AU2002328896A1 - Diagnosis and treatment of diseases associated with altered expression of HIPK1 - Google Patents

Description

METHODS FOR DIAGNOSIS AND TREATMENT OF DISEASES ASSOCIATED WITH ALTERED

EXPRESSION OF HIPK1

This application is a continuing application of U.S. Sarial Number 09/668.544, Filed September 22, 2000. which is expressly incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates to methods for use in diagnosis and treatment of diseases, including lymphoma and leuKemia, associated with altered gene expression of HIPKl.

BACKGROUND OF THE INVENTION Lymphomas are a collection of cancers involving the lymphatic system and are generally categorized as Hodgl n's disease and Noπ-Hodgtøn lymphoma. Hodgkln s l phomas are of 8 lymphocyte origin. Non-Hodgkin lymphomas are a collection of over 30 different types of cancers including T and B lymphomas. Leukemia l9 a disease of the blood forming tissues and includes B and T cell lymphocytic leukemias. It is characterized b an abnormal and persistent increase in the numbef of leukocytes and the amount of bone marrow, with enlargement of the spleen and lymph nodes.

Oncogeπes are genes that can cause cancer. Carcinogenesis can occur by a wide variety of mechanisms, including infection of cells by viruses containing oncogeπes, activation of protooncogenes in the host genome, and mutations of protooncogenes and tumor suppressor genes.

There are a number of viruses known to be involved in human cancer as well as in animal cancer. Of particular interest here are viruses that do not contain oncogeπes themselves; these are slow- transforming retroviruses. They induce tumors by integrating into the host genome and affecting neighboring protooncogenes in a variety of ways, including promoter insertion, enhancer insertion. and/or truncation of a protooncogene or tumor suppressor gene. The analysis of sequences at or near the Insertion sites has led to the identification of a number of new protooncogenes.

With respect to lymphoma and leukemia, murine leukemia retrovirus (MuLV). such as SL3-3 or Akv, is a potent inducer of tumors when inoculated into susceptible newborn mice, or when carried in the germline. A number of sequences have been identified as relevant in the induction of lymphoma and leukemia by analyzing the insertion sites; see Sorensen et al„ J. Of Virology 74:2161 (2000); Hansen et al., Genome Res. 10(2):237-43 (2000); Sorensen et al.. J. Virology 70:4063 (1996); Sorensen et al., J. Virology 67:7118 (1993); Joosten et al., Virology 268:308 (2000); and LI et al., Nature Genetics 23:348 (1999); all of which are expressly incorporated by reference herein.

As demonstrated herein, a HIPK1 gene is also implicated In lymphomas and leukemias. HIP 1 is a member of a novel family of nuclear protein kiπaSθδ that act as transcriptional co-repressors for NK class of homeoproteins (Kim YH et al., j. Biol. Chem. 1998, 273:25675-25879). Homeoproteins are transcription factors that regulate homeobox genes, which are Involved in various developmental processes, such as pattern formation and organogenβsls (McGinniε, W. and Krumiauf, R., Cell 1992, 68:283-302).

Homeoproteins may play a role in human dlβaase. Aberrant expression of the NKX2-5 homeodomain transcription factor has been found to be involved in a congenital heart disease (Schott, J.-j. et al,, Science 1998, 281 :108-111).

Accordingly, it is an object of the invention to provide methods for detection and screening of drug candidates for diseases involving HIPK1, particularly with respect to lymphomas.

SUMMARY OF THE INVENTION

In accordance with the objects outlined above, the present invention provides methods for screening for compositions which modulate diseases including lymphomas. Also provided herein are methods of inhibiting proliferation of a cell, preferably a lymphoma cell. Methods of treatment of diseases including lymphomas, and their diagnosis, are also provided herein.

In one aspect, a method of scree ing drug candidates comprises providing a cell that expresses a HIPK1 gene or fragments thereof. The method further includes adding a drug candidate to the cell and determining the effect of the drug cendidate on the expression of a HIPK1 gene. In one embodiment, the method of screening drug candidates includes comparing the level of expression in the absence of the drug candidate to the level of expression In the presence of the drug candidate

Also provided herein Is a method of screening for a bioactive agent capable of binding to a protein encoded by a HIPK1 gene, the method comprising combining a HIPK1 protein and a candidate bioactive agent, and determining the binding of the candidate agent to a HIPK1 protein.

Further provided herein is a method for screening for a bioactive agent capable of modulating the activity of a protein encoded by a HIP 1 gene In one embodiment, the method comprises combining a HIPK1 protein and a candidate bioactive agent, and determining the effect of the candidate agent on the bioactivity of a H1PK1 protein.

Also provided is a method of evaluating the effect of a candidate lymphoma drug comprising administering the drug to a patient and removing a cell sample from the patient. The expression profile of the cell is then determined. This method may further comprise companng the expression profile of the patient to an expression profile of a heathy Individual.

In a further aspect, a method for inhibiting the activity of a protein encoded by a HIPK1 gene is provided In one embodiment, the method comprises administering to a patient an inhibitor of a HIPK1 protein

A method of neutralizing the effect of HIPK1 protein is also provided. Preferably, the method comprises contacting an agent specific for said protein with said protein in an amount sufficient to effect neutralization

Moreover, provided herein is a brochip comprising a nucleic acid segment which encodes HIPK1 protein

Also provided herein is a method for diagnosing or determining the propensity to diseases, including lymphomas, by sequencing at least one HIPK1 gene of an Individual, in yet another aspect of the invention, a method Is provided for determining HIPK1 gene copy number In an individual

Other aspects of the Invention will become apparent to the skilled artisan by the following description of the invention

DETAILED DESCRIPTION OF THE INVENTION The present invent/on is directed to a sequence associated with lymphoma. The use of oncogeπic retroviruses, whose sequences insert into the genome of the host organism resulting in lymphoma, allows the identification of host sequences Involved in lymphoma. These sequences may then be used In a number of different ways, including diagnosis, prognosis, screening for modulators (including both agonists and antagonists), antibody generation (for immunotherapy and imaging), etc.

Accordingly, the present invention provides HIPK1 nucleic acid and protein sequences that are associated with lymphoma. HIPK1 nucleic acid and protein sequences as outllnid herein also are known as SGRS29 nucleic add and protein sequences. Association In this context mean* that the nucleotide or protein sequences are either differentially expressed or altered in lymphoma as compared to normal lymphoid tissue. As outlined below, HIPK1 sequences may be up-rβgulatβd (I.e. expressed at a higher level) In lymphoma, or down-regulated (i.e. expressed at a lower level), in lymphoma. HIPK1 sequences also include sequences which have been altered (i.e., truncated sequences or sequences with a point mutation) and show either the same expression profile or an altered profile. In a preferred embodiment, the HIPK1 sequences are from humans; however, as will be appreciated by those in the art, HIPK1 sequences from other organisms may be useful in animal models of disease and drug evaluation; thus, other HIPK1 sequences are provided, from vertebrates, Including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, farm animate (including sheep, goals, pigs, cowe, horses, etc). H1PK1 sequences from other organisms may be obtained using the techniques outlined balo .

Sequences of the invention can include both nucleic acid and amino acid sequences. In a preferred embodiment, the HIPK1 sequences are recombinant nucleic acids. By the term "recombinant nucleic acid" herein Is meant nucleic acid, originally formed In vitro, In general, by the manipulation of nucleic acid by polymβrases and endonucleases, in a form not normally found in nature. Thus an isolated nucleic acid, In a linear form, or an expression vector formed In vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reinLroduced into a host cell or organism, it will replicate non-recombiπantly. I.e. using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinaπtly, although subsequently replicated non-recombinanlly, are still considered recombinβnt for the puφoses of the invention.

Similarly, a "recombinant protein" is a protein made using recombinant techniques, i.e, through thθ expression of a recombinant nucleic acid as depicted above. A recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics. For example, the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure. For example, an isolated protein Is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably al least about 5% by weight of the total protein in a given sample. A substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at leaβt about 90% being particularly preferred. The definition includes the production of a HIPK1 protein from one organism in s different organism or host cell. Alternatively, the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels. Alternatively, the protein mβy be In a form not normally found in nature, aβ In the addition of an epitope tag or amino acid substitutions, insertions and deletions, as discussed below.

In a preferred embodiment, the sequences of the invention are nucleic acids. As will be appreciated by those in the art and is more fully outlined below, HIPK1 sequences are useful in a variety of applications, including diagnostic applications, which will detect nβturally occurring nucleic acids, as well as screening applications; for example, biochips comprising nucleic acid probes to a HIPK1 sequences can be generated. In the broadest sense, then, by "nucleic acid" or "oligonucleotide" or grammatical equivalents herein means at least two nucleotides covalently linked together. A nucleic acid of the present invention will generally contain phosphodiester bonds, although In some cases, aβ outlined below (for example in antisensβ applications or whan a candidate agent Is a nucleic acid), nucleic acid analogs may be used that have alternate backbones, compnsing, for example, phosphoramidate (Beaucage et al., Tetrahedron 49(10):1926 (1993) and references therein; Letsinger. J. Org. Chem. 35:3800 (1970); Spriπz! et al., Eur. J. Biochem, 81:579 (1977): Letsinger et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett 805 (1684), Lstslπgeret al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripts 26:141 91986)), phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437 (1991); and U.S. Patent No. 5.644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc. 111:2321 (1989), O-methylphophoroamidite linkages (see Eckstein, Oligonuctβotldss and Analogues; A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc. 114:1895 (1992); Meier e al., Chem. Int Ed. Engl. 31:1008 (1992); Nielsen, Nature, 365:566 (1993); Cβrlaaon et al., Nature 380:207 (1996), all of which are incorporated by reference). Other analog nucleic acids Include those with positive backbones (Deπpcy et al., Proc. Natl. Acad. Sci. USA 92.6097 (199S); non-ionic backbones (U.S. Patent Nos. 5,386,023. 5,637,684, 5,602,240, 5.216,141 and 4,469,863; Kledrowshi et al., Angew. Chem. Intl. Ed. English 30 423 (1991); Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide 13:1697 (1994); Chapters 2 and 3, ASC Symposium Series 580. "Carbohydrate Modifications In An iseπse Research", Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J. Blomolβcular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose backbones. Including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7. ASC Symposium Series 580, "Carbohydrate Modifications in Antisertse Research", Ed, Y.S, Sanghui and P. Dan Cook. Nucleic adds containing one or more carbocyclic sugars are also included within one definition of nudeic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp169-176). Several nucleic acid analogs are described in Rawls, C & E News June 2, 1997 page 35. All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be dona for a variety of reasons, for example to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip.

As will bθ appreciated by those In the art, all of these nucleic add analogs may find use in the present invention, In addition, mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nudeic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.

Particularly preferred are peptide nudeic acids (PNA) which indudes peptide nucleic acid analogs. These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic adds. This results in two advantages. First, the PNA backbone exhibits improved hybridization kinetics. PNAs have larger changes in the melting temperature (Tm) for mismatched versus perfectly matched basepairs. DNA and RNA typically exhibit a 2-4'C drop in Tm for an internal mismatch. With the non-ionic PNA backbone, the drop is doser to 7-9"C. Similarly, due to their non-ionic nature, hybridization of the bases attached to these backbones Is relatively Insensitive to salt concentration. In addition, PNAs are not degraded by cellular enzymes, and thus can be more stable.

The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. As will be appreciated by those in the art, the depidioπ of a single strand ("Watson^") also defines the sequence of the other strand ("Crick"); thus the sequences described herein also includes the complement of the sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-πucleotides, and any combination of bases, including uracil. adenine, thymlne, cytosine, guanina, iπoεine, xanthine hypoxanthiπe, isocytosine, isoguaπine, etc. As used herein, the term "nucleoslde" Indudes nucleotides and nucleoside and nucleotide analogs, and modified nucl^βosides such as amino modified nucleosides. In addition, "nucleoslde" Indudes non-naturally occurring analog structures. Thus for example the Individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside. A HIPK1 sequence can be initially identified by substantial nucleic acid and/or amino acid sequence homology to the HIPKl sequences outlined herein. Such homology can be based upon the overall nucleic acid or ammo acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions

The HIPKl sequences of the Invention were identified as follows, basically, infection of mice with murine leukemia viruses (MuLV, including SL3-3, Akv and mutants thereof) resulted in lymphoma The HI K1 sequences outlined herein comprise the insertion sites for the virus. In general, the retrovirus can cause lymphoma in three basic ways; first of all, by Inserting upstream of a normally silent host gene and activating it (e g. promoter insertion); secondly, by truncating a hoβt gene that leads to oncogβnesis, or by enhancing the transcription of a neighboring gene. For example, retrovirus enhancers, including SL3-3, are known to act on genes up to approximately 200 kilobases of the insertion site

In a preferred embodiment, HIPK1 sequences are those that are up-ragulated in lymphoma; that is, the expression of these genes is higher in lymphoma as compared to normal lymphoid tissue of the same differentiation stage. "Up-regulation" as used herein means at least about 50%, more preferably at least about 100%, more preferably at least about 150%. more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.

In a preferred embodiment, HIPK1 sequences are those that are down-regulated in lymphoma; that is. the expression of these genes is lower In lymphoma as compared to normal lymphoid lissua of the same differentiation stage. "Down-regulation" as used herein means at least about 50%. more preferably at least about 100%, more preferably at least about 150%, more preferably, at least about 200%. with from 300 to at least 1000% being especially preferred.

In a preferred embodiment, HIPK1 sequences are Ihose that are altered but show either the same expression profile or an altered profile as compared to normal lymphoid tissue of the same differentiation stage "Allβred HIPK1 sequences as used herein refers to sequences which are truncated, contain insertions or contain point mutations

In its native form, HIPK1 is an intracellular protein that is localized in the nucleus. In general, intracellular proteins may be found in the cytoplasm and/or in the nucleus Intracellular proteins are involved m all aspects of cellular function and replication (including, for example, signaling pathways), aberrant expression of such proteins results in unregulated or deregulated cellular processes. For example, many Intracellular proteins have enzymatic activity such as protein kinase activity, phosphatldyl inositol-conjugated lipid kinase activity, protein phosphatase activity, phosphatldyl inoΘitol-conjugated lipid phosphatase activity, protease activity, nucleotide cyclasβ activity, polymerase activity and the like. Intracellular proteins also serve as docking proteins that are involved in organizing complexes of proteins, or targeting proteins to various subcellular localizations, and are Involved in maintaining the structural Integrity of σrgaπellβs.

Intracellular proteins found in the nucleus Include DNA-biηdiπg transcription regulatory factors, or transcription factors. These proteins typically bind to specific nucleic acid sequences located in the regulatory regions of target genes and modulate the transcription of these target genes. Without being bound by theory. DNA-binding transcription factors can act, directly or indirectly, on a number of factors associated with the transcriptional apparatus including RNA polymerases and basal transcription factors. DNA binding transcription factors can also act at a number of stages during assembly of the transcriptional apparatus, initiation of transcription, and transcript elongation.

An Increasingly appreciated concept in characterizing intracellular proteins is the presence in the proteins of one or more motifs for which defined functions have been attributed. In addition to the highly conserved sequences found in the enzymatic domain of proteins, highly conserved sequences have been identified in proteins that are involved In protein-protein interaction. For example, Src- homology-2 (SH2) domains bind tyros^' e-phosphorylated targets in a sequence dependent manner. PTB domains, which are distinct from SH2 domains, also bind tyrosine phosphorylated targets. SH3 domains bind to proline-rich targets. In addition, PH domains, telratrlcopeptide repeats and WD domains to name only a few, have been shown to mediate protein-protein interactions. Some of these may also be involved in binding to phospholipids or other second messengers. As will be appreciated by one of ordinary skill in the art, these motifs can be identified on the basis of primary sequence; thus, an analysis of the sequence of proteins may provide insight into both the enzymatic potential of the molecule and/or molecules with which the protein may associate.

