EP1417299A1 - New biopesticide using gene from erwinia pyrifoliaewt 3, novel pathogen that affects asian pear trees - Google Patents

New biopesticide using gene from erwinia pyrifoliaewt 3, novel pathogen that affects asian pear trees

Info

Publication number
EP1417299A1
EP1417299A1 EP02758919A EP02758919A EP1417299A1 EP 1417299 A1 EP1417299 A1 EP 1417299A1 EP 02758919 A EP02758919 A EP 02758919A EP 02758919 A EP02758919 A EP 02758919A EP 1417299 A1 EP1417299 A1 EP 1417299A1
Authority
EP
European Patent Office
Prior art keywords
protein
gene
polypeptide
erwinia
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02758919A
Other languages
German (de)
French (fr)
Other versions
EP1417299A4 (en
Inventor
Chun Keun Lim
Jang Hyun Hur
Duck Hwan Park
Hu Nam Bae
Jun Mo Cho
Su Jin Baek
Cheon Soon Jeong
Shin Geon Choi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Corp
Pioneer Co Ltd
Original Assignee
Pioneer Electronic Corp
Pioneer Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Electronic Corp, Pioneer Co Ltd filed Critical Pioneer Electronic Corp
Publication of EP1417299A1 publication Critical patent/EP1417299A1/en
Publication of EP1417299A4 publication Critical patent/EP1417299A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/27Erwinia (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50Isolated enzymes; Isolated proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/18Erwinia

Definitions

  • This invention relates to a novel biopesticide using a gene derived from a novel plant pathogen, Erwinia pyrifoliae WT#3 (KCCM 10283), isolated from Chunchon, Kangwon province, Korea Korea. This pathogen is endemic to Korea.
  • This novel biopesticide has more effective properties, such as improved resistance to plant disease, promotion of plant growth, and insect repellency as compared to those of HrpN, a hypersensitive response inducing protein, isolated from Erwinia amylovora (ATCC15580 1 ), which does not exist in Korea.
  • it can be utilized as a biopesticide effective to prevent plant diseases caused by pathogens and insects and to enhance plant growth as well as a fertilizer.
  • biopesticide used to control pests through a direct application of antagonistic microorganism itself to plants but this is not considered very effective in controlling of the pests. Therefore, recent researches have been progressing to control harmful pests by stimulating the self-defensive system of plants using products of antagonistic microorganisms instead of using microorganisms themselves.
  • an essential aim of biological control is to decrease or prevent of pests by activating the self-immunological function of a plant via treatment of microorganism-derived materials to plants.
  • the plant disease resistance is primarily conducted by the defense system of a plant by via structural barriers such as cutin in epidermal cells, a wax layer and types of porosity.
  • chemicals such as saponin or lectin, secreted by the plant can prevent the increase of pathogens population
  • More essential plant disease resistance refers to a hypersensitive response (HR), is a rapid, localized necrosis for preventing spread of pathogens that is associated with the active defense of plants against many pathogens to stimulate their self -defensive system using some microorganism-derived materials. [Richberg, M. H., Aviv, D. H. & Dangl, J. L. 1998. Dead cells do tell tales. Curr. Poin. PlantBiol. 1:480-485].
  • the first method for plant disease resistance associated with HR induction is that plants mobilize their early alert system to adjacent cells infected with bacterial pathogens so that these adjacent cells can increase the resistance to pathogens. This defense system is called as 'LAR' (local acquired resistance).
  • the second method is that through the activation of defense system in non-infected parts of a plant, more potent defense system is activated against the secondary infection. Consequently, the whole plant may exert a more strongly defense system against pathogens.
  • This defense system is called as "SAR" (systemic acquired resistance).
  • SAR systemic acquired resistance
  • the SAR may be sustained for several weeks or more and the plants exhibit some resistance to a variety of other unrelated pathogens [Hunt, M. D., Neuenschwander, U. H., Delaney, T. P., Weymann, K. B., Friedrich, L. B., Lawton, K. A., Steiner, H. Y. and Ryals, J. A. 1996. Recent advances in systemic acquired resistance research a review. Gene 179:89-95].
  • ISR induced systemic resistance
  • wound response to harmful insects were reported as the types of another plant resistance [Pieterse, C. M., van Wees, S. C., van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., Weisbeek, P. J. and van Loon, L. C. 1998.
  • SYSTEMIN a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14:1-17].
  • the mechanism of the plant disease resistance is triggered by elicitors that induce the plant defense system [Kessmann, H, Staub, T., Hofmann, C, Maetzke, T., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32:439-459].
  • the typical elicitors of SAR include a phenolic signaling compound SA (salicylic acid) produced by plants, elicitin and harpin that are isolated from pathogens [Ponchet, M., Panabieres, F., Milat, M. L., Mikes, V., Montillet, J.
  • Harpin is a common name for proteins produced from hrp gene island of plant pathogenic bacteria and one of Harpins, called HrpN, is a protein produced from hrpN gene located at hrp gene island of about 40kb of Erwinia amylovora which is not existing in Korea.
  • HrpN When the HrpN is inoculated to host plants, such as an apple, it acts as a pathogenic factor. In contrast, when HrpN is given to non-host plants, it is recognized as a foreign compound in plants and HR is elicited.
  • HrpN is an acidic, heat-stable (100 °C) protein with a molecular weight of 44 kDa [The molecular weight was measured in a manner such that after electrophoresis on acrylamide gel, the protein was stained with 0.025% Coomassie Blue R-250 and compared with Molecular Weight Standard of Bio-Rad Co. (Catalog* 161-0305, Bio-Rad Laboratories, 2000 Alfred Nobel Drive Hercules, CA 94547, USA)] with glycine-rich but without cysteine [Zhong-Min, W., Laby, R. J., Zumoff, C. H., Bauer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992.
  • HrpN a non-chemical protein
  • Erwinia amylovora a gram-negative bacteria that cause fire blight of rosaceous plants.
  • SAR elicitor which controls a variety of a plant diseases, several insects, mites and nematodes and exhibits a plant growth prompting effect by enhancing photosynthesis and nutritional absorption
  • HrpN induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene. Plant J. 20:207-215]. Also, HrpN has little toxicity and it does not cause in-any environmental pollution as it is biologically degradable and it is easy to formulate due to heat-resistance even after boiling at 100 °C [Zhong-Min, W., Laby, R. J., Zumoff, C. H, Bauer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen En ⁇ inia amylovora. Science 257:85-88].
  • HrpN derived from En ⁇ inia amylovora was successfully commercialized in 2000 by Eden Bioscience in the trade marker Messenger ® in USA for controlling the diseases of crops, such as cotton, tomato, tobacco, pepper, cucumber, strawberry, and wheat. It has been effectively utilized as fungicide, bactericide, pesticide, and plant growth facilitator [US Pat. Nos. 6,174,717 Bl, 5,849,868, 6,977,060, 5,859,324, and 5,776,889; Korea Examined Pat. Appl. Nos. 1999-022577, 2000-075771, 2000-070495, and 2000-057395].
  • the inventor et al. isolated and identified some bacterial pathogens from the infected lesions of a plant showing necrosis in pear growing orchards in Chunchon, Korea and found novel species, Erwinia pyrifoliae WT#3 (KCCM 10283) which is morphologically different from recently reported En ⁇ inia pyrifoliae by German researchers: that is, En ⁇ inia pyrifoliae WT#3 (KCCM 10283) does not have flagella, while En ⁇ inia pyrifoliae, which was reported by a German research team has peritrichous flagella. Also, it was different from the well-known En ⁇ inia amylovora causing fire blight.
  • an object of the present invention is to provide a novel species Erwinia pyrifoliae WT#3 (KCCM 10283) and a protein derived from the pathogen as an effective biopesticide, a plant growth activator, a seed-treating agent, an insect repllent, and a fertilizer.
  • a further aspect of the present invention is to provide a gene (KCCM 10282) encoding a protein or polypeptide of En ⁇ inia pyrifoliae in a non-infectious form to plants, which induces a hypersensitive reaction to non-hosts or resistance to pathogens in plants when plant cells are in contact with or treated with the gene.
  • a further aspect of the present invention is to provide transformants containing a gene (KCCM 10282) encoding a protein or polypeptide in a non-infectious form to plants from Erwinia pyrifoliae WT#3 (KCCM 10283).
  • a further aspect of the present invention is to provide a biopesticidal composition containing the protein or polypeptide and a carrier.
  • a further aspect of the present invention is to provide the composition which can be applied to plants as a pesticide, a plant growth activator, a seed-treating agent, insect repellent, and a fertilizer.
  • a further aspect of the present invention is to provide a method for producing a protein or polypeptide that induces a hypersensitive response or resistance on a mass-scale by isolating and purifying a protein or a polypeptide from a cultures of En ⁇ inia pyrifoliae WT#3 (KCCM 10283) and transformants containing a plant HR-inducing gene of the strain (KCCM 10282) from Erwinia pyrifoliae WT#3 (KCCM 10283).
  • the novel En ⁇ inia pyrifoliae WT#3 (KCCM 10283) of the present invention was isolated from the affected stem of a plant showing necrosis of pears orchard in Chunchon (Kangwonzhou, Korea).
  • the strain was identified as the genus En ⁇ inia, the same genus of the causal pathogen of fire blight, Erwinia amylovora and necrotic disease, Erwinia pyrifoliae (necrotic disease of Asian pears; Erwinia pyrifoliae reported by a German research team in 1999).
  • Erwinia amylovora and Erwinia pyrifoliae are peritrichous flagella, while our pathogen Erwinia pyrifoliae WT#3 (KCCM 10283) is non-flagellated, showing a great morphological difference from En ⁇ inia pyrifoliae which is only found in Korea.
  • an isolated gene encoding a protein which induces a hypersensitive response in non-host plants from En ⁇ inia pyrifoliae WT#3 was compared with a hrpN gene encoding a HrpN protein, which was discovered by Cornell University of the US and sold by Eden Bioscience co.
  • our novel gene showed less similarity to hrpN gene encoding a HrpN.
  • several insertions of nucleotide sequences fragments were found in the gene encoding a protein which induces a hypersensitive response in non-host plants from Erwinia pyrifoliae WT#3 which are not present in hrpN gene from E. amylovora.
  • the protein or polypeptide produced by the gene has a different amino acid sequence and molecular weight from those of HrpN peptide.
