EP1421379A2 - Cysteinmutanten und verfahren zum nachweis der bindung von liganden an biologische moleküle - Google Patents

Cysteinmutanten und verfahren zum nachweis der bindung von liganden an biologische moleküle

Info

Publication number
EP1421379A2
EP1421379A2 EP02761258A EP02761258A EP1421379A2 EP 1421379 A2 EP1421379 A2 EP 1421379A2 EP 02761258 A EP02761258 A EP 02761258A EP 02761258 A EP02761258 A EP 02761258A EP 1421379 A2 EP1421379 A2 EP 1421379A2
Authority
EP
European Patent Office
Prior art keywords
residue
seq
cysteine
tbm
reference value
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02761258A
Other languages
English (en)
French (fr)
Inventor
Robert S. Mcdowell
W. Michael Flanagan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Viracta Therapeutics Inc
Original Assignee
Sunesis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/981,547 external-priority patent/US20020022233A1/en
Priority claimed from US09/990,421 external-priority patent/US6919178B2/en
Priority claimed from US10/121,216 external-priority patent/US6998233B2/en
Application filed by Sunesis Pharmaceuticals Inc filed Critical Sunesis Pharmaceuticals Inc
Publication of EP1421379A2 publication Critical patent/EP1421379A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates generally to variants of target biological molecules ("TBMs") and to methods of making and using the same to identify ligands of TBMs. More specifically, the invention relates to individual variant TBMs and sets of variant TBMs, each of which represents a modified version of a protein of interest where a thiol has been introduced at or near a site of interest. Ligands of TBMs are identified in part through the formation of a covalent bond between a potential ligand and a reactive thiol on the TBM. DESCRIPTION OF THE FIGURES
  • Figure 1 schematically illustrates one embodiment of the tethering method wherein the target is a protein and the covalent bond is a disulfide.
  • a thiol-containing protein is reacted with a plurality of ligand candidates.
  • a ligand candidate that possesses an inherent binding affinity for the target is identified and a ligand is made comprising the identified binding determinant (represented by the circle).
  • Figure 2 is a representative example of a tethering experiment.
  • Figure 2A is the deconvoluted mass spectrum of the reaction of thymidylate synthase ("TS") with a pool of 10 different ligand candidates with little or no binding affinity for TS.
  • Figure 2B is the deconvoluted mass spectrum of the reaction of TS with a pool of 10 different ligand candidates where one of the ligand candidates possesses an inherent binding affinity to the enzyme.
  • TS thymidylate synthase
  • Figure 3 shows three illustrative examples of the distribution pattern of the residues that are each mutated to a cysteine.
  • Figure 3A is an example where the residues are distributed about a single site of interest.
  • the structure is of the core domain of HIV integrase with the portion comprising the site of interest shaded in dark gray.
  • Figure 3B is an example where the residues are distributed about two sites of interest.
  • the structure is of the human interleukin-1 receptor with the portions comprising the two sites of interested shaded in dark gray.
  • Figure 3 C is an example where the residues are distributed throughout the surface of a protein.
  • the structure is the trimeric structure of human TNF- ⁇ .
  • Figure 4 shows the side chain rotamers of cysteines in A) ⁇ -sheets and B) ⁇ -helices. DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • the present invention relates generally to variants of target biological molecules ("TBMs”) and to methods of making and using the same to identify ligands of TBMs.
  • TBMs target biological molecules
  • aliphatic or “unsubstituted aliphatic” refers to a straight, branched, cyclic, or polycyclic hydrocarbon and includes alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties.
  • alkyl or "unsubstituted alkyl” refers to a saturated hydrocarbon.
  • alkenyl or "unsubstituted alkenyl” refers to a hydrocarbon with at least one carbon- carbon double bond.
  • alkynyl or “unsubstituted alkynyl” refers to a hydrocarbon with at least one carbon- carbon triple bond.
  • aryl or "unsubstituted aryl” refers to mono or polycyclic unsaturated moieties having at least one aromatic ring.
  • the term includes heteroaryls that include one or more heteroatoms within the at least one aromatic ring.
  • aryl examples include: phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazoly, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, and the like.
  • substituted when used to modify a moiety refers to a substituted version of the moiety where at least one hydrogen atom is substituted with another group including but not limited to aliphatic; aryl, alkylaryl, F, Cl, I, Br, -OH; -N0 2 ; -CN; -CF 3 ; -CH 2 CF 3 ; -CH 2 C1; -CH 2 OH: -CH 2 CH 2 OH; -CH 2 NH 2 ; -CH 2 S0 2 CH 3 ; -OR x ; -C(0)R x ; -COOR x ; -C(0)N(R x ) 2 ; -OC(0)R x -OCOOR x ; -OC(0)N(R x ) 2 ; -N(R X ) 2 ; -S(0) 2 R x ; and -NR x C(0)R x where each occurrence of R x is independently hydrogen,
  • antagonist is used in the broadest sense and includes any ligand that partially or fully blocks, inhibits or neutralizes a biological activity exhibited by a target, such as a TBM.
  • agonist is used in the broadest sense and includes any ligand that mimics a biological activity exhibited by a target, such as a TBM, for example, by specifically changing the function or expression of such TBM, or the efficiency of signaling through such TBM, thereby altering (increasing or inhibiting) an already existing biological activity or triggering a new biological activity.
  • ligand refers to an entity that possesses a measurable binding affinity for the target.
  • a ligand is said to have a measurable affinity if it binds to the target with a K d or a K; of less than about 100 mM, preferably less than about 10 mM, and more preferably less than about 1 mM.
  • the ligand is not a peptide and is a small molecule.
  • a ligand is a small molecule if it is less than about 2000 daltons in size, usually less than about 1500 daltons in size. In more preferred embodiments, the small molecule ligand is less than about 1000 daltons in size, usually less than about 750 daltons in size, and more usually less than about 500 daltons in size.
  • ligand candidate refers to a compound that possesses or has been modified to possess a reactive group that is capable of forming a covalent bond with a complimentary or compatible reactive group on a target.
  • the reactive group on either the ligand candidate or the target can be masked with, for example, a protecting group.
  • polynucleotide when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double-stranded regions, single- and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or include single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple-helical region often is an oligonucleotide.
  • polynucleotide specifically includes DNAs and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases are included within the term “polynucleotides” as defined herein.
  • polynucleotide embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.
  • protected thiol refers to a thiol that has been reacted with a group or molecule to form a covalent bond that renders it less reactive and which may be deprotected to regenerate a free thiol.
  • reversible covalent bond refers to a covalent bond that can be broken, preferably under conditions that do not denature the target. Examples include, without limitation, disulfides, Schiff-bases, thioesters, coordination complexes, boronate esters, and the like.
  • reactive group is a chemical group or moiety providing a site at which a covalent bond can be made when presented with a compatible or complementary reactive group.
  • Illustrative examples are -SH that can react with another -SH or -SS- to form a disulfide; an -NH 2 that can react with an activated -COOH to form an amide; an -NH 2 that can react with an aldehyde or ketone to form a Schiff base and the like.
  • reactive nucleophile refers to a nucleophile that is capable of forming a covalent bond with a compatible functional group on another molecule under conditions that do not denature or damage the target.
  • the most relevant nucleophiles are thiols, alcohols, and amines.
  • reactive electrophile refers to an electrophile that is capable of forming a covalent bond with a compatible functional group on another molecule, preferably under conditions that do not denature or otherwise damage the target.
  • the most relevant electrophiles are imines, carbonyls, epoxides, aziridies, sulfonates, disulfides, activated esters,- activated carbonyls, and hemiacetals.
  • site of interest refers to any site on a target on which a ligand can bind.
  • the site of interest can include amino acids that make contact with, or lie within about 10 Angstroms (more preferably within about 5 Angstroms) of a bound substrate, inhibitor, activator, cofactor, or allosteric modulator of the enzyme.
  • the site of interest includes the substrate binding channel from S6 to S6 1 , residues involved in catalytic function (e.g. the catalytic triad and oxy anion hole), and any cofactor (e.g. metal such as Zn) binding site.
  • the site of interest includes the substrate- binding channel in addition to the ATP binding site.
  • the site of interest includes the substrate binding region as well as the site occupied by NAD/NADH.
  • the enzyme is a hydralase such as PDE4
  • the site of interest includes the residues in contact with cAMP as well as the residues involved in the binding of the catalytic divalent cations.
  • target refers to a chemical or biological entity for which the binding of a ligand has an effect on the function of the target.
  • the target can be a molecule, a portion of a molecule, or an aggregate of molecules.
  • the binding of a ligand may be reversible or irreversible.
  • target molecules include polypeptides or proteins such as enzymes and receptors, transcription factors, ligands for receptors such growth factors and cytokines, immunoglobulins, nuclear proteins, signal transduction components (e.g., kinases, phosphatases), polynucleotides, carbohydrates, glycoproteins, glycolipids, and other macromolecules, such as nucleic acid-protein complexes, chromatin or ribosomes, lipid bilayer-containing structures, such as membranes, or structures derived from membranes, such as vesicles.
  • TBMs Target Biological Molecules
  • TBM Target Biological Molecule
  • the TBM is a protein or a portion thereof or that comprises two or more amino acids, and which possesses or is capable of being modified to possess a reactive group that is capable of forming a covalent bond with a compound having a complementary reactive group.
  • TBMs include: cell surface and soluble receptors and their ligands; steroid receptors; hormones; immunoglobulins; clotting factors; nuclear proteins; transcription factors; signal transduction molecules; cellular adhesion molecules, co-stimulatory molecules, chemokines, molecules involved in mediating apoptosis, enzymes, and proteins associated with DNA and/or RNA synthesis or degradation.
  • Many TBMs are those participate in a receptor-ligand binding interaction and can be either member of a receptor-ligand pair.
  • growth factors and their respective receptors include those for: erythropoietin (EPO), thrombopoietin (TPO), angiopoietin (ANG), granulocyte colony stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM-CSF), epidermal growth factor (EGF), heregulin- ⁇ and heregulin- ⁇ , vascular endothelial growth factor (VEGF), placental growth factor (PLGF), transforming growth factors (TGF- ⁇ and TGF- ⁇ ), nerve growth factor (NGF), neurotrophins, fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), bone morphogenetic protein (BMP), connective tissue growth factor (CTGF), hepatocyte growth factor (HGF), and insulin- like growth factor 1 (IGF-1).
  • EPO erythropoietin
  • TPO thrombopoietin
  • ANG angiopoietin
  • G-CSF
  • hormones and their respective receptors include those for: growth hormone, prolactin, placental lactogen (LPL), insulin, follicle stimulating hormone (FSH), luteinizing hormone (LH), and neurol inin-1.
  • cytokines and their respective receptors include those for: ciliary neurotrophic factor (CNTF), oncostatin M (OSM), TNF- ⁇ ; CD40L, stem cell factor (SCF); interleukin-1, interleukin-2, interleukin-4, interleukin-5, interleukin-6, interleukin-8, interleukin-9, interleukin- 13 , and interleukin- 18.
  • TBMs include: cellular adhesion molecules such as CD2, CDl la, LFA-1, LFA-3, ICAM-5, VCAM-1, VCAM-5, and VLA-4; costimulatory molecules such as CD28, CTLA-4, B7-1; B7-2, ICOS, and B7RP-1; chemokines such as RANTES and MlPlb; apoptosis factors such as APAF-1, p53, bax, bak, bad, bid, and c-abl; anti-apoptosis factors such as bcl2, bcl-x(L), and mdm2; transcription modulators such as AP-1 and AP-2; signaling proteins such as TRAF-1, TRAF-2, TRAF-3, TRAF-4, TRAF-5, and TRAF-6; and adaptor proteins such as grb2, cbl, she, nek, and crk
  • Enzymes are another class of preferred TBMs and can be categorized in numerous ways including as: allosteric enzymes; bacterial enzymes (isoleucyl tRNA synthase, peptide deformylase, DNA gyrase, and the like); fungal enzymes (thymidylate synthase and the like); viral enzymes (HIV integrase, HSV protease, Hepatitis C helicase, Hepatitis C protease, rhinovirus protease and the like); kinases (serine/threonine, tyrosine, and dual specificity); phosphatases (serine/threonine, tyrosine, and dual specificity); and proteases (aspartyl, cysteine, metallo, and serine proteases). Notable subclasses of enzymes include: kinases such as Lck, Syk, Zap-70, JAK, FAK, ITK, BTK,
  • MEK MEK, MEKK, GSK-3, Raf, tgf- ⁇ -activated kinase- 1 (TAK-1), PAK-1, cdk4, Alct, PKC ⁇ , IKK ⁇ ,
  • Other enzymatic targets include: BACE, TACE, cytosolic phospholipase A2 (cPLA2), PARP, PDE I-VII, Rac-2,
  • CD26 inosine monophosphate dehydrogenase, 15-lipoxygenase, acetyl CoA carboxylase, adenosylmethionine decarboxylase, dihydroorotate dehydrogenase, leukotriene A4 hydrolase, and nitric oxide synthase.
  • TBMs target biological molecules
  • the TBMs are proteins and the variants are cysteine mutants thereof wherein a naturally occurring non-cysteine residue of a TBM is mutated into a cysteine residue.
  • the non-native cysteine provides a reactive group on the TBM for use in tethering.
  • Tethering is a method of ligand identification that relies upon the formation of a covalent bond between a reactive group on a target and a complimentary reactive group on a potential ligand, and is described in U.S. Patent No. 6,335, 155, PCT Publication Nos. WO 00/00823 and WO 02/42773, Erlanson et al, Proc. Nat. Acad. Sci. USA 97: 9367-9372 (2000), and U.S. Serial No. 10/121,216 entitled METHODS FOR LIGAND DISCOVERY by inventors Daniel Erlanson, Andrew Braisted, and James Wells (corresponding PCT Application No. US02/13061).
  • the resulting covalent complex is termed a target-ligand conjugate. Because the covalent bond is formed at a predetermined site on the target (e.g., a native or non-native cysteine), the stoichiometry and binding location are known for ligands that are identified by this method.
  • the ligand portion of the target-ligand conjugate can be identified using a number of methods.
  • mass spectroscopy is used.
  • the target-ligand can be detected directly in the mass spectrometer or fragmented prior to detection.
  • the ligand can be liberated from the target-ligand conjugate within the mass spectrophotometer and subsequently identified.
  • alternate detection methods are used including to but not limited to: chromatography, labeled probes (fluorescent, radioactive, etc.), nuclear magnetic resonance (“NMR”), surface plasmon resonance (e.g., BIACORE), capillary electrophoresis, X-ray crystallography and the like.
  • functional assays can also be used when the binding occurs in an area essential for what the assay measures.
  • FIG. 1 A schematic representation of one embodiment of the tethering method where the target is a protein and the covalent bond is a disulfide is shown in Figure 1.
  • a thiol containing protein is reacted with a plurality of ligand candidates.
  • the ligand candidates possess a masked thiol in the form of a disulfide of the formula -SSR 1 where R 1 is unsubstituted C C ⁇ 0 alkyl, substituted Ci-Cio alkyl, unsubstituted aryl or substituted aryl.
  • R 1 is selected to enhance the solubility of the potential ligand candidates.