Common protein motifs have also been identified among transcription factors and have been used to divide these factors into families. These motifs include the basic helix-loop-helix, basic leuclne zipper, zinc finger and homeodomain motifs,

HIPK1 is known to contain several conserved domains, including a homeαprotein interaction domain, a protein kinase domain, a PEST domain, and a YH domain enriched In tyrosine and histidine residues (Kim et al., J. Biol. Chem, 273:25875 (1998). In the mouse HIPK1 amino add sequence depicted In Table 2 as SEQ ID NO. 3, the homeoprotein interaction domain is from about amino acid 190 to about ammo acid 518, the protein kinase domain is from about amino add 581 to about amino acid 848, the PEST domain is from about amino acid 890 to about amino acid 974, and the YH domain is from about amino acid 1067 to about amino acid 1210. It is recognized that through recombinant techniques, HIPK1 sequences can be made lo be transmembrane proteins. Transmembrane proteins are molecules that span the phospholipid bilayer of a cell. They generally include approximately 20 consecutive hydrophobic ammo acids that may be followed by charged amino acids. They mβy have an intracellular domain, an extracellular domain, or both. The intracellular domains of such proteins may have a number of functions including those already described for Intracellular proteins. For example, the Intracellular domain may have enzymatic activity and/or may serve as a binding site for additional proteins Frequently the Intracellular domain of transmembrane proteins serves both roles. For example certain receptor tyro9lne kinases have both protein kinase activity and SH2 domains. In addition, autophosphorylation of tyrosiπes on the receptor molecule Itself, creates binding sites for additional SH2 domain containing proteins,

will also be appreciated by those in the art that a transmembrane protein can be made soluble by removing transmembrane sequences, for example through recombinant methods. Furthermore, transmembrane proteins that have been made soluble can be made to be secreted through recombinant means by adding an appropriate signal sequence.

It is further recognized that HIPK1 proteins can be made to be secreted proteins through techniques well recognized in the art; the secretion of which can be either constitutive or regulated. Theβa proteins have a signal peptide or signal sequence that targets the molecule to the secretory pathway.

in another preferred embodiment, the HIPK1 proteins are nuclear proteins, preferably transcription factors Transcriplion factors are involved in numerous physiological eveπt9 and act by regulating gene expression at the transcriptional level. Transcription factors often serve as nodal points of regulation controlling multiple genes. They are capable of effecting a multifarious change in gene expression and C Π integrate many convergent signals to effect such a change Transcription factors are often regarded as "master regulators" of a particular cellular state or event. Accordingly, transcription factors have often been found to faithfully mark a particular cell state, a quality which makes them attractive for use as diagnostic markers In addition, because of their important role as coordinators of patterns of gene expression associated with particular cell states, transcription factors are attractive therapeutic targets Intervention at the level of transcriptional regulation allows one to effectively target multiple genes associated with a dysfunction which fall under the regulation of a "master regulator" or transcription factor.

A HIPK1 sequence is initially identified by substantial nucleic acid and/or ammo acid sequence homology to the HIPK1 sequences outlined herein. Such homology can be based upon the overall nucleic acid or am o acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions. As used heroin, a nucleic acid is a "HIPKl nucleic acid" If the overall homology of the nucleic acid sequence to one of the nucleic acids of Tables 1, 2, and 3 is preferably greater than about 75%, more preferably greater than about 80%. even more preferably greater than about 85% and most preferably greater than 90%. In some embodiments the homology will bs as high as about 93 to 95 or 98%. In a preferred embodiment, the sequences which are used to determine sequence identity or similarity are selected from those of the nucleic acids of SEQ ID NOS: 1, 2, 4. In another embodiment, the sequences are naturally occurring alleiic variants of the sequences of the nucleic acids of SEQ ID NOS: 1 , 2, 4. In another embodiment, the sequences are sequence variants as further described herein.

Homology In this context means sequence similarity or Identity, with identity being preferred. A preferred comparison for homology purposes is to compare the sequence containing sequeπdng errors to the correct sequence. This homology will be determined using standard techniques known in the art, including, but not limited to, the local homology algoπthm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ). by the homology alignment algorithm of Needlemaπ & Wuπsch, J. Mol. Biol, 48:443 (1970), by the search for similarity method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wl), the Best Fit sequence program described by Devereux et al., Nud. Acid Res. 12:387-395 (1984). preferably using the default settings, or by Inspection.

One exa pla of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing tha clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evo). 35:351-360 (1987); the method is similar to that described by Higgins & Sharp CABIOS 5:151-163 (1989). Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.

Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al„ J. Mol. Biol. 215. 403-410, (1990) and Karlin et al,, PNAS USA 90:5873-5787 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Methods in Enzymology, 266: 460-480 (1996); http://blastwustl]. WU-BLAST-2 uses several search parameters, most of which are set to the default values, The adjustable parameters are set with the following values: overlap span =1 , overlap fraclion = 0, 125, word threshold (T) = 11. The HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity,

- ιo . A % ammo acid sequence identity value is determined by the number of matching identical residues divided by th© total number of residues of the "longer" sequence in the aligned region. The "longer" sequence Is the one having the most actual residues in the aligned region (gaps Introduced by WU- Blast-2 to maximize the alignment score are ignored).

Thus, "percent (%) nucleic acid sequence identity" is defined as the percentage of nucleotide residues in a candidate soquence that are identical with the nucleotide residues of the nucleic acids of the SEQ ID NOS. 1 , 2, 4. A preferred method utilizes the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.

The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than those of the nucleic acids of the SEQ ID NOS 1, 2. 4, it is understood that the percentage of homology will be determined based on the number of homologous nucleosides in relation to the total number of nucleosldβs. Thus, for example, homology of sequences shorter than those of the sequences identified herein and as dtscussad below, will be determined using the number of πudeosides in the shorter sequence.

In one embodiment, the nucleic acid homology is determined through hycrldlzation studies. Thus, for example, nudeic acids which hybridize under high stringency to the nucleic acids identified m the figures, or their complements, are considered HIPK1 sequences. High stringency conditions are known in the art; see for example Maπiatis et al., Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausub , et al , both of which ere hereby incoφorated by reference. Stnngent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijsseπ, Techniques in Biochemistry and Molecular Bjology-Hybndlzation with Nuclsic AcId Probes, Overview of principles of hybridization and the strategy of nudeic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10^"C lower than the thermal melting point (Tm) for the specific sequence at a defined Ionic strength pH The Tm Is the temperature (undΗ defined ionic strength, pH and nucleic acid concentration) at which 60% of the probes complementary to the target hybridize to the target sequence at equilibrium (aβ the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those In which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8 3 and the temperature is at least about 30°C for short probes (e.g. 10 to 50 nucleotides) and at least about 60^"C for long prαbas (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as fdrmamide. In another embodiment, less stringent hybridization conditions are used; for example, moderate or low stringency conditions may be used, as are known in the art; see Maniatis and Ausubel, supra, and Tijssen, supra,

In addition, the HIPK1 nucleic acid sequences of the Invention include fragments of larger ganes. i.e. they are nucleic acid segments "Genes" in this context includes coding regions, non-coding regions, and mixtures of coding and non-coding regions Accordingly, as will be appreciated by those in the art, using the sequences provided herein, additional sequences of HIPK1 genes can be obtained, using techniques well known in the art for cloning either longer sequences or the full length sequences; see Maniatis et al., and Ausubel, et al., supra, hereby expressly incorporated by reference In general, this is done using PCR, for example, kinetic PCR.

Once a HIPK1 nucleic acid is identified, it can be cloned and, if necessary, its constituent parts racombiπed to form the entire HIPK1 nucleic add. Once isolated from its natural source, e g., contained within a plasmid or other vector or excised therefrom as a liπααr nucleic acid segment, the recombinant HIPK1 nuclaic acid can be further used as a probe to identify and isolate other HIPK1 nucleic acids, for example additional coding regions. It can also be used as a "precursor" nucleic acid to make modified or variant HIPK1 nucleic acids and proteins.

The H1PK1 nucleic acids of the present invention are used In several ways. In a first embodimant, nucleic acid probes to a H1PK1 nucleic acids are made and attached to biochips to be used in screening and diagnostic methods, as outlined below, or for administration, for example for gene therapy and/or antisense applications Alternatively, HIPK1 nucleic acids that Include coding regions of HIPK1 proteins can be put into expression vectors for the expression of HIPK1 proteins, again either for screening purposes or for administration to a patient.

In a preferred embodiment, nucleic acid probes to HIPK1 nucleic acids (both the nucleic acid sequences outlined In the figures and/or the complements thereof) are made. The nucleic acid probes attached to the blochlp are designed to be substantially complementary to HIPK1 nucleic adds, i.e. the target sequence (either the target sequence of the sample or to other probe sequences, for example in sandwich assays), such that hybridization of the target sequence and the probes of the present invention occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will Interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, If the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence Is not a complementary target sequence. Thus, by "substantially complementary" herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions, particularly high stringency conditions, as outlined herein.

A nucleic acid probe is generally single stranded but can be partially single and partially double stranded The strandedness of the probe Is dictated by the structure, composition, and properties of the target sequence In general, the nucleic acid probes range from about 8 to about 100 bases long, with from about 10 to about 80 bases being preferred, and from about 30 to about 50 bases being particularly preferred That is. generally whole genes are not used In some embodiments, much longer nucleic acids can be used, up to hundreds of bases.

In a preferred embodiment, more than σπβa probe per sequence Is used, with either overlapping probes or probes to differαnt sections of the target being used That Is. two, three, four or more probes, with three being preferred, are used to build in a redundancy for a particular targeL The probes can be overlapping (i e have some sequence in common), or separate

As will be appreciated by those in the art, nucie c adds can be attached or immobilized to a solid support i a wide variety of ways By "immobilized" and grammatical equivalents herein is meant the association or binding between the nucleic acid probe and the solid support is sufficient to be stable under the conditions of binding washing, analysis, and removal as outlined below The binding can be covalent or non-covalent, By "non-covalent binding' and grammatical equivalents herein Is meant one or more of either electrostatic, hydrophilic. and hydrophobic interactions Included in non-covalent binding is the covalent attachment of a molecule, such as, streptavidin to the support and the non- covalent binding of the biotinylated probe to the streptavidin By "covalent binding" and grammatical equivalents herein is meant that the two moieties, tha solid support and the probe, are attached by at least one bond, indud g βlgma bonds, pi bonds and coordination bonds Covalent bonds can be formed directly between the probe and the solid support or can be formed by a cross linker or by mdusion of a specific reactive group on either the solid support or the probe or both molecules Immobilization may also involve a combination of covalent and non-covalent interactions

in general the probes are attached to the biochip in a wide variety of ways as will be appreciated by those in the art. As described herein, the nucleic acids can either be synthesized first, with subsequent attachment to the biochip or can be directly synthesized on the biochip.

The biochip compnses a suitable solid substrate By "substrate" or solid support" or other grammatical equivalents herein is meant any material that can be modified to contain dlsorete individual sites appropriate for the attachment or association of the nucleic acid probes and is omenable to at least one detection method As will be appreciated by those in the art, the number of possible substrates are very large, and include, but are not limited to, glass and modified or functionalized glass, plastics (induding acrylics polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethaπes, TaflonJ. etc.), polysacchaπdes, nylon or nitrocellulose, resins, silica or slllca-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, etc. In general, the substrates allow optical detection and do not appreciably fluoresce

In a preferred embodiment, the surface of the blochlp and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. Thus, for example, the blochlp Is derivatized with a chemical functional group including, but not limited to, a ino groups, car oxy groups, oxo groups and thlol groupe, with amino groups being particularly preferred Using thacβ functional groups, the probes can ba attached using functional groupe on the probes For example, nucleic acids containing amino groups can be attached to surfaces comprising amino groups, for example using linkers as are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference) In addition, m some cases, additional linkers such as alkyl groups (including substituted and heteroalkyl groups) may be used

In this embodiment the oligonucleotides are synthesized as is known in the art and then attached to the surface of the solid support As will be appreciated by those skilled in the art, either the 5' or 3' terminus may be attached to the solid support, or attachment may be via an internal nucleoside

In an additional embodiment, the immobilization to the solid support may be very strong, yet non- covalent For example, biotinylated oligonucleotides can be made, which bind to surfaces covalently coated with streptavidin, resulting in attachment

Alternatively the oligonucleotides may be synthesized on the surface, as is known in the art For example, photoactivation techniques utilizing photopolymenzatioπ compounds and techniques are used In a preferred embodiment, the nudeic acids can be synthesized in situ, using well known photolithographic techniques, such aa those described in WO 95/25116, WO 95/35505, U S Patent Nos 5,700,637 and 5,445,934, and references cited within, all of which are expressly incorporated by reference, these methods of attachment form the basis of the Affimetrix GeneChip™ technology

In addition to the solid-phase technology represented by biochip arrays, gene expression can also be quantified using hquid-phasa arrays One such system is kinetic polymerase chain reaction (PCR) Kinetic PCR allows for the simultaneous amplification and quantification or specific nucleic acid sequences The specificity Is derived from synthetic oligonucleotide primers designed to preferentially adhere to single-stranded nucleic a d sequences bracketing the target site. This pair of oligonucleotide primers form specific, non-covalently bound complexes on each strand of the target sequence These complexes facilitate in vitro transcription of double-stranded DNA in opposite orientations Temperature cycling of the reaction mixture creates a continuous cycle of primer binding, transcription, and re-melting of the nucleic acid to individual strands. The result is an exponential increase of the target dsDNA product This product can be quantified in real time either through the use of an intercalating dye or a sequence specific probe. SYBR^® Greene I, is an example of an intercalating dye, that preferentially binds to dsDNA resulting in a concomitant increase in the fluorescent signal. Sequence specific probes, such as used with TaqMan^® technology, consist of a fluorochrome and a quaπching molecule covalently bound to opposite ends of an oligonudeotide. The probe is designed to selectively bind the target DNA sequence between the two primers. When the DNA strands are synthesized during the PCR reaction, the fluorochrome is cleaved from the probe by the exonuclease activity of the polymerase resulting in signal dequenching The probe signaling method can be more specific than the intercalating dye method, but In each case, signal strength is proportional to the dsDNA product produced. Each type of quantification method can be usαd In multi- well liquid phase arrays with each well representing primers and/or probes specific to nucleic acid sequences of interest When used with messenger RNA preparations of tissues or cell lines, and an array of probe/primer reactions can simultaneously quantify the expression of multiple gene products of interest See Qermer, S., et al , Genome Res. 10 258-266 (2000), Heid, C. A , at al.. Genome Res. 6. 986-994 (1996).

In a preferred embodiment, HIPK1 nucleic acids encoding HIPK1 proteins are used to make a variety of expression vectors to express HIPK1 proteins which can then be used in screening assays, as described below. The expression vectors may be either self-replicating extrachromosomal vectors or vectors which integrato Into a host genome Generally, these expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleic add encoding a HIPK1 protein The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism The control sequences that are suitable for prokaryotes, for example, Include a promoter, optionally an operator sequence, and a πbosome binding site Eukaryotic cells are known to utilize promoters, polyadeπylatjon signals, and enhancers.