  • a recombinant pKEP3 for higher expression containing the gene derived from the Erwinia pyrifoliae WT#3 was constructed and transformed to Escherichia coli. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with Accession No. KCCM 10282.
  • the high yield of a protein or a polypeptide to elicit hypersensitive response and disease resistance can be produced by mass cultivation of the E. coli transformant containing the expression vector having more effective properties, such as improved resistance to plant disease, promotion of a plant growth, and repellence of insect in compared to that of HrpN from E. amylovora.
  • the protein or polypeptide of this invention can be applied to plants as an insect repellent (e.g., aphid) in a conventional procedure to treat stems and leaves of a plant. Further, the seeds of rice treated with a protein or a polypeptide of this invention showed fast growth during the seeding culture period. Thus, the protein or polypeptide of this invention can be applied to plants as an insect repellent and seed-treating agent in a conventional procedure.
  • an insect repellent e.g., aphid
  • Fig. 1 shows TEM (Transmitted Electro Microscope) photographs of novel En ⁇ inia pyrifoliae WT#3 (KCCM 10283) according to the present invention, En ⁇ inia pyrifoliae Epl6 T and En ⁇ inia amylovora ATCC 15580 ⁇ .
  • Fig. 2 shows the growth curves of Erwinia pyrifoliae WT#3 and Erwinia amylovora ATCC15580 ⁇ according to temperature.
  • Fig. 3 shows the growth curves of Erwinia pyrifoliae WT#3 and Erwinia amylovora ATCC15580 according to p ' H.
  • Fig. 4 shows the numerical analysis of Erwinia pyrifoliae WT#3 (KCCM 10283) according to the Biolog system.
  • Fig. 5 shows a phylogenetic analysis based on 16S rRNA gene of Erwinia pyrifoliae WT#3 (KCCM 10283) of this invention.
  • Fig. 6 shows the results of phylogenetic analysis of the region encoding tRNA Ala in ITS region of Erwinia pyrifoliae WT#3 (KCCM 10283) of this invention.
  • Fig. 7 shows the results of phylogenetic analysis of the region encoding tRNA Glu in ITS region of En ⁇ inia pyrifoliae WT#3 (KCCM 10283) of this invention.
  • Fig. 8 shows a plasmid profile analysis of En ⁇ inia pyrifoliae having five plasmids (WT#3, Epl, Epl6) and Erwinia amylovora having one plasmid (ATCC15580 ⁇ , LMG1877, LMG1946)
  • WT#3, Epl, Epl6 T the plasmids
  • 4 Erwinia pyrifoliae WT#3
  • 5 Erwinia amylovora ATCC15580 T
  • 6 Erwinia amylovora LMG1877
  • 7 Erwinia amylovora LMG1946.
  • Fig. 9 shows a hypersensitive response observed 24 hours after inoculation of the genomic library clone constructed from Erwinia pyrifoliae WT#3 (KCCM 10283) on the leaf of tobacco [B: MES buffer, C: a plant HR-inducing protein (HrpN) from
  • Erwinia amylovora ATCC 15580 ⁇ 1: a plant HR-inducing protein from clonel
  • 2 a plant HR-inducing protein from clone2
  • 3 a plant HR-inducing protein from pCEP33
  • 4 a plant HR-inducing protein from clone4
  • NC protein from pLAFR3 vector
  • Fig. 10 shows a physical map encoding the plant HR-inducing gene from the genomic library clone (pCEP33) from En ⁇ inia pyrifoliae WT#3.
  • Fig. 11 shows a comparison of genes between a gene (KCCM 10282) encoding the plant HR-inducing protein from Erwinia pyrifoliae WT#3(KCCM 10283) of the present invention and the HR-inducing gene (hrpN) from Erwinia amylovora
  • ATCC15580 1 [A: a plant HR-inducing gene from En ⁇ inia pyrifoliae WT#3, B: a plant
  • HR-inducing gene from Erwinia amylovora ATCC15580 ⁇ .
  • Fig. 12 shows a plant HR-inducing protein (hereinafter referred to as "Pioneer”) from the gene from Erwinia pyrifoliae WT#3 which is expressed in plasmid vector pKEP3 from the gene from [M: protein size marker, 1: Pioneer with 41.1 kD, 2: HrpN with 39.7 kD, 3: pET15b vector].
  • Pr plant HR-inducing protein
  • Fig. 13 shows a comparison between the amino acid sequences of Pioneer and a plant HR-inducing protein (HrpN) from Erwinia amylovora ATCC15580 T [A: Pioneer, B : HrpN].
  • Fig. 14 shows HR on tobacco leaves treated with the Pioneer from Erwinia pyrifoliae WT#3 and HrpN from En ⁇ inia amylovora ATCC15580 T (a control) at different concentrations.
  • Fig. 15 shows the disease symptoms on the surface of immature pear fruit 4 days after inoculation of the Pioneer and a buffer (control).
  • the analytical results showed that the physiological tests on the strain (e.g., liquefaction of gelatin, motility in 3% agar, and decomposition of pectate) were close to those of type strain Epl6 T of Erwinia pyrifoliae.
  • the biochemical tests for the utilization of carbon source revealed different results, especially trehalose and L-arabinose, suggesting that the physiological and biochemical properties of the isolated strain according to the present invention were different from those of type strain Erwinia pyrifoliae Epl6 T and En ⁇ inia amylovora ATCC 15580 ⁇ .
  • the morphological property of the strain WT#3 was observed by TEM (Transmitted Electro Microscope), was different from that of recently reported Erwinia pyrifoliae EP16 T causing necrotic disease in Asian pear trees and Erwinia amylovora ATCC 15580 ⁇ causing fire blight on apples and pears [Fig. 1].
  • En ⁇ inia spp. including Erwinia pyrifoliae EP16 T and Erwinia amylovora ATCC 15580 ⁇ were rod shaped with peritrichous flagella whereas the novel strain En ⁇ inia pyrifoliae WT#3 was a slight oval rod shaped "without flagella".
  • the temperatures ranging from 12 ° C to 39 ° C were measured at intervals of 3 ° C and doubling time and specific growth rate at different temperatures of Erwinia pyrifoliae WT#3 and En ⁇ inia amylovora ATCC 15580 ⁇ were calculated [Fig. 2].
  • En ⁇ inia pyrifoliae WT#3 has higher growth rate (27-30 °C) with short doubling time than that of Erwinia amylovora.
  • the optimal temperature was 27 ° C for the strain WT#3.
  • Erwinia pyrifoliae WT#3 also showed a better growth compared to Erwinia amylovora ATCC15580 T , suggesting that Erwinia pyrifoliae WT#3 is a cold tolerant because this pathogen is well adapted in the vicinity of Chunchon.
  • Chunchon is a relatively cold area in the winter season and has different environmental conditions from that of Erwinia amylovora ATCC15580 T .
  • the isolated strain was suspended to the turbidity of 63% in a solution containing 0.4% sodium chloride, 0.03% pluronic F-68, and 0.01% gellan gum and inoculated to the wells containing 96 different carbon and nitrogen sources.
  • strain WT#3 was further cultivated in an incubator at 35-37 ° C .
  • the violet-turned as utilization of carbon and nitrogen sources were recorded using a reader and their values were numerically divided.
  • strains ATCC15580, LMG2068, LMG1877, LMG1946 and ea246 strains (USA), which belong to Erwinia amylovora were showed to be in the same group.
  • the strain WT#3 was in the group as Erwinia pyrifoliae (Ep4,
  • the nucleotide sequence of its 16S rRNA gene was analyzed considering the fact that it is an essential component to manage a life where its nucleotide sequence is well conserved and can be readily placed for phylogenetic analysis.
  • the 16S rRNA gene was amplified by PCR using fDl primer (SEQ. ID. No. 1) and rP2 primer (SEQ. ID. No. 2) and then cloned into pGEM-T vector to analyze its nucleotide sequence.
  • Fig. 5 shows a phylogenic tree prepared by a mega program [Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. The Pennsylvania State University, University Park] based on the 16S rRNA nucleotide sequence.
  • the strain WT#3 had similarities to En ⁇ inia pyrifoliae Epl6 T and En ⁇ inia amylovora 15580 ⁇ with 98.9% and 97.5% sequence identity, respectively, being more closer to Erwinia pyrifoliae than to En ⁇ inia amylovora.
  • Table 2 shows the similarity of 16S rRNA gene of each strain.
  • strain WT#3 belongs to the group as En ⁇ inia pyrifolia but was different from that of Erwinia amylovora ATCC 15580 ⁇ , and Enterobacter pyrinus, which was previously reported to infect apples and pears in Korea several years ago. 7) Analysis for 16S-23S ITS (Intergenic Transcribed Spacer) region of strain WT#3
  • 16S-23S ITS region was amplified by PCR using R16-1F primer (SEQ. ID. No. 3) and R23-1R primer (SEQ. ID. No. 4), and then cloned into pGEM-T vector to analyze the nucleotide sequence of 16S-23S ITS region.
  • 16S-23S ITS region was divided into two groups; Erwinia amylovora had three band patterns with about 1215, 970 and 720 bp in size, whereas domestic pathogen, Erwinia pyrifoliae had two band patterns with 970 and 720 bp in size.
  • the band pattern of 970 bp had about 70 bp region of tRNA Ala
  • the band pattern of 720bp had a region of tRNA Glu , respectively.
  • Fig. 6 shows a phylogenic tree prepared by analyzing the nucleotide sequences of 16S-23S ITS region of both the strain Erwinia pyrifoliae WT#3 and En ⁇ inia amylovora ATCC15580 T .
  • Group I Erwinia amylovora (ATCC15580, LMG1877, 10296) (a plasmid > 29 kb)
  • Group II Erwinia pyrifoliae (WT#3, Epl, Epl6) (a plasmid > 29 kb, a plasmid 5 kb, and three plasmids 2-4 kb in size)
  • necrotic disease pathogens En ⁇ inia pyrifoliae
  • Asian pear trees including the strain WT#3 have five plasmids
  • fire blight pathogens Erwinia amylovora
  • the relatedness in whole genome between the Korea-originated Erwinia pyrifoliae and foreign-originated Erwinia amylovora were was investigated.
