EP1427853A2 - Supported double-layer structure for displaying a nucleic acid associated with a protein - Google Patents

Abstract

The invention concerns novel biosensors, in particular a support for displaying nucleic acids and for detecting both the presence of nucleic acids in a sample and the linkage between proteins and nucleic acids, as well as the linkage between a ligand and a protein linked to a nucleic acid.

Description

 SUPPORTED BILAYER STRUCTURE FOR PRESENTING A NUCLEIC ACID ASSOCIATED WITH A PROTEIN

The present invention relates to new biostructures which can in particular serve as biosensors, in particular a support making it possible to present nucleic acids and to detect both the presence of nucleic acids in a sample, but also the interaction between proteins and said proteins. nucleic acids, as well as the binding between a ligand and a protein linked to a nucleic acid.

The development of DNA biosensors, also called DNA chips, has increased considerably in recent years. The impact of such biosensors has mainly focused on sequencing, gene expression mapping, diagnostics (detection, damage, mutation ...) and analysis of DNA-ligand interactions (hybridization ...) . Most of the sensors used use techniques for immobilizing single-stranded nucleic acid molecules or ssDNA, the analysis being carried out using optical, electrochemical or piezoacoustic transduction systems.

The extreme physiological importance of biological membranes as the seat of many chemical and metabolic reactions was at the origin of a craze for the development of lipid models on inorganic surfaces. The design of such bio-compatible and bio-functional structures on solid substrates has enabled the development of models concerning interdisciplinary fields which have led to the development of numerous lines of scientific research as well as practical applications. The main applications thus concerned:

- the manufacture of a matrix for the immobilization of enzymes, cellular receptors or hormones in non-denaturing environments,

- the interface design enabling cells to be captured in order to study the effects of pharmaceutical molecules on cell fate,

- Self-assembly of very resistant membranes for the development of biosensors. The analytical methods applied to the analysis of DNA-DNA biomolecular interactions, as they are represented at the heart of microarray devices, are essentially based on the fixation of a single stranded DNA (ssDNA) within an area delimited on a substrate. The main techniques for producing DNA covalently attached to the substrate are the in situ synthesis of ssDNA on the support, the assembly of chemically modified ssDNA to allow grafting on the support or microdeposition on an adsorbent matrix (Boncheva et al ., 1999, Berney et al., 2000, Wittung-Stafshede P. et al., 2000). However in the development of biosensors, the provision of biomolecules at the interfaces plays a crucial role. To obtain highly sensitive surfaces, it is important to present receptor molecules so that the corresponding ligand can interact without steric restrictions. However, in these different approaches, the means used to produce these DNA matrices generate artefacts (errors in synthesis in situ or functionalization of oligonucleotides) at the origin of non-specific adsorptions, thus part of current work relates to the means of circumventing these different limitations (Steel et al., 2000).

Another limitation of these systems is inherent in the mode of presentation of ssDNA. The strong compaction of the molecules on the surface leads to the appearance of steric constraints which affect the hybridization efficiency of the chip. If the immobilization of ssDNA on a surface is the alternative hitherto the most commonly used, it also constitutes that which constrains the geometry of the device resulting in a total loss of flexibility and modularity of the assembly.

One of the characteristics of the present invention is to propose a new mode of presentation of nucleic acids on the surface of a substrate. The mode of presentation of the nucleic acids according to the invention has the originality of allowing mobility of the nucleic acids, and thus of being able to detect any change in the state of said nucleic acids by detecting a transition between two states having levels separate organizations. Thus, the subject of the present invention is a cell for the presentation of a nucleic acid comprising: a support which is substantially planar on the atomic scale, a protein III having a unique three-dimensional structure (stable and defined spatial organization), an IN nucleic acid linked to said protein III, the nucleic acid-protein assembly being mobile laterally with respect to said support, so that the hybridization of a target nucleic acid to said IN nucleic acid or the change in conformation of said IN nucleic acid is detectable or detected by the geometric reorganization of the nucleic acid - protein set.

In a preferred case of the present invention, said protein III is chosen from the group consisting of proteins having a redox center and proteins having an anisotropic optical absorption property. Protein III will be described in more detail below.

By “cell” is meant a subset delimited laterally from the surface characterized by structural homogeneity and which can be reproduced in numerous identical or variant copies on the inorganic support.

A cell can in particular be used for the detection of a specific type of nucleic acid (as will be seen below), different from the nucleic acid detected by the use of another cell.

It is understood that the present invention also relates to a support, having a plurality of cells according to the present invention.

In the present application, the term "Float" may be used to designate the assembly consisting of the protein mobile relative to the support, linked to the oligonucleotide.

The oligonucleotide linked to the Float may be called “Primer” in the present application.

The following abbreviations may also be used in this application:

DMPC: Dimyristoyl phosphatidyl choline

DOGS: 1,2 dioleoyl-sn-glycero-3 [(Ν (5-amino-l-carboxypentyl) iminodiacetic acid) succinyl] DOPC: Dioleoyl phosphatidyl choline

DPDPB: 1,4-Di- [3 '- (2'-pyridyldithio) propionamido] butane

DPPC: Dipalmitoyl phosphatidyl choline

DsDNA: double stranded DNA DTT: Di thiothreitol

Hb5 (His) 4: human cytochrome b5-histidine 4 fusion protein

Hb5 (His) 4mut24: cysteine mutant (position 24) of Hb5 (His) 4

IMAC: Metal ion affinity chromatography

OG: octyl glucopyranoside OM: octadecyl mercaptan

RPS: surface plasmon resonance

UK: response unit

SAM: self-assembling monolayer

SsDNA: Single-stranded DNA

It is interesting that the oligonucleotide is not directly in contact with the support, which allows improved presentation to target nucleic acids or other elements interacting and modifying the conformation of the primer.

In a particular case, the protein-nucleic acid assembly is mobile relative to the support, since the protein is itself mobile in a lipid layer itself fixed on the support. Preferably a lipid bilayer is used.

In short, this assembly consists of a lipid membrane reconstituted on a flat surface of an inorganic nature. We then speak of a supported lipid membrane.

Such a model has properties similar to biological membranes in terms of compactness of the elements constituting it, compartmentalization, fluidity of the constituent elements of these models as well as most of the molecules incorporated or in interaction with this model (Heyse et al., 1998, Marchai et al., 1998).

This property of membrane dynamics is at the origin of the lateral mobility of the proposed structures and of the reorganization allowing the formation of domain and signal transduction. In addition, we can tailor the molecular composition of this lipid structure in order to modify its intrinsic properties or to introduce new potentials.

Thus, in a preferred embodiment, the present invention relates to a cell for the presentation of a nucleic acid comprising:

- a substantially planar support on the atomic scale, on which is fixed

- a hydrophobic monolayer I, on which is present

a monolayer II comprising phospholipids, a bridging molecule having a hydrophobic end capable of interacting with the monolayer II, and an end chemically functionalized so as to form a stable bond with a protein III,

- a protein III having a unique three-dimensional structure, said protein III being laterally mobile in said layer II,

- an IN nucleic acid unequivocally linked to said protein III, preferably by a molecular arm.

The fact that the protein is mobile in layer II (lipid sheet) ensures lateral dynamics, i.e. a possibility for the float assembly

+ primer to freely diffuse in two dimensions in the absence of additional geometric constraint which would be imposed by the interaction of the primer with other nucleic acids. The membrane fluidity allows the reorganization and contact of molecules essential for self-assembly into superstructures. In addition, in certain embodiments, the supramolecular assembly thus produced is characterized by a high degree of modularity: each stage of production or destructuring of this assembly can be carried out in a reversible manner by controlled action of the solutes present in an aqueous phase or of the action of thermal conditions or electrostatic environment. In order to use the very specific properties of these biostructures, the grafting of single-stranded nucleic acid onto the protein was carried out. In this way, the oligonucleotides are grafted onto blocks of protein nature floating on the upper lipid monolayer of the membrane model. This arrangement offers the following advantages:

- Lateral mobility of the floating protein anchor and therefore of the grafted ssDNA.

Suppression of non-specific interactions of ssDNAs on the flat support due to an appropriate lipid recovery.

- Control of the density of ssDNAs present on the surface of the biosensor (high modularity)

- In certain embodiments, reversibility of the different supramolecular interactions by aqueous treatment procedures (allowing the regeneration of the biosensor).

The term “nucleic acid, nucleic or nucleic acid sequence, polynucleotide, oligonucleotide, polynucleotide sequence, nucleotide sequence, terms which may be used interchangeably in the present description, is intended to denote a precise sequence of natural or synthetic nucleotides, defining a fragment or a region of a nucleic acid and which can correspond as well to a DNA or a single, double or triple stranded RNA. Thus, the nucleic acid sequences according to the invention also include PNA (Peptid Nucleic Acid), or the like. The bonds between the different bases can be conventional phosphodiester bonds, or modified bonds, such as phosphorothioates, methylphosphonates. The oligonucleotides can also be chimeric, that is to say having different bonds and / or bases. The term thus encompasses any variant of a nucleic acid sequence exhibiting a recognition property by hybridization.

Preferably, the nucleic acid linked to the protein in the cell according to the invention is a single-stranded nucleic acid. Its size is not a determining parameter according to the present invention, and can be easily chosen using the general knowledge of a person skilled in the art. In a preferred embodiment, the nucleic acid is linked to said protein by a reversible bond. This reversible bond can also be covalent. Thus, it is possible to link the nucleic acid to the protein so that disulfide bonds are involved, which can however be reversed by presence of appropriate agents, or under special conditions. Thus, the reversible connection can, in this particular case, be considered as a connection that can be easily broken.

In one embodiment, the nucleic acid is linked to said protein by a covalent bond. Such a bond is known to a person skilled in the art and can in particular be produced using modified bases in the oligonucleotide allowing coupling to a functionalized chemical arm in order to be able to be specifically coupled to the protein of the float.

In addition, the nature of the grafting can be of two kinds: one can carry out a related grafting so as to intimately attach the nucleic acid molecule to the protein or a grafting via a spacer molecular arm so as to offer greater conformational freedom of DNA vis-à-vis the float. A spacer arm is then preferably used which is unequivocally attached to said protein. Indeed, as will be developed later, it is interesting that the geometry of the float is perfectly defined. Thus, it is preferable that the spacer arm is connected to the protein at a precise site thereof.

