EP1419276A2 - Diagnose und behandlung von krankheiten die mit einer geänderten hipk1 expression assoziert sind - Google Patents

Diagnose und behandlung von krankheiten die mit einer geänderten hipk1 expression assoziert sind

Info

Publication number
EP1419276A2
EP1419276A2 EP02764693A EP02764693A EP1419276A2 EP 1419276 A2 EP1419276 A2 EP 1419276A2 EP 02764693 A EP02764693 A EP 02764693A EP 02764693 A EP02764693 A EP 02764693A EP 1419276 A2 EP1419276 A2 EP 1419276A2
Authority
EP
European Patent Office
Prior art keywords
hipk1
protein
expression
gene
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02764693A
Other languages
English (en)
French (fr)
Inventor
Finn Skou Pedersen
Annette Balle Sorensen
Javier Martin Hernandez
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aarhus Universitet
Original Assignee
Aarhus Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2001/029798 external-priority patent/WO2002024867A2/en
Application filed by Aarhus Universitet filed Critical Aarhus Universitet
Publication of EP1419276A2 publication Critical patent/EP1419276A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722—G-proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to methods for use in diagnosis and treatment of diseases, including lymphoma and leuKemia, associated with altered gene expression of HIPKl.
  • Lymphomas are a collection of cancers involving the lymphatic system and are generally categorized as Hodgl n's disease and No ⁇ -Hodgt ⁇ n lymphoma.
  • Hodgkln s l phomas are of 8 lymphocyte origin.
  • Non-Hodgkin lymphomas are a collection of over 30 different types of cancers including T and B lymphomas.
  • Leukemia l9 a disease of the blood forming tissues and includes B and T cell lymphocytic leukemias. It is characterized b an abnormal and persistent increase in the numbef of leukocytes and the amount of bone marrow, with enlargement of the spleen and lymph nodes.
  • Oncoge ⁇ es are genes that can cause cancer. Carcinogenesis can occur by a wide variety of mechanisms, including infection of cells by viruses containing oncoge ⁇ es, activation of protooncogenes in the host genome, and mutations of protooncogenes and tumor suppressor genes.
  • viruses There are a number of viruses known to be involved in human cancer as well as in animal cancer. Of particular interest here are viruses that do not contain oncoge ⁇ es themselves; these are slow- transforming retroviruses. They induce tumors by integrating into the host genome and affecting neighboring protooncogenes in a variety of ways, including promoter insertion, enhancer insertion. and/or truncation of a protooncogene or tumor suppressor gene. The analysis of sequences at or near the Insertion sites has led to the identification of a number of new protooncogenes.
  • murine leukemia retrovirus such as SL3-3 or Akv
  • SL3-3 or Akv murine leukemia retrovirus
  • a number of sequences have been identified as relevant in the induction of lymphoma and leukemia by analyzing the insertion sites; see Sorensen et alirri J. Of Virology 74:2161 (2000); Hansen et al., Genome Res. 10(2):237-43 (2000); Sorensen et al.. J. Virology 70:4063 (1996); Sorensen et al., J. Virology 67:7118 (1993); Joosten et al., Virology 268:308 (2000); and LI et al., Nature Genetics 23:348 (1999); all of which are expressly incorporated by reference herein.
  • HIP 1 is a member of a novel family of nuclear protein ki ⁇ aS ⁇ that act as transcriptional co-repressors for NK class of homeoproteins (Kim YH et al., j. Biol. Chem. 1998, 273:25675-25879).
  • Homeoproteins are transcription factors that regulate homeobox genes, which are Involved in various developmental processes, such as pattern formation and organogen ⁇ sls (McGinni ⁇ , W. and Krumiauf, R., Cell 1992, 68:283-302).
  • Homeoproteins may play a role in human dl ⁇ aase. Aberrant expression of the NKX2-5 homeodomain transcription factor has been found to be involved in a congenital heart disease (Schott, J.-j. et al,, Science 1998, 281 :108-111).
  • the present invention provides methods for screening for compositions which modulate diseases including lymphomas. Also provided herein are methods of inhibiting proliferation of a cell, preferably a lymphoma cell. Methods of treatment of diseases including lymphomas, and their diagnosis, are also provided herein.
  • a method of scree ing drug candidates comprises providing a cell that expresses a HIPK1 gene or fragments thereof. The method further includes adding a drug candidate to the cell and determining the effect of the drug cendidate on the expression of a HIPK1 gene. In one embodiment, the method of screening drug candidates includes comparing the level of expression in the absence of the drug candidate to the level of expression In the presence of the drug candidate
  • Also provided herein Is a method of screening for a bioactive agent capable of binding to a protein encoded by a HIPK1 gene, the method comprising combining a HIPK1 protein and a candidate bioactive agent, and determining the binding of the candidate agent to a HIPK1 protein.
  • the method comprises combining a HIPK1 protein and a candidate bioactive agent, and determining the effect of the candidate agent on the bioactivity of a H1PK1 protein.
  • Also provided is a method of evaluating the effect of a candidate lymphoma drug comprising administering the drug to a patient and removing a cell sample from the patient. The expression profile of the cell is then determined. This method may further comprise companng the expression profile of the patient to an expression profile of a heathy Individual.
  • a method for inhibiting the activity of a protein encoded by a HIPK1 gene comprises administering to a patient an inhibitor of a HIPK1 protein
  • a method of neutralizing the effect of HIPK1 protein comprises contacting an agent specific for said protein with said protein in an amount sufficient to effect neutralization
  • a brochip comprising a nucleic acid segment which encodes HIPK1 protein
  • Also provided herein is a method for diagnosing or determining the propensity to diseases, including lymphomas, by sequencing at least one HIPK1 gene of an Individual, in yet another aspect of the invention, a method Is provided for determining HIPK1 gene copy number In an individual
  • the present invent/on is directed to a sequence associated with lymphoma.
  • the use of oncoge ⁇ ic retroviruses whose sequences insert into the genome of the host organism resulting in lymphoma, allows the identification of host sequences Involved in lymphoma. These sequences may then be used In a number of different ways, including diagnosis, prognosis, screening for modulators (including both agonists and antagonists), antibody generation (for immunotherapy and imaging), etc.
  • the present invention provides HIPK1 nucleic acid and protein sequences that are associated with lymphoma.
  • HIPK1 nucleic acid and protein sequences as outllnid herein also are known as SGRS29 nucleic add and protein sequences. Association In this context mean* that the nucleotide or protein sequences are either differentially expressed or altered in lymphoma as compared to normal lymphoid tissue.
  • HIPK1 sequences may be up-r ⁇ gulat ⁇ d (I.e. expressed at a higher level) In lymphoma, or down-regulated (i.e. expressed at a lower level), in lymphoma.
  • HIPK1 sequences also include sequences which have been altered (i.e., truncated sequences or sequences with a point mutation) and show either the same expression profile or an altered profile.
  • the HIPK1 sequences are from humans; however, as will be appreciated by those in the art, HIPK1 sequences from other organisms may be useful in animal models of disease and drug evaluation; thus, other HIPK1 sequences are provided, from vertebrates, Including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, farm animate (including sheep, goals, pigs, cowe, horses, etc). H1PK1 sequences from other organisms may be obtained using the techniques outlined balo .
  • Sequences of the invention can include both nucleic acid and amino acid sequences.
  • the HIPK1 sequences are recombinant nucleic acids.
  • recombinant nucleic acid herein Is meant nucleic acid, originally formed In vitro, In general, by the manipulation of nucleic acid by polym ⁇ rases and endonucleases, in a form not normally found in nature.
  • an isolated nucleic acid, In a linear form, or an expression vector formed In vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention.
  • nucleic acid once a recombinant nucleic acid is made and reinLroduced into a host cell or organism, it will replicate non-recombi ⁇ antly. I.e. using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombina ⁇ tly, although subsequently replicated non-recombinanlly, are still considered recombin ⁇ nt for the pu ⁇ oses of the invention.
  • a "recombinant protein” is a protein made using recombinant techniques, i.e, through th ⁇ expression of a recombinant nucleic acid as depicted above.
  • a recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics.
  • the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure.
  • an isolated protein Is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably al least about 5% by weight of the total protein in a given sample.
  • a substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at lea ⁇ t about 90% being particularly preferred.
  • the definition includes the production of a HIPK1 protein from one organism in s different organism or host cell.
  • the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels.
  • the protein m ⁇ y be In a form not normally found in nature, a ⁇ In the addition of an epitope tag or amino acid substitutions, insertions and deletions, as discussed below.
  • the sequences of the invention are nucleic acids.
  • HIPK1 sequences are useful in a variety of applications, including diagnostic applications, which will detect n ⁇ turally occurring nucleic acids, as well as screening applications; for example, biochips comprising nucleic acid probes to a HIPK1 sequences can be generated.
  • diagnostic applications which will detect n ⁇ turally occurring nucleic acids, as well as screening applications; for example, biochips comprising nucleic acid probes to a HIPK1 sequences can be generated.
  • nucleic acid or oligonucleotide” or grammatical equivalents herein means at least two nucleotides covalently linked together.
  • a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, a ⁇ outlined below (for example in antisens ⁇ applications or whan a candidate agent Is a nucleic acid), nucleic acid analogs may be used that have alternate backbones, compnsing, for example, phosphoramidate (Beaucage et al., Tetrahedron 49(10):1926 (1993) and references therein; Letsinger. J. Org. Chem. 35:3800 (1970); Spri ⁇ z! et al., Eur. J. Biochem, 81:579 (1977): Letsinger et al., Nucl. Acids Res.
  • nucleic add analogs may find use in the present invention.
  • mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nudeic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
  • PNA peptide nudeic acids
  • These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic adds. This results in two advantages.
  • the PNA backbone exhibits improved hybridization kinetics. PNAs have larger changes in the melting temperature (Tm) for mismatched versus perfectly matched basepairs. DNA and RNA typically exhibit a 2-4'C drop in Tm for an internal mismatch. With the non-ionic PNA backbone, the drop is doser to 7-9"C.
  • Tm melting temperature
  • RNA typically exhibit a 2-4'C drop in Tm for an internal mismatch.
  • the non-ionic PNA backbone the drop is doser to 7-9"C.
  • hybridization of the bases attached to these backbones Is relatively Insensitive to salt concentration.
  • PNAs are not degraded by cellular enzymes, and thus can be more stable.
  • the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence.
  • the depidio ⁇ of a single strand (“Watson " ) also defines the sequence of the other strand ("Crick"); thus the sequences described herein also includes the complement of the sequence.
  • the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo- ⁇ ucleotides, and any combination of bases, including uracil.
  • nucleoslde Indudes nucleotides and nucleoside and nucleotide analogs, and modified nucl ⁇ osides such as amino modified nucleosides.
  • nucleoslde Indudes non-naturally occurring analog structures.
  • the Individual units of a peptide nucleic acid, each containing a base are referred to herein as a nucleoside.
  • a HIPK1 sequence can be initially identified by substantial nucleic acid and/or amino acid sequence homology to the HIPKl sequences outlined herein. Such homology can be based upon the overall nucleic acid or ammo acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions
  • the HIPKl sequences of the Invention were identified as follows, basically, infection of mice with murine leukemia viruses (MuLV, including SL3-3, Akv and mutants thereof) resulted in lymphoma
  • the HI K1 sequences outlined herein comprise the insertion sites for the virus.
  • the retrovirus can cause lymphoma in three basic ways; first of all, by Inserting upstream of a normally silent host gene and activating it (e g. promoter insertion); secondly, by truncating a ho ⁇ t gene that leads to oncog ⁇ nesis, or by enhancing the transcription of a neighboring gene.
  • retrovirus enhancers including SL3-3, are known to act on genes up to approximately 200 kilobases of the insertion site
  • HIPK1 sequences are those that are up-ragulated in lymphoma; that is, the expression of these genes is higher in lymphoma as compared to normal lymphoid tissue of the same differentiation stage.
  • Up-regulation means at least about 50%, more preferably at least about 100%, more preferably at least about 150%. more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.
  • HIPK1 sequences are those that are down-regulated in lymphoma; that is. the expression of these genes is lower In lymphoma as compared to normal lymphoid lissua of the same differentiation stage.
  • Down-regulation as used herein means at least about 50%. more preferably at least about 100%, more preferably at least about 150%, more preferably, at least about 200%. with from 300 to at least 1000% being especially preferred.
  • HIPK1 sequences are Ihose that are altered but show either the same expression profile or an altered profile as compared to normal lymphoid tissue of the same differentiation stage
  • All ⁇ red HIPK1 sequences as used herein refers to sequences which are truncated, contain insertions or contain point mutations
  • HIPK1 is an intracellular protein that is localized in the nucleus.
  • intracellular proteins may be found in the cytoplasm and/or in the nucleus Intracellular proteins are involved m all aspects of cellular function and replication (including, for example, signaling pathways), aberrant expression of such proteins results in unregulated or deregulated cellular processes.
  • Intracellular proteins have enzymatic activity such as protein kinase activity, phosphatldyl inositol-conjugated lipid kinase activity, protein phosphatase activity, phosphatldyl ino ⁇ itol-conjugated lipid phosphatase activity, protease activity, nucleotide cyclas ⁇ activity, polymerase activity and the like.