  • the purely isolated total DNA was dissolved in 100 ⁇ Jt TE buffer to a concentration lng/ tl, added with ION NaOH, and then denatured by boiling at 80 °C for 10 min. Denatured DNA was applied to Hybond-N + nylon membrane using a slot-blot apparatus.
  • DIG 11-dUTP by Dig-High Prime [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany], prehybridized at 49 ° C for 3 hours in the presence of DNA already fixed to a nylon membrane, and then hybridized for 16 hours at the same temperature. Development of the membranes was conducted by DIG Luminescent Detection Kit [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany].
  • the strain WT#3 was in the group of Erwinia pyrifoliae, which was present only in Korea in 1999, although there were a few other different properties between Erwinia pyrifoliae WT#3 and Epl6 T .
  • strain WT#3 does not have flagella in morphology which is first reported in genus Erwinia, it appears to be different from those of pathogen, En ⁇ inia pyrifoliae, which was reported by German researchers and Erwinia amylovora.
  • strain WT#3 was designated Erwinia pyrifoliae WT#3 (KCCM 10283) and deposited to the Korean Culture Center of Microorganisms on June 11, 2001.
  • the accession number is KCCM 10283.
  • a recombinant pKEP3 for higher expression containing the gene derived from the Erwinia pyrifoliae WT#3 was constructed and transformed to Esckerichia coli. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with
  • Example 2 Properties of specific protein triggering a plant hypersensitive reaction from Erwinia pyrifoliae WT#3 and a gene encoding it
  • E.coli strains were cultivated on Luria agar medium containing tetracycline (30 mg/m£) at 37 ° C for 24 hours and 2,000 genomic library clones were generated.
  • Fig. 11 compares a gene (KCCM 10282) encoding the plant HR-inducing protein from Erwinia pyrifoliae WT#3 (KCCM 10283) of the present invention with the HR-inducing gene (hrpN)- from Erwinia amylovora ATCC15580 T by analyzing the nucleotide sequences from the selected gene.
  • a 1287 bp gene encoding a protein of plant hypersensitive response can be obtained.
  • the 1287 bp gene was designated as "a plant HR-inducing gene from WT#3" and its similarity to hrpN gene of Erwinia amylovora ATCC15580 T (1212 bp) was investigated.
  • the gene encoding the plant HR-inducing protein of Erwinia pyrifoliae WT#3 has a different nucleotide sequences from hrpN gene of En ⁇ inia amylovora and also has the insertions of novel nucleotide sequences fragments, thus showing that the plant HR-inducing gene from WT#3 has a novel gene structure which is not found in hrpN gene of En ⁇ inia amylovora.
  • the nucleotide sequence of the gene encoding the plant HR-inducing protein of Erwinia pyrifoliae WT#3 was denoted as SEQ. ID. No. 5.
  • an expression vector pKEP3 containing the gene was constructed as follows:
  • Recombinant protein expression system in E.coli (Novagen, Inc. Madison, WI53711 USA) was employed so as to construct the expression vector pKEP3.
  • This system was derived from pBR322 plasmid, where T7 promoter and operator can bind to lac repressor before the insertion site of a foreign gene.
  • This structure can easily facilitate the expression of an inserted gene in a larger volume by T7 RNA polymerase produced in a host E.coli genome.
  • a substrate IPTG 3 hours after incubation is added, the combination of both lac repressor produced from lacl gene and IPTG does not repress the expression of T7 RNA polymerase and thus, a larger amount of protein is synthesized.
  • pKEP3 was constructed to contain an ampicillin-resistance gene and ampicillin can be used to the medium as a selective marker.
  • the gene encoding a plant HR-inducing protein from Erwinia pyrifoliae WT#3 and the plasmid of recombinant protein expression system were digested at 37 ° C for 12 hrs in the presence of the restriction enzymes Ndel and Bam ⁇ I to generate the same 5'- and 3'-end. They were then ligated into the restriction sites using DNA ligase at 14 °C for 16 hrs and transferred into E.coli via CaCl 2 transformation.
  • pKEP3 has many advantages that (1) ampicillin-resistant gene can be used as a selected marker, (2) its possession with His tag may make an easier purification, and (3) its possession of a strong T7 lac promoter may ensures a larger volume of protein production from ligated insertion DNA.
  • the E. coli transformant containing the expression vector pKEP3 was deposited to the Korean Culture Center of Microorganisms on June 11, 2001 and was assigned with the Accession No. KCCM 10282.
  • hrpN gene of Erwinia amylovora ATCC15580 T was cloned by using the same recombinant protein expression system (Novagen, Inc., Madison, WI 53711, USA) and used as a control for the biological test of pKEP3, which contains novel plant HR-inducing gene from Erwinia pyrifoliae WT#3. 3) Expression of a plant HR-inducing protein
  • bacterial cells were inoculated to a LB broth by adding ampicillin (50 as a selective marker and chloramphenicol (33 ⁇ g/i ⁇ l) for inhibiting the synthesis of other proteins produced from E.coli genome, and subcultured at 37°C for 12 hours. Then, the bacterial transformant (KCCM 10282) of the present invention was cultured at 30 °C for 7 hours using the same medium. When the O.D. of the transformant (KCCM 10282) reached 0.6 about 3 hours after the cultivation, the culture was added with 0.4 mM IPTG and cooled down to 30 ° C and then cultured again for 4 hours.
  • the mixture was centrifuged at 6,000 rpm for 15 min. Then, the supernatant was discarded and a pellet was suspended in a solution containing 5 mM MES buffer and 0.1 mM PMSF.
  • the suspension of transformant (KCCM 10282) was lysed by sonication until the suspension became transparent and then boiled for 10 min at 100 ° C. Then, the mixture was centrifuged at 15,000 rpm for 10 min and the supernatant was discarded. After adding a protein inhibitory cocktail at the ratio of 1/1,000, the mixture was filtrated by using a 0.45 ⁇ m filter and weighed the extract amount of protein.
  • the plant HR-inducing protein producing from transformant encoding the plant HR-inducing gene (KCCM 10282) of En ⁇ inia pyrifoliae WT#3 was named as 'Pioneer'.
  • hrpN gene of Erwinia amylovora ATCC15580 T was cloned by the same recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) and used as a control for the biological test of Pioneer. As shown in Fig. 12, it was demonstrated that both genes of En ⁇ inia pyrifoliae
  • WT#3 and Erwinia amylovora ATCC15580 T encoding plant HR-inducing protein were successfully expressed by the recombinant protein expression system and were synthesized a large volume of a plant HR-inducing proteins.
  • novel protein domains of Pioneer were produced from the N-terminal at the sites of 76-79 (Thr-Gly-Leu-Leu), 88 - 92 ( L e u - G l y - G l y - G l y - S e r ) , 102 - 113 (Gly-Leu-Gly-Gly-Leu-Gly-Gly-Asp-Leu-Gly-Ser-Thr), and 131-137 ( G l y - A l a - T h r - N a l - G l y - T h r - S e r ) .
  • the Pioneer had a low amino acid sequence identity of 85.9% homology to that of Hrp ⁇ .
  • the molecular weight of Pioneer was 41.1 kD as compared with 39.7 kD of Hrp ⁇ .
  • the molecular weight of both Pioneer and Hrp ⁇ was not compared with the molecular weight standards on an acrylamide gel but a molecular weight of each amino acid deduced from, the nucleotide sequence of gene using Winstar program. Therefore, Pioneer has a novel type of a protein by the insertion of novel peptide domains and such difference is expected to bring about much improved biological activity, which cannot be found in that of Hrp ⁇ .
  • ATCC15580 T were inoculated onto tobacco (non-host plants) leaves using a syringe, together with MES buffer (protein lysis buffer) as a control [Fig.14].
  • MES buffer protein lysis buffer
  • FIG.14 it was noted that Pioneer and Hrp ⁇ exhibited a clear HR in the front tobacco leaf at the dose of 10 ⁇ g/ml and 20 ⁇ g/ml, respectively; in the same reverse tobacco leaf, Pioneer and Hrp ⁇ exhibited a clear HR at the dose of 5 ⁇ g/ml and 10 ⁇ g/ml, respectively. This reflected that Pioneer induces HR at a relatively lower concentration than that of Hrp ⁇ .
  • Purified Pioneer at a dose of 500 ⁇ g/ml was inoculated to the surface of an immature fruit by punching it a hole (0.5 mm in diameter and 10 mm in depth).
  • the surface of the immature fruit turned black as a progressive symptom 4 days after treatment, compared with that of a control.
  • Example 3 The study of biological activity using plant HR-inducing protein (Pioneer)
  • Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms. The test materials were applied based on the 3-time repeated randomized complete block design. The stems and leaves of cucumbers were treated with the HR-inducing protein, Pioneer, at a dose of 20 ⁇ g/ml according to the recommended dose by EDEN Bioscience corporation.
  • EDEN Bioscience's Messenger® was used as a control at the same dose above, together with locally produced Fenarimol (chemical pesticide) based on the instruction in use.
  • the treatment methods are as follows: ⁇ Treatment by three times: Pioneer, Messenger® and Fenarimol were sprayed to the stems and leaves of cucumber three times each at intervals of 10 days after early stage of powdery mildew (Sphaerotheca fuliginea).
  • the disease severity of powdery mildew- (Sphaerotheca fuliginea) from the upper 8 leaves to the bottom 3 leaves of cucumbers was measured 7 days after treatment based on the following criteria (0: no disease, 1: 1-5%, 2: 5.1-20%, 3: 20.1-40%, 4: more than 40%).
  • Table 5 The disease severity of powdery mildew- (Sphaerotheca fuliginea) from the upper 8 leaves to the bottom 3 leaves of cucumbers was measured 7 days after treatment based on the following criteria (0: no disease, 1: 1-5%, 2: 5.1-20%, 3: 20.1-40%, 4: more than 40%).
  • the stems and leaves of cucumbers were treated with Pioneer at a dose of 20 ⁇ g/ml 5 times each at intervals of 14 days from day 7 before implantation.
  • HrpN a control, was also given to the stems and leaves of cucumbers at the same dose as aforementioned.
  • the cucumbers for this experiment were harvested at the implantation of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 ⁇ mole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan).
  • a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 ⁇ mole)
  • a chlorophyll device Chlorophyll meter SPAD-502, Minolta, Japan
  • Pioneer can be effectively used as a pesticide at a lower dose than HrpN protein.
  • the peppers for this experiment were harvested at the implantation of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 ⁇ mole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan).