  • a ligand candidate that possesses an inherent binding affinity for the target is identified and a corresponding ligand that does not include the disulfide moiety is made comprising the identified binding determinant (represented by the circle).
  • Figure 2 illustrates two representative tethering experiments where a target enzyme, E. coli thymidylate synthase, is contacted with ligand candidates of the formula
  • E. coli TS has an active site cysteine (Cysl46) that can be used for tethering. Although the E. coli TS also includes four other cysteines, these cysteines are buried and were found not to be reactive in tethering experiments. For example, in an initial experiment, wild type E.
  • cystamine H 2 NCH 2 CH 2 SSCH 2 CH 2 NH 2 .
  • the wild type TS enzyme reacted cleanly with one equivalent of cystamine while the mutant TS did not react indicating that the cystamine was reacting with and was selective for Cysl46.
  • Figure 2A is the deconvoluted mass spectrum of the reaction of TS with a pool of 10 different ligand candidates with little or no binding affinity for TS. In the absence of any binding interactions, the equilibrium in the disulfide exchange reaction between TS and an individual ligand candidate is to the unmodified enzyme. This is schematically illustrated by the following equation.
  • the peak that corresponds to the unmodified enzyme is one of two most prominent peaks in the spectrum.
  • the other prominent peak is TS where the thiol of Cysl46 has been modified with cysteamine.
  • TS thiol of Cysl46
  • this species is not formed to a significant extent for any individual library member, the peak is due to the cumulative effect of the equilibrium reactions for each member of the library pool.
  • a thiol-containing reducing agent such as 2-mercaptoethanol
  • the active site cysteine can also be modified with the reducing agent. Because cysteamine and 2-mercaptoethanol have similar molecular weights, their respective disulfide bonded TS enzymes are not distinguishable under the conditions used in this experiment.
  • the small peaks on the right correspond to discreet library members.
  • Figure 2A is characteristic of a spectrum where none of the ligand candidates possesses an inherent binding affinity for the target.
  • Figure 2B is the deconvoluted mass spectrum of the reaction of TS with a pool of 10 different ligand candidates where one of the ligand candidates possesses an inherent binding affinity to the enzyme. As can be seen, the most prominent peak is the one that corresponds to TS where the thiol of Cysl46 has been modified with the 7V-tosyl-D-proline compound. This peak dwarfs all others including those corresponding to the unmodified enzyme and TS where the thiol of Cysl46 has been modified with cysteamine.
  • Figure 2B is an example of a mass spectrum where tethering has captured a moiety that possesses a strong inherent binding affinity for the desired site.
  • a set comprising at least one cysteine mutant of a protein TBM wherein a naturally occurring non-cysteine residue at or near a site of interest is mutated to a cysteine residue.
  • the set comprises a plurality of cysteine mutants of a protein TBM wherein each mutant has a different naturally occurring non- cysteine residue that is mutated to a cysteine residue.
  • the set comprises at least three cysteine mutants of a protein TBM wherein each mutant has a different naturally occurring non-cysteine residue that is mutated to a cysteine residue.
  • the set comprises at least five cysteine mutants of a protein TBM wherein each mutant has a different naturally occurring non-cysteine residue that is mutated to a cysteine residue. In still yet another embodiment, the set comprises at least ten cysteine mutants of a protein TBM wherein each mutant has a different naturally occurring non-cysteine residue that is mutated to a cysteine residue.
  • a model or an experimentally derived three-dimensional structure e.g., X-ray or 3D NMR
  • a three-dimensional structure of a related or homologous TBM can be used as a stand-in. Once suitable residues are identified using the stand-in structure, then methods known in the art, such as sequence alignment, are used to identify the corresponding residues in the TBM of interest.
  • the methods described below for identifying suitable residues for mutating into cysteines can be used alone or in any combination with each other.
  • the local backbone conformation of a candidate residue is determined and a database of experimentally solved structures is searched for examples of a disulfide-bonded cysteine having the same or similar local backbone conformation as the candidate residue. Any combination of a residue's backbone atoms (N, C ⁇ , C and 0) can be used to determine the local conformation.
  • the likelihood that the TBM accepts the cysteine mutation improves as more examples are found in a database of known disulfide-bonded cysteines in the same or similar local backbone conformation.
  • Experimentally solved structures are available from many sources including the Protein Databank ("PDB") which can be found on the Internet at http://www.rcsb.or and the Protein Structure Database which can be found on the Internet at http://www.pcs.com.
  • Lists of unique, high-resolution protein chains (grouped by structures having a certain resolution and R- factor) that can be used to compile a database of experimentally solved structures are found on the Internet at http://www.fccc.edu/researcli/labs/dunbrack/culledpdb.html.
  • the local environment of a candidate residue includes the candidate residue itself and at least one residue preceding or following the candidate residue in sequence.
  • a conformation is considered the same or similar if the root mean square deviation ("RMSD") of the atoms being compared is less than or equal to aboutl.O Angstrom 2 , more preferably, less than or equal to about 0.75 Angstrom 2 , and even more preferably, less than or equal to about 0.5 Angstrom 2 .
  • RMSD root mean square deviation
  • the method comprises: a) obtaining a set of coordinates of a three dimensional structure of a protein TBM having n number of residues; b) selecting a candidate residue i on the three dimensional structure of the TBM wherein the candidate residue i is the z'th residue where i is a number between 1 and n and residue i is not a cysteine; c) selecting a residuey where residue/ is adjacent to residue i in sequence; d) determining a candidate reference value wherein the candidate reference value is a spatial relationship between residue i and residue j; e) obtaining a database comprising sets of coordinates of disulfide-containing protein fragments wherein each fragment comprises at least a disulfide-bonded cysteine and a first adjacent residue where the disulfide-bonded cysteine and the first adjacent residue share the same sequential relationship as residue i and residue j; f) determining a comparative reference value for each fragment wherein the comparative reference value is the corresponding spatial relationship between the
  • the method further comprises selecting a residue k where residue k is adjacent to residue i in sequence and k is noty; and wherein the candidate reference value is a spatial relationship between residue i, residue j, and residue k; each fragment comprises at least a disulfide-bonded cysteine, a first adjacent residue, and a second adjacent residue where the disulfide-bonded cysteine and the first and second adjacent residues share the same sequential relationship as residue i, residue/, and residue k; and the comparative reference value is the corresponding spatial relationship between the disulfide bonded cysteine, the first adjacent residue, and the second adjacent residue as the candidate reference value is between residue i, residue j, and residue k.
  • the method comprises: a) obtaining a set of coordinates of a three dimensional structure of a protein TBM having n number of residues; b) selecting a candidate residue i on the three dimensional structure of the TBM wherein the candidate residue i is the z ' th residue where i is a number between 1 and n and residue i is not a cysteine; c) selecting residue y and residue k wherein residue j and residue k are both adjacent in sequence to residue i; d) determining a candidate reference value wherein the candidate reference value is a spatial relationship of at least one backbone atom from each of residue i, residue j, and residue k; e) obtaining a database comprising sets of coordinates of disulfide-containing protein fragments wherein each fragment comprises at least a disulfide-bonded cysteine, a first adjacent residue, and a second adjacent residue where the disulfide-bonded cysteine, the first adjacent residue, and the second adjacent residue share the same
  • the spatial relationship comprises a dihedral angle. In yet another embodiment, the spatial relationship comprises a pair of phi psi angles. In another embodiment, the spatial relationship comprises a distance between atoms of two residues.
  • a site of interest is defined on a TBM and suitable residues for cysteine mutation are identified based on the location of the residue from the site of interest.
  • a suitable residue is a non-cysteine residue that is located within the site of interest.
  • a suitable residue is a non-cysteine residue that is located within about 5 A from the site of interest.
  • a suitable residue is a non-cysteine residue that is located within about 10 A from the site of interest.
  • any non-cysteine residue having at least one atom falling within about 5 A or about 10 A respectively from any atom of an amino acid within the site of interest is a suitable residue for mutating into a cysteine.
  • a TBM can have one or multiple sites of interests.
  • a TBM has one site of interest and the set of residues that are each being mutated to a cysteine is clustered around this site of interest.
  • a TBM has at least two different sites of interest and the set of residues that are each being mutated to a cysteine is clustered around the at least two different sites of interest.
  • a TBM either does not possess a distinct site of interest or possesses multiple sites of interests such that the set of residues that are being mutated to a cysteine is dispersed throughout the protein surface.
  • Figure 3 shows three illustrative examples of the distribution pattern of the residues that are each mutated to a cysteine
  • solvent accessibility is calculated for each non-cysteine residue of a TBM and used to identify suitable residues for cysteine mutation.
  • Solvent accessibility can be calculated using any number of known methods including using standard numeric methods (Lee, B. & Richards, F. M. J. Mol. Biol 55:379-400 (1971); Shrake, A. & Rupley, j. A. J. Mol. Biol. 79:351- 371 (1973)) and analytical methods (Connolly, M. L. Science 221:709-713 (1983); Richmond, T. J. J. Mol. Biol. 178:63-89 (1984)).
  • suitable residues for mutation include residues where the combined surface area of the residue's atoms is equaled to or greater than about 20 A 2 . In another embodiment, suitable residues for mutation include residues where the combined surface area of the residue's atoms is equaled to or greater than about 30 A 2 . In yet another embodiment, suitable residues for mutation include residues where the combined surface area of the residue's atoms is equaled to or greater than about 40 A 2 .
  • suitable residues for cysteine mutation are identified by hydrogen bond analysis.
  • a suitable residue is a non-cysteine residue that does not participate in any hydrogen bond interaction.
  • a suitable residue is a non-cysteine residue whose side chain does not participate in any hydrogen bond interaction.
  • a suitable residue is a non-cysteine residue whose side chain does not participate in a hydrogen bond interaction with a backbone atom.
  • suitable residues for cysteine mutation are identified by rotamer analysis.
  • the method comprises: a) obtaining a three dimensional structure of a TBM having n number of residues and a site of interest; b) selecting a candidate residue / that is at or near the site of interest wherein the candidate residue i is the th residue where i is a number between 1 and n and residue i is not a cysteine; c) generating a set of mutated TBM structures wherein each mutated TBM structure possesses a cysteine residue instead of residue i and wherein the cysteine residue is placed in a standard rotamer conformation; and, d) evaluating the set of mutated TBM structures.
  • a standard rotamer conformation for cysteine comprises the set of cysteine rotamers enumerated by Ponders and Richards as described by Ponder, J. W. and Richards, F. M. J. Mol. Biol. 193: 775-791 (1987).
  • a standard rotamer conformation for cysteine comprises a chil angle selected from the group consisting of about 60°, about 180°, and about 300° and a chi2 angle selected from the group consisting of about 60°, about 120°, about 180°, about 270°, and about 300°.
  • the method further comprises determining whether residue / is part of an ⁇ - helix or a ⁇ -sheet and then selecting a standard rotamer conformation based on the assigned secondary structure. As shown in Figure 4, a different set of rotamers is preferred depending on the secondary structure that is assigned to the cysteine.
  • Residue i is considered to be part of an ⁇ -helix if the phi psi angles of residues i- , i, and i+l are about 300 ⁇ 30° and 315 ⁇ 30° respectively, and is considered to be part of a ⁇ -sheet if the phi psi angles of residues i-l, i, and i+l are about 240 ⁇ 30° and 120 ⁇ 30°.
  • a standard rotamer conformation for cysteine comprises a chil chi2 pair selected from the group consisting of about 180° and about 60°; about 180° and about 270°; and about 300° and about 300°. If residue is part of an ⁇ -helix, then a standard rotamer conformation for cysteine comprises a chil chi2 pair selected from the group consisting of about 180° and about 60°; about 180° and about 180°; about 180° and about 270°; and about 300° and about 300°.
  • the set of mutated TBM structures are evaluated based upon whether an unfavorable steric contact is made.
  • a residue is considered to be a suitable candidate for cysteine mutation if it can be substituted with at least one cysteine rotamer for which no unfavorable steric contact is made.
  • An unfavorable steric contact is defined as interatomic distances that are less than about 80% of the sum of the van der Waals radii of the participating atoms.
  • only the backbone atoms of the TBM are considered for the purposes of determining whether the rotamers make an unfavorable contact with the TBM.
  • the backbone atoms and Cp of the TBM are considered for the purposes of determining whether the rotamers make an unfavorable contact with the TBM.
  • the set of mutated TBM structures are evaluated based on a force field calculation.
  • Illustrative force field methods are described by, for example, Weiner, S. J. et al. J. Comput. Chem. 7: 230-252 (1986); Nemethy, G. et al. J. Phys. Chem. 96: 6472-6484 (1992); and Brooks, B.R. et al. J. Comput. Chem. 4: 187-217 (1983). All minimized conformations within about 10 kcal/mol or more preferably within about 5 kcal/mol, of the lowest-energy conformation are considered accessible.
  • each mutated TBM structure possesses a cysteine that is capped with a S- methyl group (side chain is -CH 2 SSCH 3 ) instead of residue / and wherein the capped cysteine residue is placed in a standard rotamer conformation for cysteine.
  • a residue is considered to be a suitable candidate for cysteine mutation if it can be substituted with at least one rotamer that places the methyl carbon of the S-methyl group closer to the site of interest than the Cp ,
  • cysteines In addition to adding one or more cysteines to a site of interest, it may be desirable to delete one or more naturally occurring cysteines (and replacing them with alanines for example) that are located outside of the site of interest. These mutants wherein one or more naturally occurring cysteines are deleted or "scrubbed" comprise another aspect of the present invention.
  • Various recombinant, chemical, synthesis and/or other techniques can be employed to modify a target such that it possesses a desired number of free thiol groups that are available for tethering. Such techniques include, for example, site-directed mutagenesis of the nucleic acid sequence encoding the target polypeptide such that it encodes a polypeptide with a different number of cysteine residues.