  • Intracellular proteins also serve as docking proteins that are involved in organizing complexes of proteins, or targeting proteins to various subcellular localizations, and are Involved in maintaining the structural Integrity of ⁇ rga ⁇ ell ⁇ s.
  • DNA-binding transcription factors can act, directly or indirectly, on a number of factors associated with the transcriptional apparatus including RNA polymerases and basal transcription factors. DNA binding transcription factors can also act at a number of stages during assembly of the transcriptional apparatus, initiation of transcription, and transcript elongation.
  • Src- homology-2 (SH2) domains bind tyros ' e-phosphorylated targets in a sequence dependent manner.
  • PTB domains which are distinct from SH2 domains, also bind tyrosine phosphorylated targets.
  • SH3 domains bind to proline-rich targets.
  • PH domains, telratrlcopeptide repeats and WD domains have been shown to mediate protein-protein interactions.
  • these motifs can be identified on the basis of primary sequence; thus, an analysis of the sequence of proteins may provide insight into both the enzymatic potential of the molecule and/or molecules with which the protein may associate.
  • motifs have also been identified among transcription factors and have been used to divide these factors into families. These motifs include the basic helix-loop-helix, basic leuclne zipper, zinc finger and homeodomain motifs,
  • HIPK1 is known to contain several conserved domains, including a home ⁇ protein interaction domain, a protein kinase domain, a PEST domain, and a YH domain enriched In tyrosine and histidine residues (Kim et al., J. Biol. Chem, 273:25875 (1998).
  • the homeoprotein interaction domain is from about amino acid 190 to about ammo acid 518
  • the protein kinase domain is from about amino add 581 to about amino acid 848
  • the PEST domain is from about amino acid 890 to about amino acid 974
  • the YH domain is from about amino acid 1067 to about amino acid 1210.
  • Transmembrane proteins are molecules that span the phospholipid bilayer of a cell. They generally include approximately 20 consecutive hydrophobic ammo acids that may be followed by charged amino acids. They m ⁇ y have an intracellular domain, an extracellular domain, or both.
  • the intracellular domains of such proteins may have a number of functions including those already described for Intracellular proteins. For example, the Intracellular domain may have enzymatic activity and/or may serve as a binding site for additional proteins Frequently the Intracellular domain of transmembrane proteins serves both roles.
  • receptor tyro9lne kinases have both protein kinase activity and SH2 domains.
  • autophosphorylation of tyrosi ⁇ es on the receptor molecule Itself, creates binding sites for additional SH2 domain containing proteins,
  • transmembrane protein can be made soluble by removing transmembrane sequences, for example through recombinant methods.
  • transmembrane proteins that have been made soluble can be made to be secreted through recombinant means by adding an appropriate signal sequence.
  • HIPK1 proteins can be made to be secreted proteins through techniques well recognized in the art; the secretion of which can be either constitutive or regulated.
  • the ⁇ a proteins have a signal peptide or signal sequence that targets the molecule to the secretory pathway.
  • the HIPK1 proteins are nuclear proteins, preferably transcription factors Transcriplion factors are involved in numerous physiological eve ⁇ t9 and act by regulating gene expression at the transcriptional level. Transcription factors often serve as nodal points of regulation controlling multiple genes. They are capable of effecting a multifarious change in gene expression and C ⁇ integrate many convergent signals to effect such a change Transcription factors are often regarded as "master regulators" of a particular cellular state or event.
  • transcription factors have often been found to faithfully mark a particular cell state, a quality which makes them attractive for use as diagnostic markers
  • transcription factors are attractive therapeutic targets Intervention at the level of transcriptional regulation allows one to effectively target multiple genes associated with a dysfunction which fall under the regulation of a "master regulator" or transcription factor.
  • a HIPK1 sequence is initially identified by substantial nucleic acid and/or ammo acid sequence homology to the HIPK1 sequences outlined herein. Such homology can be based upon the overall nucleic acid or am o acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions. As used heroin, a nucleic acid is a "HIPKl nucleic acid" If the overall homology of the nucleic acid sequence to one of the nucleic acids of Tables 1, 2, and 3 is preferably greater than about 75%, more preferably greater than about 80%. even more preferably greater than about 85% and most preferably greater than 90%. In some embodiments the homology will bs as high as about 93 to 95 or 98%.
  • sequences which are used to determine sequence identity or similarity are selected from those of the nucleic acids of SEQ ID NOS: 1, 2, 4.
  • sequences are naturally occurring alleiic variants of the sequences of the nucleic acids of SEQ ID NOS: 1 , 2, 4.
  • sequences are sequence variants as further described herein.
  • Homology in this context means sequence similarity or Identity, with identity being preferred.
  • a preferred comparison for homology purposes is to compare the sequence containing seque ⁇ dng errors to the correct sequence. This homology will be determined using standard techniques known in the art, including, but not limited to, the local homology algo ⁇ thm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ). by the homology alignment algorithm of Needlema ⁇ & Wu ⁇ sch, J. Mol.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing tha clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evo). 35:351-360 (1987); the method is similar to that described by Higgins & Sharp CABIOS 5:151-163 (1989).
  • Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.
  • BLAST BLAST algorithm
  • the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity,
  • a % ammo acid sequence identity value is determined by the number of matching identical residues divided by th ⁇ total number of residues of the "longer" sequence in the aligned region.
  • the "longer” sequence Is the one having the most actual residues in the aligned region (gaps Introduced by WU- Blast-2 to maximize the alignment score are ignored).
  • percent (%) nucleic acid sequence identity is defined as the percentage of nucleotide residues in a candidate soquence that are identical with the nucleotide residues of the nucleic acids of the SEQ ID NOS. 1 , 2, 4.
  • a preferred method utilizes the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.
  • the alignment may include the introduction of gaps in the sequences to be aligned.
  • sequences which contain either more or fewer nucleotides than those of the nucleic acids of the SEQ ID NOS 1, 2. 4 it is understood that the percentage of homology will be determined based on the number of homologous nucleosides in relation to the total number of nucleosld ⁇ s. Thus, for example, homology of sequences shorter than those of the sequences identified herein and as dtscussad below, will be determined using the number of ⁇ udeosides in the shorter sequence.
  • the nucleic acid homology is determined through hycrldlzation studies.
  • nudeic acids which hybridize under high stringency to the nucleic acids identified m the figures, or their complements are considered HIPK1 sequences.
  • High stringency conditions are known in the art; see for example Ma ⁇ iatis et al., Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausub , et al , both of which ere hereby inco ⁇ orated by reference. Stnngent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • Tm thermal melting point
  • Stringent conditions will be those In which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8 3 and the temperature is at least about 30°C for short probes (e.g. 10 to 50 nucleotides) and at least about 60 " C for long pr ⁇ bas (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as fdrmamide. In another embodiment, less stringent hybridization conditions are used; for example, moderate or low stringency conditions may be used, as are known in the art; see Maniatis and Ausubel, supra, and Tijssen, supra,
  • HIPK1 nucleic acid sequences of the Invention include fragments of larger ganes. i.e. they are nucleic acid segments "Genes" in this context includes coding regions, non-coding regions, and mixtures of coding and non-coding regions Accordingly, as will be appreciated by those in the art, using the sequences provided herein, additional sequences of HIPK1 genes can be obtained, using techniques well known in the art for cloning either longer sequences or the full length sequences; see Maniatis et al., and Ausubel, et al., supra, hereby expressly incorporated by reference In general, this is done using PCR, for example, kinetic PCR.
  • HIPK1 nucleic acid Once a HIPK1 nucleic acid is identified, it can be cloned and, if necessary, its constituent parts racombi ⁇ ed to form the entire HIPK1 nucleic add. Once isolated from its natural source, e g., contained within a plasmid or other vector or excised therefrom as a li ⁇ r nucleic acid segment, the recombinant HIPK1 nuclaic acid can be further used as a probe to identify and isolate other HIPK1 nucleic acids, for example additional coding regions. It can also be used as a "precursor" nucleic acid to make modified or variant HIPK1 nucleic acids and proteins.
  • H1PK1 nucleic acids of the present invention are used in several ways.
  • nucleic acid probes to a H1PK1 nucleic acids are made and attached to biochips to be used in screening and diagnostic methods, as outlined below, or for administration, for example for gene therapy and/or antisense applications
  • HIPK1 nucleic acids that Include coding regions of HIPK1 proteins can be put into expression vectors for the expression of HIPK1 proteins, again either for screening purposes or for administration to a patient.
  • nucleic acid probes to HIPK1 nucleic acids are made.
  • the nucleic acid probes attached to the blochlp are designed to be substantially complementary to HIPK1 nucleic adds, i.e. the target sequence (either the target sequence of the sample or to other probe sequences, for example in sandwich assays), such that hybridization of the target sequence and the probes of the present invention occurs.
  • this complementarity need not be perfect; there may be any number of base pair mismatches which will Interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention.
  • the sequence is not a complementary target sequence.
  • substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions, particularly high stringency conditions, as outlined herein.
  • a nucleic acid probe is generally single stranded but can be partially single and partially double stranded
  • the strandedness of the probe Is dictated by the structure, composition, and properties of the target sequence
  • the nucleic acid probes range from about 8 to about 100 bases long, with from about 10 to about 80 bases being preferred, and from about 30 to about 50 bases being particularly preferred That is. generally whole genes are not used In some embodiments, much longer nucleic acids can be used, up to hundreds of bases.
  • more than ⁇ a probe per sequence Is used with either overlapping probes or probes to differ ⁇ nt sections of the target being used That Is. two, three, four or more probes, with three being preferred, are used to build in a redundancy for a particular targeL
  • the probes can be overlapping (i e have some sequence in common), or separate
  • nucie c adds can be attached or immobilized to a solid support i a wide variety of ways
  • immobilized and grammatical equivalents herein is meant the association or binding between the nucleic acid probe and the solid support is sufficient to be stable under the conditions of binding washing, analysis, and removal as outlined below
  • the binding can be covalent or non-covalent,
  • non-covalent binding' and grammatical equivalents herein Is meant one or more of either electrostatic, hydrophilic.
  • non-covalent binding is the covalent attachment of a molecule, such as, streptavidin to the support and the non- covalent binding of the biotinylated probe to the streptavidin
  • covalent binding and grammatical equivalents herein is meant that the two moieties, tha solid support and the probe, are attached by at least one bond, indud g ⁇ lgma bonds, pi bonds and coordination bonds
  • Covalent bonds can be formed directly between the probe and the solid support or can be formed by a cross linker or by mdusion of a specific reactive group on either the solid support or the probe or both molecules
  • Immobilization may also involve a combination of covalent and non-covalent interactions
  • the probes are attached to the biochip in a wide variety of ways as will be appreciated by those in the art.
  • the nucleic acids can either be synthesized first, with subsequent attachment to the biochip or can be directly synthesized on the biochip.
  • substrate or solid support or other grammatical equivalents herein is meant any material that can be modified to contain dlsorete individual sites appropriate for the attachment or association of the nucleic acid probes and is omenable to at least one detection method
  • substrates include, but are not limited to, glass and modified or functionalized glass, plastics (induding acrylics polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyuretha ⁇ es, TaflonJ.
  • polysaccha ⁇ des polysaccha ⁇ des, nylon or nitrocellulose, resins, silica or slllca-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, etc.
  • the substrates allow optical detection and do not appreciably fluoresce
  • the surface of the blochlp and the probe may be derivatized with chemical functional groups for subsequent attachment of the two.
  • the blochlp Is derivatized with a chemical functional group including, but not limited to, a ino groups, car oxy groups, oxo groups and thlol repertoire, with amino groups being particularly preferred
  • the probes can ba attached using functional feelings on the probes
  • nucleic acids containing amino groups can be attached to surfaces comprising amino groups, for example using linkers as are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
  • additional linkers such as alkyl groups (including substituted and heteroalkyl groups) may be used
  • oligonucleotides are synthesized as is known in the art and then attached to the surface of the solid support As will be appreciated by those skilled in the art, either the 5' or 3' terminus may be attached to the solid support, or attachment may be via an internal nucleoside
  • the immobilization to the solid support may be very strong, yet non- covalent
  • biotinylated oligonucleotides can be made, which bind to surfaces covalently coated with streptavidin, resulting in attachment
  • the oligonucleotides may be synthesized on the surface, as is known in the art
  • photoactivation techniques utilizing photopolymenzatio ⁇ compounds and techniques are used
