in a Liposofast ® basic device, Avestin, Inc.
- a second procedure is used in the case of the use of molecules sensitive to ultrasonic disturbances such as the hydrocarbon chains of certain phospholipids having polyunsaturations (ex: 1,2 dioleoyl-sn-glycero-3 [(N (5-amino -l-carboxypentyl) iminodiacetic acid) succinyl] or DOGS from Aventi Polar Lipids, Dioleoyl phosphatidyl choline or DOPC from Sigma).
- This step is followed by a stage of extrusion through a polycarbonate membrane with 50 nm pore diameter in a LiposoFast apparatus ® home AVESTIN.
- the hydrophobic support serving as a matrix to generate the lipid monolayer undergoes a treatment procedure as follows: in order to improve the wettability of the structure, an ethanol / water solution (1/1 vol) is injected onto the support and is followed by rinsing steps with water and buffered solution. In order to clean the interface, the injection of a detergent solution, octyl glucopyranoside from Sigma, 40mM concentration. Immediately after, the made-up lipid vesicles are injected into contact with the functionalized metal surface. Spontaneously, according to a liposome fusion process established by Kalb et al. (1992), the vesicles fuse in contact with the hydrophobic monolayer of OM. After 30 to 60 minutes, this process leads to the formation of a lipid monolayer completely covering the OM monolayer.
- the molecular assembly thus obtained has a metallic substrate covalently covered with a first alkylated sheet on which is assembled a fluid and dynamic sheet of amphiphilic molecules.
- Characterization experiments use BIAcore ® technology using BIAcore 1000 and BIAcore X devices.
- Liposome fusion results are obtained in the form of a sensorgram ( Figure 1).
- a phase of association with the support is observed leading to a plateau after 20-30 of contact time.
- a first quantity of lipid material is evaluated.
- a surface cleaning procedure with 20mM sodium hydroxide makes it possible to remove all the vesicles imperfectly fused to the surface of the biosensor.
- the signal obtained is between 1400 and 2000 RU, which is consistent with the results available in the literature and the calibration methods supplied by the manufacturer.
- An injection of soluble proteins in the vicinity of this supported membrane makes it possible to validate the absence of defect in the upper lipid monolayer.
- the introduction into the liposomes of synthetic phospholipids DOGS at a rate of 10% mol / mol gives this monolayer complexing properties of protein-TagHis sensor.
- Example 2 Construction, expression and purification of fusion proteins 2.1) Water-soluble proteins with a histidine tag
- the initial protein used in the context of this example is a membrane hemoprotein: human or yeast cytochrome b5. It is a bitopic protein with a large globular water-soluble domain containing heme and a small hydrophobic domain allowing anchoring to microsomal membranes. All the nucleotide and amino acid sequences are grouped in the sequence list.
- the first work to modify the sequences of cytochrome b5 consisted in the ablation of the carboxy terminal side of the amino acids involved in membrane insertion to replace them with four histidines.
- This chimeric or fusion protein is obtained by cloning the nucleotide sequence by polymerase chain reaction (PCR).
- the cloning kit used is the TOPO TA cloning® from Invitrogen.
- the coding DNA sequence for the chimeric protein is inserted into a vector pCR ® 2.1-TOPO ®.
- the assembly was amplified in cells Niai of One Shot ® .
- the DNA coding sequence was then transferred into the vector PUHE25-2 expression (SphI cloning ATG and Bam HI to the stop).
- Membrane Hb5 nucleotide sequence (SEQ ID N ° 3)
- the chimeric protein obtained previously is then mutated in order to make a thiol group appear at the periphery of the protein via a cysteine residue.
- This modification is carried out by means of a mutagenesis directed on serine No. 24 of Hb5 (His) 4.
- the mutagenesis kit used is the QuikChange ® site-directed Mutagenesis Kit from Stratagene.
- the action of DNA pfu polymerase makes it possible to reconstitute the expression vector and the sequence to be mutated.
- Supercompetent roundedcurian ® XLl-blue bacteria are transformed by this plasmid.
- HbS-Ofis ⁇ mut24 nucleotide sequence (SEQ ID N ° 6)
- AACCACTGCA AGAGCACCTG GCTGATCCTG CACCACAAGG TGTACGATTT GACCAAATTT 121 CTGGAAGAGC ATCCTGGTGG GGAAGAAGTT TTAAGGGAAC AAGCTGGAGG TGACGCTACT
- the bacterial expression strain is XLl-blue.
- LB Luria-Bertami
- the culture is placed at room temperature with stirring for 48 h then the protein overexpression is induced by addition of Isopropyl ⁇ -D-ThioGalacto Pyranoside (IPTG) at a rate of 0.5 mM final.