Nucleic acid is "operably linked" v/heπ it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it Is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation Generally, "operably linked" means that the DNA sequences baing linked are contiguous, and, in the case of a secretory leaσer, contiguous and in reading phase However, enhancers do not have to be contiguous Linking is accomplished by ligation at convenient restriction sites If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice The transcriptional and translational regulatory nucleic acid will generally be appropriate to the host cell used to express HIPK1 protein for example, transcriptional and translational regulatory nucleic acid sequences from Bacillus are preferably used to express a HIPK1 protein m Bacillus Numerous types of appropriate expression vectors, and suitable regulatory sequences are known in the art for a variety of host cells

In general, the transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences and enhancer or activator sequences In a preferred embodiment, the regulatory sequences include a promoter and transcπptioπal start and stop sequences

Promoter sequences encode either constitutive or inducible promoters The promoters may be either naturally occurring promoters or hybrid promoters Hybrid promoters, which combine elements of more than one promoter, are also known in the art, and are useful in the present invention

In addition, the expression vector may comprise additional elements For example, the expression vector may have two replication systems, thus allowing it to be maintained m two organisms, for example in mammalian or insect cells for expression and in a prσcaryotic host for cloning and amplification Furthermore, for integrating expression vectors, the expression vector contains at least one sequence homologous to the host cell genome, and preferably two homologous sequences which flank the expression construct The integrating vector may be directed to a specific locus in the host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are well known in the art

In addition, in a preferred embodiment, the expression vector contains a selectable marker gene to allow the selection of transformed host calls Selection genes are woll known in the art and will vary

The HIPK1 proteins of the present invention are produced by cultunng a host ceil transformed with an expression vector containing nucleic acid encoding a HIPK1 protein, under the appropriate conditions to Induce or cause expression of HIPK1 protein The conditions appropriate for HIPK1 protein expression will vary with the choice of the expression vector and the host cell, and will be easily ascertained by one skilled in the art through routine experimentation For example, the use of constitutive promoters in the expression vector will require optimizing the growth and proliferation of the host cell, while the use of an inducible promoter requires the appropriate growth conditions for induction In addition, In some embodiments, the timing of the harvest is important For example, the baculoviral systems used In Insect cell expression are lytic viruses, and thus harvest time selection can be crucial for product yield

Appropriate host cells Include yeast, bacteria, archaebactena, fungi, and insect plant and animal cells, including mammalian cells Of particular interest are DrosophUa melanogaster cells Saccharomycos cerβvisiaβ and other yeasts, E coli, Bacillus subtltis, Sf9 cells, C129 cells, 293 cells, Λ/eι/rospora, BHK CHO, COS, HeLa cells, THP1 cell line (a macrophage cell line) and human cells and cell lines

In a preferred embodiment, HIPKl protein Is expressed in mammalian cells Mammalian expression systama are also known in the art, and include retroviral systems A preferred expression vector system is a retroviral vector system such as Is generally described in PCT/US97/O1019 and PCT/US97/01048, both of which are hereby expressly incorporated by reference Of particular use as mammalian promoters are the promoters from mammalian viral genes, since the viral genes are often highly expressed and have a broad host range Examples include the SV40 early promoter mouse mammary tumor virus LTR promoter, adenovirus major late promoter, herpes simplex virus promoter and the CMV promoter Typically, transcription termination and polyadenylatlon sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence Examples of transcription terminator and polyadenylatlon signals include those derived form SV40

The methods of Introducing exogenous nucleic acid into mammalian hosts, as well as other hosts, is well known in the art, and will vary with the host cell used Techniques include dθxtran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, viral infection, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei

In a preferred embodiment HIPK1 proteins are expressed in bactenal systems. Bacterial expression systems are well known in the art Promoters from bactenophage may also be used and ara known In the art In addition synthetic promoters and hybrid promoters are also useful, for example, the tac promoter is a hybnd of the trp and lac promoter sequences Furthermore, a bactenal promoter can include naturally occurring promoters of non-bactenal origin that have the ability to bind badenal RNA polymerase and initiate transcription In addition to a functioning promoter sequence an efficient nbosome binding site is desirable The expression vector may also include a signal peptide sequence that provides for secretion of HIPK1 protein in bacteria, The protein is either secreted into the growth media (gram-positive bactena) or Into the pεnplasmic space, located oetween the inner and outer membrane of the cell (gram-negative bacteria) The bacterial expression vector may also Indude a selectable marker gene to allow for the selection of bacterial strains that have been transformed Suitable selection genes include genes which render the baotena resistant to drugs such as ampicd π. chloramphenicol, erythromycln, kanamyαn, πeomycln and tetracycline Selectable markers also include biosynthetic genes, such as those in the histidine. tryptophan and leucine biosynthetic pathways. These components are assembled into expression vectors Expression vectors for bacteria are well known in the art, and include vectors for Bacillus subtitis, E. coli, Streptococcus cremoris, and Streptococcus lividβns, among others The bacterial expression vectors are transformed into bacterial host cells using techniques well known in the art, such as calcium chloride treatment, βlcctroporalion, and others

In one embodiment, HIPK1 proteins are produced in insect cells Expression vectors far the transformation of insect cells, and in particular, baculovirus-based expression vectors, are well known

In a preferred embodiment, HIPK1 protein is produced in yeast cells Yeast expression systems are well known in the art, and indude expression vectors for Saccharomycβs csrevisiae, Candida albicans and C. maltosa, Hansβnula polymorpha, Kluyvβromyces frag s and K. lactis, Ptchia gυillenmondii and P pastons, Schizosaccharomyces pombe, and Yarrowia hpolytlca

HIPK1 protein may also be made as a fusion protein, using techniques well known in the art Thus, for example, for the creation of monoclonal antibodies If the desired epitope is small, a HIPK1 protein may be fused to a earner protein to form an immunσgen Alternatively, a HIPK1 protein may be made as a fusion protein to increase expression, or for other reasons For example, when a HIPK1 protein is a HIPK1 peptide, the nucleic acid encoding the peptide may be linked to other nudeic acid for expression purposes

In one embodiment, the HIPK1 nucleic acιd9, proteins and antibodies of the invention are labeled By "labeled" herein is meant that a compound has at least one element isotope or chemical compound attached to enable the detection of the compound. In general, labels fall mto three dasses a) isotøpic labels, which may be radioactive or heavy Isotopes, b) immune labels, which may be antibodies or antigens, and c) colored or fluorescent dyes The labels may be incorporated into a HIPK1 nudeic acids, proteins and antibodies at any position For example, the label should be capable of producing, either directly or indirectly, a detectable signal The detectable moiety may be a radioisotope, such as ³H, C ^MP ³⁵S, or ^,2SI, a fluorescent or chemilum esceπt compound, such as fluorescein isothiocyanate, rhodamlπe, or luclferin, or an enzyme, such as alkaline phosphatase, bata- galactosldase or horseradish peroxidase. Any method known in the art for conjugating the antibody to the label may be employed, including those methods described by Hunter et al., Nature, 144:945 (1962); David et al., Biochemistry. 13:1014 (1974); Pain et al., J. Immunol. Meth., 40:219 (1981); and Nygren, J. Histochem. and Cytocham., 30:407 (1982).

Accordingly, the present invention also provides HIPK1 protein sequences. A HIPK1 protein of the present invention may be identified in several ways. "Protein" in this sense includes proteins, polypeptides, and peptides. As will be appreciated by those in the art, the nucleic acid sequences of the invention can be used to generate protein sequences. There are a variety of ways to do this, including doniπg the entire gene and verifying its frame and amino acid sequence, or by oomparing it to known sequences to search for homology to provide a frame, assuming a HIPK1 protein has homology to some protein in the database being used. Generally, the nudeic acid sequences are input into a program that will search all three frames for homology. This Is done in a preferred embodiment using the following NCBI Advanced BLAST parameters. The program is blastx or blastn. The database is nr. The input data is as "Sequence in FASTA format". The organism list is "none". The "expect^1* Is 10; the filter is default. The "descriptions" Is 500. trie "alignments" is 500, and the "alignment view" is pairwise. The "Query Genetic Codes" is standard (1). The matrix Is BLOSUM62; gap existence cost is 11 , per residue gap cost is 1 ; and the lambda ratio is .85 default This results in the generation of a putative protein sequence.

Also included within one embodiment of HIPK1 proteins are a ino acid variants of the naturally occurring sequences, as determined herein. Preferably, the variants are preferably greater than about 75% homologous to the wild-type sequence, more preferably greater than about 80%, even more preferably greater than about 85% and most preferably greater than 90%. In some embodiments the homology will be as high as about 93 to 95 or 98%. As for nucleic acids, homology in this context means sequence similarity or Identity, with identity being preferred. This homology will be determined using standard techniques known in the art as are outlined above for the nucleic acid homαlσgies.

HIPK1 proteins of the present invention may be shorter or longer than the wild type amino acid sequences. Thus, in a preferred embodiment, included within the definition of HIPK1 proteins are portions or fragments of the wild type sequences herein. In addition, as outlined above, the HIPK1 nucleic acids of the invention may be used to obtain additional coding regions, and thus additional protein sequence, using techniques known in the art.

In a preferred embodiment, the HIPK1 proteins are derivative or variant HIPK1 proteins as compared to the wild-type sequence. That is, as outlined more fully below, the derivative HIPK1 peptide will contain at Isast one amino aoid substitution, deletion or insertion, with amino acid substitutions being particularly preferred. The amino acid substitution, insertion or deletion may occur at any residue within a HIPK1 peptide.

Alβo included in an embodiment of H1PK1 proteins of the present Invention are amino acid sequence variants. These variants fall Into one or more of three classes: substitutional, insertional or deletional variants. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding a HIPK1 protein, using cassette or PCR mutagenaβis or other techniques well known In the art, to produce DNA encoding the variant and thereafter expressing the DNA in recombinant cell culture as outlined above. However, variant HIPK1 protein fragments having up to about 100-150 residues may be prepared by in vitro synthesis using established techniques. Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allellc or interspecies variation of a HIPK1 protein amino acid sequence. The variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected which have modified characteristics as will be more fully outlined below.

While the site or region for introducing an amino acid sequence variation is predetermined, the mutation per so need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed HIPK1 variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites In DNA having a known sequence are well known, for example, M13 primer mutagenesis and LAR mutagenesis, Screening of the mutants is done using assays of HIPK1 protein activities.

Amino add substitutions are typically of single residues; insertions usually will be on the order of from about 1 to 20 amlπo adds, although considerably larger insertions may be tolerated. Deletions range from about 1 to about 20 residues, although In some cases deletions may be much larger.

Substitutions, deletions, insertions or any combination thereof may be used to arrive at a final derivative. Generally these changes are done on a few amino adds to minimize the alteration of the molecule. However, larger changes may be tolerated in certain circumstances. When small alterations in the characteristics of a HIPK1 protein are desired, substitutions are generally made in accordance with the following chart Original Residue Exemplary Substitutions

Ala Ser

Arg Lys

Asn Gin, His

Asp Glu

Cys Ser

Gin Asn

Glu Asp

Gly Pro

His Asn, Gin

He Leu, Val

Leu lie, Val

Lys Arg, Gin, Glu

Met Leu, He

Phe Met, Leu, Tyr

Ser Thr

Thr Ser

Trp Tyr

Tyr Trp, Phe

Val lie, Leu

Substantial changes in function or immuπological identity are made by selecting substitutions that are less conservative than those shown in Chart I For example, substitutions may be made which more significantly affect, the structure of the polypeptide backbone In the area of the alteration, for example the alpha-helical or beta-sheet structure, the charge or hydrophobicity of the molecule at the target site, or the bulk of the side chain The substitutions which in general are expected to produce the greatest changes In the polypeplide's properties are those In which (a) a hydrophilic residue, e.g. seryl or threonyl is substituted far (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalaπyl. valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an

) electropositive side chain, e g. lysyl, argiπyl, or histidyl, is substituted for (or by) an electronegative residue, e g. glulamyl or aspartyl; or (d) a residue having a bulky side chain, e g phenylalanine, is substituted for (or by) one not having a side chain, β,g, glydπe.

The variants typically exhibit the same qualitative biological activity and will elicit the same immune response as the naturally-occurring analogue, although variants also are selected to modify the 3 characteristics of the HIPKl proteins as needed Alternatively, the variant may be designed such that the biological activity of a HIPK1 protein is altered. For βxemple, glycosylation sites may be altered or removed, dominant negative mutations created, etc.

Covalent modifications of HIPK1 polypeptides are included within the scope of this invention, for example for use in screening One type of covalent modification includes reacting targeted am o acid 3 residues of a HIPK1 polypeptide with an organic deπvatizing agent that is capable of reacting with selected side chains or the N-or C-termiπal residues of an H1PK1 polypeptide Deπvateatlon with bifunctional agents is useful, for Instance for crosslinking HIPK I to a water-insoluble support matrix or surface for use in the method for purifying anti-HIPKl antibodies or screening assays, as is more fully described below Commonly used crosslinking agents include, e g , 1 ,1-bis(dlazoacetyl)-2- pheπylethane, glutaraldehyde. N-hydroxysuccimrπide esters for example estors with 4-azιdosalιcylic acid, homobifunctional imidoβsters, including disuccinimidyl esters such as 3,3'- dιthιobιs(succιπιmιdylproplonate), bifunctional male mides such as bιs-N-ma)eιmιdo-1,β-octane and agents such as methyl-3-[(ρ-azιdophenyl)dithιo]ρropιoimidate

Other modifications include daamidatioπ of glutaminyl and asparaginyl residues to the corresponding glutamyl and aapartyl residues, respectively, hydroxylalion of proline and lysine, phosphorylation of hydroxyl groups of seryl, thraonyl or tyrosyl residues, methylation of the α-amino groups of lysine, arginine, and hlebdine side chains [T E Creighton, Proteins' Structure and Molecular Properties, W.H Freeman & Co , San Francisco pp 79-86 (1983)], acetylation of the N-teπ-nmal amine, and amidatlon of any C-termmal carboxyl group

Another type of covalent modification of a HIPK1 polypeptide included within the scope of this invention comprises altering the native glycosylation pattim of the polypeptide "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence H1PK1 polypeptide, and/or adding one or more glycosylation sites that are not present in the native sequence HIPK1 polypeptide

Addition of glycosylation sites to HIPK1 polypeptides may be accomplished by altering the ammo acid sequence thereof The alteration may be made for example by the addition of. or substitution by one or more serine or threonine residues to the native sequence HIPK1 polypeptide (for O-linked glycosylation sites) A HIPK1 ammo acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding a HIPK1 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids

Another means of Increasing the number of carbohydrate moieties on a HIPKl polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide Such methods are described In the art, e g , in WO 87/05330 published 11 September 1987 and in Aplln and Wπstoπ, LA Cm Rev Biochem , pp 259-306 (1981 )

Removal of carbohydrate moieties present on a HIPK1 polypeptide may be accomplished chemically or enzymatically or by mulational substitution of codons encoding for ammo acid residues that serve as targets for glycosylation Chemical deglycosylatioπ techniques are known in the art and described, for instance, by HaWmuddln, et al., Arch, Biochem. Biophys., 259"52 (1987) and by Edge et al , Anal. Biochem , 118 131 (1981 ). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo-and exo-glycosidasββ as dβacribβd by Thotakura et al., Meth Enzymol , 138'350 (1987).

Another type of covalent modification of HIPK1 comprises linking a HIPK1 polypeptide to one of a variety of nonproteinaceous polymers, e g., polyethylene glycol, polypropylene glycol, or polyoxyalkylβnes, in the manner set forth m U S Patent Nos 4,640,835, 4,496.689; 4,301 ,144, 4,670,417; 4,791,192 or 4,179,337.

HIPK1 polypeptides of the present invention may also be modified in a way to form chimeπc molecules comprising a HIPK1 polypeptide fused to another, heterologous polypeptide or ammo acid sequence. In one embodiment, such a chimeπc molecule comprises a fusion of a HIPK1 polypeptide with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope Lag is generally placed at the amino-or carboxyl-termmus of a HIPK1 polypeptide. although Internal fusions may also be tolerated in some instances. The presence of such epitope-tagged forms of a HIPK1 polypeptide can be deleded using an antibody against the tag polypeptide Also, provision of the epitope tag enables a HIPK1 polypeptide to bs raadlly purified by affinity punficalion using an anti- tag antibody or another type of affinity matrix that binds to the epitope tag In an alternative embodimen the chimeπc molecule may comprise a fusion of a HIPK1 polypeptide with an immunoglobulin or a particular region of an immunoglobulln For a bivalent form of the chimeπc molecule, such a fusion could be to the Fc region of an IgG molecule.

Various tag polypeptides and their respective antibodies are well known In the art Examples include poly-histidme (poly-hls) or poly-histidine-glyc e (poly-his-gly) tags, the flu HA tag polypeptide and its antibody 12CA5 [Field ^βt al , Mol. Cell. Biol , 8 2159-2165 (1988)]; tha o-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et at, Molecular and Cellular Biology. 5 3610-3616 (1935)], and the Herpes Simplex virus glycoproteiπ D (gD) tag and its antibody [Paborsky et al , Protein Engineering, 3(6).547-553 (1990)] Other tag polypeptides include the Flag-peptidθ [Hopp et al , BioTechnology, 6^* 1204-1210 (1988)], the KT3 epitope peptide [Martin et al , Science, 255.192-194 (1992)], tubuliπ epitope peptide [Skinner et al . J. Biol Chem., 266:15163-15166 (1991)], and the 77 gene 10 protein peptide tag [Lutz-Freyermuth et al , Proc Natl Acad Sci USA, 87.6393-6397 (1990))

Also included with tha definition of HIPK1 protein In one embodiment are other H1PK1 proteins of the HIPK family, and HIPK1 proteins from other organisms, which are cloned and expressed as outlined below Thus, probe or degenerate polymerase chain reaction (PCR) primer sequences may be used to find other related HIPK1 proteins from humans or other organisms As ill be appreciated by those in the art, particularly useful probe and/or PCR primer sequences include the unique areas of a HIPK1 nucleic acid sequεncg As is generally kπpwπ in the art, preferred PCR primers are from about 16 to about 35 nucleotides in length, with from about 20 to about 30 being preferred, and may contain inosiπe as needed. The conditions for the PCR reaction are wall known in the art

In addition, as is outlined herein, HIPK1 proteins can be made that are longer than those encoded by the nucleic adds of the figures, for example, by the elucidation of additional sequences, the addition of epitope or purification tags, the addition of other fusion sequences, etc

HIPK1 proteins may also be identified as being encoded by HIPK1 nucleic a ds. Thus, HIPK1 proteins are encoded by nucleic acids that will hybridize to the sequences of the sequence listings, or their complements, aβ outlined herein.