  • a portable photosynthesis device LCD-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 ⁇ mole
  • a chlorophyll device Chlorophyll meter SPAD-502, Minolta, Japan
  • the treatment was performed as follows: ⁇ Immersion plus spray method: Oriental melon seeds were immerged in both Pioneer and HrpN protein at a dose of 10 ⁇ g/ml for 24 hours. Then, these seeds were sowed in a pot. At the implementation of day 17 and 28, the stems and leaves of melons were treated with both Pioneer and HrpN. ⁇ Spray method: At the implementation of day 17 and 28, the stems and leaves of oriental melons were treated with both Pioneer and HrpN. The disease severity of downy mildew was measured 55 days after treatment.
  • HrpN a control
  • the treatment was performed as follows: ⁇ 8 days after implantation, the stems and leaves of sweet peppers were treated with both Pioneer and HrpN.
  • Phytophthora capsici (2 X10 6 cells/ ml) was inoculated to sweet peppers, so treated, and disease severity was measured 45 days after treatment.
  • Sweet peppers were implanted to a 25 cm port and cultivated at a glass house. Sweet peppers, so treated, were investigated at the implantation of day 41 and 45. Table 14
  • Rice was cultivated by the conventional "open field culture” method prevailing in agricultural farms.
  • the stems and leaves of rice was treated with Pioneer at the doses of 10 ⁇ g/ml, and immerged at 28 ° C for 24 hours.
  • Rice seeds were sowed to a seedbed, grown for 16 days and implanted to a test field.
  • Cucumbers were selected as host plants of aphis.
  • Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms.
  • the stems and leaves of cucumbers were treated with Pioneer at a dose of 20 ⁇ g/ml.
  • HrpN a control, was also given to the stems and leaves of cucumbers at the same dose.
  • a higher dose (40 ⁇ g/ml) of Pioneer was required for better enhancement of rice's growth.
  • Pioneer can be more effectively used as a seed-treating agent which can promote the growth of rice seeds than HrpN.
  • KCCM 10283 a novel Erwinia pyrifoliae WT#3 (KCCM 10283) according to the present invention is isolated and identified, and a novel protein (Pioneer) or a polypeptide translated from a plant HR-inducing gene (KCCM 10282) of this strain shows that Pioneer has improved properties in inducing plant resistance, plant growth promotion, insect repellent effect, increase of photosynthesis and chlorophyll, and seed treatment effect than a HrpN from Erwinia amylovora ATCC15580 1 .
  • En ⁇ inia pyrifoliae WT#3 (KCCM 10283) is quite suitable for the development of a novel and better plant hypersensitive reaction eliciting biopesticide.
  • this invention is advantageous in developing a novel and improved biopesticide and a fertilizer.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Fertilizers (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to a biopesticide using a plant pathogen, and more particularly, to a biopesticide having an improved resistance against plant pathogens and an improved plant growth effect, which is superior to that of HrpN, a plant-senstive protein isolated from Erwinia amylovora ATCC 15580, by using a gene isolated from WT#3(Erwinia pyrifoliae WT#3)[KCCM 10283] thus enabling to be used as a fertilizer as well a biopesticide.

Description

NEW BIOPESTICIDE USING GENE FROM ERWINIA PYRIFOLIAE WT#3, NOVEL PATHOGEN THAT AFFECTS ASIAN PEAR TREES
TECHNICAL FIELD This invention relates to a novel biopesticide using a gene derived from a novel plant pathogen, Erwinia pyrifoliae WT#3 (KCCM 10283), isolated from Chunchon, Kangwon Province, Korea Korea. This pathogen is endemic to Korea. This novel biopesticide has more effective properties, such as improved resistance to plant disease, promotion of plant growth, and insect repellency as compared to those of HrpN, a hypersensitive response inducing protein, isolated from Erwinia amylovora (ATCC155801), which does not exist in Korea. Thus, it can be utilized as a biopesticide effective to prevent plant diseases caused by pathogens and insects and to enhance plant growth as well as a fertilizer.
BACKGOUND ART
The food shortage has been emerged as one of the most serious problems that the people are suffering around the world at present. However, the yields of crop production have been greatly decreasing due to the outbreak of harmful pests, such as pathogens and insects. Currently, chemical pesticides have been mostly used to prevent or control the spread of harmful pests. But their excessive and continued applications become responsible for inducing resistance to those chemical pesticides in pests, although rapid pesticidal effects can be demonstrated by killing the pests directly by using an easier spraying method. In addition, most effective pesticides, which are strongly toxic, have caused social problems due to serious soil and water pollution. Therefore, it is very urgent for the development of an environ ently-friendly biopesticides which do not induce any resistance to pests while having effective pesticidal activities.
The general purpose of using a biopesticide is to control pests through a direct application of antagonistic microorganism itself to plants but this is not considered very effective in controlling of the pests. Therefore, recent researches have been progressing to control harmful pests by stimulating the self-defensive system of plants using products of antagonistic microorganisms instead of using microorganisms themselves. In other words, an essential aim of biological control is to decrease or prevent of pests by activating the self-immunological function of a plant via treatment of microorganism-derived materials to plants.
The plant disease resistance is primarily conducted by the defense system of a plant by via structural barriers such as cutin in epidermal cells, a wax layer and types of porosity. When plant pathogens infiltrate into plant cells, chemicals, such as saponin or lectin, secreted by the plant can prevent the increase of pathogens population [Agrios, G. N. 1997. Plant Pathology .4th ed. Academic Press, New York; Dong, X. 1998. SA. JA, ethylene, and disease resistance in plants. Curr. Opin. Plant. Biol.l:316-323; Feys, B. J. & Parker, J. E. 2000. Interplay of signaling pathways in plant disease resistance. Trends Genet. 16:339-455].
More essential plant disease resistance refers to a hypersensitive response (HR), is a rapid, localized necrosis for preventing spread of pathogens that is associated with the active defense of plants against many pathogens to stimulate their self -defensive system using some microorganism-derived materials. [Richberg, M. H., Aviv, D. H. & Dangl, J. L. 1998. Dead cells do tell tales. Curr. Poin. PlantBiol. 1:480-485]. The first method for plant disease resistance associated with HR induction is that plants mobilize their early alert system to adjacent cells infected with bacterial pathogens so that these adjacent cells can increase the resistance to pathogens. This defense system is called as 'LAR' (local acquired resistance).
The second method is that through the activation of defense system in non-infected parts of a plant, more potent defense system is activated against the secondary infection. Consequently, the whole plant may exert a more strongly defense system against pathogens. This defense system is called as "SAR" (systemic acquired resistance). The SAR may be sustained for several weeks or more and the plants exhibit some resistance to a variety of other unrelated pathogens [Hunt, M. D., Neuenschwander, U. H., Delaney, T. P., Weymann, K. B., Friedrich, L. B., Lawton, K. A., Steiner, H. Y. and Ryals, J. A. 1996. Recent advances in systemic acquired resistance research a review. Gene 179:89-95].
In addition, ISR (induced systemic resistance) and wound response to harmful insects were reported as the types of another plant resistance [Pieterse, C. M., van Wees, S. C., van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., Weisbeek, P. J. and van Loon, L. C. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571-1580; Ryan, C. A. and Pearce, G. 1998. SYSTEMIN: a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14:1-17].
The mechanism of the plant disease resistance is triggered by elicitors that induce the plant defense system [Kessmann, H, Staub, T., Hofmann, C, Maetzke, T., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32:439-459]. The typical elicitors of SAR include a phenolic signaling compound SA (salicylic acid) produced by plants, elicitin and harpin that are isolated from pathogens [Ponchet, M., Panabieres, F., Milat, M. L., Mikes, V., Montillet, J. L., Suty, L., Triantaphylides, C, Tifilly, Y. and Blein, J. P. 1999. Are elicitins cryptograms in plant-oomycete communications. Cell Mol. Life Sci. 56:1020-1047].
Harpin is a common name for proteins produced from hrp gene island of plant pathogenic bacteria and one of Harpins, called HrpN, is a protein produced from hrpN gene located at hrp gene island of about 40kb of Erwinia amylovora which is not existing in Korea. When the HrpN is inoculated to host plants, such as an apple, it acts as a pathogenic factor. In contrast, when HrpN is given to non-host plants, it is recognized as a foreign compound in plants and HR is elicited.
HrpN is an acidic, heat-stable (100 °C) protein with a molecular weight of 44 kDa [The molecular weight was measured in a manner such that after electrophoresis on acrylamide gel, the protein was stained with 0.025% Coomassie Blue R-250 and compared with Molecular Weight Standard of Bio-Rad Co. (Catalog* 161-0305, Bio-Rad Laboratories, 2000 Alfred Nobel Drive Hercules, CA 94547, USA)] with glycine-rich but without cysteine [Zhong-Min, W., Laby, R. J., Zumoff, C. H., Bauer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992. harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257:85-88; US Pat. Nos. 6,001,959, 5,850,015, 6,172,184-B1, 6,174,717-B1, 5,849,868, 6,977,060, 5,859,324, and5,776,889; Korea Examined Pat. Appl. Nos. 1999-022577, 2000-075771, 2000-070495, and 2000-057395]. These plant defense elicitors have been sold in a variety of formulations.
Since SA (Salicylic acid) has been reported as SAR elicitor, INA (2,6-dichloroisonicotinic acid) and BTH (benzothiadiazole) having a similar structure to SA were found to induce SAR and successfully registered as plant activators. Currently, Actigard™ and BION®, have been sold in US and Europe for the protection of diseases of foliage plants, tomato and tobacco. In Japan, PBZ (probenazole) under the trade name Oryzemate® has been also marketed for controlling rice blight and bacterial leaf blight [Yoshioka, K., Nakashita, H., Klessig, D. F. and yamaguchi, I. 2001. Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action. Plant J. 25:149-157]. HrpN, a non-chemical protein, was first discovered in Erwinia amylovora, a gram-negative bacteria that cause fire blight of rosaceous plants. When it is directly sprayed to plants, it acts as the SAR elicitor which controls a variety of a plant diseases, several insects, mites and nematodes and exhibits a plant growth prompting effect by enhancing photosynthesis and nutritional absorption [Dong, H. S., Delaney, T. P., Bauer, D. W. and Beer, S. V. 1999. HrpN induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene. Plant J. 20:207-215]. Also, HrpN has little toxicity and it does not cause in-any environmental pollution as it is biologically degradable and it is easy to formulate due to heat-resistance even after boiling at 100 °C [Zhong-Min, W., Laby, R. J., Zumoff, C. H, Bauer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Enυinia amylovora. Science 257:85-88].