  • site-directed mutagenesis using polymerase chain reaction (PCR) amplification
  • PCR polymerase chain reaction
  • Other site-directed mutagenesis techniques are also well known in the art and are described, for example, in the following publications: Ausubel et al., supra, Chapter 8; Molecular Cloning: A Laboratory Manual., 2nd edition (Sambrook et al., 1989); Zoller et al, Methods Enzymol.
  • Cassette mutagenesis (Wells et al, Gene, 34:315 [1985]), and restriction selection mutagenesis (Wells et al, Philos. Trans. R. Soc. London SerA, 317:415 [1986]) may also be used.
  • Amino acid sequence variants with more than one amino acid substitution may be generated in one of several ways. If the amino acids are located close together in the polypeptide chain, they may be mutated simultaneously, using one oligonucleotide that codes for all of the desired amino acid substitutions. If, however, the amino acids are located some distance from one another (e.g. separated by more than ten amino acids), it is more difficult to generate a single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods may be employed. In the first method, a separate oligonucleotide is generated for each amino acid to be substituted.
  • the oligonucleotides are then annealed to the single-stranded template DNA simultaneously, and the second strand of DNA that is synthesized from the template will encode all of the desired amino acid substitutions.
  • the alternative method involves two or more rounds of mutagenesis to produce the desired mutant.
  • This example provides an illustrative computer algorithm written in FORTRAN for identifying disulfide pairs from the PDB that align with potential tethering mutants.
  • a stepwise description of the program and the source code are described below.
  • a user supplies the name of the PDB file for the template protein, the residues of the fragment to match, and the relative position of the cysteine within that fragment.
  • Preferred values are 1-2 residues N- and C-terminal to a potential mutant site. For example, if residue Glu 200 of PTP1B is a candidate residue, then the user would specify the fragment from residues 198 to 202 with the cysteine at relative position 3.
  • the program reads the template file, extracts the coordinates of the N,C ⁇ ,C,0 atoms for the template residues, and determines the values of ⁇ (C'-N-C ⁇ -C torsion) and ⁇ (N-C ⁇ -C-N') for each of the template residues
  • the program generates a "residue filter" based on the template ⁇ / ⁇ values.
  • This filter is used to identify contiguous segments of a test protein that have ⁇ / ⁇ values matching those of the template residues to within a coarse ( ⁇ 60°) tolerance.
  • the filter also requires that the fragment must contain a cysteine at the appropriate position.
  • the filter would identify 5-residue fragments of a test protein that roughly matched the backbone conformations of residues 198-202 of PTP1B and contained a cysteine in position 3.
  • the rest of the program operates iteratively on a user-supplied list of test proteins provided in a simple text file.
  • this file contains approx. 2500 culled PDB chains.
  • the program reads the coordinates, determines the sequence and ⁇ / ⁇ values for each residue, and identifies any contiguous chains that match the residue filter specified in step (3).
  • the program checks to see that the cysteine residue in this fragment is participating in a disulfide bond. This is done by simple distance-and angle-based searching from the S ⁇ atom. Fragments containing unpaired cysteines are rejected.
  • the N,C ⁇ ,C,0 atoms of the backbone are overlaid onto the corresponding atoms from the template molecule (e.g. 198-202 of PTP1B). If the backbone fits with an RMSD within a user-specified tolerance (typically 0.5-0.75 A), the overlaid coordinates of this fragment along with its disulfide-bound partner are written to a file in PDB format. A log file is maintained of each "hit", along with its RMSD value. The hits are viewed with a graphic program like Insight II or PyMOL.
  • AtomRec AtomRec .
  • AtomRec AtomRec
  • FragmentVecArray (iatom) AtomRec. ector end if end do end do c
  • AtomRec AtomRec
  • fragment_handle continue call rsm_translate_frame (fragment_handle, INTjDNE, t2) call rsm_rotate_frame (fragment_handle, INTJDNE, r2) call rsm_translate_frame (fragment__handle, INT_ONE, tl) call append_f agment (fragment_handle, full_structure_name, PDBout, .FALSE.) write (LOGout, ' (a22, lx, f5.2) ' ) full_structure_name, RMS_value if (returnTrajectory (fragment_handle) ) continue c 90 end do 100 if (returnTrajectory (data__handle) ) continue goto 50 999 close (LISTin) close (PDBout) close (LOGout) call exit end EXAMPLE 2 CLONING AND MUTAGENESIS OF HUMAN IL-2
  • Interleukin-2 (accession number SWS P01585) is a cytokine with a predominant role in the proliferation of activated T helper lymphocytes. Mitogenic stimuli or interaction of the T cell receptor complex with antigen MHC complexes on antigen presenting cells causes synthesis and secretion of IL-2 by the activated T cell, followed by clonal expansion of the antigen-specific cells. These effects are known as autocrine effects.
  • IL-2 can have paracrine effects on the growth and activity of B cells and natural killer (NK) cells. These outcomes are initiated by interaction of IL-2 with its receptor on the T cell surface.
  • Disruption of the IL-2/IL-2R interaction can suppress immune function, which has a number of clinical indications, including graft vs. host disease (GVHD), transplant rejection, and autoimmune disorders such as psoriasis, uveitis, rheumatoid arthritis, and multiple sclerosis.
  • GVHD graft vs. host disease
  • transplant rejection graft vs. host disease
  • autoimmune disorders such as psoriasis, uveitis, rheumatoid arthritis, and multiple sclerosis.
  • C125A mutant There is structural information available of the C125A mutant [3INK, Mc Kay, D. B. & Brandhuber, B. J., Science 257: 412 (1992)].
  • Numbering of the wild type and mutant IL-2 residues follows the convention of the first amino acid residue (A) of the mature protein being residue number 1 independent of any presequence e.g. met for the E. coli produced protein [see Taniguchi, T., et al., Nature 302: 305-310 (1983) and Devos, R., et al., Nucleic Acids Res. 11: 4307-4323 (1983)].
  • IL-2 human Interleukin-2
  • ATCC plasmid pTCGF-11
  • PCR primers were designed to contain restriction endonuclease sites Ndel and Xhol for subcloning into a pRSET expression vector (Invitrogen).
  • Double-stranded IL-2/pRSET was prepared by the following procedure.
  • the PCR product containing the IL-2 sequence and pRSET were both cut with restriction endonucleases (1 ⁇ l PCR product, 1 ⁇ l each endonuclease, 2 ⁇ M appropriate lOx buffer, 15 ⁇ l water; incubated at 37 C for 2 hours).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TAE buffer) and ligated together using T4 DNA ligase (80 ng IL-2 sequence, 160 ng pRSET vector, 4 ⁇ l 5X ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 80 ng IL-2 sequence, 160 ng pRSET vector, 4 ⁇ l 5X ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • 10 ⁇ l of the ligase reaction mixture was transformed into XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5X KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C for 20 minutes, 25 C for 10 minutes), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 5 ml 2YT media for 18 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit.
  • XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5X KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at
  • the single-stranded form of the IL-2/pRSET plasmid was prepared by transformation of double- stranded plasmid into the CJ236 cell line (1 ⁇ l IL-2/pRSET double-stranded DNA, 2 ⁇ l 2x KCM salts, 7 ⁇ l water, 10 ⁇ l PEG-DMSO competent CJ236 cells; incubated at 4 C for 20 minutes and 25 C for 10 minutes; plated on LB/agar with 100 ⁇ g/ml ampicillin and incubated at 37 C overnight).
  • Site-directed mutagenesis was accomplished as follows: Mutagenesis oligonucleotides were dissolved to a concentration of 10 OD and phosphorylated on the 5' end (2 ⁇ l oligonucleotide, 2 ⁇ l 10 mM ATP, 2 ⁇ l 10X Tris-magnesium chloride buffer, 1 ⁇ l 100 mM DTT, 10 ⁇ l water, 1 ⁇ l T4 PNK; incubate at 37 C for 45 minutes.).
  • Phosphorylated oligonucleotides were then annealed to single-stranded DNA template (2 ⁇ l single-stranded plasmid, 1 ⁇ l oligonucleotide, 1 ⁇ l lOx TM buffer, 6 ⁇ l water; heat at 94 C for 2 minutes, 50 C for 5 minutes, cool to room temperature).
  • Double-stranded DNA was then prepared from the annealed oligonucleotide/template (add 2 ⁇ l 10X TM buffer, 2 ⁇ l 2.5 mM dNTPs, 1 ⁇ l 100 mM DTT, 1.5 ⁇ l 10 mM ATP, 4 ⁇ l water, 0.4 ⁇ l T7 DNA polymerase, 0.6 ⁇ l T4 DNA ligase; incubate at room temperature for 2 hours).
  • coli (XL1 blue, Stratagene) was then transformed with the double-stranded DNA (1 ⁇ l double-stranded DNA, 10 ⁇ l 5x KCM, 40 ⁇ l water, 50 ⁇ l DMSO competent cells; incubate 20 minutes at 4 C, 10 minutes at room temperature), plated onto LB/agar containing 100 ⁇ g/ml ampicillin, and incubated at 37 C overnight. Approximately four colonies from each plate were used to inoculate 5 ml 2YT containing 100 ⁇ g/ml ampicillin; these cultures were grown at 37 C for 18-24 hours. Plasmids were then isolated from the cultures using Qiagen miniprep kit. These plasmids were sequenced to determine which IL-2/pRSET clones contained the desired mutation.
  • Mutant proteins were expressed as follows: IL-2/pRSET clones containing the mutation were transformed into BL21 DE3 pLysS cells (Invitrogen) (1 ⁇ l double-stranded DNA, 2 ⁇ l 5x KCM, 7 ⁇ l water, 10 ⁇ l DMSO competent cells; incubate 20 minutes at 4 C, 10 minutes at room temperature), plated onto LB/agar containing 100 ⁇ g/ml ampicillin, and incubated at 37 C overnight. 10 ml cultures in 10 ml 2YT with 100 ⁇ g/ml ampicillin were grown overnight from single colonies.
  • IL-2/pRSET clones containing the mutation were transformed into BL21 DE3 pLysS cells (Invitrogen) (1 ⁇ l double-stranded DNA, 2 ⁇ l 5x KCM, 7 ⁇ l water, 10 ⁇ l DMSO competent cells; incubate 20 minutes at 4 C, 10 minutes at room temperature), plated onto LB/agar containing 100
  • IL-2 mutants were then purified from the frozen cell pellets.
  • cells were lysed in a microfluidizer (100 ml Tris EDTA buffer, 3 passes through a Microfluidizer [Microfiuidics 110S]) and inclusion bodies were isolated by precipitation (10 Krpm, 10 minutes).
  • a microfluidizer 100 ml Tris EDTA buffer, 3 passes through a Microfluidizer [Microfiuidics 110S]
  • inclusion bodies were isolated by precipitation (10 Krpm, 10 minutes).
  • 50 ⁇ l of cell material was saved for analysis by SDS-PAGE. All mutants expressed as determined by gel but several (e.g. E68C) precipitated on refolding.
  • Inclusion bodies were then resuspended in 45 ml guanidine HCl and spun at 10 Krpm for 10 minutes.
  • the supernatant was added to refolding buffer (45 ml guanidine HCl, 36 ml Tris pH 8, 231 mg cysteamine, 46 mg cystamine, 234 ml water) and incubated at room temperature for 3-5 hours. The mixture was then spun at 10 Krpm for 20 minutes, and the supernatant dialyzed 4-5 times in 5 volumes of buffer (10 mM ammonium acetate pH 6, 25 mM NaCl). The protein solution was then filtered through cellulose and injected onto an S Sepharose fast flow column (2.5 cm diameter x 14 cm long) at 5 ml/min.
  • refolding buffer 45 ml guanidine HCl, 36 ml Tris pH 8, 231 mg cysteamine, 46 mg cystamine, 234 ml water
  • the protein was then eluted using a gradient of 0 - 75% Buffer B over 60 minutes (Buffer A: 25 mM NH 4 OAc, pH 6, 25 mM NaCl; Buffer B: 25 mM NH 4 OAc, pH 6, 1 M NaCl). Purified protein was then exchanged into the appropriate buffer for the TETHER assay (typically 100 mM Hepes, pH 7.4). Average yields were 0.5 to 4 mg/L culture.
  • IL-4 (accession number SWS P05112) is a cytokine that is critical for early immune response and allergic response; its interaction with the IL-4R is involved in the generation of Th2 cells. IL-4 recruits and activates B-cells that produce IgE (immunoglobulin E), eosinophils, and mast cells. These cells in turn tag and attack parasites in skin and in mucosal tissues and eject them from these tissues. The role of the IL-4/IL4R interaction in immune and allergic responses suggests that disruption of this interaction may alleviate such conditions as asthma, dermatitis, conjunctivitis, and rhinitis.
  • IL-4 residues Numbering of the wild type and mutant IL-4 residues follows the convention of the first amino acid residue (H) of the mature protein being residue number 1 independent of any presequence e.g. met for the E. coli produced protein [Yokota, T., et al., Proc. Natl. Acad. Sci. U. S. A. 83: 5894-5898 (1986)].
  • IL-4 lacking the secretion signal and containing an additional N- terminal methionine was expressed intracellularly in E. coli from the Sunesis RSET.IL4 plasmid.
  • IL4 human interleukin-4
  • primers correspond to extracellular domain of the protein and which were designed to contain restriction endonuclease sites Nde I and Xhol for subcloning into a pRSET vector (Invitrogen).
  • the PCR reaction was purified on a Qiaquick PCR purification column (Qiagen).
  • the PCR product containing the IL4 sequence was cut with restriction endonucleases (41 ⁇ l PCR product, 2 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 90 minutes).
  • the pRSET vector was cut with restriction endonucleases (6 ⁇ g DNA, 4 ⁇ l each endonuclease, 10 ⁇ l appropriate lOx buffer, water to 100 ⁇ l; incubated at 37 C for 2 hours; add 2 ⁇ l CIP and incubated at 37 C for 45 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng pRSET vector, 150 ng IL4 PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 200 ng pRSET vector, 150 ng IL4 PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • 10 ⁇ l of the ligation reaction was transformed into XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C for 20 minutes, 25 C for 10 minutes), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 3 ml 2YT media for 18 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit. Generation of IL-4 Cysteine Mutations
  • BL21 DE3 cells (Stratagene) were transformed with RSET.IL4 plasmids containing the described cysteine mutations and plated onto LB agar containing 100 ⁇ g/ml ampicillin. After overnight growth fresh individual colonies were used to inoculate a 37 C overnight shake flask culture with 30 ml 2YT (with 50 ⁇ g/ml ampicillin) media. In the morning this overnight culture was used to inoculate 1.5 L of 2YT/ampicillin (50 ⁇ g/ml), which was further cultured at 37 C and 200 rpm in a 4.0 L dented bottom shake flask.
  • the cell pellet was then thawed and resuspended in 100 ml of 10 mM Tris pH 8, 50 mM NaCl and 1 mM EDTA. This solution was kept chilled and run through a microfluidizer twice (model 110S Microfluidics Corp, Newton Massachusetts), and centrifuged at 7K rpm for 15 minutes).
  • the pellet containing the IL-4 inclusion bodies was then resuspended in a 50 ml solution of 5 M guanidine HCl, 50 mM Tris pH 8, 50 mM NaCl, 2.5 mM reduced glutathione, and 0.25 mM oxidized glutathione, and incubated for one hour at room temperature with gentle mixing.
  • the solubilized protein solution was then centrifuged at 7.5K rpm for 15 minutes and the supernatant 0.45 ⁇ m filtered to remove insoluble debris.
  • the IL-4 was refolded by slowly adding the filtered solution to 9 volumes (450 ml) of 50 mM Tris pH 8, 50 mM NaCl, 2.5 mM reduced glutathione and 0.25 mM oxidized glutathione over a 30 minute period. The resulting solution was further incubated with slow stirring for 3 hours at room temperature, then placed in a 3000 mwco dialysis bag and exchanged 3 times against 20 L of 0.5x PBS (phosphate-buffered saline).
  • 0.5x PBS phosphate-buffered saline
  • the refolded mutant proteins were then purified using a Hi-S Column Cartridge (Bio-Rad). After clarifying the protein solution by centrifugation and filtration it was loaded onto the column at a 5 ml/min flow rate. The column was next washed with buffer A (0.5x PBS) for 15-20 minutes, and 1.5 minute 7.5 ml fractions were collected over a 0-100% gradient between Buffer A and Buffer B (PBS, 1M NaCl). The fractions that contained the IL-4 protein as determined by SDS-PAGE and optical density as 280 nm were pooled, concentrated with a 5K mwco filter, and their buffer exchanged to PBS. This solution was then 0.2 ⁇ m filtered, frozen in ethanol dry ice bath, and stored at -80 C.
  • buffer A 0.5x PBS
  • Buffer B Buffer B