In the embodiment in which the nucleic acid is attached to the protein, said spacer arm can then be a metal complex such as cis-platinum, trans-platinum, europium or another transition metal involving ligands originating from the very structure of the nucleic acid and one or more ligands originating from the very structure of protein III of the float.

When the spacer arm is longer, allowing greater flexibility of the nucleic acid, it is preferable to choose a spacer arm connecting a thiol- or amino- function introduced onto the nucleic acid, in particular via a base. modified (the choice of the base being able to be any, that is to say that one can choose a base in 3 ', in 5' or inside the oligonucleotide, this alternative being able to present certain advantages, in particular to offer a greater degree of freedom than the oligonucleotide), to another functionality present, preferably in a unique manner, on the protein. Preferably, this second function is also a thiol function, carried for example by a cysteine.

However, there are other types of grafting from a nucleic acid to a protein. It can in particular be grafted onto an arginine in the protein. It is however preferable, in order to respect a principle of the invention, that the coupling of the nucleic acid to the protein is specific, perfectly defined and unambiguous at the molecular level. Thus, we generally exclude any type of random grafting of the nucleic acid onto the protein which can give rise to ambiguity or heterogeneity in the structure of the floats according to the present invention. Thus, preferably, the IN nucleic acid is linked to said TJI protein via a compound chosen from:

- A spacer arm connecting two identical or different chemically reactive residues of the nucleic acid IN and protein III, chosen from the group consisting of thiols, amines, amides and arginines.

- a metal complex such as cis-platinum, trans-platinum, europium, a complex of nickel, copper, or ruthenium coordinated on the one hand with a residue or a group of amino residues of said protein III and d on the other hand to one or more natural or modified bases of the nucleic acid IN,

- a covalent or non-covalent protein complex involving the IN nucleic acid.

The protein in the cell according to the present invention has a unequivocally detectable geometry, that is to say a stable and defined spatial organization. This means in particular that its conformation in the cell according to the present invention is identical whatever the protein observed, when the cell according to the invention has several identical floats. This also means that bringing the cell into contact with external nucleic acids capable of interacting with the primers in a univocal manner will lead to a highly repetitive organization at the spatial level of the floats within the cell. In particular, external nucleic acids can lead to the association of floats in organized groups and these groups of floats can, thanks to their lateral mobility, interact with each other in a non-covalent manner so as to form within each cell a highly organized network of floats. at the two-dimensional level. The properties (physical, electrical, optical, quantum) of this highly organized network will then differ from the dynamic properties of disorganized floats within the cell in the absence of interaction with the external nucleic acid. Preferably, the protein of the float will be chosen so that the variations in the spatial organization of the floats with respect to each other lead to a signal detectable by any process in particular electrical, optical or resonance. Proteins having this property will preferably be chosen from the group consisting of proteins having a redox center and / or an anisotropic optical absorption and / or intrinsic fluorescence property.

Mention is made in particular of cytochromes and more preferably human cytochrome b5, of yeast, or of any other origin, flavodoxins, ferridoxins, azurines and other proteins with blue copper, multihemic proteins of the class of bacterial cytochrome c which have both a redox center and anisotropic optical absorption properties. Among the fluorescent proteins, mention will preferably be made of green fluorescent protein (GFP) and its analogues obtained by mutagenesis or directed evolution. In a preferred implementation case, said protein is water-soluble. It may also have undergone modifications, some of which are indicated below, provided that these modifications lead to a protein of stable and defined three-dimensional structure meeting the criteria as defined according to the present invention. Thus, in a preferred embodiment, said protein has undergone a modification which has allowed the introduction of a single site, in said protein, to effect said binding with said nucleic acid. The fact that a unique site is introduced into the protein according to the invention for the grafting of the nucleic acid thus makes it possible to strongly promote the uniqueness, the specificity and the unambiguous definition of the protein-nucleic acid bond.

In a particular case, said modification consists of a mutation of said protein so as to leave only a single predetermined amino acid remaining or introducing it. The mutation can be introduced by mutation of the nucleic acid coding for the protein, it is the simplest method which will be favored by those skilled in the art. The unique nucleic acid grafting site will then be this unique predetermined amino acid. Depending on the sequence of the protein that has been chosen to implement the invention, it is indeed within the reach of the skilled person to determine the amino acids to be modified, in order to leave none subsist only one, or introduce one that is not present in the native protein. Thus, and to illustrate this fact, when the protein which is used is a cytochrome b5, it is possible to introduce a cysteine into the protein, insofar as this amino acid is absent from the native protein. It is, moreover, always very advantageous to modify the protein in such a way that it has only one cysteine, or at least that it has a single free cysteine (not involved in a disulfide bond with another cysteine) .

It is also preferable, for the correct implementation of the method according to the invention, that the modification in the protein is such that it facilitates the grafting of the nucleic acid, that is to say, that the acid amine used for said grafting is located at the periphery (on the surface) of said protein. It is within the reach of those skilled in the art, depending on the protein chosen, to determine the best location for the introduction of the modification into the protein. In cytochrome b5, the introduction of cysteine was thus exemplified by mutation of serine 24. However, alternative locations could easily have been chosen.

Thus, according to the three-dimensional structure of a mammalian cytochrome b5 other than a human (eg rat or bovine), it is entirely possible to select the amino acids to be modified so as to introduce only one cysteine into the protein sequence. For example, the three-dimensional representation will make it possible to target the most peripheral amino acids of the protein, that is to say those promoting better reactivity with the modified nucleic acid. In addition, it could be of crucial interest to link the ssDNA in the vicinity of the redox center of the protein: a mutation in glycine 47 would make it possible to obtain such a connection.

One of the important features of the present invention is that protein III is mobile with respect to layer II of the cell according to the invention. This also ensures the mobility of the IN nucleic acid linked to protein III in the cell, relative to the support according to the invention. The mobility of the protein in layer II can be obtained in various ways, in particular when said protein has a hydrophobic tail allowing it to be anchored in the IL layer. The sequences of the hydrophobic tails are known in the literature, and it is at scope of the skilled person to choose such a sequence and to modify the protein chosen by genetic engineering in order to introduce such an anchoring sequence. It is then advantageous to choose a hydrophobic tail which is short, so that it anchors only in the layer IL without penetrating into the layer I. This makes it possible in particular to improve the mobility of the protein in layer II, by reducing the phenomena of "friction" which can be observed if the hydrophobic tail is too large. The optimization of these elements remains within the reach of the skilled person.

In a preferred case, however, said protein is linked to a phospholipid of layer II, and in a particular case to an artificial phospholipid preferably introduced in small proportion (that is to say in proportion less than 10%, of preferably less than 5%, more preferably about 2%). In fact, the mobility of the protein relative to layer II is then similar to the mobility of phospholipids in said layer. Such mobility is generally greater than when the protein has a hydrophobic tail. This improves the performance of the cell according to the invention, as will be seen.

A person skilled in the art has several methods at his disposal for achieving a protein-phospholipid bond. Mention may in particular be made, among the covalent bonds, of acylation, farnesylation, the use of a GPI anchor sequence

(glycosylphosphatidylinositol) or the incorporation of a phospholipid or fatty acid into a specific residue of protein III by any artificial process.

It may however be preferable to have a reversible bond, that is to say which can be broken in the presence of reagents or under special conditions, but stable under the conditions or in the presence of the usual working reagents (hybridization of nucleic acids, link study between biological elements ...). In general, a person skilled in the art can use all known methods making it possible to link a protein to a liposome, for example, insofar as the liposomes generally consist of phospholipids.

Thus, it is possible in particular to use an arm capable of binding a metal chelate on one side and an amino acid on the other, by using, in layer II, a modified phospholipid, said phospholipid having a zone for fixing a chelate .

Thus, a preferred phospholipid according to the invention is DOGS or 1,2 dioleoyl-sn-glycero-3 (N (5-amino-1-carboxypentyl) iminodiacetic acid) succinyl)]. This phospholipid is a synthetic phospholipid having an iminodiacetate residue complexing a divalent nickel cation.

In order to promote the mobility of the protein in layer II, it is advantageous to choose the phospholipids of said layer II so that they have hydrophobic tails chosen so that said layer is not in the crystalline state, but in the fluid state at operating temperature.

These fluidity properties of a phospholipid layer are known to those skilled in the art, and there are in particular diagrams making it possible to choose the chain length and the unsaturation to obtain the fluidity at the temperature of use (Gulik-Krzywicki et al., 1967).

This operating temperature obviously depends on the use that one wishes to make of the sensor. Thus, when looking for hybridization, the temperature of use may be different from that used when studying the binding of a protein to a nucleic acid. On the other hand, the transition between fluid and gel states can be strategic in the context of a detection technique based on imagery of superstructures such as atomic force microscopy (AFM).

Depending on the temperature of use, those skilled in the art will look for the most suitable phospholipids for the IL layer. As a general rule, and in order to simplify and improve the potentials of the biosensor, the fluidity of layer II is sought. ambient temperature.

Thus, phospholipids having hydrophobic tails having a chain length greater than or equal to 14 carbon atoms are preferably chosen, said chain possibly having unsaturations, such that said layer II is in the fluid state at temperature d 'use. It is interesting to note, for example, that C14 elements are generally fluid at a temperature above 23 ° C, while Cl 6 are only at 37 ° C, and Cl 8 above 50-55 ° C. However, the use of Cl 8 tails, but having unsaturations, makes it possible to reduce the phase transition temperature (crystalline state - fluid state). However, for certain applications or modes of detection, it may be preferred that the layer II is not fluid at ambient temperature but only at higher temperatures. In particular, this mode will be preferred if one wishes to "memorize" the state of organization of the floats, by using the lowering of temperature to freeze the structure after a higher temperature organization phase. This will be particularly the case if the detection technique (near field microscopy for example), or the analysis conditions (dehydration for example) may alter the structure. The unmodified phospholipids of layer II do not have any particular characteristics apart from the mobility properties already described, however, it is preferable that they have polar heads, chosen from the group consisting of neutral polar heads not carrying charges, globally neutral with opposite charges (zwitterionic), or with a negative overall charge.

The choice of the charge carried by the phospholipids may prove to be interesting, in particular to reduce the phenomena of non-specific absorption of the test nucleic acids on the layer, which are reduced when the charge of the phospholipid heads is negative. The use of neutral heads (either uncharged or carrying several opposite charges) is also envisaged.