  • the nudeic acids can be synthesized in situ, using well known photolithographic techniques, such aa those described in WO 95/25116, WO 95/35505, U S Patent Nos 5,700,637 and 5,445,934, and references cited within, all of which are expressly incorporated by reference, these methods of attachment form the basis of the Affimetrix GeneChipTM technology
  • gene expression can also be quantified using hquid-phasa arrays
  • hquid-phasa arrays One such system is kinetic polymerase chain reaction (PCR)
  • Kinetic PCR allows for the simultaneous amplification and quantification or specific nucleic acid sequences
  • the specificity Is derived from synthetic oligonucleotide primers designed to preferentially adhere to single-stranded nucleic a d sequences bracketing the target site.
  • This pair of oligonucleotide primers form specific, non-covalently bound complexes on each strand of the target sequence
  • These complexes facilitate in vitro transcription of double-stranded DNA in opposite orientations
  • Temperature cycling of the reaction mixture creates a continuous cycle of primer binding, transcription, and re-melting of the nucleic acid to individual strands.
  • the result is an exponential increase of the target dsDNA product
  • This product can be quantified in real time either through the use of an intercalating dye or a sequence specific probe.
  • SYBR ® Greene I is an example of an intercalating dye, that preferentially binds to dsDNA resulting in a concomitant increase in the fluorescent signal.
  • Sequence specific probes such as used with TaqMan ® technology, consist of a fluorochrome and a qua ⁇ ching molecule covalently bound to opposite ends of an oligonudeotide.
  • the probe is designed to selectively bind the target DNA sequence between the two primers.
  • the fluorochrome is cleaved from the probe by the exonuclease activity of the polymerase resulting in signal dequenching
  • the probe signaling method can be more specific than the intercalating dye method, but In each case, signal strength is proportional to the dsDNA product produced.
  • Each type of quantification method can be us ⁇ d In multi- well liquid phase arrays with each well representing primers and/or probes specific to nucleic acid sequences of interest When used with messenger RNA preparations of tissues or cell lines, and an array of probe/primer reactions can simultaneously quantify the expression of multiple gene products of interest See Qermer, S., et al , Genome Res. 10 258-266 (2000), Heid, C. A , at al.. Genome Res. 6. 986-994 (1996).
  • HIPK1 nucleic acids encoding HIPK1 proteins are used to make a variety of expression vectors to express HIPK1 proteins which can then be used in screening assays, as described below.
  • the expression vectors may be either self-replicating extrachromosomal vectors or vectors which integrato Into a host genome Generally, these expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleic add encoding a HIPK1 protein
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism
  • the control sequences that are suitable for prokaryotes for example, Include a promoter, optionally an operator sequence, and a ⁇ bosome binding site Eukaryotic cells are known to utilize promoters, polyade ⁇ ylatjon signals, and enhancers.
  • Nucleic acid is "operably linked” v/he ⁇ it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it Is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation
  • "operably linked” means that the DNA sequences baing linked are contiguous, and, in the case of a secretory lea ⁇ er, contiguous and in reading phase
  • enhancers do not have to be contiguous Linking is accomplished by ligation at convenient restriction sites If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice
  • the transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences and enhancer or activator sequences
  • the regulatory sequences include a promoter and transc ⁇ ptio ⁇ al start and stop sequences
  • Promoter sequences encode either constitutive or inducible promoters
  • the promoters may be either naturally occurring promoters or hybrid promoters Hybrid promoters, which combine elements of more than one promoter, are also known in the art, and are useful in the present invention
  • the expression vector may comprise additional elements
  • the expression vector may have two replication systems, thus allowing it to be maintained m two organisms, for example in mammalian or insect cells for expression and in a pr ⁇ caryotic host for cloning and amplification
  • the expression vector contains at least one sequence homologous to the host cell genome, and preferably two homologous sequences which flank the expression construct
  • the integrating vector may be directed to a specific locus in the host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are well known in the art
  • the expression vector contains a selectable marker gene to allow the selection of transformed host calls Selection genes are woll known in the art and will vary
  • the HIPK1 proteins of the present invention are produced by cultunng a host ceil transformed with an expression vector containing nucleic acid encoding a HIPK1 protein, under the appropriate conditions to Induce or cause expression of HIPK1 protein
  • the conditions appropriate for HIPK1 protein expression will vary with the choice of the expression vector and the host cell, and will be easily ascertained by one skilled in the art through routine experimentation
  • the use of constitutive promoters in the expression vector will require optimizing the growth and proliferation of the host cell, while the use of an inducible promoter requires the appropriate growth conditions for induction
  • the timing of the harvest is important
  • the baculoviral systems used In Insect cell expression are lytic viruses, and thus harvest time selection can be crucial for product yield
  • Appropriate host cells include yeast, bacteria, archaebactena, fungi, and insect plant and animal cells, including mammalian cells Of particular interest are DrosophUa melanogaster cells Saccharomycos cer ⁇ visia ⁇ and other yeasts, E coli, Bacillus subtltis, Sf9 cells, C129 cells, 293 cells, ⁇ /e ⁇ /rospora, BHK CHO, COS, HeLa cells, THP1 cell line (a macrophage cell line) and human cells and cell lines
  • HIPKl protein Is expressed in mammalian cells Mammalian expression systama are also known in the art, and include retroviral systems
  • a preferred expression vector system is a retroviral vector system such as Is generally described in PCT/US97/O1019 and PCT/US97/01048, both of which are hereby expressly incorporated by reference
  • mammalian promoters are the promoters from mammalian viral genes, since the viral genes are often highly expressed and have a broad host range Examples include the SV40 early promoter mouse mammary tumor virus LTR promoter, adenovirus major late promoter, herpes simplex virus promoter and the CMV promoter
  • transcription termination and polyadenylatlon sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence
  • transcription terminator and polyadenylatlon signals include those derived form SV40
  • HIPK1 proteins are expressed in bactenal systems.
  • Bacterial expression systems are well known in the art Promoters from bactenophage may also be used and ara known In the art
  • synthetic promoters and hybrid promoters are also useful, for example, the tac promoter is a hybnd of the trp and lac promoter sequences
  • a bactenal promoter can include naturally occurring promoters of non-bactenal origin that have the ability to bind badenal RNA polymerase and initiate transcription
  • the expression vector may also include a signal peptide sequence that provides for secretion of HIPK1 protein in bacteria, The protein is either secreted into the growth media (gram-positive bactena) or Into the p ⁇ nplasmic space, located oetween the inner and outer membrane of the cell (gram-negative bacteria)
  • the bacterial expression vector may also Indude a selectable marker gene to allow for the
  • Selectable markers also include biosynthetic genes, such as those in the histidine. tryptophan and leucine biosynthetic pathways. These components are assembled into expression vectors
  • Expression vectors for bacteria are well known in the art, and include vectors for Bacillus subtitis, E. coli, Streptococcus cremoris, and Streptococcus livid ⁇ ns, among others
  • the bacterial expression vectors are transformed into bacterial host cells using techniques well known in the art, such as calcium chloride treatment, ⁇ lcctroporalion, and others
  • HIPK1 proteins are produced in insect cells
  • Expression vectors far the transformation of insect cells, and in particular, baculovirus-based expression vectors, are well known
  • HIPK1 protein is produced in yeast cells Yeast expression systems are well known in the art, and indude expression vectors for Saccharomyc ⁇ s csrevisiae, Candida albicans and C. maltosa, Hans ⁇ nula polymorpha, Kluyv ⁇ romyces frag s and K. lactis, Ptchia g ⁇ illenmondii and P pastons, Schizosaccharomyces pombe, and Yarrowia hpolytlca
  • HIPK1 protein may also be made as a fusion protein, using techniques well known in the art Thus, for example, for the creation of monoclonal antibodies If the desired epitope is small, a HIPK1 protein may be fused to a earner protein to form an immun ⁇ gen Alternatively, a HIPK1 protein may be made as a fusion protein to increase expression, or for other reasons For example, when a HIPK1 protein is a HIPK1 peptide, the nucleic acid encoding the peptide may be linked to other nudeic acid for expression purposes
  • the HIPK1 nucleic ac ⁇ d9, proteins and antibodies of the invention are labeled
  • labeled herein is meant that a compound has at least one element isotope or chemical compound attached to enable the detection of the compound.
  • labels fall mto three stoneses a) isot ⁇ pic labels, which may be radioactive or heavy Isotopes, b) immune labels, which may be antibodies or antigens, and c) colored or fluorescent dyes
  • the labels may be incorporated into a HIPK1 nudeic acids, proteins and antibodies at any position
  • the label should be capable of producing, either directly or indirectly, a detectable signal
  • the detectable moiety may be a radioisotope, such as 3 H, C M P 35 S, or ,2S I, a fluorescent or chemilum esce ⁇ t compound, such as fluorescein isothiocyanate, rhodaml ⁇ e, or luclferin, or an enzyme, such as alkaline phosphatase, bata- galactosldase or horseradish peroxidase.
  • the present invention also provides HIPK1 protein sequences.
  • a HIPK1 protein of the present invention may be identified in several ways. "Protein” in this sense includes proteins, polypeptides, and peptides.
  • the nucleic acid sequences of the invention can be used to generate protein sequences. There are a variety of ways to do this, including doni ⁇ g the entire gene and verifying its frame and amino acid sequence, or by oomparing it to known sequences to search for homology to provide a frame, assuming a HIPK1 protein has homology to some protein in the database being used.
  • the nudeic acid sequences are input into a program that will search all three frames for homology.
  • the program is blastx or blastn.
  • the database is nr.
  • the input data is as "Sequence in FASTA format”.
  • the organism list is "none”.
  • the "expect 1* Is 10; the filter is default.
  • the "descriptions” Is 500. trie “alignments” is 500, and the “alignment view” is pairwise.
  • the "Query Genetic Codes” is standard (1).
  • the matrix Is BLOSUM62; gap existence cost is 11 , per residue gap cost is 1 ; and the lambda ratio is .85 default This results in the generation of a putative protein sequence.
  • HIPK1 proteins are a ino acid variants of the naturally occurring sequences, as determined herein.
  • the variants are preferably greater than about 75% homologous to the wild-type sequence, more preferably greater than about 80%, even more preferably greater than about 85% and most preferably greater than 90%.
  • the homology will be as high as about 93 to 95 or 98%.
  • nucleic acids homology in this context means sequence similarity or Identity, with identity being preferred. This homology will be determined using standard techniques known in the art as are outlined above for the nucleic acid hom ⁇ l ⁇ gies.
  • HIPK1 proteins of the present invention may be shorter or longer than the wild type amino acid sequences.
  • included within the definition of HIPK1 proteins are portions or fragments of the wild type sequences herein.
  • the HIPK1 nucleic acids of the invention may be used to obtain additional coding regions, and thus additional protein sequence, using techniques known in the art.
  • the HIPK1 proteins are derivative or variant HIPK1 proteins as compared to the wild-type sequence. That is, as outlined more fully below, the derivative HIPK1 peptide will contain at Isast one amino aoid substitution, deletion or insertion, with amino acid substitutions being particularly preferred. The amino acid substitution, insertion or deletion may occur at any residue within a HIPK1 peptide.
  • Al ⁇ o included in an embodiment of H1PK1 proteins of the present Invention are amino acid sequence variants. These variants fall Into one or more of three classes: substitutional, insertional or deletional variants. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding a HIPK1 protein, using cassette or PCR mutagena ⁇ is or other techniques well known In the art, to produce DNA encoding the variant and thereafter expressing the DNA in recombinant cell culture as outlined above. However, variant HIPK1 protein fragments having up to about 100-150 residues may be prepared by in vitro synthesis using established techniques.
  • Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allellc or interspecies variation of a HIPK1 protein amino acid sequence.
  • the variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected which have modified characteristics as will be more fully outlined below.
  • the mutation per so need not be predetermined.
  • random mutagenesis may be conducted at the target codon or region and the expressed HIPK1 variants screened for the optimal combination of desired activity.
  • Techniques for making substitution mutations at predetermined sites In DNA having a known sequence are well known, for example, M13 primer mutagenesis and LAR mutagenesis, Screening of the mutants is done using assays of HIPK1 protein activities.
  • Amino add substitutions are typically of single residues; insertions usually will be on the order of from about 1 to 20 aml ⁇ o adds, although considerably larger insertions may be tolerated. Deletions range from about 1 to about 20 residues, although In some cases deletions may be much larger.
  • substitutions that are less conservative than those shown in Chart I
  • substitutions may be made which more significantly affect, the structure of the polypeptide backbone In the area of the alteration, for example the alpha-helical or beta-sheet structure, the charge or hydrophobicity of the molecule at the target site, or the bulk of the side chain
  • substitutions which in general are expected to produce the greatest changes In the polypeplide's properties are those In which (a) a hydrophilic residue, e.g. seryl or threonyl is substituted far (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylala ⁇ yl. valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an amino acid residue, e.g. seryl or threonyl is substituted far (or by) a hydrophobic residue, e.g. leucyl