  • TNF- Tumor necrosis factor- ⁇ (TNF- ⁇ ) (accession number SWS P01375) is a cytokine produced mainly by activated macrophages, and it plays a critical role in immune responses including septic shock, inflammation, and cachexia. This protein can interact with two receptors, TNF RI and TNF R2. These two receptors share no similarity in their intracellular domains, which suggests that they are involved in different signal transduction pathways. A structure of TNF- ⁇ is available [1TNF, Eck, M.
  • TNF- ⁇ is an elongated beta sheet, and it forms a trimer. Mutation of some of the intersubunit residues of the trimer indicates that they form part of the binding site to the receptor. However, there is no structure of TNF bound to a receptor to date.
  • TNF Tumor Necrosis Factor
  • the PCR reaction was purified on a Qiaquick PCR purification column (Qiagen).
  • the PCR product containing the TNF sequence was cut with restriction endonucleases (41 ⁇ l PCR product, 2 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 90 minutes).
  • the pRSET vector was cut with restriction endonucleases (6 ⁇ g DNA, 4 ⁇ l each endonuclease, 10 ⁇ l appropriate lOx buffer, water to 100 ⁇ l; incubated at 37 C for 2 hours; added 2 ⁇ l CIP and incubated at 37 C for 45 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng pRSET vector, 150 ng TNF PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 200 ng pRSET vector, 150 ng TNF PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • DNA oligonucleotides used are shown below and were designed to hybridize with sense strand DNA from plasmid. Sequences of the mutants were verified using primers with SEQ ID NO:17 and SEQ ID NO:18.
  • BL21 DE3 cells (Stratagene) were transformed with RSET TNF- ⁇ plasmids containing the described cysteine mutations and plated onto LB agar containing 100 ⁇ g/ml ampicillin. After overnight growth fresh individual colonies were used to inoculate a 37 C overnight shake flask culture with 30 ml 2YT (with 50 ⁇ g/ml ampicillin) media. In the morning this overnight culture was used to inoculate 1.5 L of 2YT/am ⁇ icillin (50 ⁇ g/ml), which was further cultured at 37 C and 200 rpm in a 4.0 L dented bottom shake flask.
  • the cell pellet was then thawed and resuspended in 100 ml of 25 mM ammonium acetate pH 6, 1 mM DTT and 1 mM EDTA. This solution was kept chilled and run through a microfluidizer twice (model 110S Microfluidics Corp, Newton Massachusetts), centrifuged at 9K rpm for 15 minutes to remove insoluble material and further clarified by 0.45 ⁇ m filtration. This solution was then loaded onto an S-Sepharose ff Column (Bio-Rad) column at a 5 ml/min flow rate. The flow rate was then increased to 7.5 mL/min for the following steps.
  • the column was next washed with Buffer A (0.2 M ammonium acetate pH 6, 1 mM DTT) until the OD 28 o approached zero (15-20 minutes), and fractions were collected over a 0-100% gradient in 60 minutes between Buffer A and Buffer B (1 M ammonium acetate pH 6, 1 mM DTT).
  • Buffer A 0.2 M ammonium acetate pH 6, 1 mM DTT
  • Buffer B 1 M ammonium acetate pH 6, 1 mM DTT
  • the fractions that contained the TNF- ⁇ protein as determined by SDS-PAGE and optical density at 280 nm were pooled and placed in a 3000 mwco dialysis bag and dialyzed overnight at 4 C against 4 L of 10 mM Tris pH 7.5, 10 mM NaCl, and 1 mM DTT.
  • the dialyzed protein solution was then clarified by centrifuging at 13.5K rpm for 10 minutes filtering through a 0.2 ⁇ m filter.
  • the mutant proteins were then loaded onto a Q-Sepharose Column (Bio-Rad) at a 5 ml/min flow rate. The flow rate was increased to 7.5 mL/min for the following steps. The column was next washed with Buffer A (10 mM Tris pH 7.5, 10 mM NaCl, 1 mM DTT) until the OD 280 approached zero (15-20 minutes), and fractions were collected over a 0-100% gradient in 40 minutes between Buffer A and Buffer B (10 mM Tris pH 7.5, 0.5 M NaCl, 1 mM DTT).
  • Buffer A 10 mM Tris pH 7.5, 10 mM NaCl, 1 mM DTT
  • the fractions that contained the TNF- ⁇ protein as determined by SDS-PAGE and optical density at 280 nm were pooled and concentrated with a 5K mwco filter, and their buffer exchanged to PBS. This solution was then 0.2 ⁇ m filtered, frozen in ethanol dry ice bath, and stored at -80 C.
  • IL-lra a natural IL-IR antagonist that functions by binding IL-1R1 and thereby blocking IL-1R1 binding of IL-lalpha and IL-lbeta. Inhibition of these interactions with an orally available small molecule would be desirable in treatment of diseases such as rheumatoid arthritis, autoimmune disorders, and ischemia.
  • Two structures of IL-IR have been solved [with a antagonist peptide, 1G0Y, Vigers, G. P. A., et al., J. Biol Chem. 275:36927- 36933 (2000); with receptor antagonist, URA, Schreuder, H., et al., Nature 386: 194-200 (1997)].
  • the IL-1 receptor has three regions: an N-terminal extracellular region, a transmembrane region, and a C-terminal cytoplasmic region.
  • the extracellular region itself contains three immunoglobin- like C2-type domains.
  • the constructs used here contain the two N-terminal domains of the extracellular region.
  • Numbering of the wild type and mutant IL1R residues follows the convention of the first amino acid residue (L) of the mature protein being residue number 1 after processing of the signal sequence [Sims, J. E., et al., Proc. Natl. Acad. Sci. U. S. A. 86: 8946-8950 (1989)].
  • the sequence of the 2 domain protein is shown below as SEQ ID NO:62.
  • cysteine mutants were made in the context of a 2 domain receptor and a 2 domain receptor with a his tag.
  • the constructs possessed a mutation at a glycosylation site, and one construct possessed a mutation at a glycosylation site in addition to a deletion at the C-terminal residue of the 2 domain region. The assembly of these constructs is described below.
  • IL1R human Interleukin- 1 receptor
  • the pFBHT vector is modified from the original pFastBacl(Gibco/BRL) by cloning the sequence for TEV protease followed by (His) 6 tag and a stop signal into the Xhol and HinDIII sites.
  • the PCR product containing the IL1R sequence was cut with restriction endonucleases (41 ⁇ l PCR product, 2 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 90 minutes).
  • the pFBHT vector was cut with restriction endonucleases (6 ⁇ g DNA, 4 ⁇ l each endonuclease, 10 ⁇ l appropriate lOx buffer, water to 100 ⁇ l; incubated at 37 C for 2 hours; add 2 ⁇ l CIP and incubated at 37 C for 45 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng pFBHT vector, 150 ng IL1R PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 200 ng pFBHT vector, 150 ng IL1R PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • 10 ⁇ l of the ligation reaction was transformed into XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C for 20 minutes, 25 C for 10 minutes), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 3 ml 2YT media for 18 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit.
  • XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C
  • IL1R A 2-domain version of IL1R was created by PCR using the 3-domain IL1R-FBHT clone as a template. PCR was performed using the primers ILlRsigFor (SEQ ID NO:65) corresponding to the signal sequence, in addition to one of the following two reverse primers.
  • the reverse primers are ILlR2Drevstop-Xho, which corresponds to the end of the second extracellular domain of the protein with a stop signal, and ILlR2Drev-Xho, which corresponds to the end of the second extracellular domain of the protein without a stop signal to create a fusion with the TEV protease site and the His tag.
  • the PCR primers contain restrictions sites (EcoRI at the 5 'end and Xhol at the 3' end), which were used to ligate the 2-domain version into the pFBHT vector.
  • the PCR product containing the IL1R2D sequence was cut with restriction endonucleases (41 ⁇ l PCR product, 2 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 90 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng pFBHT vector, 150 ng IL1R2D PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 200 ng pFBHT vector, 150 ng IL1R2D PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • 10 ⁇ l of the ligation reaction was transformed into XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C for 20 minutes, 25 C for 10 minutes), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 3 ml 2YT media for 18 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit.
  • XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C
  • the two glycosylation sites within IL1R2D, N83 and N176 were each individually mutated to a histidine, in order to make a more homogeneous protein.
  • Each of these single mutants were made in the context of the 2-domain protein without a his tag (sILlRd2-FB) and the 2-domain protein with a his tag (sILlRd2-FBHT).
  • Mutation was accomplished by PCR using two sets of primers to make two fragments, followed by stitching together of the fragments using the outside primers ILlRsigFor (SEQ ID NO:65) and either ILlR2Drevstop-Xho (SEQ ID NO:67) or ILlR2Drev-Xho (SEQ ID NO:68) as described below. Brief descriptions of the 2-domain glycosylation mutants and their construction follow.
  • the construct for the N83H mutant without a his tag is referred to as SIL1R2D-N83H-FB, and it was created using ILlRsigFor (SEQ ID NO:65) and N83HR (SEQ ID NO:69) along with N83HF (SEQ ID NO:70), and ILlR2Drevstop-Xho (SEQ ID NO:67) N83HR GAGGCAGTAAGATGAATGTCTTACC SEQ ID NO:69
  • the construct for the N83H mutant with a his tag is referred to as sILlR2D-N83H-FBHT and was created using ILlRsigFor (SEQ ID NO:65), and N83HR (SEQ ID NO:69) along with N83HF (SEQ ID NO:70) and ILlR2Drev-Xho (SEQ ID NO:68).
  • the construct for the N176H mutant without a his tag is referred to as sILlR2D-N176H-FB and it was created using ILlRsigFor (SEQ ID NO:65), N176HR (SEQ ID NO:71), N176HF (SEQ ID NO:72), and ILlR2Drevstop-Xho (SEQ ID NO:67).
  • the construct for the N176H mutant with a his tag is referred to as sILlR2D-N176H-FBHT.and it was created using ILlRsigFor (SEQ ID NO:65), and N176HR (SEQ ID NO:71), along with N176HF (SEQ ID NO:72), and ILlR2Drev-Xho (SEQ ID NO:68).
  • the PCR products were isolated from and agarose gel and PCR was used to sew the two fragments together using the ILlRsigFor (SEQ ID NO:65) and ILlR2Drevstop-Xho (SEQ ID NO:67) or ILlR2Drev-Xho primers (SEQ ID NO:68).
  • the PCR products containing the IL1R2D sequences mutated at the glycosylation site were cut with restriction endonucleases (41 ⁇ l PCR product, 2 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 90 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng pFBHT vector, 150 ng IL1R2D PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • T4 DNA ligase 200 ng pFBHT vector, 150 ng IL1R2D PCR product, 4 ⁇ l 5x ligase buffer [300 mM Tris pH 7.5, 50 mM MgCl 2 , 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 ⁇ l ligase; incubated at 15 C for 1 hour).
  • 10 ⁇ l of the ligation reaction was transformed into XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C for 20 minutes, 25 C for 10 minutes), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 3 ml 2YT media for 18 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit.
  • XL1 blue cells (Stratagene) (10 ⁇ l reaction mixture, 10 ⁇ l 5x KCM [0.5 M KC1, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water, 50 ⁇ l PEG-DMSO competent cells; incubated at 4 C
  • the subsequent plasmids are referred to as SIL1R2D-N83H-FB or SIL1R2D-N83H-FBHT and as SIL1R2D-N176H-FB or as sILlR2D-N176H-FBHT.
  • an additional construct was made using the sILlR2D-N83H-FB construct.
  • the additional construct contains the 2-domain IL1R receptor without a his tag and with two mutations: a N83H glycosylation mutation and a deletion of the C-terminal residue (K205). This construct is named sILlR2D2M-FB, and was made using the K205del oligonucleotide.
  • the single-stranded form of the IL1R2D (sILlR2D-FBHT, sILlR2D-N176H-FB/FBHT, sILlR2D- N83H-FB/FBHT, sILlR2D2M-FB) plasmid was prepared by transformation of double-stranded plasmid into the CJ236 cell line (1 ⁇ l IL1R-FB double-stranded DNA, 2 ⁇ l 2x KCM salts, 7 ⁇ l water, 10 ⁇ l PEG-DMSO competent CJ236 cells; incubated at 4 C for 20 minutes and 25 C for 10 minutes; plated on LB/agar with 100 ⁇ g/ml ampicillin and incubated at 37 C overnight).
  • Single colonies of CJ236 cells were then grown in 50 ml 2YT media to midlog phase; 10 ⁇ l VCS helper phage (Stratagene) were then added and the mixture incubated at 37 C overnight.
  • Single-stranded DNA was isolated from the supernatant by precipitation of phage (1/5 volume 20% PEG 8000/2.5 M NaCl; centrifuge at 12K for 15 minutes.).
  • Single-stranded DNA was then isolated from phage using Qiagen single-stranded DNA kit.
  • Site-directed mutagenesis was accomplished as follows. Oligonucleotides were dissolved to a concentration of 10 OD and phosphorylated on the 5' end (2 ⁇ l oligonucleotide, 2 ⁇ l 10 mM ATP, 2 ⁇ l lOx Tris-magnesium chloride buffer, 1 ⁇ l 100 mM DTT, 10 ⁇ l water, 1 ⁇ l T4 PNK; incubate at 37 C for 45 minutes).
  • Phosphorylated oligonucleotides were then annealed to single-stranded DNA template (2 ⁇ l single-stranded plasmid, 1 ⁇ l oligonucleotide, 1 ⁇ l lOx TM buffer, 6 ⁇ l water; heat at 94 C for 2 minutes, 50 C for 5 minutes, cool to room temperature).
  • Double-stranded DNA was then prepared from the annealed oligonucleotide/template (add 2 ⁇ l lOx TM buffer, 2 ⁇ l 2.5 M dNTPs, 1 ⁇ l 100 mM DTT, 1.5 ⁇ l 10 mM ATP, 4 ⁇ l water, 0.4 ⁇ l T7 DNA polymerase, 0.6 ⁇ l T4 DNA ligase; incubate at room temperature for two hours).
  • coli (XLl blue, Stratagene) was then transformed with the double-stranded DNA (1 ⁇ l double-stranded DNA, 10 ⁇ l 5x KCM, 40 ⁇ l water, 50 ⁇ l DMSO competent cells; incubate 20 minutes at 4 C, 10 minutes at room temperature), plated onto LB/agar containing 100 ⁇ g/ml ampicillin, and incubated at 37 C overnight. Approximately four colonies from each plate were used to inoculate 5 ml 2YT containing 100 ⁇ g/ml ampicillin; these cultures were grown at 37 C for 18-24 hours. Plasmids were then isolated from the cultures using Qiagen miniprep kit. These plasmids were sequenced to determine which IL1R2D-FB clones contained the desired mutation.
  • Sequencing of IL1R2D genes was accomplished as follows. The concentration of plasmid DNA was quantitated by absorbance at 280 nm. 800 ng of plasmid was mixed with sequencing reagents (8 ⁇ l DNA, 3 ⁇ l water, 1 ⁇ l sequencing primer, 8 ⁇ l sequencing mixture with Big Dye [Applied Biosystems]). The sequencing primers used were FB Forward and FB Reverse, shown below.
  • the mixture was then run through a PCR cycle (96 C, 10 s; 50 C, 5 s; 60 C 4 minutes; 25 cycles) and the DNA reaction products were precipitated (20 ⁇ l mixture, 80 ⁇ l 75% isopropanol; incubated 20 minutes at room temperature, pelleted at 14 K rpm for 20 minutes; wash with 250 ⁇ l 70% ethanol; heat 1 minute at 94 C).
  • the precipitated products were then suspended in Template Suppression Buffer (TSB, Applied Biosystems) and the sequence read and analyzed by an Applied Biosystems 310 capillary gel sequencer.
  • TTB Template Suppression Buffer
  • 3 out of 4 of the plasmids contained the desired mutation.
  • a listing of the constructs and their mutant(s) is given below, although any cysteine mutants can be made in any of the given contexts.
  • SIL1R2D-N83H-FB El IC I13C, V16C, Q108C, 1110C, Kl 12C, Kl 14C, VI 17C, V124C, Y127C, E129C
  • SIL1R2D-N83H-FBHT El IC I13C, V16C, Q108C, 1110C, Kl 12C, Ql 13C, Kl 14C, V117C, V124C, Y127C, E129C
  • SIL1R2D2M-FB E11C, K12C, I13C, A107C, K112C, V124C, Y127.
  • IL1R-FB/FBHT plasmids were site-specifically transposed into the baculovirus shuttle vector (bacmid) by transforming the plasmids into DHlObac (Gibco/BRL) competent cells as follows: 1 ⁇ l DNA at 5 ng/ ⁇ l, 10 ⁇ l 5x KCM [0.5 M KCl, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water was mixed with 50 ⁇ l PEG-DMSO competent cells, incubated at 4 C for 20 minutes, 25 C for 10 minutes, add 900 ⁇ l SOC and incubate at 37 C with shaking for 4 hours, then plated onto LB/agar plates containing 50 ⁇ g/ml kanamycin, 7 ⁇ g/ml gentamycin, 10 ⁇ g/ml tetracycline, 100 ⁇ g/ml Bluo-gal, 10 ⁇ g/ml IPTG.
  • pellet was resuspended in 250 ⁇ l of Solution 1 [15 mM Tris- HC1 (pH 8.0), 10 mM EDTA, 100 ⁇ g/ml RNase A].
  • 250 ⁇ l of Solution 2 [0.2 N NaOH, 1% SDS] was added, mixed gently and incubated at room temperature for 5 minutes.
  • 250 ⁇ l 3 M potassium acetate was added and mixed, and the tube placed on ice for 10 minutes.
  • the mixture was centrifuged 10 minutes at 14,000x g and the supernatant transferred to a tube containing 0.8 ml isopropanol.