Layer II is assembled on layer I, in a conventional manner, by the interactions existing between two hydrophobic elements in an aqueous medium. We can therefore speak of a self-assembled layer.

However, in certain cases a suitable catalyst called a fusogenic agent will be used to facilitate this fusion. Thus, such agents as the Ca ^{1 "4"} cations, the ethylene glycol polymer (PEG) and the detergents will be used according to protocols known to those skilled in the art.

Layer I, for its part, comprises hydrophobic elements, having a chain length of approximately 2 to 2.5 nm, for example between 12 and 20 carbon atoms, preferably between 14 and 18 carbon atoms.

It is indeed necessary to have a layer I which is particularly homogeneous. Furthermore, the length of the chains of the elements of layer I is preferably long enough for the union of the two layers I and II to form a true bilayer. The elements of layer I are linear or branched and optionally bear unsaturations. It is important that this layer I is homogeneous, insofar as it serves as a support for the deposition of the layer IL Layer I is connected to the support of the cell according to the invention in a covalent manner, or by strong non-covalent bonds. This mode of connection to the support is not of great importance for the implementation of the invention. Thus, in a particular embodiment, said layer I comprises phospholipids linked to said support via their polar heads. In another embodiment, said layer I comprises hydrophobic elements linked to said support via a covalent bond, for example an alkyl-thiol bond or an alkyl-siloxane bond, depending on the nature of the support.

It may be advantageous to have a support link - layer I which is covalent, in order to allow easier reuse of the cell according to the invention. Indeed, when the nucleic acid is linked to the protein, and the protein is linked to layer II by reversible bonds, one can easily regenerate the cell by action of the elements (or conditions) allowing the rupture of the nucleic acid bonds. - protein and protein - layer II, and remove layer II by the action of an appropriate detergent. It is therefore easy to imagine that a non-reversible covalent bond between layer I and the support makes it possible to reconstruct a cell. It is obvious that if the layer I is linked to the support by a reversible bond, we can start again to prepare the cell, but with an additional step.

The reuse of the support can prove to be very interesting, insofar as it must have an almost flatness at the atomic level, and moreover can include all or part of the system for detecting the state of the cells, which can pose certain manufacturing constraints and increase the production costs of the cell according to the invention.

Thus, in a preferred embodiment, the flatness of said support is such that the difference in height between two distant zones of less than 100 nm is less than or equal to 10 nm, preferably less than or equal to 3 nm, more preferably less than or equal to 2 nm.

Different materials can be chosen to make the base of the cell according to the invention, in particular a material chosen from the group consisting of glass covered with a layer of gold, cleaved mica, silicon or any other monocrystalline material.

Monocrystalline silicon is a very interesting material, insofar as it is effectively plane on the atomic scale, and that it can easily undergo microgravures, and various chemical modifications, which makes it possible to manufacture a support having a plurality of cells according to the invention. Furthermore, silicon has conductive or optical properties which can prove to be very advantageous as regards the detection of biological events taking place on the cell according to the invention.

As will be developed, the cell according to the invention can comprise several identical or different proteins, linked to identical or different nucleic acids. When different primers are used, a target nucleic acid complementary to two primers will be able to bind the two corresponding floats, which will accentuate its interaction with the support and initiate a change in the spatial organization of the floats within the cell.

Thus, when the nucleic acid IN - protein III and protein III - layer II links are reversible, it is possible, by means of agents competing in the Float-Support interaction (Histidine, Imidazole, EDTA), to easily differentiate degrees of hybridization.

In addition, the aspect of two-dimensional reorganization of the Float and Primer nano-objects on the flat membrane surface, obtained by the fluidity of layer II, is in the field of the self-organization of biological molecules and physical phenomena. -chemicals that arise from these collective movements.

Thus from a random distribution of the protein-nucleic acid blocks, it is clear that the action of an effector (ex: target molecule) will generate a radical restructuring in two dimensions. When in particular a cell is used in which two (or more) different primers are present, the presence in the target sample of a nucleic acid capable of hybridizing to these different primers and allowing the bridging of said blocks must lead to a process of elongation (one-dimensional organization) at the surface of the cell. We therefore move, and this is one of the major interests of the invention, from a more or less disordered system (random, or with an unstable equilibrium) to a highly ordered system, under the effect of the presence of the target nucleic acid in the test sample. Furthermore, this organization is extremely sensitive to the geometric conformation of the nucleic acid and therefore to any factor (mismatch, protein binding, chemical agent) capable of interacting with the conformation or structure of the nucleic acid. Similarly, when studying the binding of any protein or ligand to a nucleic acid (single strand or double strand) linked to the protein anchored in layer II, or when studying the binding of an effector molecule on a protein (of the transcription factor type) linked to a nucleic acid, on a cell according to the invention, we then observe (due to the arrival of these elements), a modification of the structure (by curvature of the nucleic acid) and of the balance of the system which can then be easily observed by various methods capable of detecting the change in the organization of the cell, and in particular by means of an optical system (absorbance, fluorescence), electrical, electronic, surface plasmon resonance, energy transfer, radiolabelling, diffraction (optical, electronic, X-ray, neutron) or microscopy (direct or fluorescent, electronic, proc field hey, atomic force).

This disorder phase change - order observed when an event occurs on the atomic scale can only be easily detected when the protein on the cell according to the invention has what has been called "unequivocally detectable geometry", and that the nucleic acid is unequivocally attached thereto.

The principle of the invention is therefore the mobility of the protein anchored in layer II, allowing a reorganization of the system and the fact that the protein-nucleic acid unit is unique and not random, which makes it possible to detect said reorganization.

It is also envisaged that the presence of a single target nucleic acid molecule in the test sample will allow reorganization which can then be detected. An example of carrying out such a method would be to pre-organize the cell with a nucleic acid of the same nature as that to be detected but having on the one hand a lower affinity for the primer than the nucleic acid to be tested ( modified base, mismatch), on the other hand whose geometry (size, curvature) would different from the nucleic acid to be tested. The exchange of a single nucleic acid (external competitive molecule) within a pre-organized cell will then lead to a local structural defect.

It is known to those skilled in the art that a single defect within a "crystalline" network destabilizes the entire network. If the cell size is chosen appropriately, it is reasonable to hope that this single event will change the stability of the cell organization. Such a change in stability can be tested by gradually applying an external factor (chemical, temperature, electrical potential, etc.) destabilizing until the cell is disorganized. This principle opens up the possibility of detecting unique molecular events and corresponds to the theoretical maximum sensitivity of a detector.

This sensitivity is a huge advantage compared to other existing and widely used systems, which require the presence of a large number of nucleic acid molecules in the sample to be detected. Furthermore, such a detector associated with a receptor protein adequately chosen to see its interaction with the modulated DNA can be the source of molecular detector for an infinite variety of molecules of interest (in particular proteins, medicament, pollutants).

It is also important to note that the hybridization as such is not detected, but rather the changes induced in the cell according to the invention. Thus, this implies that the cell according to the invention (or the support having a plurality of cells) can be used for the detection of a target in a sample, without it being necessary to mark or manipulate excessively said sample . This is another important advantage, since it is thus possible to detect the presence of mRNA without having to transform it first into cDNA.

It should be noted that the geometric conformation of ssDNA and dsDNA is so different that it results in very distinct physicochemical properties. Thus, after hybridization, this effect can be detected in particular by a change in the electronic conductivity of the cell according to the invention. This is particularly easy when the protein according to the invention also has a redox center. Hybridization can also be detected by surface plasmon resonance, or by an optical method, which is facilitated by the presence of a protein with anisotropic optical absorption.

In order to carry out the simultaneous detection of several targets, the invention therefore also relates to a support having a plurality of cells according to the invention.

The different cells can be separated from each other by microgravure on the support, or by the presence between two cells of a hydrophobic layer made up of elements having a chain length different (preferably less) than the chain length of the elements of layer I, for example less than or equal to 5 carbon atoms (“differential patterning” Cheng et al., 2000). These elements having a low carbon chain can be deposited on the support using the masking techniques common in microelectronics.

The support according to the invention is advantageously supplemented by the installation of a system allowing the measurement of the current, the impedance or the potential, allowing the detection of the events happening on each of the cells. Another preferred alternative is that the support has a surface alternating conductive and reflective areas and non-conductive and transparent areas. Such a network comprising transparent zones of size clearly less than the wavelength of visible light has been described as having a light transmission function as a function of the wavelength in the form of a "comb" (Ebbesen et al, 1998). The optical transmission properties of such a structure must be altered by the state of the neighboring cells, which provides a possible means of reading.

It is also conceivable that the support according to the invention comprises between each cell an integrated optical device (laser-photodiode pair for example) capable of measuring the absorbance of a cell in two crossed directions and of deducing its state of organization (anisotropy) or disorganization (isotropy).

It is also preferable to envisage a reading of the state of organization of each cell by a sensitive laser optical scanning device. when the polarization of the light changes. Such a device capable of reading cells of submicron size is commonly used at the general public level in mini-disc readers and rewritable CD-ROM readers. In such a case, the variation in polarization of the reflected light normally provided in magneto-optical discs by a reorganization of the crystal lattice of a rare earth salt (europium, and other compounds of the same transition series from the Mendeléeiv table ) by a magnetic field and laser heating, would be in the system described in the invention by the variation of spatial organization in the cell of the protein and or its cofactor which are optically active objects in terms of polarization, d ellipticity (differential absorption of polarized light) and optical absorption.

The invention also relates to a method for identifying the presence of a test nucleic acid in a sample, comprising the steps of: a) bringing said sample into contact with a cell according to the invention, under conditions allowing hybridization from said test nucleic acid to a nucleic acid linked to a protein of said cell, b) detecting the hybridization of said test nucleic acid to said nucleic acid linked to said protein. Detection can be carried out by any of the means mentioned above. If the test sample has been marked, the detection can be carried out according to said marking. However, it may be preferred to detect the presence of the target nucleic acid by changing the conformation of the system. Thus, the cell according to the invention allows detection without the need to mark the test sample.