  • electropositive side chain e g. lysyl, argi ⁇ yl, or histidyl
  • an electronegative residue e g. glulamyl or aspartyl
  • a residue having a bulky side chain e g phenylalanine, is substituted for (or by) one not having a side chain, ⁇ ,g, glyd ⁇ e.
  • variants typically exhibit the same qualitative biological activity and will elicit the same immune response as the naturally-occurring analogue, although variants also are selected to modify the 3 characteristics of the HIPKl proteins as needed Alternatively, the variant may be designed such that the biological activity of a HIPK1 protein is altered. For ⁇ xemple, glycosylation sites may be altered or removed, dominant negative mutations created, etc.
  • Covalent modifications of HIPK1 polypeptides are included within the scope of this invention, for example for use in screening
  • One type of covalent modification includes reacting targeted am o acid 3 residues of a HIPK1 polypeptide with an organic de ⁇ vatizing agent that is capable of reacting with selected side chains or the N-or C-termi ⁇ al residues of an H1PK1 polypeptide
  • De ⁇ vateatlon with bifunctional agents is useful, for Instance for crosslinking HIPK I to a water-insoluble support matrix or surface for use in the method for purifying anti-HIPKl antibodies or screening assays, as is more fully described below
  • Commonly used crosslinking agents include, e g , 1 ,1-bis(dlazoacetyl)-2- phe ⁇ ylethane, glutaraldehyde.
  • N-hydroxysuccimr ⁇ ide esters for example estors with 4-az ⁇ dosal ⁇ cylic acid, homobifunctional imido ⁇ sters, including disuccinimidyl esters such as 3,3'- d ⁇ th ⁇ ob ⁇ s(succ ⁇ m ⁇ dylproplonate), bifunctional male mides such as b ⁇ s-N-ma)e ⁇ m ⁇ do-1, ⁇ -octane and agents such as methyl-3-[( ⁇ -az ⁇ dophenyl)dith ⁇ o] ⁇ rop ⁇ oimidate
  • Another type of covalent modification of a HIPK1 polypeptide included within the scope of this invention comprises altering the native glycosylation pattim of the polypeptide "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence H1PK1 polypeptide, and/or adding one or more glycosylation sites that are not present in the native sequence HIPK1 polypeptide
  • Addition of glycosylation sites to HIPK1 polypeptides may be accomplished by altering the ammo acid sequence thereof The alteration may be made for example by the addition of. or substitution by one or more serine or threonine residues to the native sequence HIPK1 polypeptide (for O-linked glycosylation sites)
  • a HIPK1 ammo acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding a HIPK1 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids
  • HIPKl polypeptide Another means of Increasing the number of carbohydrate moieties on a HIPKl polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide Such methods are described In the art, e g , in WO 87/05330 published 11 September 1987 and in Aplln and W ⁇ sto ⁇ , LA Cm Rev Biochem , pp 259-306 (1981 )
  • Removal of carbohydrate moieties present on a HIPK1 polypeptide may be accomplished chemically or enzymatically or by mulational substitution of codons encoding for ammo acid residues that serve as targets for glycosylation
  • Chemical deglycosylatio ⁇ techniques are known in the art and described, for instance, by HaWmuddln, et al., Arch, Biochem. Biophys., 259"52 (1987) and by Edge et al , Anal. Biochem , 118 131 (1981 ).
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo-and exo-glycosidas ⁇ as d ⁇ acrib ⁇ d by Thotakura et al., Meth Enzymol , 138'350 (1987).
  • HIPK1 comprises linking a HIPK1 polypeptide to one of a variety of nonproteinaceous polymers, e g., polyethylene glycol, polypropylene glycol, or polyoxyalkyl ⁇ nes, in the manner set forth m U S Patent Nos 4,640,835, 4,496.689; 4,301 ,144, 4,670,417; 4,791,192 or 4,179,337.
  • nonproteinaceous polymers e g., polyethylene glycol, polypropylene glycol, or polyoxyalkyl ⁇ nes
  • HIPK1 polypeptides of the present invention may also be modified in a way to form chime ⁇ c molecules comprising a HIPK1 polypeptide fused to another, heterologous polypeptide or ammo acid sequence.
  • a chime ⁇ c molecule comprises a fusion of a HIPK1 polypeptide with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope Lag is generally placed at the amino-or carboxyl-termmus of a HIPK1 polypeptide. although Internal fusions may also be tolerated in some instances.
  • the presence of such epitope-tagged forms of a HIPK1 polypeptide can be deleded using an antibody against the tag polypeptide
  • provision of the epitope tag enables a HIPK1 polypeptide to bs raadlly purified by affinity punficalion using an anti- tag antibody or another type of affinity matrix that binds to the epitope tag
  • the chime ⁇ c molecule may comprise a fusion of a HIPK1 polypeptide with an immunoglobulin or a particular region of an immunoglobulln
  • such a fusion could be to the Fc region of an IgG molecule.
  • tag polypeptides and their respective antibodies are well known In the art Examples include poly-histidme (poly-hls) or poly-histidine-glyc e (poly-his-gly) tags, the flu HA tag polypeptide and its antibody 12CA5 [Field ⁇ t al , Mol. Cell. Biol , 8 2159-2165 (1988)]; tha o-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et at, Molecular and Cellular Biology.
  • Tag polypeptides include the Flag-peptid ⁇ [Hopp et al , BioTechnology, 6 * 1204-1210 (1988)], the KT3 epitope peptide [Martin et al , Science, 255.192-194 (1992)], tubuli ⁇ epitope peptide [Skinner et al . J.
  • HIPK1 protein also included with tha definition of HIPK1 protein
  • probe or degenerate polymerase chain reaction (PCR) primer sequences may be used to find other related HIPK1 proteins from humans or other organisms
  • particularly useful probe and/or PCR primer sequences include the unique areas of a HIPK1 nucleic acid sequ ⁇ ncg As is generally k ⁇ pw ⁇ in the art, preferred PCR primers are from about 16 to about 35 nucleotides in length, with from about 20 to about 30 being preferred, and may contain inosi ⁇ e as needed.
  • the conditions for the PCR reaction are wall known in the art
  • HIPK1 proteins can be made that are longer than those encoded by the nucleic adds of the figures, for example, by the elucidation of additional sequences, the addition of epitope or purification tags, the addition of other fusion sequences, etc
  • HIPK1 proteins may also be identified as being encoded by HIPK1 nucleic a ds. Thus, HIPK1 proteins are encoded by nucleic acids that will hybridize to the sequences of the sequence listings, or their complements, a ⁇ outlined herein.
  • the invention provides HIPK1 antibodies
  • a HIPK1 protein when a HIPK1 protein is to be used to generate antibodies, for example for immunotherapy, a HIPK1 protein should share at least one epitope or determinant with the full length protein
  • epitope or “determinant' * harem is meant a portion of a protein which will generate and/or bind an antibody or T- c ⁇ ll receptor in the context of MHC
  • epitope Is unique, that Is, antibodies generated to a unique epitope show little or no cross-reactivity
  • anubody' includes antibody fragments, as are known m the art, Including Fab, Fab 2 single chain antibodies (Fv for example), chimenc antibodies, etc , either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA technologies
  • polyclonal antibodies can be raised in a mammal, for example, by one or more Injections of an immunizing agent and, if desired, an adjuvant Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • the immunizing agent may Include a protein encoded by a nucleic acid of the figures or fragment thereof or a fusion protein thereof It may be useful to conjugate the Immunizing agent to a protein known to be Immunogenic m tha mammal being immunized.
  • immunogenic proteins include but are not limited to keyhole limpet hemocya ⁇ ln, serum albumin, bovine thyroglobu ⁇ , and soybean trypain inhibitor.
  • adjuvants which may be employed include Freund' ⁇ complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dlcorynomycolale)
  • the immunization protocol may be selected by one skilled in the art without undue axpe ⁇ mentatlon
  • the antibodies may alternatively, be monoclonal antibodies Monoclonal antibodies may be prepared using hyb ⁇ doma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
  • a mouse, hamster, or other appropriate host animal Is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro
  • the immunizing agent will typically include a polypeptide encoded by a nucleic acid of Tables 1 , 2, and 3 or fragment thereof or a fusion protein thereof Generally, either peripheral blood lymphocytes ("PBLs”) are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired.
  • PBLs peripheral blood lymphocytes
  • lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol, to for a hybridoma cell [Goding, Monoclonal Antibodies. Principles and Practice, Academic Press. (1986) pp 59-103].
  • a suitable fusing agent such as polyethylene glycol
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin Usually, rat or mouse myeloma cell lines are employed
  • the hybridoma calls may be cultured in a suitable culture medium that preferably contain* one or more substances that inhibit the growth or survival of the unfused, immortalized cells
  • a suitable culture medium that preferably contain* one or more substances that inhibit the growth or survival of the unfused, immortalized cells
  • the parental cells lack the enzyme hypoxanth e guanine phospho ⁇ bosyl tr ⁇ sferase (HGPRT or HPRT)
  • the culture medium for th ⁇ hybndomas typically will include hypoxanthme, ammopte ⁇ n, and thymid e ("HAT medium'), which substances prevent the growth of HGPRT-deflclent cells.
  • the antibodies are bispecific antibodies.
  • Bispe ⁇ fic antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens, In the present case, one of the binding specificities is for a protein encoded by a nucleic acid of the Tables 1 , 2, and 3, or a fragment thereof, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit, preferably one that is tumor specific
  • the antibodies to HIPK1 are capable of reducing or eliminating the biological function of HIPK1 as is described below That Is.
  • the addition of antl-HIPK1 antibodies (either polyclonal or preferably monoclonal) to HIPK1 (or cells containing HIPK1) may reduce or eliminate a HIPK1 activity Generally, at least a 25% decrease m activity is preferred, with at least about 50% being particularly preferred and about a 95-100% decrease being especially preferred.
  • the antibodies to the HIPK1 proteins are humanized antibodies
  • Humanized forms of non-human (e g murine) antibodies are chlme ⁇ c molecules of Immu ⁇ oglobu ns. imrnu ⁇ oglobul chains or fragments thereof (such as Fv Fab, Fab , F(ab') 2 or other antigen binding subsaque ⁇ ces of antibodies) which contain minimal sequence derived from non-human immunoglobuli ⁇ Humanized antibodies include human immunoglobulms (recipient antibody) In which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human spedes (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • Fv framework residues of the human immunoglobuli ⁇ are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • tha humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework residues (FR) regions are those of a human immunoglobuiln consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an Immunoglobuiln constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1086); Riechmann et at. Nature, 332:323-329 (1988): and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
  • Fc Immunoglobuiln constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeye ⁇ et at, Science, 239:1534-1535 (1988)]. by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by tha corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboo and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991 )].
  • the techniques of Cole et al. and Boar ⁇ er et al. ara also available for the preparation of human monoclonal antibodies [Cole et al.. Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boernar et al., J. Immunol., 147(1 ):86-95 (1991 )].
  • human antibodies can be made by introducing human immunoglobuiln loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, Including gene rearrangement, assembly, and antibody repertoire.
  • This approach is described, for example, in U.S. Patent Nos. 5.545,807; 5,545,806; 5.569,625; 5,625, 126; 5,633,425; 5,661 ,016, and in the following scientific publications: Marks et al..
  • Immunotherapy Is meant treatment of lymphoma with an antibody raised against a H1PK1 protein
  • Immunotherapy can be passive or active.
  • Passive immunotherapy as defined herein is the passive transfer of antibody to a recipient (patient).
  • Active immunization is the Induction of antibody and/or T-cell responses in a re ⁇ pient (patient).
  • Induction of an immune response is the result of providing the recipient with an antigen to which antibodies are raised.
  • the antigen may be provided by injecting a polypeptide against which antibodies are desired to be raised into a recipient, or contacting the recipient with a nucleic acid capable of expressing the antigen and under conditions for expression of the antigen
  • the antibody is conjugated to a therapeutic moiety.
  • the therapeutic moiety is a small molecule that modulates the activity of a HIPK1 protein.
  • the therapeutic moiety modulates the activity of molecules associated with or in close proximity to a HIPK1 protein
  • the therapeutic moiety may inhibit enzymatic activity such as protease or protein kinase activity associated with lymphoma.
  • the therapeutic moiety may also be a cyt ⁇ toxic agent.
  • targeting the cy toloxic agent to tumor tissue or cells results in a reduction in the number of afflicted cells, thereby reducing symptoms associated with lymphoma.
  • Cytotoxlc agents are numerous and varied and include, but are not limited to, cytotoxic drugs or toxins or active fragments of such toxins. Suitable toxms and their corresponding fragments include diphthe ⁇ a A cham, exotoxin A chain, rlcln A chain, ab ⁇ n A chain, curcln, crotl ⁇ , phe ⁇ omycin, enomycm and the like.
  • Cytotoxic agents also Indude radiochemic ⁇ ls made by conjugating radioisotopes to antibodies raised against HIPK1 proteins, or binding of a radlonuc de to a chelat g agent that has been covalently attached to the antibody.
  • Targeting the therapeutic moiety to transmembrane HIPK1 proteins not only serves to increase the local concentration of therapeutic moiety in the lymphoma, but also serves to reduce deleterious side effects that may be associated with the therapeutic moiety,
  • a HIPK1 protein against which the antibodies are raised is an intracellular protein
  • the antibody may be conjugated to a protein which facilitates entry into the cell.
  • the antibody enters the cell by endocytosis
  • a nucleic acid encoding the antibody is administered to the individual or cell
  • an antibody thereto contains a signal for that target localization, i e , a nudear localization signal
  • the HIPK1 antibodies of tha invention specifically bind to H1PK1 proteins.
  • specifically bind herein is meant that the antibodies bind to the protein with a binding constant in the range of at least 10"*- 10"* M " ⁇ with a preferred range being 1Q "7 - 10 "9 M” ⁇