  • the contents of the tube were mixed and placed on ice for 10 minutes; centrifuged 15 minutes at 14,000x g.
  • the pellet was washed with 70% ethanol and air-dried and the DNA resuspended in 40 ⁇ l TE.
  • the bacmid DNA was used to transfect Sf9 cells.
  • Sf9 cells were seeded at 9 x 10 5 cells per 35 mm well in 2 ml of Sf-900 II SFM medium containing 0.5x concentration of antibiotic-antimycotic and allowed to attach at 27 C for 1 hour.
  • 5 ⁇ l of bacmid DNA was diluted into 100 ⁇ l of medium without antibiotics
  • 6 ⁇ l of CellFECTIN reagent was diluted into 100 ⁇ l of medium without antibiotics and then the 2 solutions were mixed gently and allowed to incubate for 30 minutes at room temperature.
  • the cells were washed once with medium without antibiotics, the medium was aspirated and then 0.8 ml of medium was added to the lipid-DNA complex and overlaid onto the cells.
  • the cells were incubated for 5 hours at 27 C, the transfection medium was removed and 2 ml of medium with antibiotics was added.
  • the cells were incubated for 72 hours at 27 C and the virus was harvested from the cell culture medium.
  • the virus was amplified by adding 0.5 ml of virus to a 50 ml culture of Sf9 cells at 2 x 10 6 cells/ml and incubating at 27 C for 72 hours.
  • the virus was harvested from the cell culture medium and this stock was used to express the various ILIR constructs in High-Five cells.
  • a I L culture of High-Five cells at 1 x 10 6 cells/ml was infected with virus at an approximate MOI of 2 and incubated for 72 hours. Cells were pelleted by centrifugation and the supernatant was loaded onto an ILIR antagonist column at 1 ml/min, washed with PBS followed by a wash with Buffer A (0.2 M NaOAc pH 5.0, 0.2 M NaCl).
  • the protein was eluted from the column by running a gradient from 0-100% of Buffer B (0.2 M NaOAc pH 2.5, 0.2 M NaCl) in 10 minutes followed by 15 minutes of 100% Buffer B at 1 ml/min collecting 2 ml fractions in tubes containing 300 ⁇ l of unbuffered Tris. The appropriate fractions were pooled, concentrated and dialyzed against 5 L of 50 mM Tris pH 8.0, 100 mM NaCl at 4 C and filtered through a 0.2 ⁇ m filter.
  • Buffer B 0.2 M NaOAc pH 2.5, 0.2 M NaCl
  • Caspase-3 (accession number SWS P42574) is one of a series of caspases involved in the apoptosis of cells. It exists as the inactive proform, and can be processed by caspases 8, 9, or 10 to form a small subunit and a large subunit, which heterodimerize to constitute the active form.
  • Caspases that are substrates for caspase-3 in the cascade are caspase-6, caspase-7 and caspase-9.
  • Caspase-3 has been shown to be the important for the cleavage of amyloid-beta precursor protein 4A.
  • caspase-3 also known as Yama, CPP32 beta
  • human version of caspase-3 was cloned directly from Jurkat cells (Clone E6-1; ATCC). Briefly, total RNA was purified from Jurkat cells growing at 37 C/5% C0 2 using Tri-Reagent (Sigma). Oligonucleotide primers were designed to allow DNA encoding the large and small subunits of Caspase-3/Yama/CPP32 to be amplified by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • DNA encoding amino acids 28-175 (encompassing most of the large subunit) was directly amplified from 1 ⁇ g total RNA using Ready-To-Go-PCR Beads (Amersham/Pharmacia) and the following oligonucleotides:
  • DNA encoding amino acids 176-277 (encompassing most of the small subunit) was directly amplified from 1 ⁇ g total RNA using Ready-To-Go-PCR Beads (Amersham/Pharmacia) and the following oligonucleotides:
  • Amplified DNA corresponding to either the large subunit or the small subunit of caspase-3 was then cleaved with the restriction enzymes EcoRI and Ndel and directly cloned using standard molecular biology techniques into pRSET-b (Invitrogen) digested with EcoRI and Ndel.
  • pRSET-b Invitrogen digested with EcoRI and Ndel.
  • a 1.5 mL sample of each culture was removed and infected with 10 ⁇ L of phage VCS-M13 (Stratagene), shaken at 37 C for 60 minutes, and an overnight culture of each was prepared with 1 mL of the infected culture diluted 1:100 in 2YT with 100 ⁇ g/mL of ampicillin and 20 ⁇ g/ml of chloramphenicol and grown at 37 C. Cells were centrifuged at 3000 rcf for 10 minutes and 1/5 volume of 20%PEG/2.5 M NaCl was added to the supernatant. Samples were incubated at room temperature for 10 minutes and then centrifuged at 4000 rcf for 15 minutes.
  • the phage pellet was resuspended in PBS and spun at 15 K rpm for 10 minutes to remove remaining particulate matter. Supernatant was retained, and single stranded DNA was purified from the supernatant following procedures for the QIA prep spin Ml 3 kit (Qiagen).
  • each primer was phosphorylated by incubating at 37 C for 60 minutes in buffer containing IX TM Buffer (0.5 M Tris pH 7.5, 0.1 M MgCl 2 ), 1 mM ATP, 5 mM DTT, and 5U T4 Kinase (NEB).
  • IX TM Buffer 0.5 M Tris pH 7.5, 0.1 M MgCl 2
  • 1 mM ATP 1 mM ATP
  • 5 mM DTT 5U T4 Kinase
  • NEB 5U T4 Kinase
  • Denatured subunits were rapidly and evenly diluted to 100 ⁇ g/mL in renaturation buffer (100 mM Tris/KOH (pH 8.0), 10% sucrose, 0.1% CHAPS, 0.15 M NaCl, and 10 mM DTT) and allowed to renature by incubation at room temperature for 60 minutes with slow stirring.
  • renaturation buffer 100 mM Tris/KOH (pH 8.0), 10% sucrose, 0.1% CHAPS, 0.15 M NaCl, and 10 mM DTT
  • Renatured proteins were dialyzed overnight in buffer containing 10 mM Tris (pH 8.5), 10 mM DTT, and 0.1 mM EDTA. Precipitate was removed by centrifuging at 9K rpm for 15 minutes and filtering the supernatant through a 0.22 ⁇ m cellulose nitrate filter. The supernatant was then loaded onto an anion-exchange column (Uno5 Q-Column (BioRad)), and correctly folded caspase-3 protein was eluted with a 0-0.25 M NaCl gradient at 3 mL/min. Aliquots of each fraction were electrophoresed on a denaturing polyacrylamide gel and fractions containing Caspase-3 protein were pooled.
  • PTP-IB (accession number SWS PI 8031) is a tyrosine phosphatase that has a C-terminal domain that is associated to the endoplasmic reticulum (ER) and a phosphatase domain that faces the cytoplasm.
  • the proteins that it dephosphorylates are transported to this location by vesicles.
  • the activity of PTP-IB is regulated by phosphorylation on serine and protein degradation.
  • PTP-lB is a negative regulator of insulin signaling, and plays a role in the cellular response to interferon stimulation.
  • This phosphatase may play a role in obesity by decreasing the sensitivity of organisms to leptin, thereby increasing appetite. Additionally, PTP-IB plays a role in the control of cell growth. A crystal structure has been solved for PTP-IB [1PTY, Puius, Y. A., et al., Proc Natl Acad Sci USA 94: 13420-13425 (1997)].
  • human PTP-IB Full length human PTP-IB is 435 amino acids in length; the protease domain comprises the first 288 amino acids. Because truncated portions of PTP-IB comprising the protease domain is fully active, various truncated versions of PTP-IB are often used.
  • a cDNA encoding the first 321 amino acids of human PTP-IB was isolated from human fetal heart total RNA (Clontech).
  • Oligonucleotide primers corresponding to nucleotides 91 to 114 (For) and complementary to nucleotides 1030 to 1053 (Rev) of the PTP-IB cDNA [Genbank M31724.1, Chernoff, J., et al., Proc. Natl. Acad. Sci. U. S. A. 87: 2735-2739 (1990)] were synthesized and used to generate a DNA using the polymerase chain reaction.
  • the primer Forward incorporates an Ndel restriction site at the first ATG codon and the primer Rev inserts a UAA stop codon followed by an EcoRI restriction site after nucleotide 1053.
  • cDNAs were digested with restriction nucleases Ndel and EcoRI and cloned into pRSETc (Invitrogen) using standard molecular biology techniques. The identity of the isolated cDNA was verified by DNA sequence analysis (methodology is outlined in a later paragraph).
  • a shorter cDNA, PTP-IB 298, encoding amino acid residues 1-298 was generated using oligonuclotide primers Forward and Rev2 and the clone described above as a template in a polymerase chain reaction.
  • Oligonucleotides were designed to contain the desired mutations and 12 bases of flanking sequence on each side of the mutation.
  • the single-stranded form of the PTP-lB/pRSET, PTP-IB 298/pRSET and PTP-IB 298-2M/pRSET plasmid was prepared by transformation of double-stranded plasmid into the CJ236 cell line (1 ⁇ l double-stranded plasmid DNA, 2 ⁇ l 5x KCM salts, 7 ⁇ l water, 10 ⁇ l PEG-DMSO competent CJ236 cells; incubated on ice for 20 minutes followed by 25 C for 10 minutes; plated on LB/agar with 100 ⁇ g/ml ampicillin and incubated at 37 C overnight).
  • Single colonies of CJ236 cells were then grown in 100 ml 2YT media to midlog phase; 5 ⁇ l VCS helper phage (Stratagene) were then added and the mixture incubated at 37 C overnight.
  • Single-stranded DNA was isolated from the supernatant by precipitation of phage (1/5 volume 20% PEG 8000/2.5M NaCl; centrifuge at 12K for 15 minutes).
  • Single-stranded DNA was then isolated from phage using Qiagen single-stranded DNA kit.
  • Site-directed mutagenesis was accomplished as follows. Oligonucleotides were dissolved in TE (10 mM Tris pH 8.0, ImM EDTA) to a concentration of 10 OD and phosphorylated on the 5' end (2 ⁇ l oligonucleotide, 2 ⁇ l 10 mM ATP, 2 ⁇ l lOx Tris-magnesium chloride buffer, 1 ⁇ l 100 mM DTT, 12.5 ⁇ l water, 0.5 ⁇ l T4 PNK; incubate at 37 C for 30 minutes).
  • Phosphorylated oligonucleotides were then annealed to single-stranded DNA template (2 ⁇ l single-stranded plasmid, 0.6 ⁇ l oligonucleotide, 6.4 ⁇ l water; heat at 94 C for 2 minutes, slow cool to room temperature).
  • Double- stranded DNA was then prepared from the annealed oligonucleotide/template (add 2 ⁇ l lOx TM buffer, 2 ⁇ l 2.5 mM dNTPs, 1 ⁇ l 100 mM DTT, 0.5 ⁇ l 10 mM ATP, 4.6 ⁇ l water, 0.4 ⁇ l T7 DNA polymerase, 0.2 ⁇ l T4 DNA ligase; incubate at room temperature for two hours).
  • coli (XLl blue, Stratagene) were then transformed with the double-stranded DNA (5 ⁇ l double-stranded DNA, 5 ⁇ l 5x KCM, 15 ⁇ l water, 25 ⁇ l PEG-DMSO competent cells; incubate 20 minutes on ice, 10 min. at room temperature), plated onto LB/agar containing 100 ⁇ g/ml ampicillin, and incubated at 37 C overnight. Approximately four colonies from each plate were used to inoculate 5 ml 2YT containing 100 ⁇ g/ml ampicillin; these cultures were grown at 37 C for 18-24 hours. Plasmids were then isolated from the cultures using Qiagen miniprep kit. These plasmids were sequenced to determine which clones contained the desired mutation.
  • any of the site-directed mutants may be made in any construct of PTP-IB.
  • another construct is another truncated version of PTP-IB having residues 1-382, shown as SEQ ID NO: 109 below.
  • cysteines Besides mutations to cysteines, mutations removing naturally occurring cysteines can also be made. For example, two different "scrubs" of Cys 215 were made in the PTP-IB 298-2M context using the following oligonucleotides:
  • two quadruple mutants were made using the C92A oligonucleotide shown below. They are C32S, C92A, V287C, C215A, which used SEQ ID NO: 107 SEQ ID NO: 140 SEQ ID NO: 137 and SEQ ID NO:138 and C32S, C92A, E276C, C215A, which used SEQ ID NO: 107, SEQ ID NO:140 SEQ ID NO:135 and SEQ ID NO: 138.
  • Sequencing of PTP-IB clones was accomplished as follows. The concentration of plasmid DNA was quantitated by absorbance at 280 nm. 1000 ng of plasmid was mixed with sequencing reagents (1 ⁇ g DNA, 6 ⁇ l water, 1 ⁇ l sequencing primer at 3.2 pm/ ⁇ l, 8 ⁇ l sequencing mixture with Big Dye [Applied Biosystems]). The sequencing primers are SEQ ID NO: 17 and SEQ ID NO: 18.
  • the mixture was then run through a PCR cycle (96 C, 10 s; 50 C, 5 s; 60 C 4 minutes; 25 cycles) and the DNA reaction products were precipitated (20 ⁇ l mixture, 80 ⁇ l 75% isopropanol; incubated 20 minutes at room temperature then pelleted at 14 K rpm for 20 minutes; wash with 250 ⁇ l 75% isopropanol; heat 1 minute at 94 C).
  • the precipitated products were then resuspended in 20 ⁇ l TSB (Applied Biosystems) and the sequence read and analyzed by an Applied Biosystems 310 capillary gel sequencer. In general, 1/4 of the plasmids contained the desired mutation.
  • PTP-IB Mutant proteins were expressed as follows. PTP-IB clones were transformed into BL21 codon plus cells (Stratagene) (1 ⁇ l double-stranded DNA, 2 ⁇ l 5x KCM, 7 ⁇ l water, 10 ⁇ l DMSO competent cells; incubate 20 minutes at 4 C, 10 minutes at room temperature), plated onto LB/agar containing 100 ⁇ g/ml ampicillin, and incubated at 37 C overnight. 2 single colonies were picked off the plates or from frozen glycerol stocks of these mutants and inoculated in 100 ml 2YT with 50 ⁇ g/ml carbenicillin and grown overnight at 37 C.
  • PTP-IB proteins were purified from the frozen cell pellets as described in the following. First, cells were lysed in a microfluidizer in 100 ml of buffer containing 20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT, and 10% glycerol buffer (with 3 passes through a Microfluidizer [Microfluidics 11 OS]) and inclusion bodies were removed by centrifugation (10K rpm, 10 minutes). Purification of all PTP-IB mutants was performed at 4 C.
  • the supernatants from the centrifugation were filtered through 0.45 ⁇ m cellulose acetate (5 ⁇ l of this material was analyzed by SDS-PAGE) and loaded onto an SP Sepharose fast flow column (2.5 cm diameter x 14 cm long) equilibrated in Buffer A (20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT, 1% glycerol) at 4 ml/min.
  • Buffer A (20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT, 1% glycerol
  • the protein was then eluted using a gradient of 0 - 50% Buffer B over 60 minutes (Buffer B: 20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT, 1% glycerol, 1 M NaCl). Yield and purity was examined by SDS-PAGE and, if necessary, PTP-IB was further purified by hydrophobic interaction chromatography (HIC). Protein was supplemented with ammonium sulfate until a final concentration of 1.4 M was reached.
  • Buffer B 20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT, 1% glycerol, 1 M NaCl.
  • the protein solution was filtered and loaded onto an HIC column at 4 ml/min in Buffer A2: 25 mM Tris pH 7.5, 1 mM EDTA, 1.4 M (NH 4 ) 2 S0 4 , 1 mM DTT. Protein was eluted with a gradient of 0 - 100% Buffer B over 30 minutes (Buffer B2: 25 mM Tris pH 7.5, 1 mM EDTA, 1 mM DTT, 1% glycerol). Finally, the purified protein was dialyzed at 4 C into the appropriate assay buffer (25 mM Tris pH 8, 100 mM NaCl, 5 mM EDTA, 1 mM DTT, 1% glycerol). Yields varied from mutant to mutant but typically were within the range of 3-20 mg/L culture.
  • HIV IN is one of three key enzyme targets of the human immunodeficiency virus; it removes two nucleotides from each 3 ' end of the originally blunt viral DNA, and inserts the viral DNA into the host DNA by strand transfer.
  • the integration process is completed by host DNA repair enzymes.
  • HIV IN has three distinct domains: the N-terminal domain, the catalytic core domain, and the C- terminal domain. Although the X-ray crystal structures of each of these isolated domains have been solved, it is not yet clear how they interact with each other. Integration is absolutely essential for the replication of the virus and progression of disease, and thus integrase inhibitors can be used in the treatment of HIV/ AIDS. Structures of core domain of integrase are available [1EXQ, Chen, J. C.
  • HIV-1 integrase residues Numbering of the wild type and mutant HIV-1 integrase residues follows the convention of the first amino acid residue of the mature protein being residue number 1, and the HIV-1 integrase catalytic core domain being comprised of residues 52-210 [Leavitt, A. D., et al, J Biol Chem 268: 2113- 2119 (1993)].
  • This generated pT7-7 HT-I n encoding the triple mutant (C56S, W131D, F185K) of the integrase core, SEQ ID NO: 143.
  • the C65A mutation was carried out independently by Quickchange mutagenesis on pT7-7 HT-INtn using SEQ ID NO: 146 and SEQ ID NO: 147.
  • the DNA encoding HT-C130A integrase core domain was subcloned into the pRSET A vector by PCR cloning.
  • SEQ ID NO: 148 and SEQ ID NO: 149 were used as PCR primers, and the resulting amplified product was digested with Ndel and Hind III, and ligated into pRSET A that had been digested with the same enzymes, to generate pRSET-HT-C130A-IN t ri.
  • a BamHI fragment of pT7-7 HT-C65A-IN t ri containing the C65A mutation was ligated into pRSET-HT-C130A-iN t ri, to generate pRSET-HT-IN te mpi at e.
  • This plasmid served as a template for further Kunkel mutagenesis to introduce cysteine substitutions at positions chosen for tethering.