The invention also relates to a method for identifying the binding of a protein to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) bringing said protein into contact with a nucleic acid linked to a protein, in a cell according to the invention, b) detecting the binding of said protein to said nucleic acid and / or its activity on the conformation of said nucleic acid. Said nucleic acid can be single strand, double strand or triplex, when a nucleic acid has already been attached to one of the nucleic acids (primers) of the cell. It is clear that the choice of certain bases for the primer can lead to the formation of a triplex nucleic acid, said formation then being considered, within the meaning of the invention as a hybridization.

Detection can also be carried out in several ways, and in particular by changing the conformation of the system.

The invention also relates to a method of identifying the binding of a ligand to a protein attached to a nucleic acid attached to a protein in a cell according to the invention, comprising the steps of: a) bringing said ligand into contact with said protein, b) detecting the binding of said ligand to said protein.

Among the ligands and proteins envisaged, studies are carried out in particular to identify effector molecules which bind to nuclear receptors or transcription factors. The binding can be direct or indirect, and involve for example the binding of the ligand to a receptor which will then bind to a protein or a protein complex already associated with the DNA of the cell.

The binding of the ligand to the protein can be observed in particular by a change in the conformation of the system.

In general, the invention relates to a method for identifying the binding of a compound to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) contacting said compound with a nucleic acid linked to a protein, in a cell according to the invention, b) detecting the binding of the compound to said nucleic acid and / or its activity on the conformation of said nucleic acid. As previously, said nucleic acid can be single strand, double strand or triplex, when a nucleic acid has already been fixed on one of the nucleic acids of the cell.

The connection is detected in particular by change of conformation of the system, as has been explained above. The detection of the geometry or of the disturbance of the geometry of the Float-Primer-Target assemblies can be advantageously carried out thanks to the contribution of atomic force microscopy technologies in a liquid environment. Thus, the potential applications of this type of characterization relate to the study of the impact of the interaction of all molecules or macromolecules with nucleic acids (regulation, transcription factors, drugs, drugs, especially for chemotherapy ...) .

In a particular case, the device according to the invention offers molecular and supramolecular contiguity involving a lipid membrane, redox proteins and nucleic acids. This assembly of electro- and opto-active biomolecules within microsystems originating from microelectronics can prove to be potentially of strong impact in the fields of electronic transductions (conductors, semiconductors, biomolecular circuits) and non-linear optics (anisotropy).

In fact, double-stranded DNA, unlike ssDNA, has electron transfer properties according to an electronic conduction process by covering the Pi orbitals. In addition, the hybridization reaction between two molecules of ssDNA specific. The current systems developed within the framework of electronic components at the nanometer scale face various problems including:

• the interconnection of nano-objects between them

• the connection of nanostructures to macroscopic electrodes. The use of molecular recognition processes and self-assemblies of molecules within supramolecular structures, as envisaged within the cell according to the present invention, could make it possible to circumvent these difficulties.

Indeed, the cell according to the invention has an original biomolecular architecture which is positioned in the field of nano-bioengineering, that is to say the development of new types of nanostructures having properties of:

- strong modularity,

- high degree of organization at the molecular level,

- vector electronic transfers, coupling with chemical messengers.

DNA has the properties of molecular and mechanical recognition to be integrated into microcircuits. However, the intrinsic electronic properties of this macromolecule seem insufficient to be used directly (Braun et al., 1998). One of the most promising lines of research in the use of potential for transporting electrical charges along the DNA duplex is represented by the use of electrocatalytic processes (Boon et al., 2000). Such a signal transduction device can completely be integrated into the device according to the invention thanks to the use of additional redox molecules.

However, in a preferred device according to the invention, the presence of the floats composed of redox proteins having electroactive groups and / or different and modular redox potentials makes it possible to ensure a dense electronic environment in terms of recovery of the electronic orbitals. Depending on the periodicity and the two-dimensional organization of these redox macromolecules (considered then as relay centers), such a structure could be at the origin, of an electronic doping of DNA, to jumps of electrons between proteins or energy transfer processes. Thus, a cell according to the invention can have other modes of use than the simple detection methods which have been mentioned above.

The invention also relates to a method for preparing a cell according to the invention comprising the step of: - placing, on a support which is substantially planar on the atomic scale, of a protein III having a unique three-dimensional structure ( stable and defined spatial organization), linked to an IV nucleic acid, so that the nucleic acid - protein assembly is movable laterally with respect to said support, so that the hybridization of a target nucleic acid to said IV nucleic acid or the change in conformation of said nucleic acid IV is detectable by the geometric reorganization of the nucleic acid - protein assembly. The invention also relates to a method for preparing a cell according to the invention comprising the steps of:

- fixation of a hydrophobic monolayer I on a support which is substantially plane on the atomic scale,

assembly on said monolayer I of a monolayer II comprising phospholipids,

establishment of a protein III having a unique three-dimensional structure, said protein III being movable laterally in said layer II, by means of a bridging molecule having a hydrophobic end capable of interacting with monolayer II, and one end chemically functionalized so as to form a stable bond with a protein III, said protein III being unequivocally linked to an IN nucleic acid, preferably by a molecular arm.

DESCRIPTION OF THE FIGURES

Figure 1: Construction of the hybrid bilayer and characterization by resonance surface plasmon analysis. A: the recorded signal corresponds to the baseline of the metal support covered with a dense monolayer of OM in the environment of the working buffer (conventionally phosphate buffer, 50mM, pH7.5).

B: The signal variation corresponds to the injection into the fluid circuit of a mixed DMPC-DOGS vesicular solution made in water. The increase in signal corresponds to the kinetics of fusion of the vesicles on the support so as to obtain a compact lipid monolayer. Thus, after 20-40 minutes of injection, the return to the working buffer makes it possible to estimate the quantity of lipids assembled at 1700 +/- 300RU. This value, according to the different calibration modes proposed by BIAcore, corresponds to that of a lipid hemimembrane. C: A procedure for treating the membrane with a sodium hydroxide solution

20mM eliminates excess lipids adsorbed on the structure.

D: Control of the homogeneity of the lipid membrane by injection of water-soluble protein (eg Cytochrome c, BSA ...). Figure 2: Demonstration of a specific association of Hb5 (His) 4 on the hybrid bilayer functionalized by nickel chelating cations Characterization by RPS A: Three successive injections (represented by arrows) of the cytochrome b5 polyhistidine form are performed in the vicinity of the functionalized lipid bilayer. Conventionally, the protein solution, with a concentration equal to 1 μM in 50 mM phosphate buffer, pH7, is injected under a flow of 10 μl / min for 180 seconds. The different injections lead to a progressive saturation of the surface. The maximum recovery is around 650 +/-

-2

50 RU is a surface covering rate of 7pmole.cm ^" .

B: In order to show the great specificity of the interaction, injections of a solution of histidine lmg / ml in 50mM phosphate buffer are carried out (ex: Four injections symbolized by the arrows). Injection of a chelating agent between the poly histidine segment of Hb5 (His) 4 and the membrane. Each injection (flow 10 μl / min for 120 seconds) is accompanied by a drop in signal, that is to say the quantity of proteins interacting with the membrane. Thus the complete regeneration of the structure is obtained after a few minutes of contact time.

Figure 3: Diagram of the membrane biosensor, construction / regeneration of the supramolecular assembly Construction: An inorganic surface (ex: gold) is functionalized by a dense monolayer of octadecyl mercaptan. This surface is conducive to the fusion of lipid vesicles (liposomes) until a dense monolayer of phospholipids is obtained above the support. The presence of 10% (mol / mol) of modified phospholipids allows the anchoring of b5 cytochromes so as to obtain a dense monolayer of proteins. Regeneration:

Injections of competing agents for affinity by metal ions such as a histidine solution (1 mg / ml) allow the release of all of Hb5 (His) 4 interacting in a specific manner with the support. Of the same so the lipid hemimembrane reconstituted on the functionalized inorganic support can be regenerated by the use of a detergent solution such as octyl glucoside or OG (40 mM in H2O).

Thus, all of the construction and destructuring phases can be carried out in a controlled manner by the use of an aqueous solution preserving the integrity of the biological molecules.

Figure 4: Characterization of the b5-cis-Pt-DNAb complex, Polyacrylamide SDS gel (15%) of Hb5 (His) 4 platinized and coupled with an oligonucleotide of sequence CTATCATTTGCTTACTATTC (SEQ ID N ° 13)

Fig. 4.A: Autoradiogram of a gel into which Hb5 (His) 4-cisPt was injected (well 1); the oligonucleotide radiolabelled with P (well 2) and the b5-cis-Pt-ssDNA complex (well 3) makes it possible to demonstrate the appearance of an additional radioactivity signal in well 3 compared to well 2. FIG . 4.B: Use of a polyacrylamide gel (15%) under denaturing conditions (SDS). Cross characterization of the b5-cis-Pt-ssDNA complex: said complex injected on lane 3 has a band which makes it possible to confirm the existence of a population whose molecular weight is close to 20000 Dalton, ie the theoretical molecular weight. Well (1): b5 platinized with çw-Pt [(NH ₃ ) ₂ (H ₂ O) ₂ ] ²⁺ . Well (2): DNA radiolabelled mother (DNA *). Well (3): platinum b5 linked to DNA * 20-mer

Figure 5: Spectral characterization of the Hb5 (His) complex 4- CTATCATTTGCTTACTATTC via a ponta e s-Pt [(NH ₃ ) ₂ (H ₂ O) ₂ ] ²⁺ Two reconstitution procedures of the Hb5 (his) complex 4-cisPt- SsDNAs are characterized by spectrophotometry in a 240-600nm window. Cytochrome b5 has a maximum absorption at 412nm while ssDNA has a maximum at 260nm. The spectral profile of two samples as well as the relative quantification of each species thanks to the molar extinction coefficients makes it possible to highlight:

• red spectrum: a molar fraction Hb5 (His) 4 / ssDNA = 3 / l

• blue spectrum: an Hb5 (His) 4 / ssDNA molar fraction ^: = l / l The procedure allowing the characterization represented by the blue absorption spectrum makes it possible to obtain an equimolar coupling.

Figure 6: Determination of the melting temperature of 20-mer DNA and 20-mer DNA bridged with platinized Hb5 (His) 4.

The determinations of the melting temperatures were carried out by spectral measurements of hyperchromicity after melting of the complementary strand at high temperature (80 ° C.). A decrease in steps of 1 ° C makes it possible to spectrally follow the evolution of dsDNA. • The absorption results as a function of temperature for the free ssDNA makes it possible to obtain a curve whose inflection point corresponds to the melting temperature. The Tm for the ssDNA is evaluated at 45 ° C.