- IPTG Isopropyl ⁇ -D-ThioGalacto Pyranoside
- the bacteria are centrifuged after 24-48 hours of induction and are frozen. A freeze / thaw cycle is followed by a lysis / fractionation step (lysozyme, cholic acid and ultrasonic disintegrator).
- IMAC metal ion chromatography
- An agarose gel functionalized with iminodiacetic acid (Sigma) is previously loaded (flow 1 ml / min) with Nickel by loading with a 50mM Nickel Chloride solution solubilized in an acetate buffer, pH5.4. the column is washed with this same buffer at the same flow and then we replace the acetate with a sodium phosphate buffer, 50 mM, pH 7.
- the cell fractionation is directly injected onto an agarose gel column at 5 ml / min. Specifically, the chimeric proteins are retained on the column according to the IMAC technique.
- the column undergoes a washing phase with a phosphate buffer of increasing concentration 50 to 250 mM, pH7 until the passing solution no longer has an absorption spectrum in the ultraviolet (240-300nm).
- the protein sample is eluted by taking histines in solution of concentration 1 mg / ml in 50 mM phosphate buffer, pH 7. Similar experiments were carried out on the yeast form of cytochrome b5.
- cytochrome b5 Similar experiments were carried out on the yeast form of cytochrome b5.
- the hybrid bilayer structure presented in paragraph 1.3 was functionalized in order to give the model properties of affinities by metal ions.
- a synthetic phospholipid having an iminodiacetate residue complexing a divalent nickel cation was chosen. It is DOGS or 1,2 dioleoyl-sn-glycero-3 (N (5-amino-l-carboxypentyl) iminodiacetic acid) succinyl)] from Avanti polar Lipid, Inc.
- One method for addressing stable and specific soluble proteins to membrane supports is to use the coupling between a divalent metal chelating cation present on the surface of the membrane and histidine residues. It has been shown that cytochrome b5 whose membrane domain has been delisted in favor of a Tag Histidine segment retains an affinity for biological membranes having divalent chelating cations.
- a histidine solution at 1 mg / ml injected at the surface of the biosensor causes a sharp decrease in the signal, that is to say the amount of cytochrome b5 fixed on the membrane (FIG. 2b). In this way one can compete with the specific interaction and return to the baseline of the signal.
- Platinum complexes in particular cis-diamminedichloroplatin (cis- [PtCl 2 (NH 3 )] are agents which bind covalently to DNA.
- cis- [PtCl 2 (NH 3 )] are agents which bind covalently to DNA.
- these molecules by substitution of their labile chloro ligand, can bridge d on the one hand a base of DNA and on the other hand a nucleophilic residue of an amino acid of a protein.
- [Pt (NH3) 2 (H2 ⁇ ) 2 + are prepared by dissolving a suspension of cis- [Pt (N ⁇ 3) 2 (NH3) 2] and tr ⁇ ra , - [Pt (N03) 2 (NH3) 2] in the water, respectively formed by the reactino of ezs- [PtCl2 (NH3) 2] and tr ⁇ m? - [PtCl2 (NH3) 2] with silver nitrate.
- the DNA-20mer, its complementary strand and its complementary biotynilized strand come from Eurogentec.
- 5'CTATCATTTGCTTACTATTC 3 '(SEQ ID N ° 13) is chosen so as to have only one guanine because nitrogen N7 is the main site of DNA platination (Lepros et al., 1990).
- the platination reactions are carried out firstly on DNA or on cytochrome b5 (Rb5 (is) 4 and Ht> 5 (His) 4mut24) but the DNA-5 bridging yield is higher when cytochrome b5 is first platinized.
- the platination site is determined after treatment of the modified oligonucleotide with piperidine-DMS under "Maxam-Gilbert" sequencing conditions followed by treatment with NaCN.
- the lack of reactivity of guanine N7-platinum with dimethylsulfate (DMS) makes it possible to conclude that the latter is protected from DMS and therefore from its effective platinization (Comess et al., 1990).
- Cytochrome hS (100-200 ⁇ M) is incubated in the presence of 5 equivalents of platinum complexes in unbuffered water (pH5) for 5 hours at 25 ° C.
- Cytochrome b5 is then incubated (90 ⁇ M) with 1.5 equivalent of DNA in unbuffered water (pH5) for 50 hours at 25 ° C.
- the t-DNA complexes> 5 are separated from the uncomplexed DNA molecules using an agarose gel functionalized with Ni 2+ / iminodiacetic acid (Sigma) groups. The elution of the protein is by injection of immidazole (IM). Excess DNA is not retained ue on the column.