Therefore, HrpN derived from Enυinia amylovora was successfully commercialized in 2000 by Eden Bioscience in the trade marker Messenger® in USA for controlling the diseases of crops, such as cotton, tomato, tobacco, pepper, cucumber, strawberry, and wheat. It has been effectively utilized as fungicide, bactericide, pesticide, and plant growth facilitator [US Pat. Nos. 6,174,717 Bl, 5,849,868, 6,977,060, 5,859,324, and 5,776,889; Korea Examined Pat. Appl. Nos. 1999-022577, 2000-075771, 2000-070495, and 2000-057395].
DISCLOSURE OF INVENTION
The inventor et al. isolated and identified some bacterial pathogens from the infected lesions of a plant showing necrosis in pear growing orchards in Chunchon, Korea and found novel species, Erwinia pyrifoliae WT#3 (KCCM 10283) which is morphologically different from recently reported Enυinia pyrifoliae by German researchers: that is, Enυinia pyrifoliae WT#3 (KCCM 10283) does not have flagella, while Enυinia pyrifoliae, which was reported by a German research team has peritrichous flagella. Also, it was different from the well-known Enυinia amylovora causing fire blight. After isolating a gene and a protein which induce a hypersensitive response in non-host plants from novel species, Erwinia pyrifoliae WT#3 (KCCM 10283), it was noted that the protein was proven to be more effective in imparting plant disease resistance against pathogens and insects, and in enhancing plant growth than HrpN from Erwinia amylovora causing fire blight. Thus, the present invention was completed.
Therefore, an object of the present invention is to provide a novel species Erwinia pyrifoliae WT#3 (KCCM 10283) and a protein derived from the pathogen as an effective biopesticide, a plant growth activator, a seed-treating agent, an insect repllent, and a fertilizer. A further aspect of the present invention is to provide a gene (KCCM 10282) encoding a protein or polypeptide of Enυinia pyrifoliae in a non-infectious form to plants, which induces a hypersensitive reaction to non-hosts or resistance to pathogens in plants when plant cells are in contact with or treated with the gene.
A further aspect of the present invention is to provide transformants containing a gene (KCCM 10282) encoding a protein or polypeptide in a non-infectious form to plants from Erwinia pyrifoliae WT#3 (KCCM 10283).
A further aspect of the present invention is to provide a biopesticidal composition containing the protein or polypeptide and a carrier.
A further aspect of the present invention is to provide the composition which can be applied to plants as a pesticide, a plant growth activator, a seed-treating agent, insect repellent, and a fertilizer.
A further aspect of the present invention is to provide a method for producing a protein or polypeptide that induces a hypersensitive response or resistance on a mass-scale by isolating and purifying a protein or a polypeptide from a cultures of Enυinia pyrifoliae WT#3 (KCCM 10283) and transformants containing a plant HR-inducing gene of the strain (KCCM 10282) from Erwinia pyrifoliae WT#3 (KCCM 10283).
The novel Enυinia pyrifoliae WT#3 (KCCM 10283) of the present invention was isolated from the affected stem of a plant showing necrosis of pears orchard in Chunchon (Kangwon Province, Korea). The strain was identified as the genus Enυinia, the same genus of the causal pathogen of fire blight, Erwinia amylovora and necrotic disease, Erwinia pyrifoliae (necrotic disease of Asian pears; Erwinia pyrifoliae reported by a German research team in 1999). Erwinia amylovora and Erwinia pyrifoliae are peritrichous flagella, while our pathogen Erwinia pyrifoliae WT#3 (KCCM 10283) is non-flagellated, showing a great morphological difference from Enυinia pyrifoliae which is only found in Korea. We designated the novel strain as Erwinia pyrifoliae WT#3 (KCCM 10283) and deposited it to the Korean Culture Center of Microorganisms on June 11, 2001 and was assigned with Accession No. KCCM 10283.
Especially, an isolated gene encoding a protein which induces a hypersensitive response in non-host plants from Enυinia pyrifoliae WT#3 was compared with a hrpN gene encoding a HrpN protein, which was discovered by Cornell University of the US and sold by Eden Bioscience co. As a result, our novel gene showed less similarity to hrpN gene encoding a HrpN. Notably, several insertions of nucleotide sequences fragments were found in the gene encoding a protein which induces a hypersensitive response in non-host plants from Erwinia pyrifoliae WT#3 which are not present in hrpN gene from E. amylovora. More specifically, those nucleotide sequences fragments were inserted at the sites of 222-230 bp, 249-263 bp, 348-371 bp and 397-411 bp. Therefore, the protein or polypeptide produced by the gene has a different amino acid sequence and molecular weight from those of HrpN peptide.
A recombinant pKEP3 for higher expression containing the gene derived from the Erwinia pyrifoliae WT#3 was constructed and transformed to Escherichia coli. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with Accession No. KCCM 10282.
The high yield of a protein or a polypeptide to elicit hypersensitive response and disease resistance can be produced by mass cultivation of the E. coli transformant containing the expression vector having more effective properties, such as improved resistance to plant disease, promotion of a plant growth, and repellence of insect in compared to that of HrpN from E. amylovora.
As a result, evaluation of biological activities of the protein or polypeptide inducing hypersensitive response or plant disease resistance proved its improved effectiveness than those of HrpN in the powdery mildew of cucumber, anthracnose on pepper, blight of pepper, downy mildew of oriental melon, blight of sweet pepper, leaf blight of rice. Further, yield of harvesting showed higher cucumber, pepper, sweet pepper, and strawberry than HrpN protein. Also, the protein or polypeptide which induces a hypersensitive response in non-host plants from Erwinia pyrifoliae WT#3 showed an excellent in increasing the photosynthesis and the content of chlorophylls in cucumbers and peppers. Therefore, the protein or polypeptide from Erwinia pyrifoliae WT#3 can be applied to plants as a pesticide, a plant growth activator, and a fertilizer.
In addition, the protein or polypeptide of this invention can be applied to plants as an insect repellent (e.g., aphid) in a conventional procedure to treat stems and leaves of a plant. Further, the seeds of rice treated with a protein or a polypeptide of this invention showed fast growth during the seeding culture period. Thus, the protein or polypeptide of this invention can be applied to plants as an insect repellent and seed-treating agent in a conventional procedure.
BRIEF DESCRIPTIO OF DRAWINGS
Fig. 1 shows TEM (Transmitted Electro Microscope) photographs of novel Enυinia pyrifoliae WT#3 (KCCM 10283) according to the present invention, Enυinia pyrifoliae Epl6T and Enυinia amylovora ATCC 15580τ .
Fig. 2 shows the growth curves of Erwinia pyrifoliae WT#3 and Erwinia amylovora ATCC15580 τ according to temperature.
Fig. 3 shows the growth curves of Erwinia pyrifoliae WT#3 and Erwinia amylovora ATCC15580 according to p'H.
Fig. 4 shows the numerical analysis of Erwinia pyrifoliae WT#3 (KCCM 10283) according to the Biolog system. Fig. 5 shows a phylogenetic analysis based on 16S rRNA gene of Erwinia pyrifoliae WT#3 (KCCM 10283) of this invention.
Fig. 6 shows the results of phylogenetic analysis of the region encoding tRNAAla in ITS region of Erwinia pyrifoliae WT#3 (KCCM 10283) of this invention.
Fig. 7 shows the results of phylogenetic analysis of the region encoding tRNAGlu in ITS region of Enυinia pyrifoliae WT#3 (KCCM 10283) of this invention.
Fig. 8 shows a plasmid profile analysis of Enυinia pyrifoliae having five plasmids (WT#3, Epl, Epl6) and Erwinia amylovora having one plasmid (ATCC15580 τ, LMG1877, LMG1946) [Lanes 1: lkb ladder, 2: Erwinia pyrifoliae Epl, 3: Erwinia pyrifoliae Epl6T, 4: Erwinia pyrifoliae WT#3, 5: Erwinia amylovora ATCC15580T, 6: Erwinia amylovora LMG1877, 7: Erwinia amylovora LMG1946].
Fig. 9 shows a hypersensitive response observed 24 hours after inoculation of the genomic library clone constructed from Erwinia pyrifoliae WT#3 (KCCM 10283) on the leaf of tobacco [B: MES buffer, C: a plant HR-inducing protein (HrpN) from
Erwinia amylovora ATCC 15580τ, 1: a plant HR-inducing protein from clonel, 2: a plant HR-inducing protein from clone2, 3: a plant HR-inducing protein from pCEP33, 4: a plant HR-inducing protein from clone4, and NC: protein from pLAFR3 vector].
Fig. 10 shows a physical map encoding the plant HR-inducing gene from the genomic library clone (pCEP33) from Enυinia pyrifoliae WT#3.
Fig. 11 shows a comparison of genes between a gene (KCCM 10282) encoding the plant HR-inducing protein from Erwinia pyrifoliae WT#3(KCCM 10283) of the present invention and the HR-inducing gene (hrpN) from Erwinia amylovora
ATCC155801 [A: a plant HR-inducing gene from Enυinia pyrifoliae WT#3, B: a plant
HR-inducing gene (hrpN) from Erwinia amylovora ATCC15580 τ].
Fig. 12 shows a plant HR-inducing protein (hereinafter referred to as "Pioneer") from the gene from Erwinia pyrifoliae WT#3 which is expressed in plasmid vector pKEP3 from the gene from [M: protein size marker, 1: Pioneer with 41.1 kD, 2: HrpN with 39.7 kD, 3: pET15b vector].
Fig. 13 shows a comparison between the amino acid sequences of Pioneer and a plant HR-inducing protein (HrpN) from Erwinia amylovora ATCC15580T [A: Pioneer, B : HrpN].
Fig. 14 shows HR on tobacco leaves treated with the Pioneer from Erwinia pyrifoliae WT#3 and HrpN from Enυinia amylovora ATCC15580T (a control) at different concentrations.
Fig. 15 shows the disease symptoms on the surface of immature pear fruit 4 days after inoculation of the Pioneer and a buffer (control).