• The same characterization on the ssDNA coupled to Hb5 (His) 4 gives a modified profile whose Tm has been estimated at 23 ° C.

Figure 7: Separation of protein species and the cytochrome b5- complex

SsDNA via a DPDPB bridge by chromatography. Characterization by spectrophotometry 240-450nm

The different populations resulting from the incubation (4 H at 30 ° C.) of ssDNA-DPDPB with Hb5 (His) 4mut24 are loaded onto a DEAE column. The different species are then eluted via a phosphate buffer solution

25mM and an increasing NaCl gradient.

Cytochrome b5 has a maximum absorption at 412nm while the

SsDNA has a maximum at 260nm. The NaCI gradient allows the gradual elution of all populations:

• [NaCl] <0.15M: population 1 of Hb5 (His) 4mut24

• 0.15 <[NaCl] <0.25M: population 2 of Hb5 (His) 4mut24

• [NaCl] = 0.5M: population 3 of Hb5 (His) 4mut24

Figure 8: Elution profile and supramolecular composition of cytochrome b5-ssDNA complexes

The molar quantification of the isolated species after separation on DEAE is represented in the form of a histogram: • populations 1 and 2 of Hb5 (His) 4mut24 characterized in FIG. 7 do not present any ssDNA component measured at 260nm. These two populations correspond to the monomeric form (which did not react during the incubation) and to the dimeric form (resulting from a cystine bridge between two proteins).

• Population 3 presents an Hb5 (his) 4mut24-ssDNA equimolar complex.

Figure 9: Detection by surface plasmon resonance of the association kinetics of a ssDNA complementary to the ssDNA primer in interaction with the biosensor

From a “b5-Wl” signal close to 250RU, different injections of ssDNA were carried out, at a density of b5-ssDNA equal to 1 pmol.cm ^"2 :

Thus the ws DNA complementary strand of Wl was injected in the vicinity of the biosensor (1 μl / min for 10 min) for two NaCl concentrations.

At a 150 mM NaCl concentration, a hybridization signal is observed in a complexation range corresponding to 100% of the “b5-ssDNA” assemblies interacting with the membrane.

The same oligonucleotide injected at low NaCl concentration (25 mM) shows very limited hybridization with respect to the biosensor.

FigurelO: Diagram of the assembly as a DNA biosensor ~

The arrow represents the flow of biomolecules from the test sample.

Figure 11: Diagram of the assembly as nanostructures with dynamic and conformational properties

A set of different floating blocks can be presented on the surface of the biosensor, the injection of a potentially hybridizing oligonucleotide on part of the floating blocks must allow inter-block bridging. The character of lateral mobility of the elements must favor this process until obtaining phenomena of supramolecular reorganization on the surface of the cell. The examples which follow relate to a particular case of the invention, but should not be considered as limiting the invention.

EXAMPLES Example 1: Production of the hybrid bilayer

1.1) Functionalization of the support

The solid support used consists of a glass plate coated with a gold film marketed by the company BIAcore ^® as Jl chip name.

Such supports have also been manufactured by the inventors. They consist of the use of planed glass strips (thickness 0.4mm, 22 * 10mm, Prolabo) undergoing successively a vaporization of 2.6nm of chromium then a vaporization of 48nm of gold under a vacuum of 2.10 mm of Hg.

Next, the metal interface is covered by self-assembly of octadecyl mercaptan or OM molecules from Aldrich. The OM solution is used at ImM in a 4/1 (v / v) ethanol / water mixture. After two hours of incubation, the slides are washed with chloroform, methanol and then with water and are dried under a stream of nitrogen.

The result is the reconstitution on gold of a dense highly organized monolayer giving the support very strong hydrophobic properties. This first assembly has been characterized many times in the literature. Contact angle measurements allow routine verification of the compactness of the monolayer thus reconstituted.

1.2) Manufacture of lipid vesicles 1.2.1) Sonication / extrusion method

The method used to prepare the liposomes is based on a double sonication / extrusion procedure.

The dimyristoyl and / or dipalmitoyl phosphatidyl choline phospholipids from Sigma, main constituents of the vesicles, are dissolved in an organic solution of chloroform. A lipid film is then deposited in scintillation glass tubes by evaporation of the chloroform under a stream of nitrogen. This film is re-suspended in an aqueous solution (ultra pure or buffered water) to a final concentration of ImM. This mixture is then sonicated:

- in an ultrasonic bath (Transsonic 310 from Fisher-Scientific) at maximum power for 20 min, then by an ultrasonic disintegrator (Vibra-Cell from Bioblock) in 2 min pulses, with 50% of active cycle for output power of 4. The procedure is stopped when the solution has become translucent, ie conventionally after 6 to 10 min of cumulative sonication time.

The last manufacturing step consists of extrusion through a polycarbonate membrane (Avestin, 19mm diameter and pore diameter 50nm or 100nm) in a Liposofast ^® basic device, Avestin, Inc.

1.2.2) Vortex / extrusion method

A second procedure is used in the case of the use of molecules sensitive to ultrasonic disturbances such as the hydrocarbon chains of certain phospholipids having polyunsaturations (ex: 1,2 dioleoyl-sn-glycero-3 [(N (5-amino -l-carboxypentyl) iminodiacetic acid) succinyl] or DOGS from Aventi Polar Lipids, Dioleoyl phosphatidyl choline or DOPC from Sigma).

In this case, a procedure identical to 1.2.1 of solubilization in CHC1 ₃ and then of construction of a lipid film on glass is applied. The procedure then differs by resuspending the phospholipids in aqueous solution to ImM by a vortex step, 5 min at maximum speed.

This step is followed by a stage of extrusion through a polycarbonate membrane with 50 nm pore diameter in a LiposoFast apparatus ^® home AVESTIN.

1.3) Reconstitution of the lipid monolayer

The hydrophobic support serving as a matrix to generate the lipid monolayer, undergoes a treatment procedure as follows: in order to improve the wettability of the structure, an ethanol / water solution (1/1 vol) is injected onto the support and is followed by rinsing steps with water and buffered solution. In order to clean the interface, the injection of a detergent solution, octyl glucopyranoside from Sigma, 40mM concentration. Immediately after, the made-up lipid vesicles are injected into contact with the functionalized metal surface. Spontaneously, according to a liposome fusion process established by Kalb et al. (1992), the vesicles fuse in contact with the hydrophobic monolayer of OM. After 30 to 60 minutes, this process leads to the formation of a lipid monolayer completely covering the OM monolayer.

The molecular assembly thus obtained has a metallic substrate covalently covered with a first alkylated sheet on which is assembled a fluid and dynamic sheet of amphiphilic molecules. Characterization experiments use BIAcore ^® technology using BIAcore 1000 and BIAcore X devices.

Liposome fusion results are obtained in the form of a sensorgram (Figure 1). Upon injection of the vesicles, a phase of association with the support is observed leading to a plateau after 20-30 of contact time. When the injection is stopped and therefore when the working buffer is returned, a first quantity of lipid material is evaluated. A surface cleaning procedure with 20mM sodium hydroxide makes it possible to remove all the vesicles imperfectly fused to the surface of the biosensor. Conventionally, the signal obtained is between 1400 and 2000 RU, which is consistent with the results available in the literature and the calibration methods supplied by the manufacturer. An injection of soluble proteins in the vicinity of this supported membrane makes it possible to validate the absence of defect in the upper lipid monolayer. The introduction into the liposomes of synthetic phospholipids DOGS at a rate of 10% mol / mol gives this monolayer complexing properties of protein-TagHis sensor.

Example 2: Construction, expression and purification of fusion proteins 2.1) Water-soluble proteins with a histidine tag

The initial protein used in the context of this example is a membrane hemoprotein: human or yeast cytochrome b5. It is a bitopic protein with a large globular water-soluble domain containing heme and a small hydrophobic domain allowing anchoring to microsomal membranes. All the nucleotide and amino acid sequences are grouped in the sequence list.

The amino acid sequence of human and yeast forms are named as follows:

Amino acid sequence of human cytochrome b5 membrane (SEQ ID N ° 1)

1 MLAEQSDEAV KYYTLEEIQK HNHSKSTW I LHHKVYDLTK FLEEHPGGEE V REQAGGDA 61 TENFEDVGHS TDAREMSKTF IIGELHPDDR PKLNKPPETL ITTIDSSSS WTNWVIPAIS 121 AVAVAMYR YMA

Amino acid sequence of cytochrome b5 from membrane yeast (SEQ ID N °

2}

1 MPKVYSYQEV AEHNGPQNFW IIIDDKVYDV SQFKDEHPGG DEIIMDLGGQ DATESFVDIG 61 HSDEALRL K GLYIGDVDKT SERVSVE VS TSENQSKGSG T WILAILM LGVAYYLLNE

The first work to modify the sequences of cytochrome b5 consisted in the ablation of the carboxy terminal side of the amino acids involved in membrane insertion to replace them with four histidines.

This chimeric or fusion protein is obtained by cloning the nucleotide sequence by polymerase chain reaction (PCR).

The cloning kit used is the TOPO TA cloning® from Invitrogen. The coding DNA sequence for the chimeric protein is inserted into a vector pCR ^® 2.1-TOPO ^®. The assembly was amplified in cells Niai of One Shot ^® .The DNA coding sequence was then transferred into the vector PUHE25-2 expression (SphI cloning ATG and Bam HI to the stop).