  • a HIPKl protein is purified or isolated after expression.
  • HIPK1 proteins may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including Ion exchange, hydrophobic, affinity, and reverse-phase HPtC chromatography, and chromatofocusing,
  • a HIPK1 protein may be purified using a standard a ⁇ tl-G,a antibody column.
  • Ultraflltration and diafiltration techniques In conjunction with protein concentration, are also useful.
  • suitable purification techniques see Scopes, R., Protein Purification, Springer- eriag, NY (1982). The degree of purification necessary will vary depending on the use of a HIPK1 protein. In some instances no purification will be necessary.
  • tha HIPK1 proteins and nucleic acids are useful in a number of applications.
  • the expression levels of genes are determined for different cellular states In the lymphoma phenotype; that is, the expression levels of genes in normal tissue and in lymphoma tissue (and in some cases, for varying severities of lymphoma that relate to prognosis, as outlined below) are evaluated to provide expression profiles.
  • An expression profile of $ particular cell state or point of development Is essentially a "fingerprint" of the state; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that Is unique to the state of the cell.
  • information regarding which genes are important is important (including both up- and down- regulation of genes) in each of these states is obtained. Then, diagnosis may be done or confirmed: does tissue from a particular patient have the gene expression profile of normal or lymphoma tissue.
  • differential expression refers to both qualitative as well as quantitative differences in the genes' temporal and/or cellular expression patterns within and among the cells.
  • a differentially expressed gene can qualitatively have its expression altered, including an activation or i ⁇ activation. in, for example, normal versus lymphoma tissue. That is, genes may be turned on or turned off in a particular state, relative lo another state. As Is apparent to the skilled artisan, any comparison of two or more states can be made. Such a qualitatively regulated gene will exhibit an expression pattern within a state or cell type which is detectable by standard techniques in one such state or cell type, but Is not detectable in both.
  • the determination is quantitative in that expression is increased or decreased; that Is, the expression of the gene is either upregulated, resulting if) s increased amount of transcript, or downregulat ⁇ d, resulting in a decreased amount of transcript
  • the degree to which expression differs need only be large enough to quantify via standard characterization techniques as outlined below, such as by use of Affymetrlx GeneChipTM expression arrays, Lockhart, Nature Biotechnology, 14:1675-1680 (1996), hereby expressly
  • the change in expression is at least about 60%. More preferably at least about 100%, more preferably at least about 130%, more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.
  • this may be done by evaluation at either the gene transcript, or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes to the DNA or RNA equivalent of the gene transcript, and the quantification of gene expression levels, or, alternatively, the final gene product Itself (protein) can be monitored, for example through the use of antibodies to a HIPK1 protein and standard immunoassays (ELISAs, etc.) or other techniques, including mass spectroscopy assays, 2D gel electrophoresis assays, etc.
  • ELISAs standard immunoassays
  • the proteins corresponding to HIPKl genes i.e. those Identified as being important in a lymphoma phenotype, can be evaluated in a lymphoma diagnostic test.
  • gene expression monitoring Is dons and a number of genes, i.e. an expression profile, is monitored simultaneously, although multiple protein expression monitoring can be done as well. Similarly, these assays may be done on an individual basis as well.
  • the HIPK1 nucleic acid probes may be attached to biochips as outlined herein for the detection and quantification nf HIPK1 sequences in a particular call.
  • the assays are done as is known in the art. As will be appreciated by those in the art, any number of different HIPK1 sequences may be used as probes, with single sequence assays being used in some cases, and a plurality of the sequences described herein being used in other embodiments. In addition, while solid-phase 89says are described, any number of solution based assays may be done as well.
  • both solid and solution based assays may be used to detect HIPK1 sequences that are up-regulated or down-regulated in lymphoma as compared to normal lymphoid tissue, In instances where a HIPK1 sequence has been altered but shows the same expression profile or an altered expression profile, the protein will be detected as outlined herein
  • nucleic acids encoding a H1PK1 protein are detected
  • DNA or RNA encoding a HIPK1 protein may be detected of particular interest are mettiods wherem the mRNA encoding HIPK1 protein is detected
  • the presence of mRNA in a sample is an indication that a HIPK1 gene has been transcribed to form the mRNA and suggests that the protein is expressed
  • Probes to detect the mRNA can be any nucleotlde/de ⁇ xynucleotide probe that is complementary to and base pairs with the mRNA and indudes but is not limited to oligonucleotides, cDNA or RNA
  • HIPKl proteins antibodies nucleic acids modified HIPK1 proteins and cells containing HIPK1 sequences are used in diagnostic assays This can be done on an individual gene or corresponding polypeptide level, or as sets of assays
  • HIPK1 proteins find use as markers of lymphoma. Detection of these proteins in putative lymphomic tissue or patients allows for a determination or diagnosis of lymphoma Numerous methods known to those of ordinary skill in the art find use in detecting lymphoma
  • antibodies ara used to detect HIPK1 proteins
  • a prefened method separates proteins from a sample or patient by electrophoresis on a gel (typically a denaturing and reducing protein gel but may be any other type of gel induding isoelectric focusing gels and the like) Following separation of proteins a HIPK1 protein Is detected by immunoblotlmg with antibodies raised agamst a HIPK1 protein Methods of immunoblotting are well known to those of ordinary skill in the art
  • antibodies to a HIPK1 protein find use in in situ imaging techniques
  • cells are contacted with from one to many antibodies to a HIPK1 prote (s) Following washing to remove non-specrfic antibody binding the presence of (ho antibody or antibodies is detected
  • the antibody is detected by incubating with a secondary antibody that contains a detectable label
  • the primary antibody to a HIPK1 prot ⁇ ln(s) contains a delectable label
  • each one of multiple primary antibodies contains a distinct and detectable label. This method finds particular use in simultaneous screening for a plurality of HIPK1 proteins. As will be appreciated by one of ordinary skill in the art, numerous other histological imaging techniques are useful In the invention.
  • the label Is detected in a fluorometer which has the ability to detect and distinguish emissions of different wavelengths.
  • a fluorescence activated cell sorter FACS
  • FACS fluorescence activated cell sorter
  • in situ hybridization of labeled HIPKT nucleic acid probes to tissue arrays is done.
  • arrays of tissue samples including leuke le/lymphoma tissue and/or normal tissue, are made.
  • sttu hybridization as is known in the art can then be done.
  • the HIPK1 proteins, antibodies, nucleic acids, modified HIPK1 proteins and cells containing HIPK1 sequences are used in prognosis assays.
  • gene expression profiles can be generated that correlate to lymphoma severity, in terms of long term prognosis. Again, this may be done on either a protein or gene level, with the use of genes being preferred.
  • the HIPK1 probes are attached to biochips for the detection and quantification of HIPK1 sequences in a tissue or patient The assays proceed as outlined for diagnosis,
  • any of the HIPK1 sequences as described herein are used In drug screening assays.
  • the HIPK1 proteins, antibodies, nucleic adds, modified HIPK1 proteins and cells containing HIPK1 sequences are used In drug screening assays or by evaluating the effect of drug candidates on a "gene expression profile" or expression profile of polypeptides.
  • the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, Zlokarnik, et al., Science 279. 84-8 (1998). Heid. et at, Genome Res., 6:986-994 (1996).
  • the HIPK1 proteins, antibodies, nudeic acids, modified HIPK1 proteins and cells containing the native or modified HIPK1 proteins are used In screening as ⁇ ays. That ie, the present invention provides novel methods for screening for compositions which modulate the lymphoma phenotype. As above, this can be done by screening for modulators of gene expression or for modulators of protein activity. Similarly, this may be done on an individual gene or protein level or by evaluating the effect of drug candidates on a "gene expression profile".. In a preferred embodiment the expression profiles are used, preferably in conjunction with high throughput ocreening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, see Zlokamik, supra.
  • assays may be run on an individual gene or protein level. That is, having identified a particular gene as aberrantly regulated in lymphoma, candidate bioactive agents may be screened to modulate the gene's response, "Modulation" thus includes both an increase and a decrease in gene expression or activity.
  • the preferred amount of modulation will depend on the original change of the gene expression in normal versus tumor tissue, with changes of at least 10%, preferably 50%. more preferably 100-300%, and in some embodiments 300-1000% or graater.
  • a gene exhibits a 4 fold increase in tumor compared to normal tissue, a decrease of about four fold Is desired; a 10 fold decrease in tumor compared to normal tissue gives a 10 fold increase In expression for a candidate agent is desired, etc.
  • a HIPK1 sequence has been altered but shows the same expression profile or an altered expression profile, the protein will be detected as outlined herein.
  • this may be done by evaluation at either the gene or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, the level of the gene product itself can be monitored, for example through the use of antibodies to a HIPK1 protein and standard immunoassays, Alternatively, binding and bioactlvity assays wilh the protein may be done as outlined below.
  • gene expression monitoring is done and a number of genes, I e. an expression profile, la monitored simultaneously, although multiple protein expression monitoring can be done as well.
  • the HIPK1 nucleic acid probes are attached to biochips as outlined herein for the detection and quantification of HIPKl sequences in a particular cell, The assays are further described below.
  • a candidate bioactive agent is added to the cells prior to analysis.
  • screens are provided to Identify a candidate bioactive agent which modulates lymphoma, modulates HIPK1 proteins, binds to HIPK1 protein, or interferes between the binding of HIPK1 protein and an antibody.
  • candidate bioactive agent or “drug candidate” or grammatical equivalents as used herein describes any molecule, e.g., protein, oligopeptide, small organic or inorganic molecule, polysaccharide, polynucleotide, etc., to be tested for bioactive agents that are capable of directly or Indirectly altering either the lymphoma phenotype.
  • the candidate agent suppresses a lymphoma/leukemla associated (LA) phenotype, for example to a normal tissue fingerprint.
  • LA lymphoma/leukemla associated
  • the candidate agent preferably suppresses a sever ⁇ LA phenotype.
  • a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations, Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below Ihe level of detection.
  • a candidate agent will neutralize the effect of a HIPK1 protein.
  • neutralize i ⁇ meant that activity of a protein Is either inhibited or counter acted against so as to have substantially no effect on a cell.
  • Candidate agents encompass numerous chemical classes, though typically they are organic or inorganic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Preferred small molecules are less than 2000. or less than 1500 or less than 1000 or less than 500 D.
  • Candidate agents comprise functional groups necessary for structural Interaction with proteins, particularly hydrogan bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably al least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or pdyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidlnes, derivatives, structural analogs or combinations thereof. Particularly preferred are peptides.
  • Candidate agents are obtained from a wide variety of sources induding libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules. including expression of randomized Oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced, Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation.
  • the candidate bioactive agents are proteins
  • protein herein is meant at least two covalently attached am o acids, which includes proteins, polypeptides, oligopeptides and peptides.
  • the protein may be made up of naturally occurring am o acids and peptide bonds, or synthetic peptidomimellc structures.
  • ammo acid or "peptide residue”, as used herein means both naturally occurring and synthetic a ino acids
  • homo-phenylalanme, citrullme and ⁇ orsleuci ⁇ e are considered amino acids for the purposes of the invention
  • Am o acid ' also Includes i o acid residues such as prolme and hydr ⁇ xyprol e
  • the side chains may be in either tha (R) or the (S) configuration
  • the am o acids are in the (S) or L-configuratlon If non-naturally occurnng side chains are used, non-ammo acid substituents may be used for example to prevent or retard in vivo degradations
  • the candidate bioactive agents are naturally occurring proteins or fragments of naturally occurring proteins
  • cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts may be used
  • libraries of procaryotic and eucaryobc proteins may be made for screening in the methods of the invention.
  • Particularly preferred in this embodiment are libraries of bacterial fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred
  • the candidate bioactive agents are peptides of from about 5 to ahout 30 amino acids with from about 5 to about 20 ammo acids being preferred and Tram about 7 to about 15 being particularly preferred
  • the peptides may be digests of naturally occurring proteins as is outlined above random peptides or "biased ' random peptides
  • randomized or grammatical equivalents herein is meant that each nudeic acid and peptide consists of essentially random nucleotides and ammo acids, respectively S ce generally these random peptides (or nucleic acids, discussed below) are chemically synthesized they may incorporate any nucleotide or ammo acid at any posibon
  • the synthetic process can be designed to generate randomized proteme or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence thus forming a library of randomized candidate bioactive proteinaceous agents
  • the library Is fully randomized, with no sequence preferences or constants at any position