The following examples are intended to be illustrative of the present invention and should not be construed as limiting the scope of the invention as defined by compounds or examples herein.
EXAMPLES
Example 1: Isolation and identification of novel strain
1) Physiological /biochemical tests based on Schaad's Laboratory guide and Bergey's manual
In order to identify the pathogenic bacteria from the affected lesions by necrotic disease on pears from orchards of Chunchon (Kangwon Province, Korea), different physiological and biochemical tests were performed based on Schaad's laboratory guide [Schaad, N. W. 1988. Initial identification of common genera. In: Laboratory Guide for Identification of a plant Pathogenic Bacteria, ed. by N. W. Schaad. American Phytopathological Society, Minnesot. pp. 44-59] and Bergey 's manual [Lelliott, R. A. and Dickey, R. S. 1984. Genus Enυinia. In: Bergey's Manual of Systemic Bacteriology vol. 1, pp. 469-476, Williams and Willkins Co., Baltimore/London], as shown in the following table 1.
Table 1
Overall, the analytical results showed that the physiological tests on the strain (e.g., liquefaction of gelatin, motility in 3% agar, and decomposition of pectate) were close to those of type strain Epl6T of Erwinia pyrifoliae. In contrast, the biochemical tests for the utilization of carbon source revealed different results, especially trehalose and L-arabinose, suggesting that the physiological and biochemical properties of the isolated strain according to the present invention were different from those of type strain Erwinia pyrifoliae Epl6Tand Enυinia amylovora ATCC 15580τ.
2) Morphological property of strain WT#3
The morphological property of the strain WT#3 was observed by TEM (Transmitted Electro Microscope), was different from that of recently reported Erwinia pyrifoliae EP16T causing necrotic disease in Asian pear trees and Erwinia amylovora ATCC 15580τ causing fire blight on apples and pears [Fig. 1].
As a result, Enυinia spp. including Erwinia pyrifoliae EP16T and Erwinia amylovora ATCC 15580τ were rod shaped with peritrichous flagella whereas the novel strain Enυinia pyrifoliae WT#3 was a slight oval rod shaped "without flagella".
3) Growth of the strain WT#3 at different temperatures
To investigate the physiological and biological properties, growth curve of Erwinia pyrifoliae WT#3 at different temperatures was performed and the growth was measured by turbidity using Bioscreen C.
The temperatures ranging from 12 °C to 39 °C were measured at intervals of 3 °C and doubling time and specific growth rate at different temperatures of Erwinia pyrifoliae WT#3 and Enυinia amylovora ATCC 15580τ were calculated [Fig. 2].
The results showed Enυinia pyrifoliae WT#3 has higher growth rate (27-30 °C) with short doubling time than that of Erwinia amylovora. The optimal temperature was 27 °C for the strain WT#3.
At lower temperatures below 20 °C, Erwinia pyrifoliae WT#3 also showed a better growth compared to Erwinia amylovora ATCC15580T, suggesting that Erwinia pyrifoliae WT#3 is a cold tolerant because this pathogen is well adapted in the vicinity of Chunchon. Chunchon is a relatively cold area in the winter season and has different environmental conditions from that of Erwinia amylovora ATCC15580T.
4) Growth of the strain WT#3 at different pH levels
To investigate the effects of pH on the growth of Erwinia pyrifoliae WT#3 the growth at different pH levels was measured by turbidity using Bioscreen C. The pH ranging from pH 5.5 to 9.5 was measured at intervals of 0.5 at a constant temperature of 28 °C and doubling time and specific growth rate at different pH levels of Erwinia pyrifoliae WT#3 and Enυinia amylovora ATCC15580T were calculated [Fig. 3].
The results showed that the optimal pH range for the growth of Erwinia pyrifoliae WT#3 was between pH 7.0 and 8.0 and its rapid growth was observed in an alkaline condition of pH 7.5 which was different from that of Erwinia amylovora ATCC15580T.
5) Property of strain WT#3 using Biolog system Biolog system [BIOLOG, Hay ward, CA 94545, USA] designed to monitor the utilization of 96 different carbon and nitrogen sources was applied to investigate the biochemical property of strain WT#3 in detail.
After incubation in TSA (triptic soy agar) at 28 °C for 24 hours, the isolated strain was suspended to the turbidity of 63% in a solution containing 0.4% sodium chloride, 0.03% pluronic F-68, and 0.01% gellan gum and inoculated to the wells containing 96 different carbon and nitrogen sources.
Then, the strain WT#3 was further cultivated in an incubator at 35-37 °C . The violet-turned as utilization of carbon and nitrogen sources were recorded using a reader and their values were numerically divided. As shown in Fig. 4, strains ATCC15580, LMG2068, LMG1877, LMG1946 and ea246 strains (USA), which belong to Erwinia amylovora, were showed to be in the same group. In contrast, the strain WT#3 was in the group as Erwinia pyrifoliae (Ep4,
Ep8, Epl6T). Therefore, it was clear that the strain WT#3 is different from the source of fire blight pathogen, E. amylovora.
6) Analysis of 16S rRNA gene from strain WT#3
To investigate the phylogenetic analysis of the strain WT#3, the nucleotide sequence of its 16S rRNA gene was analyzed considering the fact that it is an essential component to manage a life where its nucleotide sequence is well conserved and can be readily placed for phylogenetic analysis. The 16S rRNA gene was amplified by PCR using fDl primer (SEQ. ID. No. 1) and rP2 primer (SEQ. ID. No. 2) and then cloned into pGEM-T vector to analyze its nucleotide sequence.
Fig. 5 shows a phylogenic tree prepared by a mega program [Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. The Pennsylvania State University, University Park] based on the 16S rRNA nucleotide sequence.
The strain WT#3 had similarities to Enυinia pyrifoliae Epl6T and Enυinia amylovora 15580τ with 98.9% and 97.5% sequence identity, respectively, being more closer to Erwinia pyrifoliae than to Enυinia amylovora. Table 2 shows the similarity of 16S rRNA gene of each strain. Table 2
Also, the analysis of 16s rRNA gene revealed that the strain WT#3 belongs to the group as Enυinia pyrifolia but was different from that of Erwinia amylovora ATCC 15580τ, and Enterobacter pyrinus, which was previously reported to infect apples and pears in Korea several years ago. 7) Analysis for 16S-23S ITS (Intergenic Transcribed Spacer) region of strain WT#3
To analyze the ITS of the Korea-originated pathogens Erwinia pyrifoliae and foreign-originated Erwinia amylovora, 16S-23S ITS region was amplified by PCR using R16-1F primer (SEQ. ID. No. 3) and R23-1R primer (SEQ. ID. No. 4), and then cloned into pGEM-T vector to analyze the nucleotide sequence of 16S-23S ITS region.
As a result, 16S-23S ITS region was divided into two groups; Erwinia amylovora had three band patterns with about 1215, 970 and 720 bp in size, whereas domestic pathogen, Erwinia pyrifoliae had two band patterns with 970 and 720 bp in size. Currently, all strains were showed two groups; the band pattern of 970 bp had about 70 bp region of tRNAAla, whereas the band pattern of 720bp had a region of tRNAGlu, respectively.
Fig. 6 shows a phylogenic tree prepared by analyzing the nucleotide sequences of 16S-23S ITS region of both the strain Erwinia pyrifoliae WT#3 and Enυinia amylovora ATCC15580T.
As a result of analyzing the nucleotide sequences of a 970 bp band encoding 70bp regions of tRNAAla, it was revealed that the strain WT#3 is different from Enυinia amylovora group and had a similarity of 47.4% to Enυinia amylovora. However, we could not compare with tRNA^3 region of Erwinia pyrifoliae, which was designated by German researchers because it was not registered in GenBank.
The analysis of the nucleotide sequences of a 720 bp band encoding tRNAGlu region showed that the strain Erwinia pyrifoliae WT#3 has 85.2%- 92.7% of sequence identity to that of Erwinia pyrifoliae reported by a German researchers, thus being suggested as the same group [Fig. 7].
8) Analysis of Enυinia pyrifoliae WT#3 according to plasmid profiles
The Korea-originated Erwinia pyrifoliae and foreign-originated Erwinia amylovora were divided into the following two groups [Fig. 8].
Group I: Erwinia amylovora (ATCC15580, LMG1877, 10296) (a plasmid > 29 kb) Group II : Erwinia pyrifoliae (WT#3, Epl, Epl6) (a plasmid > 29 kb, a plasmid 5 kb, and three plasmids 2-4 kb in size)
That is, the necrotic disease pathogens, Enυinia pyrifoliae, on Asian pear trees including the strain WT#3 have five plasmids, whereas fire blight pathogens, Erwinia amylovora, have only one plasmid, respectively.
9) Analysis for DNA relatedness according to DNA-DNA hybridization
The relatedness in whole genome between the Korea-originated Erwinia pyrifoliae and foreign-originated Erwinia amylovora were was investigated. The purely isolated total DNA was dissolved in 100 μJt TE buffer to a concentration lng/ tl, added with ION NaOH, and then denatured by boiling at 80 °C for 10 min. Denatured DNA was applied to Hybond-N+ nylon membrane using a slot-blot apparatus. Native DNA to be used as a probe was labeled with DIG 11-dUTP by Dig-High Prime [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany], prehybridized at 49 °C for 3 hours in the presence of DNA already fixed to a nylon membrane, and then hybridized for 16 hours at the same temperature. Development of the membranes was conducted by DIG Luminescent Detection Kit [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany].
The result showed that the foreign-originated Enυinia amylovora (ATCC15580T, LMG1877, LMG1946, LMG2068) belong to group I while Korea-originated Erwinia pyrifoliae (WT#3, Epl6T) belong to group II .
More specifically, the foreign-originated pathogens, Erwinia amylovora belonged to group I but the Korea-originated pathogens, Erwinia pyrifoliae belonged to group II. This result clearly indicates that the Korean pathogens, Erwinia pyrifoliae including strain WT#3 and the foreign pathogens, Erwinia amylovora were distinct, suggesting that Erwinia pyrifoliae is native to Korea. The following table 3 shows the similarities of related strains. Table 3
From the above physiological, biochemical and genetic properties of the strain WT#3, it was noted that, in terms of physiological and biochemical properties based on Schaad's laboratory guide and Bergey's manual, temperature and pH level-related properties, Biolog system, 16S rRNA gene, 16S-23S ITS, plasmid profiles, and relatedness by DNA-DNA hybridization, the strain WT#3 was in the group of Erwinia pyrifoliae, which was present only in Korea in 1999, although there were a few other different properties between Erwinia pyrifoliae WT#3 and Epl6T. However, since the strain WT#3 does not have flagella in morphology which is first reported in genus Erwinia, it appears to be different from those of pathogen, Enυinia pyrifoliae, which was reported by German researchers and Erwinia amylovora.