The basic modification for Hb5 is therefore as follows:

Membrane Hb5 nucleotide sequence (SEQ ID N ° 3)

1 ATGGCAGAGC AGTCGGACGA GGCCGTGAAG TACTACACCC TAGAGGAGAT TCAGAAGCAC 61 AACCACAGCA AGAGCACCTG GCTGATCCTG CACCACAAGG TGTACGATTT GACCAAATTT

121 CTGGAAGAGC ATCCTGGTGG GGAAGAAGTT TTAAGGGAAC AAGCTGGAGG TGACGCTACT

181 GAGAACTTTG AGGATGTCGG GCACTCTACA GATGCCAGGG AAATGTCCAA AACATTCATC

241 ATTGGGGAGC TCCATCCAGA TGACAGACCA AAGTTAAACA AGCCTCCGGA AACTCTTATC

301 ACTACTATTG ATTCTAGTTC CAGTTGGTGG ACCAACTGGG TGATCCCTGC CATCTCTGCA 361 GTGGCCGTCG CCTTGATGTA TCGCCTATAC ATGGCAGAGG ACTGA Nucleotide sequence of soluble Hb5 histidine tag [Hb5- (His l (SEQ ID N ° 4

1 ATGGCAGAGC AGTCGGACGA GGCCGTGAAG TACTACACCC TAGAGGAGAT TCAGAAGCAC

61 AACCACAGCA AGAGCACCTG GCTGATCCTG CACCACAAGG TGTACGATTT GACCAAATTT

121 CTGGAAGAGC ATCCTGGTGG GGAAGAAGTT TTAAGGGAAC AAGCTGGAGG TGACGCTACT 181 GAGAACTTTG AGGATGTCGG GCACTCTACA GATGCCAGGG AAATGTCCAG AACATTCATC

241 ATTGGGGAGC TCCATCCAGA TGACAGACCA AAGTTAAACA AGCCTCCGGA AACTCTTATC

301 ACTACTATTG ATTCTAGTTC CAGTAACGGA CATCACCACC ATTAA

Amino acid sequence of [ ^" Hb5- (His) ₄ ] (SEQ ID NO: 5) 1 MLAEQSDEAV KYYTLEEIQK HNHSKSTWLI LHHKVYD TK FLEEHPGGEE VLREQAGGDA 61 TENFEDVGHS TDAREMSRTF IIGELHPDSSH LNK

2.2) The water-soluble protein Histidine tag mutated Ser24 ^> Cys

The chimeric protein obtained previously is then mutated in order to make a thiol group appear at the periphery of the protein via a cysteine residue. This modification is carried out by means of a mutagenesis directed on serine No. 24 of Hb5 (His) 4.

The mutagenesis kit used is the QuikChange ^® site-directed Mutagenesis Kit from Stratagene. The action of DNA pfu polymerase makes it possible to reconstitute the expression vector and the sequence to be mutated. Supercompetent épicurian ^® XLl-blue bacteria are transformed by this plasmid.

Several different localizations of the mutation have been tried and it is exemplified in particular at position 24, ie a modification of the serine residue to cysteine. The mutation was verified by laboratory sequencing (ABI sequencer):

HbS-Ofis ^ mut24 nucleotide sequence (SEQ ID N ° 6)

1 ATGGCAGAGC AGTCGGACGA GGCCGTGAAG TACTACACCC TAGAGGAGAT TCAGAAGCAC

61 AACCACTGCA AGAGCACCTG GCTGATCCTG CACCACAAGG TGTACGATTT GACCAAATTT 121 CTGGAAGAGC ATCCTGGTGG GGAAGAAGTT TTAAGGGAAC AAGCTGGAGG TGACGCTACT

181 GAGAACTTTG AGGATGTCGG GCACTCTACA GATGCCAGGG AAATGTCCAG AACATTCATC

241 ATTGGGGAGC TCCATCCAGA TGACAGACCA AAGTTAAACA AGCCTCCGGA AACTCTTATC

301 ACTACTATTG ATTCTAGTTC CAGTAACGGA CATCACCACC ATTAA

Amino acid sequence of Hb5- (His) * mut24 (SEQ ID No. 7)

1 MLAEQSDEAV KYYTLEEIQK HNHCKSTWLI LHHKVYDLTK FLEEHPGGEE VLREQAGGDA 61 TENFEDVGHS TDAREMSRTF IIGELHPDDR PKLNKPPETL ITTIDSSSSN GHHHH 2.3) Expression of proteins in Escherichia Coli

The bacterial expression strain is XLl-blue.

A preculture (6 h at 37 ° C. in 50 ml of medium) of a clone in a Luria-Bertami (LB) medium in the presence of a selection marker, ampicillin, made it possible to inoculate at a rate of l / 100 ^eme a liter of Terrifie Broth medium supplemented with 100 mg / l of ampicillin.

The culture is placed at room temperature with stirring for 48 h then the protein overexpression is induced by addition of Isopropyl β-D-ThioGalacto Pyranoside (IPTG) at a rate of 0.5 mM final.

2.4) Purification of proteins

The bacteria are centrifuged after 24-48 hours of induction and are frozen. A freeze / thaw cycle is followed by a lysis / fractionation step (lysozyme, cholic acid and ultrasonic disintegrator).

The purification procedure by metal ion chromatography (IMAC) is defined as follows:

An agarose gel functionalized with iminodiacetic acid (Sigma) is previously loaded (flow 1 ml / min) with Nickel by loading with a 50mM Nickel Chloride solution solubilized in an acetate buffer, pH5.4. the column is washed with this same buffer at the same flow and then we replace the acetate with a sodium phosphate buffer, 50 mM, pH 7.

The cell fractionation is directly injected onto an agarose gel column at 5 ml / min. Specifically, the chimeric proteins are retained on the column according to the IMAC technique. The column undergoes a washing phase with a phosphate buffer of increasing concentration 50 to 250 mM, pH7 until the passing solution no longer has an absorption spectrum in the ultraviolet (240-300nm). The protein sample is eluted by taking histines in solution of concentration 1 mg / ml in 50 mM phosphate buffer, pH 7. Similar experiments were carried out on the yeast form of cytochrome b5. Thus it is possible to obtain several human mutant chimeric proteins and yeast of high degree of purity and at the rate of several milligrams of protein. Example 3: Realization of the floating protein anchor

The hybrid bilayer structure presented in paragraph 1.3 was functionalized in order to give the model properties of affinities by metal ions. To do this, a synthetic phospholipid having an iminodiacetate residue complexing a divalent nickel cation was chosen. It is DOGS or 1,2 dioleoyl-sn-glycero-3 (N (5-amino-l-carboxypentyl) iminodiacetic acid) succinyl)] from Avanti polar Lipid, Inc.

It has been demonstrated that such a molecule allows the interaction of proteins having a poly-histidine domain in their primary sequence. In order to introduce these synthetic phospholipids into the membrane model, we have produced lipid vesicles composed of a mixture of lipids up to 10% (mol / mol) of modified lipid. These mixed liposomes have the same behavior towards the hydrophobic support as those composed of a single species of phospholipids. The results of fusion by RPS lead to comparable values in terms of kinetics of fusion and recovery (results not shown).

One method for addressing stable and specific soluble proteins to membrane supports is to use the coupling between a divalent metal chelating cation present on the surface of the membrane and histidine residues. It has been shown that cytochrome b5 whose membrane domain has been delisted in favor of a Tag Histidine segment retains an affinity for biological membranes having divalent chelating cations.

Different forms of cytochrome b5 with a TagHis domain have been produced (section 2.1).

The immobilization of cytochrome b5 on the hybrid bilayer by IMAC approach was characterized by RPS (Figure 2). To assess the binding capacity of the membrane, multiple protein injections were carried out in its environment. Protein concentrations are conventionally between 0.5 and 2μM and lead to saturation kinetics of the biosensor. For the Hb5 (His) 4 form, a maximum loading signal of 650RU, which corresponds to approximately 75% of optimal recovery on such a membrane model (FIG. 1a), was obtained. To demonstrate the specific interaction of these proteins with the biosensor, multiple injections of a competing agent for histidine-Ni2 + coordination were carried out. A histidine solution at 1 mg / ml injected at the surface of the biosensor causes a sharp decrease in the signal, that is to say the amount of cytochrome b5 fixed on the membrane (FIG. 2b). In this way one can compete with the specific interaction and return to the baseline of the signal.

This procedure, using a non-denaturing aqueous solution for the biomolecules, thus allows complete regeneration of the surface of the lipid monolayer. The results presented in FIG. 2 confirm the high potential of the biosensor in terms of protein capture with a high level of compactness. They underline the extreme control of the authors over the different phases of construction of this supramolecular assembly because, by modulating the pulses of protein injections or competing agents, it is possible to precisely fix the amount of protein on the surface.

This great modularity can be summarized in Figure 3.

Example 4: Graft Protein-ssDNA by Cis-Pt Complex

Platinum complexes, in particular cis-diamminedichloroplatin (cis- [PtCl ₂ (NH ₃ )] are agents which bind covalently to DNA. In addition these molecules, by substitution of their labile chloro ligand, can bridge d on the one hand a base of DNA and on the other hand a nucleophilic residue of an amino acid of a protein.

4.1) Materials

Cw- [PtCl2 (NH3) 2] and trα / M- [PtCl2 (NH3) 2] are supplied by Johnson

Matthey (London, United Kingdom). w- [Pt (NH3) 2 (H2θ) 2] ^ ⁺ and trans-

[Pt (NH3) 2 (H2θ) 2 ⁺ are prepared by dissolving a suspension of cis- [Pt (Nθ3) 2 (NH3) 2] and trαra ^, - [Pt (N03) 2 (NH3) 2] in the water, respectively formed by the reactino of ezs- [PtCl2 (NH3) 2] and tr <m? - [PtCl2 (NH3) 2] with silver nitrate. The DNA-20mer, its complementary strand and its complementary biotynilized strand come from Eurogentec. The DNA-20mer sequence,

5'CTATCATTTGCTTACTATTC 3 '(SEQ ID N ° 13) is chosen so as to have only one guanine because nitrogen N7 is the main site of DNA platination (Lepros et al., 1990).

4.2) Formation of DNA-b5 bridging via platinum bridging

The platination reactions are carried out firstly on DNA or on cytochrome b5 (Rb5 (is) 4 and Ht> 5 (His) 4mut24) but the DNA-5 bridging yield is higher when cytochrome b5 is first platinized. Platinization of ssDNA (500 μM) with an equivalent of platinum complex in

70mM NaClO ₄ leads to the formation of cis- or trα ^, - [Pt (NH3) 2 (H2θ)] 2+ mono-adduct linked to guanine.