- IM immidazole
- the platinum-coupled DNA-b5 complexes are also purified from non-reactive forms of DNA using magnetic spheres coated with Promega streptavidin according to a modification of the procedure described by Promega: 0.5 nmol of total DNA.
- Platinum complexes and trans- [Pt (NH3) 2 (H2 ⁇ ) 2] 2 + are able to couple cytochrome> 5 with ssDNA-20mer.
- the platinization site on the DNA oligonucleotide occurs at the N7 level of a single guanine.
- the "DNA-b5" macromolecular complexes are characterized by gel analyzes of electrophoresis under denaturing conditions, spectrophotometric quantification and determination of melting temperature with a complementary free ssDNA.
- the radioactivity of the ssDNA * is associated with the migration band of Hb5 [His] 4 (revealed by staining with coomassie blue) demonstrating that a covalent bond has been formed between the ssDNA-20mer and the cytochrome b5 ( Figure 4).
- the “DNA-pt-b5” complex was characterized by spectral analysis in order to determine the stoichiometry of the reaction between cytochrome b5 and ssDNA-20mer.
- the experimental conditions allowed the formation of an equimolecular complex as indicated by the respective absorbance of cytochrome b5 at 413nm and of ssDNA-20mer at 260 nm ( Figure 5).
- the platinization reactions do not occur on the label 4 histidines in the carboxy terminal position, in which case the complex thus formed would not be capable of being purified on an agarose-iminodiacetate column or of interacting strongly. with the cell.
- Mass characterization experiments electrospray, Maldi-TOF of the various complexes are in progress.
- Example 5 Grafting of Protein-ssDNA by Spacer Arm 5.1) Functionalization of ssDNA by DPDPB
- a second alternative was explored concerning the grafting of a nucleic acid with cytochrome b5.
- the inventors chose not to use direct coupling but preferably complexation by through a spacer arm.
- the molecule ensuring intermolecular bridging is 1,4-Di- [3 '- (2'-pyridyldithio) propionamido] butane or DPDPB. This molecule allows a covalent bond between two molecules having thiol functions and ensures an intermolecular space of 1.6 nm.
- a thiol function was created both on an oligonucleotide and on cytochrome b5.
- the modified oligonucleotides are of HPLC quality and are produced by Eurogentec.
- the different modified oligonucleotides are as follows:
- Oligonucleotide no W1 (SEQ ID No 8) 5 'GCT-AGC-TGC-ATA-GAT-CTC-TAC-C-SH 3'
- the thiol modification is carried out at the 3 'end of the 22mer.
- Oligonucleotide no W2 (SEQ ID No 9) 5 'GCT-AGC-TGC-ATA-GAT-CTC-TAC-C 3'
- the thiol modification is carried out in-chain on a thymine placed in position l 1 of the 22mer.
- the different unmodified oligonucleotides involved in the exemplification are the following:
- Oligonucleotide No. W3 (SEQ ID No. 10) 5 '-GGT-AGA-GAT-CTA-TGC-AGC-TAG-G-3' W3 is the complementary 22mer of W1.
- W4 has a sequence complementary to the first 9 bases of Wl (5 'side) and the first 11 bases of Wl (3' side). In this way W4 has the particularity of being able to bridge two oligonucleotides W1.
- the DPDPB-W1 coupling procedure is as follows: in order to prevent any dimerization of the WIs by disulfide bond, the oligonucleotides are treated with a reducing agent of DiThioThreitol (DTT) at the rate of a 1/5 molar fraction. The mixture is incubated at 30 ° C for 15 min. The mother solution of DPDPB is dissolved in dimethyl sulfoxide (DMSO) at the rate of 10 mg / ml. Addition of DPDPB in an amount of 1 mole of W1 for 500 to 5000 moles of DPDPB is carried out in the presence of the residual DTT during an incubation time of 2 to 4 hours at 30 ° C.
- DTT DiThioThreitol
- the sample W1 is then specifically fixed on a DEAE ion exchange column, the reagents are eliminated and the oligonucleotide is eluted by addition of a 1.5M NaCl solution.
- the rate of modification can be calculated by DTT assay of the cross-linking agent. This reduction causes the departure of the second thiopyridine group of the bridging agent, the quantification of which can be obtained spectrally at 341nm. The describe procedure achieves 100% complex.
- the excess oligonucleotide is eliminated by retention of the proteins on an iminodiacetate-Ni 2+ gel.
- the elution of the proteins is obtained by using a histidine lmg / ml solution, as indicated during the step of purification of the HisTag proteins.