  • the library is biased That is, so a positions within the sequence are either held constant, or are selected from a limited number of possibilities
  • the nucleotides or ammo acid residues are randomized within a defined class for example, of hydrophobic am o acids, hydrophilic residues, stencally biased (either small or large) residues towards the creation of nucleic acid binding domains the creation of cystelnes.
  • the candidate bioactive agents are nucleic acids, as defined above.
  • nucleic acid candidate bioaotive agents may be naturally occurring nucleic a ds, random nucleic acids, or "biased" random nucleic acids.
  • digests of procaryotic or eucaryotic genomes may be used as is outlined above for proteins.
  • the sample containing the target sequences to ba analyzed is added to the biochip.
  • the target sequence is prepared using known techniques, For example, the sample may be treated to lys ⁇ the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR occu ⁇ i ⁇ g as needed, as will be appreciated by those in the art.
  • nucleic acids are labeled with a label as defined herein, with biotin-FlTC or PE, cy3 and cy5 being particularly preferred.
  • the target sequence is labeled with, for example, a fluorescent, chemlluminescent, chemical, or radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe.
  • the label also can be an enzyme, such as, alkaline phosphat ⁇ aa or horseradish peroxidase. which wnen provided with an appropriate substrata produces a product that can be detected.
  • the label can be a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme.
  • the label also can be a moiety or compound, such as, an epitope tag or blotl ⁇ which specifically binds to streptavidin.
  • the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence, As known in the art, unbound labeled streptavidin is removed prior to analysis.
  • these assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as Is generally outlined in U.S. Patent Nos. 5,681,702, 5,597,909, 5,545,730. 5,594,117, 5,591 ,584, 5,571 ,670. 5,580,731, 5,571.670, 5,591,584, 5,624,802. 5,635,352, 5,594,118, 5,359,100, 5, 124,246 and 5,681,697, all of which are hereby incorporated by reference.
  • the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex.
  • hybridization conditions may be used in the present invention, including high moderate and low stringency conditions as outlined above
  • the assays are generally run under stnng ⁇ ncy conditions which allows formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc
  • reaction may include a va ⁇ ety of other reagents may be Included in the assays These include reagents Ilka salts, buffers, neutral proteins ⁇ g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, ⁇ ucleas ⁇ inhibitors, anli-microblal agents, etc., may be used, depending on the sample preparation methods and purity of the target In addition, either solid phase or solution based (l.e , kinetic PCR) assays may be used
  • the data is analyzed to determine the expression levels, and changes in expression levels as between states, of individual genes forming a gene expression profile
  • screens can be run to alter the expression of the genes individually That is, screening for modulation of regulation of expression of a single gane can be done Thus for example, particularly the case of target genes whose presence or absence is unique between two states screening is done for modulators of the target gene expression
  • screens can be done for novel genes that are induced in response to a candidate agent After identifying a candidate agent based upon its ability to suppress a HIPK1 expression pattern leading to a normal expression pattern, or modulate a single HIPK1 gene expression profile so as to mimic the expression of the gene from normal tissue, a screen as described above can be performed to identify genes that are specifically modulated In response to the agent Comparing expression profiles between normal tissue and agent treated tA tissue reveals genes that are not expressed In normal tissue or LA tissue, but are expressed in agent treated tissue.
  • agent specific sequences can be identified and used by any of the methods described herein for HIPK1 genes or proteins. In particular these sequences and the proteins they encode find use In marking or identifying agent treated cells.
  • antibodies can be raised against the agent induced proteins and used to target novel therapeutics to the treated LA tissue sample.
  • a candidate agent is administered to a population of LA cells, that thus has an associated HIPK1 expression profile.
  • administration or “contacting” herein is meant that the candidate agent is added to the cells in such a manner as to allow the agent to act upon the cell, whether by uptake and Intracellular action, or by action at the cell surface.
  • nucleic acid encoding a proteinaceous candidate agent i.e. a peptide
  • the cells can be washed if desired and are allowed to incubate under preferably physiological conditions for some period of time.
  • the ceils are then harvested and e new gene expression profile is generated, as outlined herein.
  • LA tissue may be screened for agents that reduce or suppress the LA phenotype.
  • a change in at l&ast one gene of the expression profile indicates that the agent has an effect on HIPK1 activity.
  • screens for new drugs thai alter the phenotype can be devised. With this approach, the drug target need not be known and need not be represented In the original expression screening platform, nor does the level of transcript for the target protein need to change.
  • screens may be done on individual genes and gene products (proteins). That is, having identified a particular differentially expressed gene as important In a particular state, screening of modulators of either the expression of the gene or tha gene product itself can be done.
  • a HIPK1 product may be a fragment, or alternatively, be the full length protein to the fragment encoded by the nucleic acids of the figures.
  • a HIPK1 is a fragment.
  • the sequences are sequence variants as further described herein.
  • a HIPK1 is a fragment of approximately 14 to 24 amino acids long. More preferably the fragment is a soluble fragment Preferably, the fragment includes a non-transmembrane region. In a preferred embodiment, the fragment has an N-tsrmlnal Cys to aid in solubility. In one embodiment, the c-terminua of the fragment is kept as a free acid and the n-terminus is a free amine to aid in coupling, I.e., to cysteine. In one embodiment, the HIPK1 proteins are conjugated to an immunogenic agent as discussed herein in one embodiment a HIPK1 protein is conjugated to BSA.
  • screens for agents that alter the biological function of the expression product of a HIPK1 gene are done. Again, having identified tha Importance of a gene in a particular state, screening for agents that bind and/or modulate the biological activity of the gene product can be run as is more fully outlined below.
  • screens are designed to first find candidate agents that can bind to H1PK1 proteins, and then these agents may be used essays that evaluate the ability of the candidate agent to modulate a HIPK1 activity and the lymphoma phenotype.
  • binding assays are done.
  • purified or isolated gene product is used, that is, the gene products of one or more H1PK1 nucleic acids are made.
  • this Is done as is known In the art.
  • antibodies are generated to the protein gene products, and standard immunoassays are run to determine the amount of protein present.
  • cells comprising the H1PK1 proteins can be used in the assays.
  • the methods comprise combining HIPK1 protein and a candidate bioactive agent, and determining the binding of the candidate agent to a HIPK1 protein.
  • Preferred embodiments utilize the human or mouse HIPK1 protein, although other mammalian proteins may also be used, for example for the development of animal models of human disease.
  • variant or derivative HIPK1 proteins may be used
  • a HIPK1 protein or the candidate agent Is non-diffusably bound to an insoluble support having Isolated sample receiving areas (e.g. a microtiter plate, an array, etc.).
  • the insoluble supports may be made of any composition to which the compositions can be bound, is readily separated from soluble material, and i ⁇ otherwise compatible with the overall method of screening.
  • the surface of such supports may be solid or porous and of any convenient shape.
  • suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g., polystyrene), polysaccha ⁇ de ⁇ , nylon or nitrocellulose, Teflon ' TM, etc.
  • Microtiter plates and arrays are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples
  • the particular manner of binding of the composition is not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition and is nondiffusable
  • Preferred methods of binding include the use of antibodies (which do not sterically block either the ligand binding site or activation sequence when the protein is bound to the support), direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or agent, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety ; .
  • BSA bovine serum albumin
  • a HIPK1 protein is bound to the support, and a candidate bioactive agent is added to the assay.
  • the candidate agent is bound to the support and a HIPK1 protein is added.
  • Novel binding agents include specific antibodies, non-natural binding agents identified In screens of chemical libraries, peptide analogs, etc. Of parUcular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.
  • the determination of the binding of the candidate bioactive agent to a HIPK1 protein may be done In a number of w ⁇ ys.
  • the candidate bioactive agent is labeled, and binding determined directly. For example, this may be done by attaching all or a portion of a HIPK1 prolein to a solid support, adding a labeled candidale agent (for example a fluorescent label), washing off excess reagent, and determining whether the label Is present on the solid support Various blocking and washing steps may be utilized as is known in the art.
  • label herein is meant that the compound is either directly or indirectly labeled with a label which provides a detectable signal, e.g. radlolsotope, fluorescers, enzyme, antibodies, partides such as magnetic particles, chemilu inescers. or spedfic binding molecules, etc.
  • Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
  • the complementary member would normally be labeled with a molecule which provides for detection, in accordance with known procedures, as outlined above.
  • the label can directly or indirectly provide a detectable slgnaL
  • the proteins may be labeled at tyrosine positions using ,2S I, or with fluorophores.
  • more than one component may be labeled with different labels: using l for the proteins, for example, and a fluorophor for the candidate agents.
  • the binding of the candidate bioactive agent is determined through the use of competitive binding assays.
  • the competitor is a binding moiety known to bind to the target molecule (i.e. HIPK1 protein), such as an antibody, peptide, binding partner, ligand, etc.
  • HIPK1 protein a binding moiety known to bind to the target molecule
  • the candidate bioactive agent is labeled Either the candidate bioactive agent, or the competitor, or both, is added first to the protein for a time sufficient to allow binding, if present Incubations may be performed at any temperature which facilitates optimal activity, typically between 4 and 40°C Incubation periods are selected for optimum activity, but may also be optimized to fadHtate rapid high through put screening Typically between 0 1 and 1 hour will be sufficient Excess reagent is generally removed or washed away The second component Is then added, and the presence or absence of the labeled component Is followed, to indicate binding
  • the competitor is added first, followed by the candidate bioactive agent Displacement of the competitor is an Indication that the candidate bioactive agent is binding to a HIPK1 protein end thus is capable of binding to, and potentially modulating, the activity of a HIPK1 protein
  • either component can be labeled
  • the presence of label in the wash solution indicates displacement by the agent
  • the candidate bioactive agent is labeled the presence of the label on the support indicates displacement
  • the candidate bioactive agent is added first with incubation and washing, followed by the competitor
  • the absence of binding by the competitor may Indicate that the bioactive agent is bound to a HIPK1 protein with a higher affinity
  • the candidate bioactive agent Is labeled, the presence of the label on the support, coupled with a lack of competitor binding, may indicate that the candidate agent is capable of binding to a HIPK1 protein
  • the methods comprise differential screening to identity blo ⁇ ctive agents that are capable of modulating the activity of a HIPK1 proteins
  • the methods compnse combining HIPK1 protein and a competitor a first sample
  • a second sample comprises a candidate bioactive agent HIPK1 protein and a competitor
  • the binding of the competitor is determined for both samples and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to a HI K1 protein and potentially modulating its activity That is if the binding of the competitor is different m the second sample relative to the first sample, the agent is capable of binding to a HIPK1 protein
  • a preferred embodiment utilizes differential screening to identify drug candidates that bind to the native HIPK1 prolein, but cannot bind to modified H1PK1 proteins
  • the structure of a HIPK1 protein may be modeled and used in rational drug design to synthesize agents that interact with that site Drug candidates that affect HIPK1 blo ⁇ ctlvity nre also identified by screening drugs for the ability to either enhance or reduce the activity of the protein.
  • Positive controls and negative controls may be used in the assays.
  • Preferably all control and test samples are performed in at least triplicate to obtain statistically significant results. Incubation of all samples is for a time sufficient for the binding of Ihe agent to the protein. Following incubation, all samples are washed free of non-specifically bound material and the amount of bound, generally labeled agent determined. For example, where a radiolabel is employed, the samples may be counted in a scintillation counter to determine the amount of bound compound
  • reagents may be Included in the screening assays These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc which may be used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease Inhibitors, anti-microbial agents, etc., may be used. The mixture of components may be added In any order that provides for the requisite binding
  • methods for screening for a bioactive agent capable of modulating the activity of HIP 1 proteins comprise the steps of adding a candidate bioactive agent to a sample of HIPK1 proteins, as above, and determining an alteration in the biological activity of HIPK1 proteins.
  • “Modulating the activity of a HIPK1 protein” includes an increase in activity, a decrease in activity, or a change in the type or kind of activity present.
  • the candidate agent should both bind to H1PK1 proteins (although this may not be necessary), and alter its biological or biochemical activity as defined herein,