The platination site is determined after treatment of the modified oligonucleotide with piperidine-DMS under "Maxam-Gilbert" sequencing conditions followed by treatment with NaCN. The lack of reactivity of guanine N7-platinum with dimethylsulfate (DMS) makes it possible to conclude that the latter is protected from DMS and therefore from its effective platinization (Comess et al., 1990). Cytochrome hS (100-200 μM) is incubated in the presence of 5 equivalents of platinum complexes in unbuffered water (pH5) for 5 hours at 25 ° C. Cytochrome b5 is then incubated (90 μM) with 1.5 equivalent of DNA in unbuffered water (pH5) for 50 hours at 25 ° C. The t-DNA complexes> 5 are separated from the uncomplexed DNA molecules using an agarose gel functionalized with Ni ²⁺ / iminodiacetic acid (Sigma) groups. The elution of the protein is by injection of immidazole (IM). Excess DNA is not retained ue on the column. The platinum-coupled DNA-b5 complexes are also purified from non-reactive forms of DNA using magnetic spheres coated with Promega streptavidin according to a modification of the procedure described by Promega: 0.5 nmol of total DNA. (complexed or not) of the complexing mixture is heated to 45 ° C for 10 min in water and then is confronted with its complementary biotinylated strand in 0.075M NaCl, 0.0075M citrate pH7.2 at 2.5 ° C. The mixture (500 μl) is added to 0.6 mg of magnetic spheres complexed with streptavidin, washed beforehand and balanced in the same buffer at 2.5 ° C. The platinum complex bsDNA-b5 is not retained on the spheres and the uncomplexed bsDNA is eluted between 30-40 ° C in 0.015M NaCl and 0.0015M citrate pH7.2. These purification steps are followed on the one hand by a detection of radioactivity of the P32-labeled ss DNA in the 5 ′ position (previously radiolabelled by the action of the polynucleotide kinase using [γ32p] ATP) and on the other hand, spectral study on an absorbance window comprising 413nm for b5 (e ≈ 100 OOOM ^ .cm ^"1 ) and 260nm for bsDNA (e = 180 500 M ^{" 1} .cm ^"1 ). The latter is corrected for the component of absorbance of Hb5 at this wavelength (ie 1/5 of its absorbance at 413 nm). However, it should be pointed out that these last two procedures do not allow the separation of the platinum complex "ssDNA-b5" from cytochrome b5 not complexed.

Platinum complexes and trans- [Pt (NH3) 2 (H2θ) 2] 2 ⁺ are able to couple cytochrome> 5 with ssDNA-20mer. The platinization site on the DNA oligonucleotide occurs at the N7 level of a single guanine. The "DNA-b5" macromolecular complexes are characterized by gel analyzes of electrophoresis under denaturing conditions, spectrophotometric quantification and determination of melting temperature with a complementary free ssDNA. The electrophoretic study on 15%) SDS-PAGE of the mixture composed of 5 'radiolabelled ss DNA, Hb5 [His] 4 and cis or trans- [Pt (NH3) 2 (H2θ) 2] ²⁺ was carried out .

After migration of the samples, the radioactivity of the ssDNA * is associated with the migration band of Hb5 [His] 4 (revealed by staining with coomassie blue) demonstrating that a covalent bond has been formed between the ssDNA-20mer and the cytochrome b5 (Figure 4). The “DNA-pt-b5” complex was characterized by spectral analysis in order to determine the stoichiometry of the reaction between cytochrome b5 and ssDNA-20mer. The experimental conditions allowed the formation of an equimolecular complex as indicated by the respective absorbance of cytochrome b5 at 413nm and of ssDNA-20mer at 260 nm (Figure 5). 4.3) Determination of the melting temperature

The melting temperatures of ss-20 mer DNA and ss-20mer DNA coupled to t 5 by a czj bridge ^, - [Pt (NH3) 2 (H2θ) 2] 2 ⁺ were determined in 0.1 M NaClO pH4 with their complementary ssDNA. Melting temperatures were measured on a spectrophotometer

Uvikon 941 (Kontron). 0.2 nmole of DNAsb-20mer (or complex "DNAsb-b5-Pt") were incubated with a DNAsb having a sequence complementary to a final concentration of 0.5 μM in 0.025M NaClO ₄ pH4.4. The duplex sample is heated at 80 ° C (DNA-20mer) or 65 ° C ("DNA-Pt-b5"), the temperature decreases by 1 ° C / min to 2.5 ° C and the absorbance is measured at 260nm. samples are heated from 2.5 ° C to 60 ° C at 1 ° C / min and their absorbance is monitored at 260nm, in order to verify that the curves obtained during cooling and heating are superimposable (reversible profiles). The melting temperature of the duplex containing the ssDNA-20mer decreases by 22 ° C (from 45 ° C to 23 ° C) when it is coupled with cytochrome b5 (Figure 6).

No difference was observed between the complex comprising Hb5 (His) 4 and the cysteine mutant: the cysteine at position 24 does not seem to be, for the cis Pt complex, more reactive than the other nucleophilic sites present at the periphery of the cytochrome b5.

In any case, the platinization reactions do not occur on the label 4 histidines in the carboxy terminal position, in which case the complex thus formed would not be capable of being purified on an agarose-iminodiacetate column or of interacting strongly. with the cell. Mass characterization experiments (electrospray, Maldi-TOF) of the various complexes are in progress.

Example 5: Grafting of Protein-ssDNA by Spacer Arm 5.1) Functionalization of ssDNA by DPDPB A second alternative was explored concerning the grafting of a nucleic acid with cytochrome b5. With a view to optimally presenting the DNA coupled to the surface of the membrane biosensor, the inventors chose not to use direct coupling but preferably complexation by through a spacer arm. The molecule ensuring intermolecular bridging is 1,4-Di- [3 '- (2'-pyridyldithio) propionamido] butane or DPDPB. This molecule allows a covalent bond between two molecules having thiol functions and ensures an intermolecular space of 1.6 nm. To make such a supramolecular assembly, a thiol function was created both on an oligonucleotide and on cytochrome b5. The modified oligonucleotides are of HPLC quality and are produced by Eurogentec. The different modified oligonucleotides are as follows:

Oligonucleotide no W1 (SEQ ID No 8) 5 'GCT-AGC-TGC-ATA-GAT-CTC-TAC-C-SH 3'

The thiol modification is carried out at the 3 'end of the 22mer.

Oligonucleotide no W2 (SEQ ID No 9) 5 'GCT-AGC-TGC-ATA-GAT-CTC-TAC-C 3' The thiol modification is carried out in-chain on a thymine placed in position l 1 of the 22mer.

The different unmodified oligonucleotides involved in the exemplification are the following:

Oligonucleotide No. W3 (SEQ ID No. 10) 5 '-GGT-AGA-GAT-CTA-TGC-AGC-TAG-G-3' W3 is the complementary 22mer of W1.

Oligonucleotide No. W4 (SEQ ID No. 11)

5 '-GCA-GCT-AGC-GGT-AGA-GAT-CT-3'

W4 has a sequence complementary to the first 9 bases of Wl (5 'side) and the first 11 bases of Wl (3' side). In this way W4 has the particularity of being able to bridge two oligonucleotides W1.

Oligonucleotide No. W5 (SEQ ID No. 12)

5 '-GCT-AGC-TGC-ATA-GAT-CTC-TAC-C-3' W5 corresponds to the base random sequence of Wl.

The DPDPB-W1 coupling procedure is as follows: in order to prevent any dimerization of the WIs by disulfide bond, the oligonucleotides are treated with a reducing agent of DiThioThreitol (DTT) at the rate of a 1/5 molar fraction. The mixture is incubated at 30 ° C for 15 min. The mother solution of DPDPB is dissolved in dimethyl sulfoxide (DMSO) at the rate of 10 mg / ml. Addition of DPDPB in an amount of 1 mole of W1 for 500 to 5000 moles of DPDPB is carried out in the presence of the residual DTT during an incubation time of 2 to 4 hours at 30 ° C. The sample W1 is then specifically fixed on a DEAE ion exchange column, the reagents are eliminated and the oligonucleotide is eluted by addition of a 1.5M NaCl solution. The rate of modification can be calculated by DTT assay of the cross-linking agent. This reduction causes the departure of the second thiopyridine group of the bridging agent, the quantification of which can be obtained spectrally at 341nm. The describe procedure achieves 100% complex.

5.2) Cytochrome b5-Wl grafting via the spacer arm

In order to carry out a controlled and reversible grafting on cytochrome b5, the inventors carried out a directed mutagenesis of Hb5 (His) 4 as described in paragraph 2.2 leading to the protein Hb5 (His) 4 mutant24. The serine-cysteine mutation makes it possible to specifically introduce a thiol group at the periphery of the protein. To prevent protein dimerization, the solution is treated with DTT (X ol b5 / DTT = 1/5) for 30 min at 30 ° C. The sample is then loaded on an exclusion gel chromatography column (G25) so as to remove the DTT and is immediately injected into the solution of modified oligonucleotides (Xmol b5 / Wl = 1/2) for 4 hours at 30 °. vs. The excess oligonucleotide is eliminated by retention of the proteins on an iminodiacetate-Ni ²⁺ gel. The elution of the proteins is obtained by using a histidine lmg / ml solution, as indicated during the step of purification of the HisTag proteins. Spectral analysis on a [240-500] nm window makes it possible to demonstrate the effective coupling of Hb5 (His) 4 mut24 with W1 (FIG. 7). With regard to the molar absorption coefficients of the two macromolecules, the complexation rates vary from 35 to 65%.

In order to subsequently use only an equimolecular population Hb5 / Wl, an additional purification step is carried out on DEAE. An elution carried out under a NaCl concentration gradient makes it possible to isolate the various species reconstituted during coupling (monomeric Hb5 and dimeric, Hb5-spacer-Wl). Thus, starting from the initial population, all of the species are separated by increasing gradient of NaCl (FIG. 7): Spectrum a) monomer of Hb5 (His) 4 mut 24 Spectrum b) dimer of Hb5 (His) 4 mut 24 Spectrum c) Equimolar complex b5-Wl.

According to this procedure, the b5-Wl population is isolated and can be confronted with the hybrid membrane.

Example 6: Realization of the supramolecular assembly "b5-cis Pt-ADNsb" and "b5-DPDPB-ADNsb"

The grafting of the different complexes on the hybrid bilayer was characterized by surface plasmon resonance. Within a BIAcore device. Experiments based on radioactivity and fluorescence labeling are being developed in the laboratory. The coupling experiments of the molecular assembly on the lipid model using the nickel chelating complex by surface plasmon resonance have shown the formation of a stable complex.