- Spectral analysis on a [240-500] nm window makes it possible to demonstrate the effective coupling of Hb5 (His) 4 mut24 with W1 (FIG. 7).
- the complexation rates vary from 35 to 65%.
- the b5-Wl population is isolated and can be confronted with the hybrid membrane.
- the grafting of the different complexes on the hybrid bilayer was characterized by surface plasmon resonance.
- BIAcore device Experiments based on radioactivity and fluorescence labeling are being developed in the laboratory.
- the coupling experiments of the molecular assembly on the lipid model using the nickel chelating complex by surface plasmon resonance have shown the formation of a stable complex.
- the compactness levels obtained with the assembly appear to be lower than those obtained with the protein not modified by the oligonucleotide.
- the increase in negative charges brought by Wl can be at the origin of repulsions between supramolecular blocks and thus lead to a less recovery.
- the recovery values were evaluated between 200 and 250RU.
- Example 7 Potential of the Biosensor and Hybridization Detection In order to evaluate the potential of the membrane biosensor in terms of specificity and sensitivity, various tests were carried out.
- W4 represents a random sequence starting from the constitutive bases of Wl, the study of the evolution of the signal made it possible to show that W4 does not interact on the surface of the biosensor ie the lipid structure and the supramolecular assembly b5-Wl; and this whatever the bridging means (cis-Pt or DPDPB)
- the hybridization results demonstrate the possibility of detecting hybridization states between two ssDNAs on the surface of the biosensor.
- the hybridization results show a threshold value of approximately 30 to 35RU.
- the expected value for a complete hybridization from a b5-Wl block signal of 250RU is 70RU.
- the measurements of Tm carried out on W1 clearly show a phase transition temperature close to ambient temperature, that is to say the measurement temperature within the BIAcore device. At this temperature only 50% of hybridization is expected. The value measured with our device is therefore close to optimal hybridization proof of a very favorable accessibility of the target molecules presented by the biosensor.
- the membrane biosensor allows molecular hybridization o of approximately 10 molecules.
- biosensor presented requires only the capture of a complementary ssDNA without the use of a labeled probe being necessary.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Addition Polymer Or Copolymer, Post-Treatments, Or Chemical Modifications (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0104559 | 2001-04-04 | ||
FR0104559A FR2823223B1 (fr) | 2001-04-04 | 2001-04-04 | Structure bicouche supportee de presentation d'un acide nucleique associe a une proteine |
PCT/FR2002/001150 WO2002081740A2 (fr) | 2001-04-04 | 2002-04-03 | Structure bicouche supportee de presentation d'un acide nucleique associe a une proteine |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1427853A2 true EP1427853A2 (fr) | 2004-06-16 |
Family
ID=8861918
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP02759812A Withdrawn EP1427853A2 (fr) | 2001-04-04 | 2002-04-03 | Structure bicouche supportee de presentation d'un acide nucleique associe a une proteine |
Country Status (5)
Country | Link |
---|---|
US (1) | US7294460B2 (fr) |
EP (1) | EP1427853A2 (fr) |
AU (1) | AU2002308059A1 (fr) |
FR (1) | FR2823223B1 (fr) |
WO (1) | WO2002081740A2 (fr) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2701726A1 (fr) * | 2007-10-04 | 2009-04-09 | Halcyon Molecular | Sequencage de polymeres d'acides nucleiques par microscopie electronique |
US8753309B2 (en) * | 2011-06-24 | 2014-06-17 | The Invention Science Fund I, Llc | Device, system, and method including micro-patterned cell treatment array |
WO2014185960A2 (fr) | 2013-05-14 | 2014-11-20 | Genomics Usa, Inc. | Composition et procédés pour piéger une protéine sur une surface |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001020330A1 (fr) * | 1999-09-17 | 2001-03-22 | The Texas A & M University System | Agencements de bicouches lipidiques adressees et bicouches lipidiques avec compartiments aqueux confines adressables |
-
2001
- 2001-04-04 FR FR0104559A patent/FR2823223B1/fr not_active Expired - Fee Related
-
2002
- 2002-04-03 AU AU2002308059A patent/AU2002308059A1/en not_active Abandoned
- 2002-04-03 US US10/474,299 patent/US7294460B2/en not_active Expired - Fee Related
- 2002-04-03 EP EP02759812A patent/EP1427853A2/fr not_active Withdrawn
- 2002-04-03 WO PCT/FR2002/001150 patent/WO2002081740A2/fr not_active Application Discontinuation
Non-Patent Citations (1)