In a preferred embodiment, the invention provides HIPK1 antibodies In a preferred embodiment, when a HIPK1 protein is to be used to generate antibodies, for example for immunotherapy, a HIPK1 protein should share at least one epitope or determinant with the full length protein By "epitope" or "determinant'^* harem is meant a portion of a protein which will generate and/or bind an antibody or T- cβll receptor in the context of MHC Thus, in most instances antibodies made to a smaller HIPK1 protein will be able to bind to the full length protein In a preferred embodiment, the epitope Is unique, that Is, antibodies generated to a unique epitope show little or no cross-reactivity

In one embodiment, the term "anubody' includes antibody fragments, as are known m the art, Including Fab, Fab₂ single chain antibodies (Fv for example), chimenc antibodies, etc , either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA technologies

Methods of preparing polyclonal antibodies are known to the skilled artisan Polyclonal antibodies can be raised in a mammal, for example, by one or more Injections of an immunizing agent and, if desired, an adjuvant Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may Include a protein encoded by a nucleic acid of the figures or fragment thereof or a fusion protein thereof It may be useful to conjugate the Immunizing agent to a protein known to be Immunogenic m tha mammal being immunized. Examples of such immunogenic proteins Include but are not limited to keyhole limpet hemocyaπln, serum albumin, bovine thyroglobu π, and soybean trypain inhibitor. Examples of adjuvants which may be employed include Freund'ε complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dlcorynomycolale) The immunization protocol may be selected by one skilled in the art without undue axpeπmentatlon The antibodies may alternatively, be monoclonal antibodies Monoclonal antibodies may be prepared using hybπdoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybndoma method, a mouse, hamster, or other appropriate host animal, Is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro The immunizing agent will typically include a polypeptide encoded by a nucleic acid of Tables 1 , 2, and 3 or fragment thereof or a fusion protein thereof Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol, to for a hybridoma cell [Goding, Monoclonal Antibodies. Principles and Practice, Academic Press. (1986) pp 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin Usually, rat or mouse myeloma cell lines are employed The hybridoma calls may be cultured in a suitable culture medium that preferably contain* one or more substances that inhibit the growth or survival of the unfused, immortalized cells For example, if the parental cells lack the enzyme hypoxanth e guanine phosphoπbosyl trαπsferase (HGPRT or HPRT), the culture medium for th© hybndomas typically will include hypoxanthme, ammopteπn, and thymid e ("HAT medium'), which substances prevent the growth of HGPRT-deflclent cells.

In one embodiment, the antibodies are bispecific antibodies. Bispeαfic antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens, In the present case, one of the binding specificities is for a protein encoded by a nucleic acid of the Tables 1 , 2, and 3, or a fragment thereof, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit, preferably one that is tumor specific

in a preferred embodiment, the antibodies to HIPK1 are capable of reducing or eliminating the biological function of HIPK1 as is described below That Is. the addition of antl-HIPK1 antibodies (either polyclonal or preferably monoclonal) to HIPK1 (or cells containing HIPK1) may reduce or eliminate a HIPK1 activity Generally, at least a 25% decrease m activity is preferred, with at least about 50% being particularly preferred and about a 95-100% decrease being especially preferred.

In a preferred embodiment the antibodies to the HIPK1 proteins are humanized antibodies Humanized forms of non-human (e g murine) antibodies are chlmeπc molecules of Immuπoglobu ns. imrnuπoglobul chains or fragments thereof (such as Fv Fab, Fab , F(ab')₂ or other antigen binding subsaqueπces of antibodies) which contain minimal sequence derived from non-human immunoglobuliπ Humanized antibodies include human immunoglobulms (recipient antibody) In which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human spedes (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some Instances, Fv framework residues of the human immunoglobuliπ are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, tha humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework residues (FR) regions are those of a human immunoglobuiln consensus sequence. The humanized antibody optimally also will comprise at least a portion of an Immunoglobuiln constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1086); Riechmann et at. Nature, 332:323-329 (1988): and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

Methods for humanizing non-human antibodies are well known In the art Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyeπ et at, Science, 239:1534-1535 (1988)]. by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by tha corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboo and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991 )]. The techniques of Cole et al. and Boarπer et al. ara also available for the preparation of human monoclonal antibodies [Cole et al.. Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boernar et al., J. Immunol., 147(1 ):86-95 (1991 )]. Similarly, human antibodies can be made by introducing human immunoglobuiln loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, Including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5.545,807; 5,545,806; 5.569,625; 5,625, 126; 5,633,425; 5,661 ,016, and in the following scientific publications: Marks et al.. Bio Technology 10, 779-783 (1992), tonberg et al., Nature 368 856-859 (1994), Morrison, Nature 368, 812-13 (1994), Fishwild et al , Nature Biotechnology 14, 845-51 (1996), Neubergar, Nature Biotechnology 14 826 (1996), Lonberg and Huszar. Intern Rev Immunol. 13 65-93 (1995)

By immunotherapy Is meant treatment of lymphoma with an antibody raised against a H1PK1 protein As used herein, Immunotherapy can be passive or active. Passive immunotherapy as defined herein is the passive transfer of antibody to a recipient (patient). Active immunization is the Induction of antibody and/or T-cell responses in a reαpient (patient). Induction of an immune response is the result of providing the recipient with an antigen to which antibodies are raised. As appreciated by one of ordinary skill in the art, the antigen may be provided by injecting a polypeptide against which antibodies are desired to be raised into a recipient, or contacting the recipient with a nucleic acid capable of expressing the antigen and under conditions for expression of the antigen

In another preferred embodiment, the antibody is conjugated to a therapeutic moiety. In one aspect the therapeutic moiety is a small molecule that modulates the activity of a HIPK1 protein. In another aspect the therapeutic moiety modulates the activity of molecules associated with or in close proximity to a HIPK1 protein The therapeutic moiety may inhibit enzymatic activity such as protease or protein kinase activity associated with lymphoma.

In a preferred embodiment the therapeutic moiety may also be a cytσtoxic agent. In this method, targeting the cy toloxic agent to tumor tissue or cells, results in a reduction in the number of afflicted cells, thereby reducing symptoms associated with lymphoma. Cytotoxlc agents are numerous and varied and include, but are not limited to, cytotoxic drugs or toxins or active fragments of such toxins. Suitable toxms and their corresponding fragments include diphtheπa A cham, exotoxin A chain, rlcln A chain, abπn A chain, curcln, crotlπ, pheπomycin, enomycm and the like. Cytotoxic agents also Indude radiochemicβls made by conjugating radioisotopes to antibodies raised against HIPK1 proteins, or binding of a radlonuc de to a chelat g agent that has been covalently attached to the antibody. Targeting the therapeutic moiety to transmembrane HIPK1 proteins not only serves to increase the local concentration of therapeutic moiety in the lymphoma, but also serves to reduce deleterious side effects that may be associated with the therapeutic moiety,

In a preferred embodiment, a HIPK1 protein against which the antibodies are raised is an intracellular protein In this case, the antibody may be conjugated to a protein which facilitates entry into the cell. In one case, the antibody enters the cell by endocytosis In another embodiment, a nucleic acid encoding the antibody is administered to the individual or cell Moreover, wherein a HIPK1 prote can be targeted within a cell, i.e., the nucleus, an antibody thereto contains a signal for that target localization, i e , a nudear localization signal The HIPK1 antibodies of tha invention specifically bind to H1PK1 proteins. By "specifically bind" herein is meant that the antibodies bind to the protein with a binding constant in the range of at least 10"*- 10"* M^"\ with a preferred range being 1Q^"7 - 10^"9 M"\

In a preferred embodiment a HIPKl protein is purified or isolated after expression. HIPK1 proteins may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including Ion exchange, hydrophobic, affinity, and reverse-phase HPtC chromatography, and chromatofocusing, For example, a HIPK1 protein may be purified using a standard aπtl-G,a antibody column. Ultraflltration and diafiltration techniques, In conjunction with protein concentration, are also useful. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer- eriag, NY (1982). The degree of purification necessary will vary depending on the use of a HIPK1 protein. In some instances no purification will be necessary.

Once expressed and purified if necessary, tha HIPK1 proteins and nucleic acids are useful in a number of applications.

In one aspect, the expression levels of genes are determined for different cellular states In the lymphoma phenotype; that is, the expression levels of genes in normal tissue and in lymphoma tissue (and in some cases, for varying severities of lymphoma that relate to prognosis, as outlined below) are evaluated to provide expression profiles. An expression profile of $ particular cell state or point of development Is essentially a "fingerprint" of the state; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that Is unique to the state of the cell. By comparing expression profiles of cells In different states, information regarding which genes are important (including both up- and down- regulation of genes) in each of these states is obtained. Then, diagnosis may be done or confirmed: does tissue from a particular patient have the gene expression profile of normal or lymphoma tissue.

"Differential expression," or grammatical equivalents as used herein, refers to both qualitative as well as quantitative differences in the genes' temporal and/or cellular expression patterns within and among the cells. Thus, a differentially expressed gene can qualitatively have its expression altered, including an activation or iπactivation. in, for example, normal versus lymphoma tissue. That is, genes may be turned on or turned off in a particular state, relative lo another state. As Is apparent to the skilled artisan, any comparison of two or more states can be made. Such a qualitatively regulated gene will exhibit an expression pattern within a state or cell type which is detectable by standard techniques in one such state or cell type, but Is not detectable in both. Alternatively, the determination is quantitative in that expression is increased or decreased; that Is, the expression of the gene is either upregulated, resulting if) s increased amount of transcript, or downregulatθd, resulting in a decreased amount of transcript The degree to which expression differs need only be large enough to quantify via standard characterization techniques as outlined below, such as by use of Affymetrlx GeneChip™ expression arrays, Lockhart, Nature Biotechnology, 14:1675-1680 (1996), hereby expressly

Incorporated by reference. Other techniques include, but are not limited to, quantitative reverse traπscriptase PCR, Northern analysis and RNase protection. As outlined above, preferably the change in expression (I.a. upregulation or downregulation) is at least about 60%. more preferably at least about 100%, more preferably at least about 130%, more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.

As will be appredated by those in the art this may be done by evaluation at either the gene transcript, or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes to the DNA or RNA equivalent of the gene transcript, and the quantification of gene expression levels, or, alternatively, the final gene product Itself (protein) can be monitored, for example through the use of antibodies to a HIPK1 protein and standard immunoassays (ELISAs, etc.) or other techniques, including mass spectroscopy assays, 2D gel electrophoresis assays, etc. Thus, the proteins corresponding to HIPKl genes, i.e. those Identified as being important in a lymphoma phenotype, can be evaluated in a lymphoma diagnostic test.

In a preferred embodiment, gene expression monitoring Is dons and a number of genes, i.e. an expression profile, is monitored simultaneously, although multiple protein expression monitoring can be done as well. Similarly, these assays may be done on an individual basis as well.

In this embodiment, the HIPK1 nucleic acid probes may be attached to biochips as outlined herein for the detection and quantification nf HIPK1 sequences in a particular call. The assays are done as is known in the art. As will be appreciated by those in the art, any number of different HIPK1 sequences may be used as probes, with single sequence assays being used in some cases, and a plurality of the sequences described herein being used in other embodiments. In addition, while solid-phase 89says are described, any number of solution based assays may be done as well.

In a preferred embodiment, both solid and solution based assays may be used to detect HIPK1 sequences that are up-regulated or down-regulated in lymphoma as compared to normal lymphoid tissue, In instances where a HIPK1 sequence has been altered but shows the same expression profile or an altered expression profile, the protein will be detected as outlined herein In a preferred embodiment nucleic acids encoding a H1PK1 protein are detected Although DNA or RNA encoding a HIPK1 protein may be detected of particular interest are mettiods wherem the mRNA encoding HIPK1 protein is detected The presence of mRNA in a sample is an indication that a HIPK1 gene has been transcribed to form the mRNA and suggests that the protein is expressed Probes to detect the mRNA can be any nucleotlde/deαxynucleotide probe that is complementary to and base pairs with the mRNA and indudes but is not limited to oligonucleotides, cDNA or RNA Probes also should contain a detectable label, as defined herein In one method the mRNA is detected after immobilizing the nucleic add to be examined on a solid support such as nylon membranes and hybridizing the probe with the sample Following washing to remove the πon-specifically bound probe, the label is detected In another method detection of the mRNA Is performed m situ In this method permeabilized cells or tissue samples are contacted with a detectably labeled nucleic acid probe for sufficient time to allow the probe to hybridize with the target mRNA Following washing to remove the non-«pecrfically bound probe, the label is detected For example a digoxygemn labeled πboprobe (RNA probe) that is complementary to the mRNA encoding HIPK1 protein is detected by binding the digoxygemn with an anti-dlgoxygenin secondary antibody and developed with πitro blue letrazollum and 5-bromα-4-chloro-3-ιndoyl phosphate

In a preferred embodiment the HIPKl proteins antibodies nucleic acids modified HIPK1 proteins and cells containing HIPK1 sequences are used in diagnostic assays This can be done on an individual gene or corresponding polypeptide level, or as sets of assays

As dβscπbed and defined herein HIPK1 proteins find use as markers of lymphoma. Detection of these proteins in putative lymphomic tissue or patients allows for a determination or diagnosis of lymphoma Numerous methods known to those of ordinary skill in the art find use in detecting lymphoma In one embodiment, antibodies ara used to detect HIPK1 proteins A prefened method separates proteins from a sample or patient by electrophoresis on a gel (typically a denaturing and reducing protein gel but may be any other type of gel induding isoelectric focusing gels and the like) Following separation of proteins a HIPK1 protein Is detected by immunoblotlmg with antibodies raised agamst a HIPK1 protein Methods of immunoblotting are well known to those of ordinary skill in the art

In another preferred method, antibodies to a HIPK1 protein find use in in situ imaging techniques In this method cells are contacted with from one to many antibodies to a HIPK1 prote (s) Following washing to remove non-specrfic antibody binding the presence of (ho antibody or antibodies is detected In one embodiment the antibody is detected by incubating with a secondary antibody that contains a detectable label In another method the primary antibody to a HIPK1 protβln(s) contains a delectable label In another preferred embodiment each one of multiple primary antibodies contains a distinct and detectable label. This method finds particular use in simultaneous screening for a plurality of HIPK1 proteins. As will be appreciated by one of ordinary skill in the art, numerous other histological imaging techniques are useful In the invention.

In a preferred embodiment the label Is detected in a fluorometer which has the ability to detect and distinguish emissions of different wavelengths. In addition, a fluorescence activated cell sorter (FACS) can be used In the method.

In β preferred embodiment, in situ hybridization of labeled HIPKT nucleic acid probes to tissue arrays is done. For example, arrays of tissue samples, including leuke le/lymphoma tissue and/or normal tissue, are made. In sttu hybridization as is known in the art can then be done.

It is understood that when comparing the expression fingerprints between an individual and a standard, the skilled artisan can make a diagnosis as well as a prognosis. It Is further understood that the genes which indicate the diagnosis may differ from those which indicate the prognosis.