The compactness levels obtained with the assembly, on the other hand, appear to be lower than those obtained with the protein not modified by the oligonucleotide. The increase in negative charges brought by Wl can be at the origin of repulsions between supramolecular blocks and thus lead to a less recovery. The recovery values were evaluated between 200 and 250RU.

We have verified, like Hb5 (His) 4, that the structures are in specific interactions with the support and that the action of chelating competing agents such as a histidine solution 1 mg / ml allows complete regeneration of the structure, (data not shown but exhibiting the same behavior as that which is the subject of FIG. 2).

Example 7 Potential of the Biosensor and Hybridization Detection In order to evaluate the potential of the membrane biosensor in terms of specificity and sensitivity, various tests were carried out.

First, it was essential to verify the absence of non-specific interactions of oligonucleotides with the biosensor. To do this different W4 injections have been made. W4 represents a random sequence starting from the constitutive bases of Wl, the study of the evolution of the signal made it possible to show that W4 does not interact on the surface of the biosensor ie the lipid structure and the supramolecular assembly b5-Wl; and this whatever the bridging means (cis-Pt or DPDPB)

In a second step, different W3 injections were carried out at different saline concentrations. Thus, it has clearly been demonstrated that injections of W3, the complementary sequence of W1, in the presence of a high concentration of NaCl were accompanied by kinetics of association or hybridization. On the other hand, for NaCl concentrations of less than or equal to 20 mM, the same oligonucleotide does not or hardly interact with the biosensor.

These results demonstrate the possibility of detecting hybridization states between two ssDNAs on the surface of the biosensor. The hybridization results show a threshold value of approximately 30 to 35RU. However, according to the different calibration modes, the expected value for a complete hybridization from a b5-Wl block signal of 250RU, is 70RU. However, the measurements of Tm carried out on W1 clearly show a phase transition temperature close to ambient temperature, that is to say the measurement temperature within the BIAcore device. At this temperature only 50% of hybridization is expected. The value measured with our device is therefore close to optimal hybridization proof of a very favorable accessibility of the target molecules presented by the biosensor.

The dimensions of the work cell within the BIAcore device are of the order of 1mm ² . However, the surface actually probed by the evanescent wave represents only 0.224mm. Considering the calibration 1000RU <- 0.224ng / 0.224mm2, 250 RU of molecular assembly correspond to O.lng or 5fmole =

3.10 molecules. The membrane biosensor allows molecular hybridization o of approximately 10 molecules.

In addition, the biosensor presented requires only the capture of a complementary ssDNA without the use of a labeled probe being necessary. BIBLIOGRAPHICAL REFERENCES

Berney et al. (2000) Sensors and Actuators B 68, 100-108

Boncheva et al. (1999) Langmuir 15, 4317-4320

Boon et al. (2000) Nature Biotechnology 18, 1096-1100 Braun et al. (1998) Nature 391, 775-778

Cheng et al. (2000) Reviews in molecular biotechnology 74, 159-174 (pi 8)

Comess et al. (1990) Biochemistry, 29, 2102-2110

Ebbesen et al. (1998) Nature 391, 667-669 (pi 8)

Gulik-Krzywicki et al, (1967), J Mol Biol.; 27 (2): 303-22 Heyse et al. (1998) Biochemistry 37, 507-522

Kalb et al. (1992) Biochim. Biophys. Acta 1103: 307-316

Leprosy et al. (1990) Nucleic Acids Molec. Biol, 4, 9-38

Marchai et al. (1998) Biophysical Journal 74, 1937-1948

Steel et al. (2000) Biophysical Journal 79, 975-981 Wittung-Stafshede et al. (2000) Colloids and Surfaces 174, 269-273

Claims

claims

1. Cell for the presentation of a nucleic acid comprising:

- a substantially planar support on the atomic scale, - a protein III having a unique three-dimensional structure,

- an IN nucleic acid linked to said protein III, the entire nucleic acid - protein being movable laterally with respect to said support, so that the hybridization of a target nucleic acid to said nucleic acid IN or the change in conformation of said acid nucleic acid IN is detectable by the geometric reorganization of the nucleic acid - protein set.

2. Cell according to claim 1, characterized in that said protein III is chosen from the group consisting of proteins having a redox center and proteins having an anisotropic optical absorption property.

3. Cell according to one of claims 1 or 2, comprising:

- a substantially plane support on the atomic scale, on which is fixed - a hydrophobic monolayer I, on which is present

- a monolayer II comprising phospholipids,

- A bridging molecule having a hydrophobic end capable of interacting with the monolayer II, and a chemically functionalized end so as to form a stable bond with a protein III, a protein III having a unique three-dimensional structure, said protein III being laterally mobile in said layer II,

- an IN nucleic acid unequivocally linked to said protein III, preferably by a molecular arm.

4. Cell according to one of claims 1 to 3, characterized in that the nucleic acid is linked to said protein by a covalent bond.

5. Cell according to one of claims 1 to 3, characterized in that the nucleic acid is linked to said protein by a reversible bond.

6. Cell according to one of claims 1 to 3, characterized in that the IN nucleic acid is linked to said protein III via a compound chosen from:

- A spacer arm connecting two identical or different chemically reactive residues of the nucleic acid IN and protein III, chosen from the group consisting of thiols, amines, amides and arginines.

- a metal complex such as cis-platinum, trans-platinum, europium, a nickel, copper, or ruthenium complex coordinated on the one hand with a residue or a group of amino residues of said protein III and d on the other hand to one or more natural or modified bases of nucleic acid IV,

- a covalent or non-covalent protein complex involving nucleic acid IV.

7. Cell according to one of claims 1 to 6, characterized in that said protein III has undergone a modification introducing a unique site making it possible to effect said binding of said nucleic acid IV unequivocally.

8. Cell according to claim 7, characterized in that the said modification consists in a mutation of the said protein so as to leave only subsist or introduce only a single predetermined amino acid.

9. Cell according to claim 8, characterized in that said predetermined amino acid is a cysteine.

10. Cell according to one of claims 3 to 9, characterized in that said protein is linked to a phospholipid of layer II.

11. Cell according to claim 10, characterized in that said bond is a covalent bond, for example by acylation, faraesylation, by a GPI anchor sequence (glycosylphosphatidylinositol) or by the attachment of a phospholipid to a specific residue of protein III by any artificial method.

12. Cell according to claim 10 or 11, characterized in that said bond is a reversible bond, for example by means of an arm capable of binding a metal chelate on one side and an amino acid or a group of amino acids on the other.

13. Cell according to one of claims 10 to 12, characterized in that said protein is linked to a modified phospholipid of layer II, said phospholipid having a binding zone of a chelate.

14. Cell according to one of claims 3 to 9, characterized in that said protein has a hydrophobic tail allowing it to be anchored in the IL layer

15. Cell according to one of claims 3 to 14, characterized in that the phospholipids of layer II have hydrophobic tails chosen so that said layer is not in the crystalline state, but in the fluid state at operating temperature.

16. Cell according to claim 15, characterized in that said hydrophobic tails have a chain length greater than or equal to 14 carbon atoms, said chain possibly having unsaturations, so that said layer II is in the fluid state at operating temperature.

17. Cell according to one of claims 3 to 16, characterized in that said phospholipids of layer II have polar heads, chosen from the group consisting of neutral polar heads not carrying charges, neutral globally carrying opposite charges (zwitterionic), or carrying a negative overall charge.

18. Cell according to one of claims 3 to 17, characterized in that said layer I comprises hydrophobic elements, having a chain length of about 2 to 2.5 nm, for example between 12 and 20 carbon atoms , preferably between 14 and 18 carbon atoms.

19. Cell according to one of claims 3 to 18, characterized in that said layer I comprises phospholipids linked to said support via their polar heads.

20. Cell according to one of claims 3 to 18, characterized in that said layer I comprises hydrophobic elements linked to said support via a covalent bond, for example an alkyl-thiol bond or an alkyl-siloxane bond .

21. Cell according to one of claims 1 to 20, characterized in that the flatness of said support is such that the difference in height between two distant zones of less than 100 nm is less than or equal to 10 nm, preferably less than or equal at 3 nm, more preferably less than or equal to 2 nm.

22. Cell according to one of claims 1 to 21, characterized in that said support consists of a material chosen from the group consisting of glass covered with a layer of gold, cleaved mica, silicon or any other monocrystalline material.

23. Cell according to one of claims 1 to 22, characterized in that it comprises several identical or different proteins, linked to identical or different nucleic acids.

24. Support for the detection of nucleic acids having a plurality of cells according to one of claims 1 to 23.

25. Support according to claim 24, characterized in that it comprises a system allowing the measurement of current, impedance or potential.

26. Support according to claim 24, characterized in that it comprises between each cell an integrated optical device capable of measuring the absorbance of a cell in two crossed directions and of deducing its state of organization (anisotropy) or disorganization (isotropy).

27. Support according to claim 24, characterized in that it comprises a surface alternating conductive and reflective areas and non-conductive and transparent areas.

28. A method of identifying the presence of a test nucleic acid in a sample, comprising the steps of: a) bringing said sample into contact with a cell according to one of claims 1 to 23, under conditions allowing the hybridization of said test nucleic acid to a nucleic acid linked to a protein of said cell, b) detecting the hybridization of said test nucleic acid to said nucleic acid linked to said protein.

29. Method for identifying the binding of a protein to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) bringing said protein into contact with a nucleic acid linked to a protein , in a cell according to one of claims 1 to 23, b) detecting the binding of said protein to said nucleic acid and / or its activity on the conformation of said nucleic acid.

30. A method of identifying the binding of a ligand to a protein attached to a nucleic acid attached to a protein in a cell according to one of claims 1 to 23, comprising the steps of: a) bringing said ligand into contact with said protein, b) detecting the binding of said ligand to said protein.

31. A method of identifying the binding of a compound to a nucleic acid and / or its activity on the conformation of said nucleic acid, comprising the steps of: a) bringing said compound into contact with a nucleic acid linked to a protein , in a cell according to one of claims 1 to 23, b) detecting the binding of said compound to said nucleic acid and / or its activity on the conformation of said nucleic acid.

32. Identification method according to one of claims 28 to 31, characterized in that the detection is carried out by means of an optical system (absorbance, fluorescence), electric, electronic, with surface plasmon resonance , energy transfer, radiolabelling, diffraction (optics, electronics, X-rays, neutrons) or microscopy (direct optics or fluorescence, electronics, near field, atomic force).