Title |
---|
CORNELL B A ET AL: "A biosensor that uses ion-channel switches", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol. 387, no. 6633, 5 June 1997 (1997-06-05), pages 580 - 583, XP002140886, ISSN: 0028-0836, DOI: DOI:10.1038/42432 * |
Also Published As
Publication number | Publication date |
---|---|
US7294460B2 (en) | 2007-11-13 |
US20060110728A1 (en) | 2006-05-25 |
FR2823223B1 (fr) | 2004-03-12 |
WO2002081740A3 (fr) | 2004-04-15 |
WO2002081740A8 (fr) | 2003-11-06 |
AU2002308059A1 (en) | 2002-10-21 |
FR2823223A1 (fr) | 2002-10-11 |
WO2002081740A2 (fr) | 2002-10-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Salafsky et al. | Architecture and function of membrane proteins in planar supported bilayers: a study with photosynthetic reaction centers | |
Robeson et al. | Spontaneous reconfiguration of adsorbed lysozyme layers observed by total internal reflection fluorescence with a pH-sensitive fluorophore | |
Diaz et al. | Double cushions preserve transmembrane protein mobility in supported bilayer systems | |
Naumann et al. | Proton transport through a peptide-tethered bilayer lipid membrane by the H+-ATP synthase from chloroplasts measured by impedance spectroscopy | |
Yoon et al. | Multilayered assembly of dendrimers with enzymes on gold: thickness-controlled biosensing interface | |
Song et al. | Direct, ultrasensitive, and selective optical detection of protein toxins using multivalent interactions | |
Ross et al. | Formation of self-assembled, air-stable lipid bilayer membranes on solid supports | |
Wicklein et al. | Phospholipid–sepiolite biomimetic interfaces for the immobilization of enzymes | |
Brennan | Biofriendly sol–gel processing for the entrapment of soluble and membrane-bound proteins: Toward novel solid-phase assays for high-throughput screening | |
Kriegel et al. | Biomimetic environment to study E. coli complex I through surface-enhanced IR absorption spectroscopy | |
Gutiérrez‐Sanz et al. | H2‐Fueled ATP Synthesis on an Electrode: Mimicking Cellular Respiration | |
Hayes et al. | Preservation of NADH voltammetry for enzyme-modified electrodes based on dehydrogenase | |
Madoz-Gurpide et al. | Modulation of electroenzymatic NADPH oxidation through oriented immobilization of ferredoxin: NADP+ reductase onto modified gold electrodes | |
Vargo et al. | Distance dependence of electron transfer kinetics for azurin protein adsorbed to monolayer protected nanoparticle film assemblies | |
Shen et al. | Hydrogen bond organic frameworks as radical reactors for enhancement in ECL efficiency and their ultrasensitive biosensing | |
Xu et al. | Sensitive electrochemical sensor for glycoprotein detection using a self-serviced-track 3D DNA walker and catalytic hairpin assembly enzyme-free signal amplification | |
Bondurant et al. | Optical and scanning probe analysis of glycolipid reorganization upon concanavalin A binding to mannose-coated lipid bilayers | |
Winger et al. | Formation and Stability of Complex Membrane− Mimetic Monolayers on Solid Supports | |
Chen et al. | Oriented assembly of purple membrane on solid support, mediated by molecular recognition | |
US20070116733A1 (en) | Surface immobilised multilayer structure of vesicles | |
Zhang et al. | Electrochemical analysis of enzyme based on the self-assembly of lipid bilayer on an electrode surface mediated by hydrazone chemistry | |
EP1427853A2 (fr) | Structure bicouche supportee de presentation d'un acide nucleique associe a une proteine | |
Zhong et al. | Site specific and reversible protein immobilization facilitated by a DNA binding fusion tag | |
Lindholm-Sethson et al. | Electron transfer to a gold electrode from cytochrome oxidase in a biomembrane via a polyelectrolyte film | |
Boireau et al. | Unique supramolecular assembly of a redox protein with nucleic acids onto hybrid bilayer: towards a dynamic DNA chip |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20031027 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
17Q | First examination report despatched |
Effective date: 20090722 |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12Q 1/68 20060101ALI20131003BHEP Ipc: C40B 40/06 20060101AFI20131003BHEP Ipc: C40B 40/10 20060101ALI20131003BHEP Ipc: B01J 19/00 20060101ALI20131003BHEP Ipc: G01N 33/543 20060101ALI20131003BHEP |
|
INTG | Intention to grant announced |
Effective date: 20131105 |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: BOMBARD, SOPHIE Inventor name: BOIREAU, WILFRID Inventor name: POMPON, DENIS Inventor name: SARI, MARIE-AGNES |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
INTG | Intention to grant announced |
Effective date: 20140424 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20140506 |