  • the methods include both in vitro screening methods, as are generally outlined above, and in vivo screening of cells for alterations in the presence, distribution, activity or amount of HIPK1 proteins.
  • the methods comprise combining HIPK1 sample and a candidate bioactive agent and evaluating the effect on HIPK1 activity.
  • ⁇ IPK1 activity or grammatical equivalents herein is meant one of a HIPK1 protein's biological activities, induding, but not limited to, its role in lymphoma. including cell division, preferably in lymphoid tissue, cell proliferation, tumor growth and transformation of cells
  • HIPK1 activity includes activation of or by a protein encoded by a nucleic add of the tables
  • An inhibitor of HIPK1 activity is the inhibition of any one or more HIPK1 activities.
  • bioactive agents that are antagonists are preferred in some embodiments, and bioactive agents that are agonists may be preferred in other embodiments
  • the Invention provides methods for screening for bioactive agents capable of modulating the activity of HIPK1 prote .
  • the methods comprise adding a candidate bioactive agent as defined above, to a cell comprising HIPK1 proteins
  • Preferred cell types include almost any cell
  • the cells contain a recombinant nucleic acid that encodes HIPK1 protein.
  • a library of candidate agents are tested on a plurality of cells
  • the assays are evaluated In the presence or absence or previous or subsequent exposure of physiological signals, for example hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeulics, radiation, carcmogenics, or other cells (i e cell-cell contacts).
  • physiological signals for example hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeulics, radiation, carcmogenics, or other cells (i e cell-cell contacts).
  • physiological signals for example hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeulics, radiation, carcmogenics, or other cells (i e cell-cell contacts).
  • the determinations are determined at different stages of the cell cycle process,
  • bioactive agents are Identified.
  • Compounds with pharmacological activity are able to enhance or interfere with the activity of a HIPK1 protein.
  • a method of inhibiting lymphoma cancer cell division comprises administration of a lymphoma cancer inhibitor
  • the method comprises administration of a HIPK1 Inhibitor
  • a method of inhibiting tumor growth comprises administration of a lymphoma cancer inhibitor.
  • the method comprises administration of a HIPK1 inhibitor
  • methods of treating cells or individuals with cancer ate provided.
  • the method comprises administration of a lymphoma cancer inhibitor.
  • the method comprises administration of a HIPK1 inhibitor
  • a lymphoma cancer inhibitor is an antibody as discussed above.
  • the lymphoma cancer inhibitor is an antisense molecule
  • Antisense molecules as used herein include antisense or sense oligonucleotides comprising a singe-stranded nucleic acid sequence (either RNA or ONA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for lymphoma cancer molecules
  • Antisense or sense oligonucleotido ⁇ comprise a fragment generally at least about 14 nucleotides, preferably from about 14 to 30 nucleotides The ability to derive an antisense or a ⁇ snse oligonucleotide. based upon a cDNA sequence encoding a given protein is described In. for example, Stein and Cohen Cancer Res 48 2659, (1988) and van der Krol et al BioTechnlques 6 958 (1988)
  • Antisense molecules may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753
  • Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors
  • conjugation of the ligand binding molecule does not substantially interfere ith the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the call
  • a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide- pid complex, as described in WO 90/10448 It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods
  • the compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host, as previously described
  • the agents may be administered In a variety of ways, orally, parenterally e g , subcutaneously, intraperitoneally, iniravascularly, etc Depending upo ⁇ ⁇ the manner of introduction, the compounds may be formulated in a variety of ways.
  • the concentration of therapeutically active compound in the formulation may vary from about 0.1-100% wgt vol.
  • the agents may be administered alone or in combination with other treatments, ⁇ e , radiation
  • compositions can be prepared in various forms, such as granules tablets, pills, suppositories, capsules, suspensions salves, lotions and the like.
  • Pharmaceutical grade organic or inorganic carriers and/or diluenls suitable for oral and topical use can be used to make up compositions containing the therapeutically-adive compounds
  • Diluents known to the art include aqueous media, vegetable and animal oils and fats Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for secunng an adequate pH value and skin penetration enhancers can be used as auxiliary agents
  • the invention provides methods for Identifying cells containing variant HIPK1 gene ⁇ comprising determining all or part of the sequence of at least one endogenous HIPK1 genes in a cell As will be appreciated by those In the art, this may be done using any number of sequencing techniques.
  • the invention provides methods of identifying a HIPK1 genotype of an individual comprising determining all or part of the sequence of at least ona HIPK1 gene of the individual. This is generally done in at least one tissue of the individual, and may Include the evaluation of a number of tissues or different samples of the same tissue.
  • the method may include comparing the sequence of the sequenced HIPK1 gene to a known HIPK1 gene, i.e.. a wild- type gene.
  • a known HIPK1 gene i.e.. a wild- type gene.
  • alterations In the sequence of some oncogene ⁇ can be an Indication of ⁇ ither the presence of the disease, or propensity to develop the disease, or prognosis evaluations.
  • the sequence of all or part of a H1PK1 gene can then be compared to the sequence of a known HIPK1 gene to determine if any differences exist This can be done using any number of known homology programs, such as Bestfit, etc.
  • the presence of a difference in the sequence between a HIPK1 gene of the patient and the known HIPK1 gene Is indicative of a disease state or a propensity for a disease state, as outlined herein.
  • the HIPK1 genes are used as probes to determine the number of copies of a HIPK1 gene in the genome. For example, some cancers exhibit chromosomal deletions or insertions, resulting in an alteration in the copy number of a gene.
  • HIPK1 genes are used as probes to determine the chromosomal location of the HIPK1 genes.
  • Information such as chromosomal location finds use In providing a diagnosis or prognosis In particular when chromosomal abnormalities $uch as translocations, and the like are identified in HIPK1 gene loci.
  • methods of modulating H1PK1 in cells or organisms ara comprise administering to a cell en anti-HI K1 antibody that reduces or eliminates the biological activity of an endogenous HIPK1 protein.
  • the methods comprise administering to a cell or organism a recombinant nucleic acid encoding HIPK1 protein. As will be appreciated by those in the art, this may be accomplished in any number of ways.
  • a HIPK1 sequence for example when a HIPK1 sequence is down-regulated in lymphoma, the activity of a HIPK1 gene is increased by increasing the amount of HIPK1 in the cell, for example by overexpresslng the endogenous HIPK1 or by administering a gene encoding a HIPK1 sequence, using k ⁇ w ⁇ gene-therapy techniques, for example.
  • tha gene therapy techniques include the incorporation of the exogenous gene using enhanced homologous recombination (EHR), for example as described in PCT/US93/03868, hereby incorporated by reference in its entirety.
  • EHR enhanced homologous recombination
  • the activity of the endogenous HIPK1 gene is decreased, for example by the administration of a HIPK1 antisense nucleic acid.
  • the HIPK1 proteins of the present invention may be used to generate polyclonal and monoclonal antibodies to HIPK1 proteins, which are useful as described herein.
  • the H1PK1 proteins can be coupled, using standard technology, to affinity chromatography columns. These columns may then be used to purify HIPK1 antibodies.
  • the antibodies are generated to epitopes unique to HIPK1 protein; that is, the antibodies show little or no cross-reactivity to other proteins. These antibodies find use in a number of applications.
  • the HIPK1 antibodies may be coupled to standard affinity chromatography columns and used to purify HIPK1 proteins.
  • the antibodies may also be used as blocking polypeptides, as outlined above, since they will specifically bind to a HIPK1 protein,
  • a therapeutically effective dose of HIPK1 or modulator thereof is administered to a patient.
  • therapeutically effective dose herein is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As Is known in the art, adjustments for H1PK1 degradation, systemic versus localized delivery, and rate of new protease synthesis, as well as the age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
  • a "patient” for the purposes of the present Invention includes both humans and other animals, particularly mammals, and organisms. Thus the methods are applicable to both human therapy and veterinary applications.
  • the patient is a mammal, and in the most preferred embodiment the patient Is human.
  • HIPK1 proteins and modulators of the present invention can be done In a variety of ways as discussed above, indudi ⁇ g, but not limited to, orally, subcutaneously, intravenously, intranasally, ixansdermalty, intraperitoneally, intramuscularly, intrapul onary, vaginally, rectally, or intraocularly.
  • indudi ⁇ g but not limited to, orally, subcutaneously, intravenously, intranasally, ixansdermalty, intraperitoneally, intramuscularly, intrapul onary, vaginally, rectally, or intraocularly.
  • the HIPK1 proteins and modulators may be directly applied as a solution or spray.
  • compositions of the present invention comprise HIPKl protein in a form suitable for administration to a patient.
  • pharmaceutical compositions are In a water soluble form, such as being present as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts.
  • “Pharmaceutically acceptable add addition salt” refers to those sails that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such ac hydrochloric acid, hydrobromic acid, sulturic acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric odd.
  • inorganic acids such as ac hydrochloric acid, hydrobromic acid, sulturic acid, nitric acid, phosphoric acid and the like
  • organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric odd.
  • “Pharmaceutically acceptable base addition salts” include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Particularly preferred are the ammonium, potassium, sodium, calcium, and magnesium salts.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, t ⁇ methylamine, diethylamlne, triethylamine, tripropylamlne, and ethanolamine.
  • compositions may also include one or more of the following, carrier proteins such as serum albumin; buffers, fillers such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol.
  • carrier proteins such as serum albumin
  • buffers such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches
  • binding agents such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches
  • sweeteners and other flavoring agents such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches
  • binding agents such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches
  • sweeteners and other flavoring agents such as rnicrocrystallln ⁇ cellulose, lactose, corn and other ⁇ larches
  • binding agents
  • HIPK1 proteins and modulators are administered as therapeutic agents, and can be formulated as outlined above
  • H1PK1 genes can be administered in gene therapy applications, as is known in the art
  • These HIPK1 genes can Include antisense applications, either as gene therapy (i.e. for incorporation into the genome) or as antisense compositions, as will be appreciated by those in the art.
  • HIPK1 genes are administered as DNA vaccines, either single genes or combinations of HIPK1 genes Naked DNA vaccines are generally known in the art Brewer, Nature Biotechnology, 16:1304-1305 (1998).
  • HIPK1 genes of the present invention are used as DNA vaccines.
  • Methods for the use of genes as DNA vaccines are well known to one of ordinary skill in the art, and include placing a HIPK1 gene or portion of a HIPK1 gene under the control of a promoter for expression in a LA patient
  • a HIPK1 gene used for DNA vaccines can encode full-length HIPK1 proteins, but more preferably encodes portions of a HIPK1 proteins including peptides derived from a HIPK1 protein.
  • a patient is immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a HIPK1 gene.
  • HIPK1 genes or portions thereof as defined herein.
  • expression of the polypeptide encoded by the DNA vaccine, cytotoxic T-cells, helper T-cells and antibodies are induced which recognize and destroy or eliminate cells expressing HIPK1 proteins.
  • the DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine.
  • adjuvant molecules include cytokines that increase the Immunogenic response to a HIPK1 polypeptide encoded by the DNA vaccine. Additional or alternative adjuvants are known to those of ordinary skill in the art and find use in the invention.
  • HIPKl genes find use In generating animal models of Lymphoma.
  • gene therapy technology wherein antisense RNA directed to a HIPK1 gene will also diminish or repress expression of the gene.
  • An animal generated as such serves as an animal model of lymphoma that finds use in screening bioactive drug candidates.
  • gene knockout technology for example as a result of homologous recombination with an appropriate gene targeting vector, will result in the absence of HIPK1 protein.
  • tissue-specific expression or knockout of HIPK1 protein may be necessary.
  • HIPK1 protein is overexpressed in lymphoma.
  • transgenic animals can be generated that overexpress HIPK1 protein.
  • promoters of various strengths can be employed to express the transgene.
  • the number of copies of the integrated transgene can be determined and compared for a determination of the expression level of the transgene. Animals generated by such methods find use as animal models of HIPK1 and are additionally useful in screening for bioactive molecules to treat lymphoma.
  • a HIPK1 nucleic acid sequence of the invention is depleted in Table 1 as SEQ ID NO. 1.
  • the nucleic acid sequence shown is from mouse.
  • SEQ ID NO. 2 A co ⁇ tig assembled from the mouse EST database by the National Center for Biotechnology Information (NCBl) having homology with all or parts of a HIPK1 nucleic acid sequence of the invention Is depicted in Table 2 as SEQ ID NO. 2
  • SEQ ID NO 3 represents the amino add sequence of a protein encoded by SEQ ID NO. 2.
  • SEQ ID NO. 4 depicts the amino acid sequence of a open reading frame of SEQ ID NO. 4 which encodes the C-term ' mal portion of human HIPK1 protein.
  • GTCTCTTCCTTCCCTTTCN CCTCCTTCCCTTATTGTAGTGCCTTATATGATAATGTAGT