  • SEQ ID NO: 17 was used for sequencing.
  • pT7-7 and pRSET integrase core domain expression plasmids were transformed into BL21star E. coli (Invitrogen) by standard methods, and a single colony from the resulting plate was used to inoculate 250 mL of 2x YT broth containing 100 ⁇ g/mL ampicillin. Following overnight growth at 37 C, the cells were harvested by centrifugation at 4K rpm and resuspended in 100 mL 2YT/amp. 40 mL of the washed cells was used to inoculate 1.5 L of the same media, and after growth at 37 C to an OD at 600 nm of between 0.5 and 0.8, the culture was moved to 22 C and allowed to cool.
  • IPTG was added to a final concentration of 0.1 mM and expression continued 17-19 h at 22 C.
  • Cells were harvested by centrifugation at 4K ⁇ m.
  • Cell pellets were resuspended in 100 mL Wash 5 buffer (Wash 5: 20 mM Tris-HCl, 1 M MgCte, 5 mM imidazole, 5 mM ⁇ -mercaptoethanol, pH 7.4) and lysis was accomplished by sonication for 1 minute, repeated a total of 3 times with 2 minutes rest between.
  • Cell debris was removed by centrifugation at 14K m followed by filtration. Integrase core domain was purified by affinity chromatography on Ni-NTA superflow resin (Qiagen) at 4 C.
  • BACEl (accession number SWS 56817) is a typel integral glycoprotein that is an aspartic protease. Found mostly in the Golgi, BACEl cleaves the amyloid precursor protein to form the Abeta peptide. A strong association has been shown between deposition of this peptide on the cerebrum and Alzheimer's disease; therefore BACEl is one of the primary targets for this disease. A crystal structure of BACEl has been solved [1FKN, Hong, L. et al., Science 290:150-153 (2000)].
  • the proprotease domain gene sequence (bases 64-1362, amino acid residues 22-454) was subcloned from pFBHT into the E. coli expression vector pRSETC by PCR, to create pB22, which served as a template for mutagenesis to inco ⁇ orate cysteine tethering sites.
  • pBHT a modified pFastBac plasmid, see example 4 above. The subcloning was accomplished as follows.
  • the cDNA encoding full-length human BACEl, bases 1-1551, starting from the initiator Met codon and including an extra 48 bases of mRNA transcript following the stop codon [Vassar, R., et al., Science 286: 735-741 (1999)] was obtained by a combination of PCR cloning of the 3' 1425 bases from human cDNA libraries, and synthesis of the remaining 5' 126 bases by serial overlapping PCR. All PCR reactions were performed using Advantage2 polymerase (Clontech) according to manufacturers instructions.
  • a fragment spanning bases 126-374 was obtained by PCR from a human cerebral cortex library and SEQ ID NO: 170 and SEQ ID NO: 171; a fragment spanning bases 339-770 was obtained by PCR from a Stratagene Unizap XR human brain cDNA library, and SEQ ID NO:172 and SEQ ID NO:173; and the 3' end fragment, spanning bases 735-1551, was obtained by PCR from a human brain library, using SEQ ID NO:174 and SEQ ID NO:175.
  • the three fragments, having 35 bp of overlap at the junctions, were gel purified and combined in one PCR reaction, using primers to the ends (SEQ ID NO:170 and SEQ ID NO:176) to amplify the 126- 1551 product.
  • the 126-1551 piece, and the subsequent elongated products were used as a templates for serial overlapping PCR reactions, to add the remaining 5' -126 bases using SEQ ID NO: 177, SEQ ID NO: 178 and SEQ ID NO: 179 as forward primers, with SEQ ID NO: 176 always at the reverse primer.
  • SEQ ID NO: 179 and SEQ ID NO: 176 contained EcoRI and Xhol restriction sites, respectively, and digestion of the PCR product, along with the Baculovirus expression vector, pFBHT, with the same enzymes was followed by gel purification and ligation of the resulting DNA fragments, yielding the construct, pFBHT-BACE.
  • This construct was used as a template for PCR amplification of bases 1- 1362, corresponding to the preproBACE soluble protease domain, using SEQ ID NO: 180 and SEQ ID NO:181.
  • SEQ ID NO:180 and SEQ ID NO:181 contained Ndel and EcoRI restriction sites, respectively, and digestion of the PCR product, along with the E. coli expression vector, pRSETC, with the same enzymes was followed by gel purification and ligation of the resulting DNA fragments led to the construct pBl.
  • Vector pBl was then used as a template for Kunkel mutagenesis (Kunkel, T. A., et al., Methods Enzymol. 154:367-382 [1987]) to delete the BACE presequence (bases 1-63), producing the construct pB22.
  • pB22 served as a template for mutagenesis to inco ⁇ orate cysteine tethering sites, using either the Kunkel method or a Quickchange mutagenesis kit (Stratagene).
  • Washed inclusion body pellets were solubilized in 50 mM CAPS, 8 M urea, 1 mM EDTA, and 100 mM ⁇ -mercaptoethanol, pH 10, and remaining insoluble debris removed by centrifugation at 20K m for 30 minutes.
  • BACEl was refolded by slow injection of the urea- solubilized protein to between 50 and 100 volumes of rapidly stirred water, or 10 mM Na 2 C0 3 , pH 10, followed by incubation at room temperature for 3-7 days.
  • the pH of the refolding solution was adjusted to 8.0 by addition of 5 mM (final concentration) Tris-HCl, and loaded onto a Q-Sepharose column.
  • Mek-1 (accession number SWS Q02750) is a dual specificity kinase that plays a key role in cellular proliferation and survival in response to mitogenic stimuli.
  • Mek-1 is the central component of a three-kinase cascade commonly called a MAP kinase cascade.
  • This Raf-Mek-Erk kinase cascade transmits information from cell surface receptors (e.g. EGFR, HER2, PDGFR, FGFR, IGF, etc.) to the nucleus. This pathway is upregulated in approximately 30% of all tumor types, either through overexpression of specific cell surface receptors (e.g.
  • Mek-1 in breast cancers
  • Mek-2 is a dual specificity kinase that is both highly homologous (79% identity) to Mek-1 and coordinately expressed with Mek-1.
  • Mek-1 and Mek-2 represent attractive targets for the development of novel anti-cancer therapeutics. There are no crystal structures to date for Mek-1 or Mek-2.
  • Mek-1 and Mek-2 Numbering of the wild type and mutant Mek-1 and Mek-2 residues begins at their respective amino termini, with residue number 1 being the initiation methionine, according to the NCBI reported sequences (NCBI accession number L05624 for Mek-1 and NCBI accession number HUMMEK2F for Mek-2). All standard cloning and mutagenesis steps were carried out according to the recommendations of the enzyme manufacturer.
  • the DNA encoding human Mek-1 was isolated from plasmid pUSE MEKl (Upstate Biotechnology) and inserted into plasmid pGEX-4T-l (Amersham) in frame with GST as follows.
  • pUSE MEKl was digested with Notl (New England Biolabs), the 3' overhang filled in with the Klenow fragment of DNA polymerase (New England Biolabs), and the 1193 bp product encoding MEKl was isolated from an agarose gel.
  • pGEX-4T-l was linearized by digestion with EcoRI (New England Biolabs) and the 3' overhang similarly filled in with the Klenow fragment of DNA polymerase (New England Biolabs).
  • the MEKl and pGEX-4T-l DNA fragments were then ligated with T4 ligase and amplified in E. coli strain Topi OF' (Invitrogen) to generate plasmid pGEX-MEKl.
  • the DNA encoding human Mek-2 was isolated from plasmid pUSE MEK2 (Upstate Biotechnology) and inserted into plasmid pGEX-4T-l (Amersham) in frame with GST as follows.
  • pUSE MEK2 was digested with Notl (New England Biolabs), the 3' overhang filled in with the Klenow fragment of DNA polymerase (New England Biolabs), and the 1213 bp product encoding MEK2 was isolated from an agarose gel.
  • pGEX-4T-l was linearized by digestion with EcoRI (New England Biolabs) and the 3' overhang similarly filled in with the Klenow fragment of DNA polymerase (New England Biolabs).
  • the MEK2 and pGEX-4T-l DNA fragments were then ligated with T4 ligase and amplified in E. coli strain To i OF' (Invitrogen) to generate plasmid pGEX-MEK2.
  • reactions contained the parent plasmid (2 ng/ ⁇ l), sense strand mutant primer (0.5 ⁇ M), and antisense strand mutant primer (0.5 ⁇ M) that are unique to each reaction.
  • all reactions contained dNTPs (25 ⁇ M) and Pfu polymerase (0.05 Units/ ⁇ l; Stratagene). Reactions were incubated for one minute at 95 C followed by 16 cycles of (0.5 minutes at 95 C, 1 minute at 55 C, and 2 minutes at 68 C) and a final 10 minutes at 68 C.
  • Parent plasmid DNA was then digested with Dpnl (New England Biolabs) and the remaining linear PCR product was transformed into E. coli strain ToplOF' (Invitrogen). Mutagenized plasmid DNA, the result of in vivo recombination and subsequent amplification, was purified using QIAquick (Qiagen) columns and verified by sequencing.
  • a 6xHIS epitope tag was introduced into pGEX-MEKl, at the carboxy terminus of MEKl, to generate pGEX-MEKl-HIS using the sense and antisense oligonucleotides MEK1-6HIS-S and MEKl-6HIS-as, resepectively.
  • a 6xHIS epitope tag was introduced into pGEX-MEK2, at the carboxy terminus of MEK2, to generate pGEX-MEK2-HIS using the sense and antisense oligonucleotides, MEK2-6HIS-S and MEK2-6HIS-as, resepectively.
  • Mek-1 and Mek-2 were expressed in E. coli and purified essentially as described for Mek-1 [by McDonald, O. B., et al., Analytical Biochem. 268: 318-329 (1999)]. Plasmids containing the mutant Mek-1 and Mek-2 alleles were transformed into BL21 DE3 pLysS cells (Invitrogen) according to manufacturer's suggestions. Cultures were grown overnight at 37 C from single colonies in 100 ml 2YT medium supplemented with 100 ⁇ g/ml ampicillin and 100 ⁇ g/ml chloramphenicol.
  • This culture was then added to 1.5 L 2YT supplemented with 100 ⁇ g/ml ampicillin to achieve an OD 600 of approximately 0.05 and then grown to an OD 6 oo of approximately 0.7 at 30 C.
  • Expression was induced with the addition of IPTG to a final concentration of 1 mM and the culture was incubated for four hours at 25 C.
  • Cells were pelleted in a Sorfall GSA rotor at 6K ⁇ m for 15 minutes and stored at -80 C.
  • Mek-1 and Mek-2 mutants were purified from cells by first resuspending cell pellets in ice cold PBS containing 0.5% Triton X-100 and incubating on ice for 45 minutes, followed by extensive sonication. Lysates were clarified by centrifugation in a Sorvall GSA rotor at 12K ⁇ m for one hour. Fusion proteins were first purified on Ni-NTA resin (Qiagen) according to manufacturer's suggestions, followed by further purification on glutathione agarose as described [by McDonald, O. B., et al., Analytical Biochem. 268: 318-329 (1999)]. Epitope tags were removed with thrombin cleavage and aliquots of purified protein were stored at -80 C in TBS containing 10% glycerol.
  • Cathepsin S (accession number SWS P25774) is a thiol protease located primarily in the lysosome. This enzyme plays roles in antigen presentation by processing of the MHC-II antigen receptor; thus inhibitors to the enzyme could be used for diseases such as inflammation and autoimmunity such as rheumatoid arthritis, multiple sclerosis, asthma and organ rejection. It has also been reported that catS is present in increased levels in the Alzheimer's disease and Down Syndrome brain compared with normal brain. A structural model of cathepsin S [1BXF, Fengler, A. & Brandt W., Protein Eng 11:1007-1013(1998)] and a crystal structure of the C25S mutant [Turkenburg, J. P. et al. Acta Crystallogr D Biol Crystallog 58: 451-455 (2002)] are available.
  • the DNA sequence encoding human cathepsin S was isolated by PCR from the plasmid pDualGC (Stratagene #E01089) using PCR primers listed below corresponding to the protein N- and C-termini. These primers were designed to contain restriction endonuclease sites EcoRI and
  • SEQ ID O: 263 was used with SEQ ID NO: 264 and SEQ ID NO 265 to make catS with and without a 6xhis tag, respectively.
  • the PCR reaction was purified on a Qiaquick PCR purification column (Qiagen).
  • the PCR product containing the catS sequence was cut with restriction endonucleases (42 ⁇ l PCR product, 1 ⁇ l each endonuclease, 5 ⁇ l appropriate lOx buffer; incubated at 37 C for 3 hours).
  • the pFBHT vector was cut with restriction endonucleases (5 ⁇ g DNA, 1 ⁇ l each endonuclease, 3 ⁇ l appropriate lOx buffer, water to 30 ⁇ l; incubated at 37 C for 3 hours; added 1 ⁇ l CIP and incubated at 37 C for 60 minutes).
  • the products of nuclease cleavage were isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (50 ng pFBHT vector and 50 ng catS PCR product in 10 ⁇ l, 10 ⁇ l 2x ligase buffer (Roche), 1 ⁇ l ligase, incubated at 25 C for 15 minutes).
  • T4 DNA ligase 50 ng pFBHT vector and 50 ng catS PCR product in 10 ⁇ l, 10 ⁇ l 2x ligase buffer (Roche), 1 ⁇ l ligase, incubated at 25 C for 15 minutes).
  • 1 ⁇ l of the ligation reaction was transformed into Library Efficiency Chemically Competent DH5 ⁇ cells (Invitrogen) (1 ⁇ l ligation reaction, 100 ⁇ l competent cells; incubated at 4 C for 30 minutes, 42 C for 45 seconds, 4 C for 2 minutes, then 900 ⁇ l SOC media was added and incubated for 1 hour with shaking at 225 ⁇ m at 37 C), and plated onto LB/agar plates containing 100 ⁇ g/ml ampicillin. After incubation at 37 C overnight, single colonies were grown in 3 ml LB media containing 100 ⁇ g/ml ampicillin for 8 hours. Cells were then isolated and double-stranded DNA extracted from the cells using a Qiagen DNA miniprep kit. Sequencing of catS gene was accomplished using Ml 3/pUC Forward and Reverse Amplification Primers (Invitrogen # 18430-017).
  • All CatS-FBHT plasmids were site-specifically transposed into the baculovirus shuttle vector (bacmid) by transforming the plasmids into DHlObac (Gibco/BRL) competent cells as follows: 1 ⁇ l DNA at 5 ng/ ⁇ l, lO ⁇ l 5x KCM [0.5 M KCl, 0.15 M CaCl 2 , 0.25 M MgCl 2 ], 30 ⁇ l water was mixed with 50 ⁇ l PEG-DMSO competent cells, incubated at 4 C for 20 minutes, 25 C for 10 minutes, added 900 ⁇ l SOC and incubated at 37 C with shaking for 4 hours, then plated onto LB/agar plates containing 50 ⁇ g/ml kanamycin, 7 ⁇ g/ml gentamycin, 10 ⁇ g/ml tetracycline, 100 ⁇ g/ml Bluo-gal, 10 ⁇ g/ml IPTG.
  • pellet was resuspended in 250 ⁇ l of Solution 1 [15 mM Tris-HCl (pH 8.0), 10 mM EDTA, 100 ⁇ g/ml RNase A]. Added 250 ⁇ l of Solution 2 [0.2 N NaOH, 1% SDS] mixed gently and incubated at room temperature for 5 minutes. Added 250 ⁇ l 3 M potassium acetate, mixed and placed on ice for 10 minutes. Centrifuged 10 minutes at 14,000x g and transferred supernatant to a tube containing 0.8 ml isopropanol.
  • Sf9 cells were seeded at 9 x 10 s cells per 35 mm well in 2 ml of Sf-900 II SFM medium containing 0.5x concentration of antibiotic-antimycotic and allowed to attach at 27 C for 1 hour.
  • bacmid DNA was diluted into 100 ⁇ l of medium without antibiotics
  • 6 ⁇ l of CellFECTIN reagent was diluted into 100 ⁇ l of medium without antibiotics and then the 2 solutions were mixed gently and allowed to incubate for 30 minutes at room temperature.
  • the cells were washed once with medium without antibiotics, the medium was aspirated and then 0.8 ml of medium was added to the lipid-DNA complex and overlaid onto the cells.
  • the cells were incubated for 5 hours at 27 C, the transfection medium was removed and 2 ml of medium with antibiotics was added.
  • the cells were incubated for 72 hours at 27 C and the virus was harvested from the cell culture medium.
  • the virus was amplified by adding 1.0 ml of virus to a 50 ml culture of Sf9 cells at 2 x 10 6 cells/ml and incubating at 27 C for 72 hours.
  • the virus was harvested from the cell culture medium and this stock was used to express the various catS constructs in High-Five cells.
  • a I L culture of High-Five cells at 2 x 10 6 cells/ml was infected with virus at an approximate MOI of 2 and incubated for 72 hours.
  • Caspase-1 (accession number SWS P25774), like other caspases exists as an inactive proform, and is proteolytically processed into a large subunit and a small subunit, which then combine to form the active enzyme.
  • An important substrate of caspase-1 is the proform of interleukin- 1 (beta).
  • Caspase-1 produces the active form of this cytokine, which plays a role in processes such as inflammation, septic shock and wound healing. Additionally, active capase-1 induces apoptosis, and plays a role in the progression Huntington's disease.
  • the structure of caspase-1 has been solved [1BMQ, Okamoto, Y., et al., Chem Pharm Bull (Tokyo), 47:11-21 (1999)].