In a preferred embodiment, the HIPK1 proteins, antibodies, nucleic acids, modified HIPK1 proteins and cells containing HIPK1 sequences are used in prognosis assays. As above, gene expression profiles can be generated that correlate to lymphoma severity, in terms of long term prognosis. Again, this may be done on either a protein or gene level, with the use of genes being preferred. As above, the HIPK1 probes are attached to biochips for the detection and quantification of HIPK1 sequences in a tissue or patient The assays proceed as outlined for diagnosis,

In a preferred embodiment, any of the HIPK1 sequences as described herein are used In drug screening assays. The HIPK1 proteins, antibodies, nucleic adds, modified HIPK1 proteins and cells containing HIPK1 sequences are used In drug screening assays or by evaluating the effect of drug candidates on a "gene expression profile" or expression profile of polypeptides. In one embodiment, the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, Zlokarnik, et al., Science 279. 84-8 (1998). Heid. et at, Genome Res., 6:986-994 (1996).

In a preferred embodiment the HIPK1 proteins, antibodies, nudeic acids, modified HIPK1 proteins and cells containing the native or modified HIPK1 proteins are used In screening asβays. That ie, the present invention provides novel methods for screening for compositions which modulate the lymphoma phenotype. As above, this can be done by screening for modulators of gene expression or for modulators of protein activity. Similarly, this may be done on an individual gene or protein level or by evaluating the effect of drug candidates on a "gene expression profile".. In a preferred embodiment the expression profiles are used, preferably in conjunction with high throughput ocreening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, see Zlokamik, supra.

Having identified the HIPK1 genes herein, a variety of assays to evaluate the effects of agents on gene expression may be executed. In a preferred embodiment, assays may be run on an individual gene or protein level. That is, having identified a particular gene as aberrantly regulated in lymphoma, candidate bioactive agents may be screened to modulate the gene's response, "Modulation" thus includes both an increase and a decrease in gene expression or activity. The preferred amount of modulation will depend on the original change of the gene expression in normal versus tumor tissue, with changes of at least 10%, preferably 50%. more preferably 100-300%, and in some embodiments 300-1000% or graater. Thus, if a gene exhibits a 4 fold increase in tumor compared to normal tissue, a decrease of about four fold Is desired; a 10 fold decrease in tumor compared to normal tissue gives a 10 fold increase In expression for a candidate agent is desired, etc, Alternatively, where a HIPK1 sequence has been altered but shows the same expression profile or an altered expression profile, the protein will be detected as outlined herein.

As will be appreciated by those in the art, this may be done by evaluation at either the gene or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, the level of the gene product itself can be monitored, for example through the use of antibodies to a HIPK1 protein and standard immunoassays, Alternatively, binding and bioactlvity assays wilh the protein may be done as outlined below.

In a preferred embodiment, gene expression monitoring is done and a number of genes, I e. an expression profile, la monitored simultaneously, although multiple protein expression monitoring can be done as well.

In this embodiment, the HIPK1 nucleic acid probes are attached to biochips as outlined herein for the detection and quantification of HIPKl sequences in a particular cell, The assays are further described below.

Generally, in s preferred embodiment, a candidate bioactive agent is added to the cells prior to analysis. Moreover, screens are provided to Identify a candidate bioactive agent which modulates lymphoma, modulates HIPK1 proteins, binds to HIPK1 protein, or interferes between the binding of HIPK1 protein and an antibody. The term "candidate bioactive agent" or "drug candidate" or grammatical equivalents as used herein describes any molecule, e.g., protein, oligopeptide, small organic or inorganic molecule, polysaccharide, polynucleotide, etc., to be tested for bioactive agents that are capable of directly or Indirectly altering either the lymphoma phenotype. binding to and/or modulating the bioactivity of an HIPK1 protein, or the expression of a H1PK1 sequence, including both nucleic acid sequences and protein sequences. In a particularly preferred embodiment the candidate agent suppresses a lymphoma/leukemla associated (LA) phenotype, for example to a normal tissue fingerprint. Similarly, the candidate agent preferably suppresses a sever© LA phenotype. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations, Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below Ihe level of detection.

In one aspect a candidate agent will neutralize the effect of a HIPK1 protein. By "neutralize" iβ meant that activity of a protein Is either inhibited or counter acted against so as to have substantially no effect on a cell.

Candidate agents encompass numerous chemical classes, though typically they are organic or inorganic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Preferred small molecules are less than 2000. or less than 1500 or less than 1000 or less than 500 D. Candidate agents comprise functional groups necessary for structural Interaction with proteins, particularly hydrogan bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably al least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or pdyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidlnes, derivatives, structural analogs or combinations thereof. Particularly preferred are peptides.

Candidate agents are obtained from a wide variety of sources induding libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules. including expression of randomized Oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced, Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation. alkylation, esterification, amidificatioπ to produce struclural analogs, In a preferred embodiment the candidate bioactive agents are proteins By "protein" herein is meant at least two covalently attached am o acids, which includes proteins, polypeptides, oligopeptides and peptides. The protein may be made up of naturally occurring am o acids and peptide bonds, or synthetic peptidomimellc structures. Thu9 "ammo acid" or "peptide residue", as used herein means both naturally occurring and synthetic a ino acids For example, homo-phenylalanme, citrullme and πorsleuciπe are considered amino acids for the purposes of the invention "Am o acid ' also Includes i o acid residues such as prolme and hydrσxyprol e The side chains may be in either tha (R) or the (S) configuration In the preferred embodiment, the am o acids are in the (S) or L-configuratlon If non-naturally occurnng side chains are used, non-ammo acid substituents may be used for example to prevent or retard in vivo degradations

In a preferred embodiment, the candidate bioactive agents are naturally occurring proteins or fragments of naturally occurring proteins Thus, for example, cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, may be used In this way libraries of procaryotic and eucaryobc proteins may be made for screening in the methods of the invention. Particularly preferred in this embodiment are libraries of bacterial fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred

In a preferred embodiment, the candidate bioactive agents are peptides of from about 5 to ahout 30 amino acids with from about 5 to about 20 ammo acids being preferred and Tram about 7 to about 15 being particularly preferred The peptides may be digests of naturally occurring proteins as is outlined above random peptides or "biased ' random peptides By "randomized or grammatical equivalents herein is meant that each nudeic acid and peptide consists of essentially random nucleotides and ammo acids, respectively S ce generally these random peptides (or nucleic acids, discussed below) are chemically synthesized they may incorporate any nucleotide or ammo acid at any posibon The synthetic process can be designed to generate randomized proteme or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence thus forming a library of randomized candidate bioactive proteinaceous agents

In one embodiment the library Is fully randomized, with no sequence preferences or constants at any position In a preferred embodiment, the library is biased That is, so a positions within the sequence are either held constant, or are selected from a limited number of possibilities For example, a preferred embodiment, the nucleotides or ammo acid residues are randomized within a defined class for example, of hydrophobic am o acids, hydrophilic residues, stencally biased (either small or large) residues towards the creation of nucleic acid binding domains the creation of cystelnes. for cross-link g prollnes for SH-3 domains sarlnes, threonmes tyrσs es or hlstid es for phosphorylatlon sites, etc or to puπnes elc In a preferred embodiment, the candidate bioactive agents are nucleic acids, as defined above.

As described above generally for proteins, nucleic acid candidate bioaotive agents may be naturally occurring nucleic a ds, random nucleic acids, or "biased" random nucleic acids. For example, digests of procaryotic or eucaryotic genomes may be used as is outlined above for proteins.

In a preferred embodiment, the candidate bioactive agents are organic chemical moieties, a wide variety of which are available in the literature.

In assays for altering the expression profile of one or more HIPK1 genes, after the candidate agent has been added and the cells allowed to incubate for some period of time, the sample containing the target sequences to ba analyzed is added to the biochip. If required, the target sequence is prepared using known techniques, For example, the sample may be treated to lysβ the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR occuσiπg as needed, as will be appreciated by those in the art. For example, an in vitro transcription with labels covelently attached to the nucleosides is done, Generally, the nucleic acids are labeled with a label as defined herein, with biotin-FlTC or PE, cy3 and cy5 being particularly preferred.

In a preferred embodiment, the target sequence is labeled with, for example, a fluorescent, chemlluminescent, chemical, or radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe. The label also can be an enzyme, such as, alkaline phosphatαaa or horseradish peroxidase. which wnen provided with an appropriate substrata produces a product that can be detected. Alternatively, the label can be a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme. The label also can be a moiety or compound, such as, an epitope tag or blotlπ which specifically binds to streptavidin. For the example of biotin, the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence, As known in the art, unbound labeled streptavidin is removed prior to analysis.

As will be appredated by those in the art, these assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as Is generally outlined in U.S. Patent Nos. 5,681,702, 5,597,909, 5,545,730. 5,594,117, 5,591 ,584, 5,571 ,670. 5,580,731, 5,571.670, 5,591,584, 5,624,802. 5,635,352, 5,594,118, 5,359,100, 5, 124,246 and 5,681,697, all of which are hereby incorporated by reference. In this embodiment, in general, the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex. A variety of hybridization conditions may be used in the present invention, including high moderate and low stringency conditions as outlined above The assays are generally run under stnngβncy conditions which allows formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc

These parameters may also be used to control non-specific Diπdiπg, as is generally outlined in U S Patent No 5,681,697 Thus it may be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding

The reactions outlined herein may be accomplished in a variety of ways as will be appreciated by those in the art Components of the reaction may be added simultaneously, or sequentially, in any order, with preferred embodiments outlined below In addition, the reaction may include a vaπety of other reagents may be Included in the assays These include reagents Ilka salts, buffers, neutral proteins β g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, πucleasε inhibitors, anli-microblal agents, etc., may be used, depending on the sample preparation methods and purity of the target In addition, either solid phase or solution based (l.e , kinetic PCR) assays may be used

Once the assay is run, the data is analyzed to determine the expression levels, and changes in expression levels as between states, of individual genes forming a gene expression profile

In a preferred embodiment, as for the diagnosis and prognosis applications, having identified the differentially expressed genβ(s) or mutated gene(s) important in any one state, screens can be run to alter the expression of the genes individually That is, screening for modulation of regulation of expression of a single gane can be done Thus for example, particularly the case of target genes whose presence or absence is unique between two states screening is done for modulators of the target gene expression

In addition screens can be done for novel genes that are induced in response to a candidate agent After identifying a candidate agent based upon its ability to suppress a HIPK1 expression pattern leading to a normal expression pattern, or modulate a single HIPK1 gene expression profile so as to mimic the expression of the gene from normal tissue, a screen as described above can be performed to identify genes that are specifically modulated In response to the agent Comparing expression profiles between normal tissue and agent treated tA tissue reveals genes that are not expressed In normal tissue or LA tissue, but are expressed in agent treated tissue. These agent specific sequences can be identified and used by any of the methods described herein for HIPK1 genes or proteins. In particular these sequences and the proteins they encode find use In marking or identifying agent treated cells. In addition, antibodies can be raised against the agent induced proteins and used to target novel therapeutics to the treated LA tissue sample.

Thus, in one embodiment, a candidate agent is administered to a population of LA cells, that thus has an associated HIPK1 expression profile. By "administration" or "contacting" herein is meant that the candidate agent is added to the cells in such a manner as to allow the agent to act upon the cell, whether by uptake and Intracellular action, or by action at the cell surface. In some embodiments, nucleic acid encoding a proteinaceous candidate agent (i.e. a peptide) may be put into a viral construct such as a retroviral construct and added to the cell, such that expression of the peptide agent is accomplished; see PCT US97/01019, hereby expressly Incorporated by reference.

Once the candidate agent has been administered to the cells, the cells can be washed if desired and are allowed to incubate under preferably physiological conditions for some period of time. The ceils are then harvested and e new gene expression profile is generated, as outlined herein.

Thus, for example, LA tissue may be screened for agents that reduce or suppress the LA phenotype. A change in at l&ast one gene of the expression profile indicates that the agent has an effect on HIPK1 activity. By defining such a signature for the LA phenotype, screens for new drugs thai alter the phenotype can be devised. With this approach, the drug target need not be known and need not be represented In the original expression screening platform, nor does the level of transcript for the target protein need to change.

In a preferred embodiment, as outlined above, screens may be done on individual genes and gene products (proteins). That is, having identified a particular differentially expressed gene as important In a particular state, screening of modulators of either the expression of the gene or tha gene product itself can be done. A HIPK1 product may be a fragment, or alternatively, be the full length protein to the fragment encoded by the nucleic acids of the figures. Preferably, a HIPK1 is a fragment. In anot er embodiment, the sequences are sequence variants as further described herein.

Preferably, a HIPK1 is a fragment of approximately 14 to 24 amino acids long. More preferably the fragment is a soluble fragment Preferably, the fragment includes a non-transmembrane region. In a preferred embodiment, the fragment has an N-tsrmlnal Cys to aid in solubility. In one embodiment, the c-terminua of the fragment is kept as a free acid and the n-terminus is a free amine to aid in coupling, I.e., to cysteine. In one embodiment, the HIPK1 proteins are conjugated to an immunogenic agent as discussed herein in one embodiment a HIPK1 protein is conjugated to BSA.

In a preferred embodiment, screens for agents that alter the biological function of the expression product of a HIPK1 gene are done. Again, having identified tha Importance of a gene in a particular state, screening for agents that bind and/or modulate the biological activity of the gene product can be run as is more fully outlined below.

In a preferred embodiment, screens are designed to first find candidate agents that can bind to H1PK1 proteins, and then these agents may be used essays that evaluate the ability of the candidate agent to modulate a HIPK1 activity and the lymphoma phenotype. Thus, as will be appreciated by those in the art, there are a number of different assays which may be run; binding assays and activity assays

In a preferred embodiment, binding assays are done. In general, purified or isolated gene product is used, that is, the gene products of one or more H1PK1 nucleic acids are made. In general, this Is done as is known In the art. For example, antibodies are generated to the protein gene products, and standard immunoassays are run to determine the amount of protein present. Alternatively, cells comprising the H1PK1 proteins can be used in the assays.

Thus, In a preferred embodiment, the methods comprise combining HIPK1 protein and a candidate bioactive agent, and determining the binding of the candidate agent to a HIPK1 protein. Preferred embodiments utilize the human or mouse HIPK1 protein, although other mammalian proteins may also be used, for example for the development of animal models of human disease. In some embodiments, as outlined herein, variant or derivative HIPK1 proteins may be used

Generally, In a preferred embodiment of the methods herein, a HIPK1 protein or the candidate agent Is non-diffusably bound to an insoluble support having Isolated sample receiving areas (e.g. a microtiter plate, an array, etc.). The insoluble supports may be made of any composition to which the compositions can be bound, is readily separated from soluble material, and i© otherwise compatible with the overall method of screening. The surface of such supports may be solid or porous and of any convenient shape. Examples of suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g., polystyrene), polysacchaπdeβ, nylon or nitrocellulose, Teflon^'™, etc. Microtiter plates and arrays are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples The particular manner of binding of the composition is not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition and is nondiffusable Preferred methods of binding include the use of antibodies (which do not sterically block either the ligand binding site or activation sequence when the protein is bound to the support), direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or agent, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety_;.

In a preferred embodiment, a HIPK1 protein is bound to the support, and a candidate bioactive agent is added to the assay. Alternatively, the candidate agent is bound to the support and a HIPK1 protein is added. Novel binding agents include specific antibodies, non-natural binding agents identified In screens of chemical libraries, peptide analogs, etc. Of parUcular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.

The determination of the binding of the candidate bioactive agent to a HIPK1 protein may be done In a number of wβys. In a preferred embodiment, the candidate bioactive agent is labeled, and binding determined directly. For example, this may be done by attaching all or a portion of a HIPK1 prolein to a solid support, adding a labeled candidale agent (for example a fluorescent label), washing off excess reagent, and determining whether the label Is present on the solid support Various blocking and washing steps may be utilized as is known in the art.

By "labeled" herein is meant that the compound is either directly or indirectly labeled with a label which provides a detectable signal, e.g. radlolsotope, fluorescers, enzyme, antibodies, partides such as magnetic particles, chemilu inescers. or spedfic binding molecules, etc. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule which provides for detection, in accordance with known procedures, as outlined above. The label can directly or indirectly provide a detectable slgnaL

In some embodiments, only one of the components is labeled, For example, the proteins (or proteinaceous candidate agents) may be labeled at tyrosine positions using ^,2SI, or with fluorophores. Alternatively, more than one component may be labeled with different labels: using l for the proteins, for example, and a fluorophor for the candidate agents.