We designated the strain WT#3 as Erwinia pyrifoliae WT#3 (KCCM 10283) and deposited to the Korean Culture Center of Microorganisms on June 11, 2001. The accession number is KCCM 10283. Also, a recombinant pKEP3 for higher expression containing the gene derived from the Erwinia pyrifoliae WT#3 was constructed and transformed to Esckerichia coli. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with
Accession No. KCCM 10282. Example 2: Properties of specific protein triggering a plant hypersensitive reaction from Erwinia pyrifoliae WT#3 and a gene encoding it
1) Analysis of a plant HR-inducing gene from Erwinia pyrifoliae WT#3
To analyze a gene encoding specific protein eliciting a plant hypersensitive response, total DNA of Enυinia pyrifoliae WT#3 was incubated at 37 °C to ensure that it was partially digested with Sau3Al. The DNA (1 μl) was then examined for appropriate digestion on an electrophoresis at the .intervals of 1 hr, and the result revealed that about 6 hours of digestion was most appropriate. Total DNA, so manipulated, was prepared as an insertion DNA and ligated into the BαmHI polylinker site of cloning vector pLAFR3 using DNA ligase by incubating at 14 °C for 12 hours. A complete plasmid DNA ligated with the insertion DNA and a vector was transformed to E. coli (HB101) via CaCl2 transformation. Then, E.coli strains were cultivated on Luria agar medium containing tetracycline (30 mg/m£) at 37 °C for 24 hours and 2,000 genomic library clones were generated.
To select clones encoding the specific protein eliciting a plant hypersensitive reaction from the 2,000 genomic DNA library clones of Erwinia pyrifoliae WT#3, total protein was extracted from each clone as follows. The solution, so cultured in LB medium for 12 hours, was centrifuged to obtain a pellet and after suspending the pellet in the mixture containing 5 mM MES buffer and 0.1 mM PMSF, the mixture was lysed by sonication and boiled at 100 °C for 10 min. Then, the supernatant only, so centrifuged, was collected and injected to the reverse sides of tobacco leaves (Nicotiana tabacum L. Samsun) using a syringe, which were grown with more than four true leaves with each leaf having a diameter of more than 15 cm. The necrosis of tobacco leaves 24 hours after injection was regarded as the HR and then genomic DNA library clones showing HR were selected [Fig. 9].
From the selected clone pCEP33, an 8.5 kb DNA fragment containing the HR-inducing gene was cloned to pUC19 vector and a physical map was constructed using a restriction endonuclease [Fig. 10]. Fig. 11 compares a gene (KCCM 10282) encoding the plant HR-inducing protein from Erwinia pyrifoliae WT#3 (KCCM 10283) of the present invention with the HR-inducing gene (hrpN)- from Erwinia amylovora ATCC15580T by analyzing the nucleotide sequences from the selected gene. From Erwinia pyrifoliae WT#3 of this invention, a 1287 bp gene encoding a protein of plant hypersensitive response can be obtained. The 1287 bp gene was designated as "a plant HR-inducing gene from WT#3" and its similarity to hrpN gene of Erwinia amylovora ATCC15580T (1212 bp) was investigated.
As a result, it was shown that five novel nucleotide sequences fragments were inserted to the plant HR-inducing gene of WT#3 at the sites of 222-230 bp (TTTAACGGG), 249-263 bp (TGGCGGCGGTCTGCT), 327-333 bp (TCTGGGT), 348-371 bp (CGGCATTGGCGGCGGCATTGGTGG), and 397-411 bp (ACCGTGGGGACCTCT), thus resulting in the increase in the molecular weight of the gene. The plant HR-inducing gene from WT#3 had a low sequences similarity of 83.2% homology to hrpN gene of Erwinia amylovora.
Therefore, it demonstrated that the gene encoding the plant HR-inducing protein of Erwinia pyrifoliae WT#3 has a different nucleotide sequences from hrpN gene of Enυinia amylovora and also has the insertions of novel nucleotide sequences fragments, thus showing that the plant HR-inducing gene from WT#3 has a novel gene structure which is not found in hrpN gene of Enυinia amylovora.
The nucleotide sequence of the gene encoding the plant HR-inducing protein of Erwinia pyrifoliae WT#3 was denoted as SEQ. ID. No. 5.
2) Construction of expression vector of a plant HR-inducing protein from Erwinia pyrifoliae WT#3
To extract and purify a plant hypersensitive response eliciting protein on a large scale from the plant HR inducing gene of Erwinia pyrifoliae WT#3, an expression vector pKEP3 containing the gene was constructed as follows:
Recombinant protein expression system in E.coli (Novagen, Inc. Madison, WI53711 USA) was employed so as to construct the expression vector pKEP3. This system was derived from pBR322 plasmid, where T7 promoter and operator can bind to lac repressor before the insertion site of a foreign gene. This structure can easily facilitate the expression of an inserted gene in a larger volume by T7 RNA polymerase produced in a host E.coli genome. Notably, when a substrate IPTG 3 hours after incubation is added, the combination of both lac repressor produced from lacl gene and IPTG does not repress the expression of T7 RNA polymerase and thus, a larger amount of protein is synthesized. For the selection of complete transformants, pKEP3 was constructed to contain an ampicillin-resistance gene and ampicillin can be used to the medium as a selective marker. The gene encoding a plant HR-inducing protein from Erwinia pyrifoliae WT#3 and the plasmid of recombinant protein expression system were digested at 37 °C for 12 hrs in the presence of the restriction enzymes Ndel and BamΗI to generate the same 5'- and 3'-end. They were then ligated into the restriction sites using DNA ligase at 14 °C for 16 hrs and transferred into E.coli via CaCl2 transformation. pKEP3 has many advantages that (1) ampicillin-resistant gene can be used as a selected marker, (2) its possession with His tag may make an easier purification, and (3) its possession of a strong T7 lac promoter may ensures a larger volume of protein production from ligated insertion DNA.
The E. coli transformant containing the expression vector pKEP3 was deposited to the Korean Culture Center of Microorganisms on June 11, 2001 and was assigned with the Accession No. KCCM 10282.
In the present invention, hrpN gene of Erwinia amylovora ATCC15580T was cloned by using the same recombinant protein expression system (Novagen, Inc., Madison, WI 53711, USA) and used as a control for the biological test of pKEP3, which contains novel plant HR-inducing gene from Erwinia pyrifoliae WT#3. 3) Expression of a plant HR-inducing protein
To produce a large-scale protein from E. coli transformants containing pKEP3 (KCCM 10282) bacterial cells were inoculated to a LB broth by adding ampicillin (50 as a selective marker and chloramphenicol (33 μg/iΑl) for inhibiting the synthesis of other proteins produced from E.coli genome, and subcultured at 37°C for 12 hours. Then, the bacterial transformant (KCCM 10282) of the present invention was cultured at 30 °C for 7 hours using the same medium. When the O.D. of the transformant (KCCM 10282) reached 0.6 about 3 hours after the cultivation, the culture was added with 0.4 mM IPTG and cooled down to 30 °C and then cultured again for 4 hours. After a total of 7 hours cultivation, the mixture was centrifuged at 6,000 rpm for 15 min. Then, the supernatant was discarded and a pellet was suspended in a solution containing 5 mM MES buffer and 0.1 mM PMSF. The suspension of transformant (KCCM 10282) was lysed by sonication until the suspension became transparent and then boiled for 10 min at 100 °C. Then, the mixture was centrifuged at 15,000 rpm for 10 min and the supernatant was discarded. After adding a protein inhibitory cocktail at the ratio of 1/1,000, the mixture was filtrated by using a 0.45 μm filter and weighed the extract amount of protein.
Through the above-mentioned process, the plant HR-inducing protein producing from transformant encoding the plant HR-inducing gene (KCCM 10282) of Enυinia pyrifoliae WT#3 was named as 'Pioneer'.
According to the present invention, hrpN gene of Erwinia amylovora ATCC15580T was cloned by the same recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) and used as a control for the biological test of Pioneer. As shown in Fig. 12, it was demonstrated that both genes of Enυinia pyrifoliae
WT#3 and Erwinia amylovora ATCC15580T encoding plant HR-inducing protein were successfully expressed by the recombinant protein expression system and were synthesized a large volume of a plant HR-inducing proteins.
4) Analysis for the similarity of plant HR-inducing protein (Pioneer)
The similarity of Pioneer was compared with the HR-inducing protein of
Enυinia amylovora ATCC15580T by analyzing the amino acid sequence of purified
Pioneer [Fig. 13].
As a result, it was noted that novel protein domains of Pioneer were produced from the N-terminal at the sites of 76-79 (Thr-Gly-Leu-Leu), 88 - 92 ( L e u - G l y - G l y - G l y - S e r ) , 102 - 113 (Gly-Leu-Gly-Gly-Leu-Gly-Gly-Asp-Leu-Gly-Ser-Thr), and 131-137 ( G l y - A l a - T h r - N a l - G l y - T h r - S e r ) .
The Pioneer had a low amino acid sequence identity of 85.9% homology to that of HrpΝ. The molecular weight of Pioneer was 41.1 kD as compared with 39.7 kD of HrpΝ. The molecular weight of both Pioneer and HrpΝ was not compared with the molecular weight standards on an acrylamide gel but a molecular weight of each amino acid deduced from, the nucleotide sequence of gene using Winstar program. Therefore, Pioneer has a novel type of a protein by the insertion of novel peptide domains and such difference is expected to bring about much improved biological activity, which cannot be found in that of HrpΝ.
5) Hypersensitive response of a plant HR-inducing protein (Pioneer) Until recently, the plant HR-inducing protein is known as a pathogenic factor in host plants but induces the HR in non-host plants.