  • IL-13 (accession number SWS P35225), which is produced mainly by activated Th2 cells, shows structural and functional similarities to IL-4. Like IL-4, it increases the secretion of immunoglobulin E by B cells and is involved in the expulsion of parasites. In addition, IL-13 downregulates the production of cytokines including IL-lb, IL-6, TNF-alpha and IL-8 by stimulated monocytes. IL-13 also prolongs monocyte survival, increases the expression of MHC class II and CD23 on the surface of monocytes, and increases expression of CD23 on B cells. Furthermore, IL-2 and IL-13 synergize in the regulation interferon-gamma synthesis.
  • IL-13 plays a role in conditions such as allergy and asthma.
  • a polymo ⁇ hism at position 130 (Q) increases the risk of asthma development.
  • the structure of IL-13 has been solved by nuclear magnetic resonance (NMR) [1GA3, Eissenmesser, E. Z. et al., J. Mol. Biol. 310: 231-241 (2001)].
  • CD40L (accession number SWS P29965) is a protein that is found in two forms, a transmembrane form and also an active, proteolytically processed, extracellular soluble form. The transmembrane form is expressed on the surface of CD4+ T lymphocytes. Like other members of the TNF family, it is forms a homotrimer. CD40L mediates the proliferation of B cells, epithelial cells, fibroblasts, and smooth muscle cells. Binding of CD40L to the CD40 receptor on T cells provides a critical signal for isotype class switching and production of immunoglobulin antibodies. Defects in CD40L lead to an elevation in IgM levels, and an deficiency in all other immunoglobulin subtypes.
  • Inhibitors to CD40L would find use in the treatment of autoimmune disease and graft rejection.
  • reduced interaction between CD40L and its receptor reduces the degree of tau hype ⁇ hosphorylation in a mouse model of Alzheimer's disease.
  • the crystal structure of CD40L has been solved [1ALY, Ka ⁇ usas, M., et al, Structure 3: 1031-1039(1995), erratum in Structure 3:1046 (1995)].
  • BAFF A member of the TNF superfamily, BAFF (accession number SWS Q9Y275) is a homotrimer and found in both transmembrane and soluble forms. The transmembrane form is processed by the furin family of proprotein convertases. BAFF is upregulated by interferon-gamma and downregulated by PMA/ionomycin treatment. BAFF binds to three different receptors. When it binds to the B-cell specific receptor (BAFFR), it promotes survival of B-cells and the B-cell response.
  • BAFFR B-cell specific receptor
  • BAFF proliferation-inducing ligand
  • APRIL proliferation-inducing ligand
  • TACI transmembrane activator and CAML interactor
  • BCMA B cell maturation antigen
  • Inhibitors of BAFF would serve as therapeutics for autoimmune diseases characterized by abnormal B-cell activity, such as systemic lupus erythematosis (SLE) and rheumatoid arthritis (RA).
  • SLE systemic lupus erythematosis
  • RA rheumatoid arthritis
  • P53 (accession number SWS P04637), a transcription factor that can suppress tumor growth, binds DNA as a homotetramer and is activated by phosphorylation of a serine residue.
  • P53 controls cell growth by regulating expression of a set of genes; for example, it increases the transcription of an inhibitor of cyclin-dependent kinases.
  • Apoptosis results from the p53-mediated stimulation of Bax or Fas expression, or the decrease in Bcl2 expression.
  • P53 is mutated or inactivated in about 60% of known cancers, and is also often overexpressed in a variety of tumor tissues.
  • Reversible inhibitors of p53 could be used as an adjunct to conventional radio- and chemotherapy to prevent damage to normal tissues during treatment and its severe side effects. Such an inhibitor was shown to protect mice from lethal doses of radiation without the promotion of tumor formation.
  • Xenopus laevis mdm2 protein [1YCQ, Kussie, P. H., et al., Science 274: 948-953 (1996)].
  • mdm2 In response to DNA damage, p53 increases the transcription of the protein mdm2 (accession number SWS Q00987). In a form of negative feedback, mdm2 inhibits p53-induced cell cycle arrest and apoptosis by two means. Firstly, mdm2 binds the transcriptional activation domain of p53, reducing its transcriptional activation activity. Secondly, in the presence of ubiquitin El and E2, mdm2 serves as an ubiquitin protein ligase E3 for both itself and p53. The ubiquitination of p53 allows its export from the nucleus to the proteasome, where it is destroyed. There are eight isoforms of mdm2 that are produced by alternative splicing.
  • mdm2 mdm2, mdm2-A, mdm2-Al, mdm2-B, mdm2-C, mdm2-D, mdm2-E, and mdm2 -alpha.
  • mdm2-A, mdm2-B, mdm2-C, mdm2-D, and mdm2-E are observed in human cancers but not in normal tissues.
  • Mdm2 amplification has also been observed in certain tumor types, including soft tissue sarcoma, osteosarcoma, and glioblastoma. These tumors often contain wild type p53.
  • Small molecule inhibitors of mdm2 could promote the proapoptotic activity of the wild type p53 and find use in cancer therapy.
  • the structure of Xenopus laevis mdm2 in complex with human p53 has been solved [1YCR, Kussie, P. H. et al., Science 274: 948-953 (1996)].
  • Bcl-x (accession number SWS Q07817) is a member of the Bcl2 family of proteins and has two major isoforms produced by alternative splicing, bcl-x(L), bcl-x(S).
  • the long isoform, bcl-x(L) is found in long-lived postmitotic cells and inhibits apoptosis
  • the short isoform, bcl-x(S) is found in cells with a high turnover rate and promotes apoptosis.
  • the long isoform inhibits apoptosis by binding to voltage-dependent anion channel (VDAC) and preventing the release of apopotosis activator cytochrome c from the mitochondrial membrane.
  • VDAC voltage-dependent anion channel
  • This antiapoptotic activity is dependent upon the BH4 (bcl-2 homology) domain of Bcl-x(L); binding of this protein to other Bcl2 family members is dependent upon the BH1 and BH2 domains.
  • Expression of Bcl-x(L) has been observed to be expressed primarily by the neoplastic cells in a majority of lymphoma cases. Inhibition of bcl-x(L) expression in several cell lines resulted in apoptosis. Thus, due to its antiapoptotic effects, bcl-x(L) is a target for cancer therapeutics.
  • BAX gamma (BAX gamma); SWS P55269 (BAX delta)] promotes apoptosis by binding to the antiapoptotic protein bcl-x(L), inducing the release of cytochrome c, and activating caspase-3.
  • Bax has several isoforms produced by alternative splicing; some are membrane bound and others are cytoplasmic.
  • the BH3 domain of Bax is necessary for its binding to members of the anti-apoptotic Bcl2 family.
  • Bax agonists could be used in cancer therapies, while Bax inhibitors could be used to counteract neuronal cell death resulting from ischemia, spinal cord injury, Parkinson's disease and Alzheimer's disease.
  • An NMR structure of BAX has been solved [1F16, Suzuki, M., et al., Cell 103:645-654 (2000)].
  • CDC25A (accession number SWS P30304) is a dual-specificity phosphatase also known as M- phase inducer phosphatase 1 (MPIl). Induced by cyclin B, CDC25A is required for progression of the cell cycle, and induces mitosis in a dosage-dependent manner. CDC25 directly dephosphorylates CDC2, thereby decreasing its activity. It has also been demonstrated in vitro that CDC25 dephosphorylates CDK2 in complex with cyclinE. Elevated levels of CDC25 can trigger uncontrolled cell growth and are linked with increased mortality in breast cancer patients. Activated CDC25A is also observed in degenerating neurons of the Alzheimer's diseased brain. A structure of the catalytic core has been solved [1C25, Fauman, F. B., et al., Cell 93: 617-625 (1998)].
  • CD28 CD28 (accession number SWS PI 0747) is a disulfide-Iinked homodimeric transmembrane protein expressed on activated B-cells and a subset of T-cells. This protein can bind three others: B7-1, B7-2, and CTLA-4.
  • CD28-associated signaling pathways are important therapeutic targets for autoimmune disease, graft vs. host disease (GVHD), graft rejection, and promotion of immunity against tumors. The structure of CD28 has not been solved to date.
  • B7-1 (accession number SWS P33681), also known as CD80
  • B7-2 (accession number SWS P42081), also known as CD86. Both are highly glycosylated transmembrane proteins expressed on activated B-cells. Early events in immune response are controlled by the interactions of these molecules with CD28 and CTLA-4 (see above). Thus B7-1 and B7-2 make significant targets for therapeutics treating autoimmune disease.
  • a structure of the soluble form of B7-1 has been solved [1DR9, Ikemizu, S., et al., Immunity 12: 51-60 (2000)] in addition to a structure of B7-1 in complex with CTLA-4 [1I8L, Stamper, C.
  • the immune system comprises in part the complement cascade, which is a set of more than 20 proteins.
  • C5a is one of these complement proteins; it is a cytokine-like activation product of C5.
  • C5a effects inflammation, and specifically has a role in the recruitment of neutrophils in response to bacterial infection.
  • sepsis the life threatening spread of bacterial toxins through the blood, the effects of C5a are exhausted, due to an overexposure of the neutrophils to excessive amounts of this complement protein.
  • expression levels of C5a receptor (accession number SWS P21730) are increased in certain vital organs during sepsis. Thus inhibitors of C5a or the C5a receptor could help in treating sepsis.
  • Inhibitors of C5a could also be used in the treatment of bullous pemphigoid, the most common autoimmune blistering disease.
  • Another effect of C5a is its synergy with the Abeta peptide to promote secretion of IL-1 and IL-6 in human macrophage-like THP-1 cells; C5a may therefore be involved in the pathogenesis of Alzheimer's disease.
  • NMR NMR
  • Akt is an important component of the signaling pathway of growth factor receptors.
  • Akt genes There are three highly related Akt genes, Akt 1-3 (accession numbers SWS P31749, Aktl; SWS P31751, Akt2; SWS Q9Y243), which show compensatory effects for one another. However, they have different expression patterns, suggesting that each may have unique functions as well.
  • Each Akt is activated by phosphorylation of multiple residues and is activated by the kinase ILK. Binding of activated Akt to PI3K (phosphatidyl inositol 3 -kinase) causes the translocation of the active Akt to the plasma membrane.
  • Akt has pleiotropic effects leading to cell survival.
  • Akt amplification and elevated levels of Akt have been found in some types of cancers.
  • CD45 (accession number SWS P08575) is a receptor protein tyrosine phosphatase that is primarily located in the plasma membrane of leukocytes; it has several isoforms differing in the extracellular domain, the significance of which is presently unknown. Substrates for CD45 include the kinases lye, fyn, and other src kinases. Additionally, CD45 engages in noncovalent interactions with the lymphocyte phosphatase associated protein (LPAP). CD45 is critical for activation through the antigen receptor on T cells and B cells, and may also be important for the antigen-mediated activation in other leukocytes. Dimerization of CD45 disables its function. Inhibitors of CD45 could be used to prevent allograft rejection. There is no structure of CD45 to date.
  • HER-2 (accession number SWS P04626), otherwise known as ErbB2 is a receptor tyrosine kinase that is related to EGFR (ErbBl).
  • ErbBl receptor tyrosine kinase that is related to EGFR
  • ligands for HER-2 include heregulins, EGF, betacellulin, and NRG, although binding depends upon which ErbB proteins are in the heterodimer. Ligand binding increases the phosphorylation of HER-2, and effects subsequent intracellular signaling steps.
  • HER-2 is frequently overexpressed in breast cancer cells, and this overexpression may mediate their proliferation.
  • Breast cancer cells overexpressing HER-2 are also more responsive to HER-2 inhibitors.
  • HER-2 is also implicated in a number of other cancers, such as ovarian, prostate, lung, fallopian tube, osteosarcoma, and childhood medulloblastoma. The structure of this receptor has not yet been solved.
  • GSK-3 (accession numbers SWS P49840, GSK-3 ⁇ ; SWS P49841, GSK-3 ⁇ ) is involved in the hormonal control of Myb, glycogen synthase, and c-jun.
  • the phosphorylation of c-jun by GSK-3 decreases the affinity of c-jun for DNA.
  • GSK-3 is phosphorylated by ILK-1 and Akt-1. Phosphorylation by Aktl causes the inhibition of catalytic activity of GSK-3, which normally phosphorylates cyclin D, thereby targeting cyclin D for destruction.
  • the net effect of this phosphorylation of GSK-3 is the promotion of cell survival.
  • GSK-3 activity has been found in tissue from diabetic patients, consistent with its role in the development of insulin resistance. Furthermore, GSK-3 ⁇ is overexpressed in the Alzheimer's disease brain, and this overexpression is associated with tau protein hype ⁇ hosphorylation, a hallmark of the disease. Finally, the effects of some mood-stabilizing drugs such as lithium appear to be mediated by inhibition of GSK. Therefore it is possible that GSK-3 inhibitors would increase the effectiveness of some psychoactive drugs.
  • GSK-3 ⁇ There is a structure available for GSK-3 ⁇ [1H8F, Dajani, R., et al., Cell 105: 721-732 (2001)].
  • the protein complex alpha-E beta-7 is a transmembrane integrin that plays a role in lymphocyte migration and homing. Specifically, the complex serves as a receptor for E-cadherin.
  • Alpha-E (accession number SWS P38570) is made up of two subunits, ⁇ and ⁇ , the ⁇ -subunit itself is composed of a light chain and a heavy chain linked by a disulfide bond.
  • beta-7 (accession number SWS P26010) is also composed of ⁇ - and ⁇ - subunits.
  • the alpha-E/beta-7 complex normally mediates the adhesion of intra-epithelial T lymphocytes to mucosal epithelial cell layers; it also plays a role in the dissemination of non-Hodgkin's lymphoma. Furthermore, a possible mechanism of inflammation involves migration of lymphocytes from the gut epithelium to other parts of the body. Changes in alpha-E/beta-7 levels have been observed in a variety of diseases. Elevated levels of this integrin have been observed in patients with Systemic Lupus Eryfhematosus (SLE), in the lung epithelium of patients with interstitial lung disease, and in the sinovial fluid of patients with rheumatoid arthritis.
  • SLE Systemic Lupus Eryfhematosus
  • alpha-E/beta-7 Altered patterns of alpha-E/beta-7 expression have been observed in patients with Crohn's disease, and antibodies to this complex were shown to prevent immunization-induced colitis in a mouse model. Hence, inhibitors to this complex would be valuable in the treatment of inflammation, especially mucosal inflammation. There are no structures available for alpha-E or beta-7.
  • TISSUE FACTOR Human tissue factor (accession number SWS PI 3726), also known as thromboplastin, is an integral transmembrane protein that is normally located at the extravascular cell surface. Upon injury to the skin, tissue factor is exposed to blood and complexes with the active form of coagulation enzyme Factor VII, known as Factor VILA (see below). Tissue factor can bind both the inactive and active forms of coagulation Factor VII, and is an obligate cofactor for Factor VILA in triggering the coagulation cascade.
  • Tissue Factor plays a major role in thrombosis
  • inhibition of this factor would be expected to decrease the risk for clinical outcomes of thrombosis such as atherosclerosis, arterial occlusion, stroke, and myocardial infarction.
  • a structure of the extracellular domain of tissue factor has been solved [2HFT, Muller, Y. A., et al., J Mol Biol 256:144-159 (1996)].
  • Factor VII (accession number SWS P08709) is the zymogen (inactive precursor) form of the serine protease coagulation Factor Vila. More than 99% of this protease circulates in the inactive single- chain form; upon cleavage of an Arg-Ile peptide bond by one of several factors, the active two- chain form is produced. This two-chain form comprises a heavy chain and a light chain, linked by a disulfide bond. Enzymatic carboxylation of Glu residues in Factor VII, which is dependent upon vitamin K, allows the protein to bind calcium.
  • Factor Vila cleaves Factor X and Factor IX to produce their respective active forms, which propagate the coagulation cascade. Defects in Factor VII can lead to bleeding disorders, where recombinant Factor Vila finds use as a treatment. Conversely, some polymo ⁇ hisms of the Factor VII gene have been associated with an increased risk for myocardial infarction, which is often caused by blood clots. Factor VII inhibitors are expected to find use in preventing heart disease. A structure of the zymogen form of factor VII in complex with an inhibitory peptide has been solved [1 JBU, Eigenbrot, C, et al., Structure 9:627-636 (2001)].