In a preferred embodiment the binding of the candidate bioactive agent is determined through the use of competitive binding assays. In this embodiment, the competitor is a binding moiety known to bind to the target molecule (i.e. HIPK1 protein), such as an antibody, peptide, binding partner, ligand, etc. Under certain circumstances, there may be competitive binding as between tha bioactive agent and the binding moiety, with the binding moiety displacing the bioactive agent

In one embodiment, the candidate bioactive agent is labeled Either the candidate bioactive agent, or the competitor, or both, is added first to the protein for a time sufficient to allow binding, if present Incubations may be performed at any temperature which facilitates optimal activity, typically between 4 and 40°C Incubation periods are selected for optimum activity, but may also be optimized to fadHtate rapid high through put screening Typically between 0 1 and 1 hour will be sufficient Excess reagent is generally removed or washed away The second component Is then added, and the presence or absence of the labeled component Is followed, to indicate binding

In a preferred embodiment the competitor is added first, followed by the candidate bioactive agent Displacement of the competitor is an Indication that the candidate bioactive agent is binding to a HIPK1 protein end thus is capable of binding to, and potentially modulating, the activity of a HIPK1 protein In this embodiment either component can be labeled Thus for example, if the competitor is labeled, the presence of label in the wash solution indicates displacement by the agent Alternatively, if the candidate bioactive agent is labeled the presence of the label on the support indicates displacement

In an alternative embodiment, the candidate bioactive agent is added first with incubation and washing, followed by the competitor The absence of binding by the competitor may Indicate that the bioactive agent is bound to a HIPK1 protein with a higher affinity Thus, if the candidate bioactive agent Is labeled, the presence of the label on the support, coupled with a lack of competitor binding, may indicate that the candidate agent is capable of binding to a HIPK1 protein

In a preferred embodiment, the methods comprise differential screening to identity bloβctive agents that are capable of modulating the activity of a HIPK1 proteins In this embodiment the methods compnse combining HIPK1 protein and a competitor a first sample A second sample comprises a candidate bioactive agent HIPK1 protein and a competitor The binding of the competitor is determined for both samples and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to a HI K1 protein and potentially modulating its activity That is if the binding of the competitor is different m the second sample relative to the first sample, the agent is capable of binding to a HIPK1 protein

Alternatively a preferred embodiment utilizes differential screening to identify drug candidates that bind to the native HIPK1 prolein, but cannot bind to modified H1PK1 proteins The structure of a HIPK1 protein may be modeled and used in rational drug design to synthesize agents that interact with that site Drug candidates that affect HIPK1 bloβctlvity nre also identified by screening drugs for the ability to either enhance or reduce the activity of the protein.

Positive controls and negative controls may be used in the assays. Preferably all control and test samples are performed in at least triplicate to obtain statistically significant results. Incubation of all samples is for a time sufficient for the binding of Ihe agent to the protein. Following incubation, all samples are washed free of non-specifically bound material and the amount of bound, generally labeled agent determined. For example, where a radiolabel is employed, the samples may be counted in a scintillation counter to determine the amount of bound compound

A variety of other reagents may be Included in the screening assays These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc which may be used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease Inhibitors, anti-microbial agents, etc., may be used. The mixture of components may be added In any order that provides for the requisite binding

Screening for agents that modulate the activity of HIPK1 proteins may also be done. In a preferred embodiment, methods for screening for a bioactive agent capable of modulating the activity of HIP 1 proteins comprise the steps of adding a candidate bioactive agent to a sample of HIPK1 proteins, as above, and determining an alteration in the biological activity of HIPK1 proteins. "Modulating the activity of a HIPK1 protein" includes an increase in activity, a decrease in activity, or a change in the type or kind of activity present. Thus, in this embodiment, the candidate agent should both bind to H1PK1 proteins (although this may not be necessary), and alter its biological or biochemical activity as defined herein, The methods include both in vitro screening methods, as are generally outlined above, and in vivo screening of cells for alterations in the presence, distribution, activity or amount of HIPK1 proteins.

Thus, in this embodiment, the methods comprise combining HIPK1 sample and a candidate bioactive agent and evaluating the effect on HIPK1 activity. By ΗIPK1 activity" or grammatical equivalents herein is meant one of a HIPK1 protein's biological activities, induding, but not limited to, its role in lymphoma. including cell division, preferably in lymphoid tissue, cell proliferation, tumor growth and transformation of cells In one embodiment, HIPK1 activity includes activation of or by a protein encoded by a nucleic add of the tables An inhibitor of HIPK1 activity is the inhibition of any one or more HIPK1 activities. In a preferred embodiment the activity of a H1PK1 protein is increased; in another preferred embodiment, the activity of a H1PK1 protem is decreased Thus, bioactive agents that are antagonists are preferred In some embodiments, and bioactive agents that are agonists may be preferred in other embodiments

In a preferred embodiment, the Invention provides methods for screening for bioactive agents capable of modulating the activity of HIPK1 prote . The methods comprise adding a candidate bioactive agent as defined above, to a cell comprising HIPK1 proteins Preferred cell types include almost any cell The cells contain a recombinant nucleic acid that encodes HIPK1 protein. In a preferred embodiment, a library of candidate agents are tested on a plurality of cells

In one aspect, the assays are evaluated In the presence or absence or previous or subsequent exposure of physiological signals, for example hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeulics, radiation, carcmogenics, or other cells (i e cell-cell contacts). In another example, the determinations are determined at different stages of the cell cycle process,

In this way, bioactive agents are Identified. Compounds with pharmacological activity are able to enhance or interfere with the activity of a HIPK1 protein.

In one embodiment, a method of inhibiting lymphoma cancer cell division is provided, The method comprises administration of a lymphoma cancer inhibitor In a preferred embodiment, the method comprises administration of a HIPK1 Inhibitor

In another embodiment, a method of inhibiting tumor growth is provided The method comprises administration of a lymphoma cancer inhibitor In a preferred embodiment, the method comprises administration of a HIPK1 inhibitor

In a further embodiment, methods of treating cells or individuals with cancer ate provided. The method comprises administration of a lymphoma cancer inhibitor. In a preferred embodiment, the method comprises administration of a HIPK1 inhibitor

In one embodiment, a lymphoma cancer inhibitor is an antibody as discussed above. In another embodiment, the lymphoma cancer inhibitor is an antisense molecule Antisense molecules as used herein include antisense or sense oligonucleotides comprising a singe-stranded nucleic acid sequence (either RNA or ONA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for lymphoma cancer molecules Antisense or sense oligonucleotidoβ. according to the present invention, comprise a fragment generally at least about 14 nucleotides, preferably from about 14 to 30 nucleotides The ability to derive an antisense or a βsnse oligonucleotide. based upon a cDNA sequence encoding a given protein is described In. for example, Stein and Cohen Cancer Res 48 2659, (1988) and van der Krol et al BioTechnlques 6 958 (1988)

Antisense molecules may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753 Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors Preferably, conjugation of the ligand binding molecule does not substantially interfere ith the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the call Alternatively, a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide- pid complex, as described in WO 90/10448 It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods of treatment

The compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host, as previously described The agents may be administered In a variety of ways, orally, parenterally e g , subcutaneously, intraperitoneally, iniravascularly, etc Depending upo^ιι the manner of introduction, the compounds may be formulated in a variety of ways. The concentration of therapeutically active compound in the formulation may vary from about 0.1-100% wgt vol. The agents may be administered alone or in combination with other treatments, ι e , radiation

The pharmaceutical compositions can be prepared in various forms, such as granules tablets, pills, suppositories, capsules, suspensions salves, lotions and the like. Pharmaceutical grade organic or inorganic carriers and/or diluenls suitable for oral and topical use can be used to make up compositions containing the therapeutically-adive compounds Diluents known to the art include aqueous media, vegetable and animal oils and fats Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for secunng an adequate pH value and skin penetration enhancers can be used as auxiliary agents

Without being bound by theory, it appears that the various HIPK1 sequences are important in lymphoma Accordingly, disorders based on mutant or variant HIPK1 genes may be determined In one embodiment the invention provides methods for Identifying cells containing variant HIPK1 geneβ comprising determining all or part of the sequence of at least one endogenous HIPK1 genes in a cell As will be appreciated by those In the art, this may be done using any number of sequencing techniques. In a preferred embodiment the invention provides methods of identifying a HIPK1 genotype of an individual comprising determining all or part of the sequence of at least ona HIPK1 gene of the individual. This is generally done in at least one tissue of the individual, and may Include the evaluation of a number of tissues or different samples of the same tissue. The method may include comparing the sequence of the sequenced HIPK1 gene to a known HIPK1 gene, i.e.. a wild- type gene. As will be appreciated by those In the art. alterations In the sequence of some oncogeneβ can be an Indication of αither the presence of the disease, or propensity to develop the disease, or prognosis evaluations.

The sequence of all or part of a H1PK1 gene can then be compared to the sequence of a known HIPK1 gene to determine if any differences exist This can be done using any number of known homology programs, such as Bestfit, etc. In a preferred embodiment, the presence of a difference in the sequence between a HIPK1 gene of the patient and the known HIPK1 gene Is indicative of a disease state or a propensity for a disease state, as outlined herein.

In a preferred embodiment, the HIPK1 genes are used as probes to determine the number of copies of a HIPK1 gene in the genome. For example, some cancers exhibit chromosomal deletions or insertions, resulting in an alteration in the copy number of a gene.

In another preferred embodiment HIPK1 genes are used as probes to determine the chromosomal location of the HIPK1 genes. Information such as chromosomal location finds use In providing a diagnosis or prognosis In particular when chromosomal abnormalities $uch as translocations, and the like are identified in HIPK1 gene loci.

Thus, In one embodiment, methods of modulating H1PK1 in cells or organisms ara provided. In one embodiment, the methods comprise administering to a cell en anti-HI K1 antibody that reduces or eliminates the biological activity of an endogenous HIPK1 protein. Alternatively, the methods comprise administering to a cell or organism a recombinant nucleic acid encoding HIPK1 protein. As will be appreciated by those in the art, this may be accomplished in any number of ways. In a preferred embodiment, for example when a HIPK1 sequence is down-regulated in lymphoma, the activity of a HIPK1 gene is increased by increasing the amount of HIPK1 in the cell, for example by overexpresslng the endogenous HIPK1 or by administering a gene encoding a HIPK1 sequence, using kπαwπ gene-therapy techniques, for example. In a preferred embodiment, tha gene therapy techniques include the incorporation of the exogenous gene using enhanced homologous recombination (EHR), for example as described in PCT/US93/03868, hereby incorporated by reference in its entirety. Alternatively, for example when a HIPK1 sequence Is up-regulated in lymphoma, the activity of the endogenous HIPK1 gene is decreased, for example by the administration of a HIPK1 antisense nucleic acid.

In one embodiment the HIPK1 proteins of the present invention may be used to generate polyclonal and monoclonal antibodies to HIPK1 proteins, which are useful as described herein. Similarly, the H1PK1 proteins can be coupled, using standard technology, to affinity chromatography columns. These columns may then be used to purify HIPK1 antibodies. In a preferred embodiment, the antibodies are generated to epitopes unique to HIPK1 protein; that is, the antibodies show little or no cross-reactivity to other proteins. These antibodies find use in a number of applications. For example, the HIPK1 antibodies may be coupled to standard affinity chromatography columns and used to purify HIPK1 proteins. The antibodies may also be used as blocking polypeptides, as outlined above, since they will specifically bind to a HIPK1 protein,

In one embodiment, a therapeutically effective dose of HIPK1 or modulator thereof is administered to a patient. By "therapeutically effective dose" herein is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As Is known in the art, adjustments for H1PK1 degradation, systemic versus localized delivery, and rate of new protease synthesis, as well as the age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.

A "patient" for the purposes of the present Invention includes both humans and other animals, particularly mammals, and organisms. Thus the methods are applicable to both human therapy and veterinary applications. In the preferred embodiment the patient is a mammal, and in the most preferred embodiment the patient Is human.

The administration of the HIPK1 proteins and modulators of the present invention can be done In a variety of ways as discussed above, indudiπg, but not limited to, orally, subcutaneously, intravenously, intranasally, ixansdermalty, intraperitoneally, intramuscularly, intrapul onary, vaginally, rectally, or intraocularly. In some instances, for example, in the treatment of wounds and inflammation, the HIPK1 proteins and modulators may be directly applied as a solution or spray.

The pharmaceutical compositions of the present invention comprise HIPKl protein in a form suitable for administration to a patient. In the preferred embodiment the pharmaceutical compositions are In a water soluble form, such as being present as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts. "Pharmaceutically acceptable add addition salt" refers to those sails that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such ac hydrochloric acid, hydrobromic acid, sulturic acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric odd. tartaπc add, citric acid, benzoic acid, clnnamic acid, mandelic acid, methaπesulf mc acid, ethanesulfonic a d, p-toluenesulfoπic acid, salicylic acid and the like, "Pharmaceutically acceptable base addition salts" include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Particularly preferred are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, tπmethylamine, diethylamlne, triethylamine, tripropylamlne, and ethanolamine.

The pharmaceutical compositions may also include one or more of the following, carrier proteins such as serum albumin; buffers, fillers such as rnicrocrystalllnβ cellulose, lactose, corn and other εlarches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol. Additives are well known in the art, and are used in a variety of formulations

In a preferred embodiment HIPK1 proteins and modulators are administered as therapeutic agents, and can be formulated as outlined above Similarly, H1PK1 genes (Including both the fulHength sequence, partial sequences, or regulatory sequences of the H1PK1 coding regions) can be administered in gene therapy applications, as is known in the art These HIPK1 genes can Include antisense applications, either as gene therapy (i.e. for incorporation into the genome) or as antisense compositions, as will be appreciated by those in the art.

In a preferred embodiment, HIPK1 genes are administered as DNA vaccines, either single genes or combinations of HIPK1 genes Naked DNA vaccines are generally known in the art Brewer, Nature Biotechnology, 16:1304-1305 (1998).

In one embodiment, HIPK1 genes of the present invention are used as DNA vaccines. Methods for the use of genes as DNA vaccines are well known to one of ordinary skill in the art, and include placing a HIPK1 gene or portion of a HIPK1 gene under the control of a promoter for expression in a LA patient A HIPK1 gene used for DNA vaccines can encode full-length HIPK1 proteins, but more preferably encodes portions of a HIPK1 proteins including peptides derived from a HIPK1 protein. In a preferred embodiment a patient is immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a HIPK1 gene. Similarly, it is possible to immunize a patient with a plurality of HIPK1 genes or portions thereof as defined herein. Without being bound by theory, expression of the polypeptide encoded by the DNA vaccine, cytotoxic T-cells, helper T-cells and antibodies are induced which recognize and destroy or eliminate cells expressing HIPK1 proteins.

In a preferred embodiment, the DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine. Such adjuvant molecules include cytokines that increase the Immunogenic response to a HIPK1 polypeptide encoded by the DNA vaccine. Additional or alternative adjuvants are known to those of ordinary skill in the art and find use in the invention.

In another preferred embodiment HIPKl genes find use In generating animal models of Lymphoma. As ii appredated by one of ordinary skill in the art, when a HIPK1 gene identified is repressed or diminished in tissue, gene therapy technology wherein antisense RNA directed to a HIPK1 gene will also diminish or repress expression of the gene. An animal generated as such serves as an animal model of lymphoma that finds use in screening bioactive drug candidates. Similarly, gene knockout technology, for example as a result of homologous recombination with an appropriate gene targeting vector, will result in the absence of HIPK1 protein. When desired, tissue-specific expression or knockout of HIPK1 protein may be necessary.

It is also possible that HIPK1 protein is overexpressed in lymphoma. As such, transgenic animals can be generated that overexpress HIPK1 protein. Depending on the desired expression level, promoters of various strengths can be employed to express the transgene. Also, the number of copies of the integrated transgene can be determined and compared for a determination of the expression level of the transgene. Animals generated by such methods find use as animal models of HIPK1 and are additionally useful in screening for bioactive molecules to treat lymphoma.

A HIPK1 nucleic acid sequence of the invention is depleted in Table 1 as SEQ ID NO. 1. The nucleic acid sequence shown is from mouse.

TABLE 1

A coπtig assembled from the mouse EST database by the National Center for Biotechnology Information (NCBl) having homology with all or parts of a HIPK1 nucleic acid sequence of the invention Is depicted in Table 2 as SEQ ID NO. 2 SEQ ID NO 3 represents the amino add sequence of a protein encoded by SEQ ID NO. 2.