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
EP02764693A 2001-07-13 2002-07-15 Diagnose und behandlung von krankheiten die mit einer geänderten hipk1 expression assoziert sind Withdrawn EP1419276A2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US90549101A 2001-07-13 2001-07-13
US905491 2001-07-13
PCT/US2001/029798 WO2002024867A2 (en) 2000-09-22 2001-09-24 Novel compositions and methods for lymphoma and leukemia
WOPCT/US01/29798 2001-09-24
PCT/EP2002/007854 WO2003006689A2 (en) 2001-07-13 2002-07-15 Diagnosis and treatment of diseases associated with altered expression of hipk1

Publications (1)

Publication Number Publication Date
EP1419276A2 true EP1419276A2 (de) 2004-05-19

Family

ID=26680574

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02764693A Withdrawn EP1419276A2 (de) 2001-07-13 2002-07-15 Diagnose und behandlung von krankheiten die mit einer geänderten hipk1 expression assoziert sind

Country Status (3)

Country Link
EP (1) EP1419276A2 (de)
AU (1) AU2002328896B2 (de)
WO (1) WO2003006689A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1989320A4 (de) * 2006-02-14 2010-04-07 Harvard College Mitotische progressionsgene und verfahren zur mitosemodulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03006689A3 *

Also Published As

Publication number Publication date
WO2003006689A2 (en) 2003-01-23
AU2002328896B2 (en) 2008-01-24
WO2003006689A3 (en) 2003-08-07

Similar Documents

Publication Publication Date Title
JP2006507794A (ja) 癌のための新規の組成物および方法
US6762020B1 (en) Methods of diagnosing breast cancer
US20020006616A1 (en) Novel methods of diagnosing breast cancer, compositions, and methods of screening for breast cancer modulators
WO2000055629A2 (en) Methods of diagnosing and treating breast cancer
EP1163524A2 (de) Screeningverfahren für modulatoren von darmkrebs
AU2009202600A1 (en) Novel compositions and methods for cancer
US6294343B1 (en) Methods of diagnosing colorectal cancer, compositions, and methods of screening for colorectal cancer modulators
US20030224460A1 (en) Novel compositions and methods for lymphoma and leukemia
US20030077590A1 (en) Methods for diagnosis and treatment of diseases associated with altered expression of neurogranin
US6455668B1 (en) Methods of diagnosing colorectal cancer, compositions, and methods of screening for colorectal cancer modulators
US6780586B1 (en) Methods of diagnosing breast cancer
AU2003220178B2 (en) Novel compositions and methods in cancer associated with altered expression of PRLR
US20020076707A1 (en) Novel methods of diagnosing cancer, compositions, and methods of screening for cancer modulators
US20030108926A1 (en) Novel methods of diagnosing colorectal cancer, compositions, and methods of screening for colorectal cancer modulators
US6649342B1 (en) Methods of diagnosing breast cancer, compositions, and methods of screening for breast cancer modulators
US6566502B1 (en) Methods of diagnosing cancer, compositions, and methods of screening for cancer modulators
US20030157544A1 (en) Novel methods of diagnosing breast cancer, compositions, and methods of screening for breast cancer modulators
EP1419276A2 (de) Diagnose und behandlung von krankheiten die mit einer geänderten hipk1 expression assoziert sind
AU2002328896A1 (en) Diagnosis and treatment of diseases associated with altered expression of HIPK1
WO2003027321A2 (en) Methods for diagnosis and treatment of diseases associated with altered expression of neurogranin
US20030044803A1 (en) Methods for diagnosis and treatment of diseases associated with altered expression of JAK1
AU2003225750B2 (en) Novel compositions and methods in cancer associated with altered expression of KCNJ9
AU2003230669B2 (en) Novel compositions and methods in cancer associated with altered expression of TBX21
US20020115058A1 (en) Methods for diagnosis and treatment of diseases associated with altered expression of Pik3r1
JP2005520536A (ja) Ｍｃｍ３ａｐの変更された発現に関連する癌における新規組成物および方法

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040315

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100601