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Enzymes And Modification Thereof (AREA)
EP02761258A 2001-08-07 2002-08-05 Cysteinmutanten und verfahren zum nachweis der bindung von liganden an biologische moleküle Withdrawn EP1421379A2 (de)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US31072501P 2001-08-07 2001-08-07
US310725P 2001-08-07
US09/981,547 US20020022233A1 (en) 1998-06-26 2001-10-17 Methods for rapidly identifying small organic molecule ligands for binding to biological target molecules
US981547 2001-10-17
US09/990,421 US6919178B2 (en) 2000-11-21 2001-11-21 Extended tethering approach for rapid identification of ligands
US990421 2001-11-21
US10/121,216 US6998233B2 (en) 1998-06-26 2002-04-10 Methods for ligand discovery
US121216 2002-04-10
PCT/US2002/024921 WO2003014308A2 (en) 2001-08-07 2002-08-05 Cysteine mutants and methods for detecting ligand binding to biological molecules

Publications (1)

Publication Number Publication Date
EP1421379A2 true EP1421379A2 (de) 2004-05-26

Family

ID=27494353

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02761258A Withdrawn EP1421379A2 (de) 2001-08-07 2002-08-05 Cysteinmutanten und verfahren zum nachweis der bindung von liganden an biologische moleküle

Country Status (7)

Country Link
EP (1) EP1421379A2 (de)
JP (1) JP2005503380A (de)
CA (1) CA2454246A1 (de)
IL (1) IL159900A0 (de)
MX (1) MXPA04001000A (de)
NZ (1) NZ530721A (de)
WO (1) WO2003014308A2 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7214487B2 (en) 1998-06-26 2007-05-08 Sunesis Pharmaceuticals, Inc. Methods for identifying compounds that modulate enzymatic activities by employing covalently bonded target-extender complexes with ligand candidates
AU2003228345B2 (en) 2002-03-21 2009-02-05 Sunesis Pharmaceuticals, Inc. Identification of kinase inhibitors
WO2005034840A2 (en) * 2003-09-17 2005-04-21 Sunesis Pharmaceuticals, Inc. Identification of kinase inhibitors

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5642292A (en) * 1992-03-27 1997-06-24 Akiko Itai Methods for searching stable docking models of biopolymer-ligand molecule complex
US6010861A (en) * 1994-08-03 2000-01-04 Dgi Biotechnologies, Llc Target specific screens and their use for discovering small organic molecular pharmacophores

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03014308A3 *

Also Published As

Publication number Publication date
CA2454246A1 (en) 2003-02-20
NZ530721A (en) 2006-09-29
WO2003014308A3 (en) 2004-03-18
WO2003014308A9 (en) 2004-04-22
IL159900A0 (en) 2004-06-20
MXPA04001000A (es) 2004-06-25
WO2003014308A2 (en) 2003-02-20
JP2005503380A (ja) 2005-02-03

Similar Documents

Publication Publication Date Title
Pirozzi et al. Identification of novel human WW domain-containing proteins by cloning of ligand targets
Lin et al. The carboxyl terminus of B class ephrins constitutes a PDZ domain binding motif
Xiao et al. Three-dimensional structure of a complex between the death domains of Pelle and Tube
US20030194745A1 (en) Cysteine mutants and methods for detecting ligand binding to biological molecules
EP1525213A2 (de) Dreidimensionale strukturen von tall-1 und seiner entsprechenden rezeptoren und modifizierten proteine sowie damit in verbindung stehende verfahren
WO1998007835A2 (en) Crystal structures of a protein tyrosine kinase
WO2004078923A2 (en) Pyk2 crystal structure and uses
US7491731B2 (en) Crystal structure of liganded cFMS kinase domain
WO2003014308A2 (en) Cysteine mutants and methods for detecting ligand binding to biological molecules
Oda et al. Structural analysis of the STAT1: STAT2 heterodimer revealed the mechanism of Sendai virus C protein–mediated blockade of type 1 interferon signaling
Xu et al. Integrative x-ray structure and molecular modeling for the rationalization of procaspase-8 inhibitor potency and selectivity
US20040014140A1 (en) Methods for identifying allosteric sites
AU2002326537A1 (en) Cysteine mutants and methods for detecting ligand binding to biological molecules
Ulrich et al. Engineering a “methionine clamp” into Src family kinases enhances specificity toward unnatural ATP analogues
ZA200400342B (en) Cysteine mutants and methods for detecting ligand binding to biological molecules
Baker et al. Amino acid substitution at position 99 affects the rate of CRP subunit exchange
Saleh et al. Affinity of Stat2 for the subunits of the interferon alpha receptor
Wienk et al. The tandem zinc-finger region of human ZHX adopts a novel C2H2 zinc finger structure with a C-terminal extension
Kim et al. Characterization of Ad5 E3–14.7 K, an adenoviral inhibitor of apoptosis: structure, oligomeric state, and metal binding
US20030235862A1 (en) Methods of characterizing molecular interaction sites on proteins
You et al. Analysis of a macrophage carbamylated proteome reveals a function in post-translational modification crosstalk
Silva et al. A previously-unrecognized motif of transcription factor RYBP, hotspot of cancer-related mutations, is essential for the integrity of Polycomb repressive complex 1
Beeler et al. A soluble C1b protein and its regulation of soluble type 7 adenylyl cyclase
Ko Understanding the Role of NEMO in IKK Activation
Anamika et al. Classification of nonenzymatic homologues of protein kinases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040209

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIC1 Information provided on ipc code assigned before grant

Ipc: G06F 19/00 20060101AFI20070321BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20070511