TABLE 2

MOU9E

SAQRES REF SEQ SEQUENCE TAG* IDjt

S000013 F3 CCGCCACCΛAACGCCGGTTAAACCACCTCGOAGACTGCTGTQCGGAGAGGACTGGGAAACC

GGTCCCCACACACTOTO^CGCTGGCTCCCCACGGAGGCCCACCCACACCCGCGGCCCGGG

^QCAAGATGCAGTGATCTCAGCCCΤCCC^CTCCTCCGCACTTCCGCCTCAGTATGGCCTCACA

QCTGCAGGTGTRΠCGCCCCCATCAGTCRRCGTCGAGTGCCTTCTGCAROTGCAAAGAAACTGA

AAATAGAGCCCTCTGGCTGGGATGTTTCAGQAR^GAGCAGCAACGACAAATACTATACCCACA

GCAAAACCCRRCCCAGCTACACAAGGGCAAGCCAGCTCCTCTWCCAΒGTAGCAAATTTCAATC

TTCCTGCRRRACGACCAGGGCCTCCRRCTCCCAGC CCTGCCGTGGAGCATATTGTGGTAACAG

CTGCTGATAGCTCAGGCAGCGCCGCTACAGCAACCTTCCAAAGCAGCCAGACCCTGACTCAC

AGGAGCAACG I 1 I C 1 I I GCTTGAGCCATATCAAAAATGTGGATTGAAGAGAAAGAGTGAGGAA

GTGGAGAGCAACGGTAGCGTQCAGATCATAGAAGAACACCCCCCTCTCATGCTGCAGAACAG

AACCGTGGTGGGTGCTGCTGCCACGACCACCACTGTGACCACCAAGAΣTAGCAGTTCCAGTG

GAGAAGGGGA TACCAGCTGGTCCAGCATGAGATCCTI GCTCTATGACCAACAGCTATGAA

GTCCTGGAGTTCCTAGGCCGGGGGACATTTGGACAGGTGGCAAAGTGCTGQAAGCGGAGCA

CCAAGGAAATTGTGGCCATTAAGATCNGAAGAACCACCCCRCCTATGCCAGACAAGGACAGA

TRGAAGTGAGCATCCRITRCCCGCCTMGCAGTGAAAATGCTGATGAGTATAACTTTGTCCG7T

CTTATGAGTGTTTTCAGCAC GAATCATACCTGC RRRGTGTTTQAGATGTTGGAGCAQAACTT

GTACGATTTTCTAAAGCAGMCMGTRRAGCCCACTGCCACTC GTACΛTAAGACCAATCTTG

CΛGCAGGTGGCCACAGCCCTGATGAAGCTGAAGAGTCTΓGGTCTGATTT^TGCTQACCTTAA

ACCTGAAAACAT TGCTAGTCGATCCAGTTCGCCAACCCTACCGAGTGAAGGTCATTGACTT

TGRJTTC GCRAGTCATGTTTCCAMGCCGTGTGTTCAACCTACCTGCAATCACGCTACTACAG

AGCTCCTGAAATTATCCTRGGATTACCATTCTGTGAAGCTATTGACATGTGGTCACTGGGCTGT

GTAATAGCTGAGCTGΠCCTGGGATGGCCTCTTTATCC GGTGCTTCAGAATACGATCAGATT

CGCTATATNCACAAACACMGGCCTGCCAGCTGAGTATCRRTCTCAGTGCCGGAACAAAAACA

ACCAGG I I I I R TAAR^GAGATCCTAATTTGGQGTACCCACTGTQΒAGGCTTAAGACACCTG

AAGAACATQAATTGGAMCTGGAATAAAGTC^VAAAGAAGCTCGGMGTACATTTTTAACT

TJTRRAOATCACATGGCTCAGGTAAATATGTCTACAGACTTAGAGGGGACAGATATGTTAG

CAGAGAAAOCAGATCGGAGAGAGTATATTGATCTRCTAAAGAAAATGCTGACGATRGATG

CAGATAAGAGAATCACGCCTCTGAAGACTCTTAACCACCAATTTGTGACGATGAGTCACC

TCCTGGACTTTCCTC^CAGCAGCCACGTT GRCCTGTTTCCAGAACATGGAGATCTGCA

AGCGGAGGGTRCACATGTATGACACAGTGAGTCAGATCAAGAGTCCCΠCACTACACATG

TCGCTCCAAATACAAGCACAAATCTAACCATGAGCTTCAGCAACCAGCTCAACACAGTGC

ACAATCAGGCCAGTGΠCTAGCTTCCAGCTCTACRRGCΛGCAGCAGCRACCCTTTCTCTGG

CTAATTCAGATGTCTCGCTGCTA CTACCAATCQGCLTRGTACCCATCGTCGGCAGCGC

CΛGTRCCTGGAΣTTQCCCAGCAGGGTGTTTCCTTACAACCΤGGAACCACCCAGATCTGCA

CTCAGACAGATCCATTCWGCA CATTTATAGTATGCCCACCTTGCTTTTCAGACTGGAC

TACAAGCAACAACAAAGCATTCTGGATTCCCTGTGAGGATGGATAATGCTGTGCCAATTG

TACCCCAGGCGCCTGCTGCTCAGCCGCTQCAGATCCAGTCAGGAGTACTCACACAGGGAA

GCTGTACACCACTAATGGTAGCAACTCTCCACCCTCAΛGTAGCCACCATCACGCCGCAGT

ATGCGGTGCCCTTTACCCTGAGCTGCGCAGCAGGCCGGCCGGCGCrrGGrrGAACAGACTG MOUSE

SAGRES REF sεq SEQUENCE

TAGW # ιo#

CTGCTGTACTGCAAGCCTGGCCTGGAGGAACCCAACAAATTCTCCTGCCRRCAGCCTGGC

AGCAGCTGCCCGGGGTAGCTCTGCACAACTCTGTCCAGCCTGCTGCAGTGATΓCCAGAGG

CCATGGGGAGCAGCCAACAGCTAGCTGACTGGAQGAATGCCCACTCTCATGGCAACCAGT

ACAGCACTATTATGCAGCAGCCATCTTTGCTGACCAACCATGTGACCTTGGCCACTGCTC

AGCCTCTGAATGTTGGTGTTGCCCATQTTGTCAGACAACAACAGTCTAGTTCCCTCCCTT

CAAAGAAGAATAAGCAGTCTGCTCCΛGTTTCATC Υ ATCCTCTCTGGAAGTCCTGCCTT

CTCAAGTTTATTCTCTGGlTGGQA^QTAGTCCTCrrTCroTACWCATCTTCrrrATAATTC

TAGTΓCCTGTCCAAGACCAGCATCAGCCMTCATCATTCCAGATACCCCCAGCC TCCTG TGAGTGTCATCACTATCCGTAGTGACACTGATGAAGAAGAGGACAACAAATACAAGCCCA ATAGCTCGAGCCTGAAGQCGAQGTCTAATGTCATCAGTRATGTCACTGTCAATGATTCRRC CΛGACTCTGACTCCTCCCTGAGCAGCCCACATCCCACAGACACRRCΤGAGTGCTCTGCGGG

GCAACAGTGGGACCCTTCTGr GGGACC GGCAGACCTGCAGCAGATGGCATTGGCACCC GTACTATCATTGTGCCTCC I I I UAA~\ACACAGCTTGGC6ACTGCACTGTAGCAACACAGa CCTWGGTCTCCITAGCAGTAAGACC GCCAaTGGCCTCAGTGAGTGGGCAGTCATCTG GATGCTGTATCACTCCCACGGGGTACCGGGCTCAGCGAGGGGGAGCCAGCGCGGTGCAGC CACTCAftCC TAGCCAGAACCAGCAGTCATCGTCAGCH CAACCrrαSCAGGAAAGAAGrA

ΣCAΛCCCTGCTCCCCGCAGACAGCAGGCATTTGTGGCCCCGCTCTCCCAAGCCCCCTACG

CCΠCCAGCATGGCAGCCCACTGCACTCGACGGGGCACCCACACTTGGCCCCAGCCCCTG

CTCACCTGCCAAGCCAGCCTCACCTGTATACGTACGCTGCCCCCACTTCTGCTGCTGCAT

TGGGCTCCACCAGTTCCATTGCTCATCTGTTCTCCCCCCAGGGTFCCTCAAGGCATGCTG

CAGCTTATACCACACACCCTAGCACTCTGGTGCATCAQQTTCCTGTCAGTGTCGGGCCCA

GCCTCCTCACTTCTGCCAGTGTGGCCCCTGCTCAGTACCAACACCAGTTTGCCACTCAGT

CCTACATCGGGTCTTCCCGAGGCTCAACAATRTACACTGGATACCCGCTGAGTCCTACCA

AGATCAGTCAGTATTCTTACTTGTAGTTGATGAGCACGAGGAGGGCTCCGTGGCTGCCTG

CTAAGTAGCCCTGAGTTCTTAATGGGCTCTGGAGAGCACCTCCATTATCTCCTCTTGAAA

GΠCCTAGCCAGCAGCGCGTTCTGCGGGGCCCACTGAAQ^GΛAGGCTTTTCCCTGGGAA

CAGCTCTCGGTrirrrGACTGCArrGnGCAGTCTCCCMGTCTGCCCTGTTTTrTTAATTC

TTTAπCTTG GACAGCAπ r 1 1 GGACGTTGGAAGAGCTCAGAAOCCCATCTTCTGCAGT

TACCAAGGAAGAMGATCGTTCTGMGπACCCTCTGTCATACATTTGGTCTCTrTGACT

TGGTTTCTATAAATG TTT1 I A TG GTAAAQCTCTTCTTTACGAGGGGAAATGCTGA

CnGAAATCCTGTAGCAGATGAGAMGAGTCATTACTTTrrGTTTGCTTAAAAAACTAAA

ACACAAGACrrCCTTGTCTTTTATTrrGAAAGCAGCTTAGCAAGGGTGTGCTTATGGCGT

ATGGA CAGMTGATnCAτTTTCATGTCGTGCTGTCCTTACTGGGCAGTTGTTAGAGT

TTTAGTACAACGAGTCACTGAAACCTGTGCAGCTQCTGCTGAGCTGCTCGCAGAGCAGCA

CTG CAGGCAGCCAGCGCTGCTGGQAAΘGAAGGTGAGGGTGAGGACTGTGCCCACCAGG

AπCATTCTAAATGAAGACCATGAGTrCAAGTCCTCCTCC CTCTCTAGπTMCTTAAA nCTCCTrATAGAAMGCC GTGAGGTGGTAAGTGTATGGTGGTGGTTTGCATACAATAG

TATGCAAAATCTCTCTCTAaMTGAQATACTQGCACTGATAAAC-ATTGCCTAAGATTTCT

ATGAATTTCAATAATACACGTCTGTG M i l CCTCATCTCTCCCTTCTGTTTCATGTGACT

TATTTQAGGGGAAMCTAAAGAAACTAAMCCAGATAAGTTGTGTATAGCTΓΓTATACTT TAAAGTAGCTTCCTΓΓGTATGCC CAGCAAATTGAATGCTCTCTTACTAAGACTTATGT AATAAGTGCATGTAGGAATTGCAGAAAATATTTTAAAAGTTTATTACTGAATTTAAAAAT

ATTTTAGAAG l l l l GTAATGGTGGTGTTrTAATATTTTGCATAATTAAATATGTACATAT TGATTAGAAGAMTATMC-AATTTTrCCTCTAACCCAAMTGTTATTTGTAATCAAATGT MOUSE

SAGRES REF SEQ SEQUENCE

TAG# ≠ ID*

GTAGTGATTACACTTGAATTGTGTATTTAGTGTGTATCTGATCCTCCAGTGTTACCCCGG

AGATGGATTATGTCTCCATTGTATTTAMCCAAAATGAACTrWTACrrGrrGGAATGTAT

GTGAACTAATTGCAATTCTATTAGAGCATATTAC GTAQΥT3CTGAGAGAQI AGGGGCATT

GCCTGCAGAGAGGAGACCTT∞GATTGTTTTGCACAGGTGTGTCTGGTGAGGAGTTGTTC

AGTGTGTGTCTTTTCCTTCCTCCTCTCCTCTCTCCCCTTATTGTAGTGCCTTATATGATA

ATGTAGTGGTTAATAGAGTTTACAGTGAGCrrTGCCnrAGGATGACCAGCAAGCCCCAGTG

ACCCCAAGCTGTrCGtrrGGGATTTAACAGAGCAGGTTGAGTAGCTGTGTTGTGTAAATGC

GTTCGTGTTCTCAGTCTCCCrrACCGACAGTGACAAGTCAAAGCCGCAGC I I 1 CCTCCTTA

ACTGCCACCTCTGTCCCGTTCCATTTTGr^TCrrrCAGCTl^GTTCrrCACAGAAGCATTCr

CTAACGTGGCTCrCTCACTGTGCCTTGCTACCrrGGCπ

CGAGAAGAGTGACGCCAGTGCrrAAATATGCATATTTGAAGGTTTGTGCATTACTTAGGGT

GGGATTCCTTTTCTCTCCTCC^TGTGATATGATAGTCCrrTCTGC-ATAGtrrGTCGTr^

TGGTAAACTTTGCTTGGI I I I I I I I I I I I MG I I I GTTG I I I I I 1 I 1 1 1AAAGCATGTAA

CAGATGTGTTTATACCAAAGAGCCTGTTGTATTGCTTAATATGTCOCATACTACGAGAAG

GGTTTTGTAGAACTACTGGTGACAAGAAGCTCACAGAAAGG I I 1 lAATTAGTGACGAA

TATGAAAAAGAAAGC>AAACCTCTTGAATCTGAACAATTCCTGAGG1 I I C M I GGGACAA

CATGTTGTTCTTGGGGCCCTGCACACTGTAAAATTGTCCTAGTATTCAACCCCTCCATGG

ATrTGGGTCAAGTTGAAGGTACTAGGGroTGGGGACATTCTrGCCCATGAGGGATTTGTGG

GGAGAAGGTTAACCCTAAGCTACAGAGTGGTCC^CCTGAATTAAATTATATCAGAGTGGT

AATTCTAGGATTGGTTCTGTGTAGGTGGTGTCAGGAGGTGCAGGATGGAGATGGGAGATT

TCATGGAACCCGTrCAGGAAAGC CTGAACCAGGTGGAACACCGAGGGGCTGTCAACGAA

CnGGAGTTTCTTCATCAT^QQQQA^QGAAαAGTTrCCAαθ^QCAα^QOCA^QQTAOTCAαTTTA

GCCTGCCGGCMCOTαQTGτ0TGrπGTCTTTrcrrTAATCATTATATrAAGCTGTGCGTT

CAOCAGTCTGTTGGTrGAGATAACCACGCATCATTGTGT^^

CGTTTATGTCAnCTGTGTGTGATCTnGTGTTTCCTTTCCCCCAAGCATTCTGGGrrrTT

TCCTATTTAAATACAGTTCTAGTTTCTAGGCAAACA I i I M M IAACCITI ICICVATAA GGQACMGATTTATTG I I I I IATAGGAATGAGATGCAGGGAAAAAACAAACCAACCCTGT

CCCCACTCCTCACCrCCCTAATCCAATAAGCAGTTATTGAAGATGGGAGTCTrAAATTTA

TGGGAAMGAGGATGCCTAGGAGTTTG^TCGTTACCTGAr^CATCTGGCTAGCAGTGTG

ACTTTAr ,GACTrTGAGGnGTCACTCTGCAAACTGACATTrCAGATT7TCCTAGATAAC

CCATCTGTGTCTQCTGAATGTQTATQCGCCAGACATAGTTTTACATTCAri'CTGGCCTGG

GGCTTAACATTGACTGCTTGCCCTQATGGCATGGAGGAGAGCCCTACGAACATAGCGCTG

ACTAG^QTCAOCATTGCCTGACCTrGGAAC- GCTTAAGGCT rAAACC TCTCTTAGA^^

TGCATTTCCAGTTTCTCCCTTCCCAGGTGAGAGAGGAACTGGAAGGGTTGCATAGGCACA

CACCAGGACACTTAGTCACTCCAGAGTCCCCAGTTGCAACTAGGAGGTGGTTACCCTGTT

AACCCCAGGAAG GMCCCCATTTCAAACAGTTCCGGCCATTGAGAGCCTGCTTTTGTG

GTTGCTCATCCGTCATCATCCGCTAGAGGGGCTTAGCCAGGCCAGCACAQTACTGGCTGT

CCTATTCTGCAπAGTATGCAGGMTTrACTAGTrGAGATGGTTTGTTTTAGGATAGGAG

ATGA TTGCCTπCGGTGACAGG TGGCCAAGCCTGCTTTGTG I I I 1 1 1 1 I lAAATGA

TGGATGGTGC VGCATGTπCCAAGTπCCATGGnGTTTGTTGCTAAAATrTATATAATG

TGTGGTπCAArrC TTC QCT GAAAAATMTTTCACTATATGTAGCAQTACATTATA

TGTACATTATATGTAATQTTAGTAl l l l l GCTTTGAATCCTTGATATTQCMTGGAATTC

CTAATTTATTAAATGTATTTGATATGCTAAAAAA

Also suitable for use in the present invention is the sequence provided in Genbank Accession No. AF077658.

A contig assembled from the human EST database by the NCBl having homology with all or parts of a HIPK1 nucleic acid sequence of the Invention Is depicted in Table 3 as SEQ ID NO. 4. SEQ ID NO. 5 depicts the amino acid sequence of a open reading frame of SEQ ID NO. 4 which encodes the C-term^'mal portion of human HIPK1 protein.

TABLE 3

HUMAN

SAGRES REF SEQ SE^QUENCE TAG* IO#

CCCTCCTGTGAGTGTCATCACTATCCGAAGTGACACTGATGAOαΛAGAGGACAACAAATA

C GCCCAGTAGCTCTGGACTGAAGCCAAGGTCTMTGTCATCAQTTATGTCACTGTCAA

TGATTCTCr^GACTCTGACTCTTCTTTGAGCAGCCCTTATTCCACTQATACCCTGAGTGC

TCTCCGAGGC^ATAGTGGATCCGTrTTGGAGGGGCCTGGCAGAGTTGTGGCAQATGGCAC

TGGCACCCGCACTATCATTGTGCCTCrjACTGAAAACTCAGCTrGGTGACTGCACTGTAGC

MCCCAGGCCTCAGGTCTCCTTGAGC TMGACTAAGCCAGTCGσrTCΛGTGAGT^QOGCA

GTCATCTGGATGCTGTATCACCCCCACAGGGTATCGAGCTCAACGCGGGGGGACCAGTGC

AGCAC^V CCACTCMTCTΓAGCCAGAACCAGCAGTCATCGGCGGCTCCAACCTCACAGGA

GAGAAGCAGCAACCCAGCCCCCCGCAGGCAGCAGGCGTRTGTGGCCCCTCTCTCCCAAGC

CCCCTAC^CCTTCR^GCATGGCAGCCCGCTACACTCGACAGGGCACCCACACCTTGCCCC

QQCCCCTGCTCACCTGCCAAGCCAGOCTCATCTGTATACGTATGCTGCCCCGACTTCTGC

TQCTGL^CRRGGGCTCAACCAGCTCCANGCTCATCTTTTCTCCCCACAGGGTTCCTCAAG

GCATGCTGCAGCCTATACCACTCACCCTAGΪ^CTTTGGTGCACCAGGTCCCTGTCAGTGT

TttGGCCCAGCCTCCTCACTTCTGCCAGCGYGGCCCCTGCTCArirrACCAACACCAGrrTGG

CACCCMTCCTACATTGGGTCTTCCCQAGGCTCAAGAATTTACACTGGATACCCGCTGAG

TCCTACCAAGATCΛGCCAGTAnCCTACTTATAGTτGGTGAGCATGAGGGAGGAOGAATC

ATGGCTACCTrcTCCTGGCCCTGCGTTCTτAA^'TAτTGGGCTATαGAGAGATCCTCCTTTA

CC rCTTGA TTTCπAGCCAGCΛACTTGTrCTGCAGGGGCCCACTGAAGCAGAAGGTT

TTTCTCTGGGGGAACCTGTCTCAGTGTTGACTGCATTGTTGTAGTCTTCCCAAAGTTTGC

CCTATTTTTAAAT CATT l 1 1 1 1 GTGACAGTAA^'I I I H GTACTTGGAAGAGTrCAGATG

CCCATCnCrrGCAGTTACCAAGGAAGAGAGATTGTTCTGAAGTTACCCTCTGAAAAATAT

TTTGTCTCTCTαACTTGAl I l UATAAATGC I I I I AAAAACAAGTGAAGCCCCTCTTTAT

TTCATTTTGTCrrrATTGTGATTCCTGGTCAGGAAAMTGCTGATAGAAGGAGTTGAAATC

TGATGACAAAAA GAAAAAπACTTTπGTπGTnATAAACTCAGACnGCCTATTTr

ATTTTAAAAGCGGCTTACAC TCTCCCTTrTGTnATTGGACATTTAAACTrACAGAGT

TTCAGTrrTGTrrTAATGTCATAπATAC^,rTMTGGGCAATTGTrArrTTTGCAAAACTG

GTTACGTATTACTCTGTGπACTAπGAGATrCTCTCAATTGCTCCTGTGTTTGTTATAA

AGTAGTGTπAAMGGCAGCTCACCATTTQCTGGTAACTTAATGTGAGAGAATCCATATC

TGCGTGAAAAC^CCAAGTAnCTTTTTAAATGAAGCACCATGAATrCI l l l l lAAATTAT l l l l lAAAAGTCTTTCTCTCTCTGAnCAGCTTAMTTTTTTTATCGAAAAAGCCATTAA

GGTGGTrAπATTACATGGTGGTGGTGGTTTrATTATATGCAAAATCTCTGTCTATTATG

AGATACTGGCATTGATGAGCTrrGCCTAAAGATTAGTATGMTTTTCAGTAATACACCTC

TGTTTTGCTCATCTCTCCCTTCTGTTTTATGTGATTTGTTTGGGGAGAAAGCTAAAAAAA

CCTGAAACCAQAT GAACATnCTTGTGTATAGCTTTTATACTTCAAAQTAGCTTCCTT

TGTATG∞AQCAGCAMTTGMTGCTCTCTrATTAAGACTTATATAATAAGTGCATGTAG

GAAnGCAAAAAATATTTTAAAAATTrAnACTGAATTTAAAAATATTTTAGAAGT^

TAATGGnrGGTGTTTTAATATTTTACATAATTAAATATGTACATATTGATTAGAAAAATAT

AACMGCMTTTTTCCTGCTAACCCAAAATGTTATTTGTAATCAMTGTGTAGTGARRAC

ACTTGAANGTGTACRTAGTGTGTATGTGATCCTCCAOTGTTATCCCGGAGATOGATTGA

TGTCTCCANGTATTTAAACCAAAATGAACTGATACTTGTTGGMTGTATGTGAACTAAT

TGCAATTATATTAGAGCATATTACTGTAGTGCTGAATGAGCAGGGGCATTGCCTGCAAGG

AGAGGAGACCCTTGGAATTGTTTTQCACAGGTGTGTCTGOTGAGGAGTTTTTCAGTGTGT

GTCTCTTCCTTCCCTTTCN CCTCCTTCCCTTATTGTAGTGCCTTATATGATAATGTAGT

GGTT TAGAGTTTACAGTQAGCTTGCCTTAGGATGGACCAGCAAGCCCCCGTGGACCCT HUMAN

SAGRES REF SEQ SEQUENCE TAG# U 10#

AAGnGTTCArXGGGATTTATCAG CΛGGATTAGTAOCTGTATTGTGTAATGWTTGTT

CTCΛθπrTTCCCTGCCMCΛTTGAAAAATAΛAAACAGCAGCTTτTCTCCrrrrACCACCACC

TCTACCCCTTTCCAI I I l υGAπCTCGGCTGAGTTCTCACAGAAGCATTTTCCCCATGTG

GCTCTCTCACTGTGCGTTGCTACCTrGCTTCTGTGAGAAπ^

GTCMG^CMTATTAMTATGCAπCTTTTAAAGTATGTGCAATCACπTTAGAATGAAT

M M πTrccrrrrCCCATGTGGCAGTCCTTCCTGCACΛTAGTTGACATTCCTAGTAAAA

TATTTGCTTGTTGAAAAAAAr^TGTTAACAGATGTGTrTATACClAAAGAGCCTGTTGTAT

TGCTTACCATGTCCCCATACTATGAGGAGAAGTTTTGTGGTGCCGCTGGTGACAAGGAAC

TCACAGAAAGGTTTCrrTAGCTGGTGAAGΛATATAGAGAA^QQAACCAAAGCCTGTTGAGTC

ATTGAGGCTTTTGAGQ I M I I I I I I AACAGCTTGTATA^QTCTrGGGGCCCTTCAAGCTG

TQAAATTGTCCTTQTACTCTCAGCTCCTGCATGGATCTGGGTCAAGTAGAAGGTACTGGG

GATGGGGACATTCCrTGCCCATAAAGGATTTGGGGAAAQAAGATrAATCCTAAAATACAGG

T^QTGTTCCATCCGAATTGAAAATGvATATATTrGAGATATAATTTTAGGACTGGTTCTGTG

TAGATAGAGATGGTQTCAAGGAGGTGCAGGATGGAGATGGGAGATTTCATGGAGCCTGGT

CAGCCAGCTCTGTACCAQrjTTGAACACCGAGGAGCrrrjTCVVAAQTArπGGAGTrTGπ

TTGTMGGAGTAAGGGCTTCCAAGATGGGGCAQQTAGTCCGTACAOCCTACCAGGAACAT

GTTGTGT CTTTATTTmAAAVrCATTATATTGAGTTGTG

GTCMr^TAGCCAAGCAGTrrGTATAATTTCTGTCACTAGTGTCArACAGTTTTCTGGTC

AACATGTGTGATCTTTGTGTCTCCl 1 I M GCC GCACATTCTGATTTTCTrGTTGGAAC

ACAGGTGTAGTTTCTAAAQQACAAA U M GTTCCTTGTC M 1^'TCTGTAAGGGACAA

GATTTGTTG H I QTAAGAAATGAGATGCAGGAAAGAAAACCAAΛTCCCATTCCTGCAC

CCCAG CCAATAAGCAGATACCACTTAAGATAGGAGTCTAAACTCCACAGAAAAGGATAA

TACCMGAGCTTGTAnGTTACCTTAGTCACnGCCTAGCAGTGTGTGGCTTrAAAAACT

AGAGA^'l I I I I CAGTCnAGTCTGCAMCTGGCATTTCCGATTTTCCAGCATAAAMTCCA

CCTGTGTCTGCTGAATGTGTATGTATQTGCTCACTGTGGCTrTAGATTCTGTCCCTGGGG

TrAGCCCTGTTGGCCCTGACAGGAAGGQAGGAAGCCTGGTGAATTTAGTGAGCAQCTGGC

CTGGGTCACAGTtSACCTGACCTCAAACCAGCTTAAGGCTTTAAGTCCTCTCTCAGAACTT

GGCATTTCCMCTTCnCCTTrCCGGOTGACWGAAG αCGGAGAAGGGTTCAGTGTAGC

CACTCTGGGCTCATAGGGACACTTGGTCACTCCAGAG I 1 1 1 LAATAGCTCCCAGGAGGTG

ATATTATTTTCAGTGCTCAGCTR AATACCAACCCCAGGAATAAGAACTCCATTTCAAAC

AGTTCTGGCCATTCTGAQCCTGCTTTTGTQATTGCTCATCCATTGTCCTCCACTAGAGGG

GCTAAGCRRGACTGCCCTTAGCCAGGCAAGCACAGTAATGTGTGTTTTGTTCAGCATRAT

TATGCAAAAATTCACTAGTTGAGATGGTNGTTTTAGGATAGGAAATGAAATTGCCTCTC

AGTGACAGGAGTGGCCCGAGCCTGCTTCCTATΠTGA I M M M I 1 1 I I I I ACTGATAG

ATGGTGCAGCATGTCTACATGGTTGTAQNGCTAAACTTTATATAATGTQTGGTTRCAA

TTCAGCTTGAAAAATAATCTCACTACATQTAGCAGTACATTATATGTACATTATATGTAA

TGTTAGTATTTCTGCTTTGMTCCTTGATAΠGCAATGGMTTCCTACTRRATTAAATGT

ATTTGATATQCTAGTTATTGTGTGCGATTTAAAC I I I I I I I GCTTTCTCCC I 1 1 I I I I GG nGTGCGCTTTCTTrrACAACAAGCCTCTAGAAACAr^jWTAGTTTCTGAGM^"rTACTGAGC

TATGTTTGT TGCAGATGTACnAGGGACTATCTAA TMTCATTTTAACAAAAGAM

TAGATATTTAAAATnMTACTMCTATGGGAAAAGGGTCCATTGTGTAAAACATAGTTT

ATσrTTGGAπCAATGTTrGTCTπGGTTTTACAAAGTAGCTTGTATrrrC^GTATrrTC

TACTVTAATATGGTAA T^QTAGAGCAATTGCAATGCATCAATAAAATQGGTAAATTTTCTG

TPQYAVPFTLSCAAGRPALVEQTAAVU^ PGGT^QQlLLPSTVV^QQ PGVAXMNSV^QPTAMIPEAMG

All references cited herein are incorporated by reference.

Claims (14)

CLAIMSWe claim;

1. A method of screening drug candidates comprising: a) providing a cell that expresses a HIPK1 gene selected from the group consisting of SEQ ID NOS. 1, 2, and 4, or fragment thereof; b) adding a drug candidate to said cell; and c) determining the effect of said drug candidate on the expression of said HIPK1 gene.

2. A method according to claim 1 wherein said determining comprises comparing the level of expression in the absence of said drug candidate to the level of expression In the presence of said drug candidate.

3. A method of screening for a bioactive agent capable of binding to HIPK1 protein, wherein said HIPK1 protein is encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4, said method comprising: a) combining said HIPK1 protein and a candidate bioactive agent; and b) determining the binding of said candidate agent to said HIPK1 protein.

4. A method for screening for a bioactive agent capable of modulating the activity of HIPK1 protein, wherein said HIPK1 protein is encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4, said method comprising: a) combining said HIPK1 proteJn and a candidate bioactive agent and b) determining the effect of said candidate agent on the bioactrvity of said HIPK1 protein.

5. A method of evaluating the effect of a candidate lymphoma drug comprising: a) administering said drug to a patient; b) removing a cell sample from said patient; and c) determining alterations In the expression or activation of a gene selected from the group consisting 5EQ 1D NQS. 1 , 2, and 4,

6. A method of diagnosing lymphoma comprising: a) determining the expression of a HIPK1 gene selected from the group consisting of SEQ ID NOS. 1 , 2, and 4, or a polypeptide encoded thereby In a first tissue type of a first individual; and b) comparing said expression of said gene(s) from a second normal tissue type from said first Individual or a second unaffected individual; wherein a difference in said expression indicates that the first individual has lymphoma.

7. A method for Inhibiting the activity of a HIPK1 protein, wherein said HIPK1 protein is encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1. 2, and 4, said method comprising binding an inhibitor to said HIPK1 protein.

8. A method of treating lymphoma comprising administering to a patient an inhibitor of HIPK1 protein, wherein said HIPK1 protein is encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4.

9. A method of neutralizing the effect of a HIPKl prolein, wherein said HIPK1 protein is encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4, comprising contacting an agent specific far said H1PK1 protein with said H1PK1 protein in an amount sufficient to effect neutralization.

10. A polypeptide which specifically binds to a HIPK1 protein encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4.

11. A polypeptide according to claim 10 comprising an antibody which specifically binds to H1PK1 protein encoded by a nucleic acid selected from the group consisting of SEQ ID NOS. 1, 2, and 4.

12. A biochip comprising one or more nucleic acid segments selected from the group consisting of SEQ ID NOS. 1. 2, and 4.

13. A method of diagnosing lymphomas or a propensity to lymphomas by sequenciπd at least one HIPK1 gene of an individual.

14. A method of determining HIPK1 gene copy number comprising adding a HIPK1 gene probe to a sample of genomic DNA from an individual under conditions suitable for hybridization.