Pioneer from Erwinia pyrifoliae WT#3 and HrpΝ from Erwinia amylovora
ATCC15580T were inoculated onto tobacco (non-host plants) leaves using a syringe, together with MES buffer (protein lysis buffer) as a control [Fig.14]. As shown in Fig.14, it was noted that Pioneer and HrpΝ exhibited a clear HR in the front tobacco leaf at the dose of 10 μg/ml and 20 μg/ml, respectively; in the same reverse tobacco leaf, Pioneer and HrpΝ exhibited a clear HR at the dose of 5 μg/ml and 10 μg/ml, respectively. This reflected that Pioneer induces HR at a relatively lower concentration than that of HrpΝ. As shown in the following table 4, it revealed that when Pioneer was inoculated at the dose of 5 μg/ml and 10 μg/ml, a clear HR was observed at 24 hours and 14 hours after inoculation, respectively, whereas HrpΝ induced a clear HR at 48 hours and 18 hours after inoculation at same concentration, respectively. - This demonstrates that Pioneer exhibited more rapid HR than HrpΝ by 24 hours at of 5 μg/ml while Pioneer exhibited more rapid HR than HrpΝ by 4 hours at 10 μg/ml respectively.
This test was repeatedly performed three times and the result suggests that Pioneer induces the immune system of a plant at a lower dose and faster than HrpN. Table 4
6) Pathogenicity test on pear of plant HR-induced protein (Pioneer)
Purified Pioneer at a dose of 500 μg/ml was inoculated to the surface of an immature fruit by punching it a hole (0.5 mm in diameter and 10 mm in depth).
As shown in Fig. 15, the surface of the immature fruit turned black as a progressive symptom 4 days after treatment, compared with that of a control.
Therefore, Pioneer might have a potent pathogenicity on pears although it needs a further investigation.
As mentioned above, the properties of Pioneer and a gene encoding it can be summarized as follows.
(1) The gene encoding Pioneer showed that several novel nucleotide sequences fragments are inserted to the several sites of Pioneer gene, which are not found in hrpN gene; the size of Pioneer gene was 1,287 bp as compared with that of the gene of hrpN (1,212 bp). (2) In the protein structure, the molecular weight of Pioneer (41.1 kD) with novel peptide domains was larger than HrpN (39.7 kD) [The molecular weight of both Pioneer and HrpN were not compared with molecular weight standards on an acrylamide gel but their molecular weight for each amino acid were deduced from the nucleotide sequences of a gene using Winstar program]. (3) In the HR observed in tobacco leaves, it was noted that Pioneer induces the immune system of a plants at a lower dose and faster than HrpN.
Therefore, it is clear that Pioneer is more suitable than HrpN from Erwinia amylovora for the development of a better biopesticide eliciting the excellent HR.
Example 3: The study of biological activity using plant HR-inducing protein (Pioneer)
1) Control effect against powdery mildew (Sphaerotheca fuliginea) of cucumbers To evaluate the control effect of Pioneer against powdery mildew
(Sphaerotheca fuliginea), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein.
Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms. The test materials were applied based on the 3-time repeated randomized complete block design. The stems and leaves of cucumbers were treated with the HR-inducing protein, Pioneer, at a dose of 20 μg/ml according to the recommended dose by EDEN Bioscience corporation.
EDEN Bioscience's Messenger® was used as a control at the same dose above, together with locally produced Fenarimol (chemical pesticide) based on the instruction in use. The treatment methods are as follows: φ Treatment by three times: Pioneer, Messenger® and Fenarimol were sprayed to the stems and leaves of cucumber three times each at intervals of 10 days after early stage of powdery mildew (Sphaerotheca fuliginea).
(2) Treatment by four times: Pioneer, Messenger® and Fenarimol were sprayed to the stems and leaves of cucumber three times each at the implantation of day 7, 21, 35, and 49.
The disease severity of powdery mildew- (Sphaerotheca fuliginea) from the upper 8 leaves to the bottom 3 leaves of cucumbers was measured 7 days after treatment based on the following criteria (0: no disease, 1: 1-5%, 2: 5.1-20%, 3: 20.1-40%, 4: more than 40%). Table 5
As shown in the table 5, Pioneer is expected to be used as an excellent pesticide, since both three-time and four-time treatments showed that its control effects were increased by 122.6% and 187.0% as compared with Messenger®.
2) Enhanced production of cucumbers
To ascertain the enhanced production of cucumbers with the treatment of Pioneer, the stems and leaves of cucumbers were treated with Pioneer at a dose of 20 μg/ml 5 times each at intervals of 14 days from day 7 before implantation. HrpN, a control, was also given to the stems and leaves of cucumbers at the same dose as aforementioned.
The cucumbers for this experiment were harvested at the implantation of day 8, 10, 12, 14, 16, 18, 21, 23, 25, and 30. Under the judgment that the cucumbers with 20 cm in length can be commercialized, the results are indicated as a marketable rate as follows. Table 6
*Note : marketable fruit/ total fruit
From the above tables, it was noted that the marketable rate treated with Pioneer was increased by 8.1% as compared to that of non-treatment, and 4.6% as compared to that of HrpN.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
3) Increase of contents in photosynthesis and chlorophyll of cucumbers
To ascertain the physiological reaction of cucumbers, namely, the increase of contents in photosynthesis and chlorophyll of cucumbers, when treated with Pioneer, the stems and leaves of cucumbers were treated with Pioneer at a dose of 20 μg/ml 5 times each at intervals of 14 days from day 7 before implantation. HrpN, a control, was also given to the stems and leaves of cucumbers at the same dose as aforementioned .
The cucumbers for this experiment were harvested at the implantation of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 μmole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan). Table 7
*Note: P, contents of photosynthesis; C, contents of chlorophyll
From the above table, it was noted that when cucumbers was treated with Pioneer, the contents of photosynthesis and chlorophyll were increased by 16.2% and 5.4%, respectively, vs. non-treatment and 9.8% and 2.0%, respectively vs. HrpN.
Therefore, Pioneer may be effectively used as a plant growth activator and a fertilizer than HrpN. 4) Control effect against blight of pepper (Phytophthora capsici)
To evaluate the control effect of Pioneer against blight of pepper (Phytophthora capsici), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. Peppers were cultivated by the conventional "open field culture" method prevailing in agricultural farms. The stems and leaves of pepper were treated with Pioneer at the doses of 10, 20 and 40 μg/ml. HrpN, a control, was also given to the stems and leaves of pepper at the same dose as aforementioned. The treatment was performed as follows:
CD At the intervals of day 8 and 12 after implantation, the stems and leaves of peppers were treated with each concentration of both Pioneer and HrpN. Phytophthora capsici (2 106 cells/m ) was inoculated to peppers, so treated, and their disease severity was measured 63 days after treatment.
Table 8
As shown in table 8, it was noted that Pioneer (10 μg/ml) exhibited better control effect than HrpN (40 μg/ml).
Therefore, Pioneer can be effectively used as a pesticide at a lower dose than HrpN protein.
5) Control effect against anthracnose of pepper (Colletotrichum orbiculare)
To evaluate the control effect of Pioneer against anthracnose of pepper (Colletotrichum orbiculare), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. Peppers were cultivated by the conventional "open field culture" method prevailing in agricultural farms. The stems and leaves of peppers were treated with Pioneer at a dose of 10 μg/ml 5 times at the implantation of day 14 from day 7 before treatment. HrpN, a control, was also given to the stems and leaves of peppers at the same dose. The treatment was performed as follows: φ At the implementation of day 8 and 12, the stems and leaves of peppers were treated with each concentration of both Pioneer and HrpN. At the implementation of day 20, 27, 34 and 40, implanted peppers, so treated, were indicated as health and unhealthy fruits. Table 9
As shown in table 9, Pioneer exhibited better control effect against anthracnose of pepper (Colletotrichum orbiculare) than HrpN by 14.3%. Therefore, Pioneer can be effectively used as a pesticide than HrpN. 6) Enhanced production of peppers
To ascertain the enhanced production of peppers with the treatment of Pioneer, Pioneer was sprayed 5 times to the stems and leaves of peppers at a dose of 10 μg/ml at implantation of day 8 and 12. HrpN, a control, was also inoculated to the stems and leaves of peppers at the same dose. The treatment was performed as follows: φ Immersion plus spray method: Peppers were immerged in both Pioneer and HrpN at a dose of 10 μg/ml and immerged at 28 °C for 24 hours. Then, these peppers were sowed in a pot with soil, grown for 46 days and planted in an open field. At the implementation of day 8 and 12, the stems and leaves of peppers were sprayed with both Pioneer and HrpN protein. The peppers for this experiment were harvested at the implantation of day 18, 25, 32, 39 and 46.
Table 10
As shown in table 10, it was noted that Pioneer exhibited better production by 22.7% than HrpN.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
7) Increase of contents in photosynthesis and chlorophyll of peppers
To ascertain the physiological reaction of cucumbers, namely, the increase of contents in photosynthesis and chlorophyll of peppers, when treated with Pioneer, the stems and leaves of peppers were treated with Pioneer at a dose of 20 μg/ml 5 times at the intervals of 14 days from day 7 before treatment. HrpN, a control, was also given to the stems and leaves of peppers at the same dose as aforementioned.
The peppers for this experiment were harvested at the implantation of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 μmole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan). Table 11
*Note : P, contents of photosynthesis; C, contents of chlorophyll From the above table, it was noted that when peppers was treated with Pioneer, the contents of photosynthesis and chlorophyll were increased by 16.0% and 6.7%, respectively, vs. non -treatment and 7.5% and 4.9%, respectively vs. HrpN.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
8) Control effect against downy mildew of oriental melon (Psendoperonospora cubensis) To evaluate the control effect of Pioneer against downy mildew of oriental melon (Pseudoperonospora cubensis), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. The stems and leaves of oriental melons were treated with Pioneer at a dose of 40 μg/ml 5 times. HrpN, a control, was also given to the stems and leaves of oriental melons at the same dose. The treatment was performed as follows: φ Immersion plus spray method: Oriental melon seeds were immerged in both Pioneer and HrpN protein at a dose of 10 μg/ml for 24 hours. Then, these seeds were sowed in a pot. At the implementation of day 17 and 28, the stems and leaves of melons were treated with both Pioneer and HrpN. φ Spray method: At the implementation of day 17 and 28, the stems and leaves of oriental melons were treated with both Pioneer and HrpN. The disease severity of downy mildew was measured 55 days after treatment.
Table 12
As shown in table 12, it was noted that both the spray and its immersion plus spray of Pioneer exhibited better control effect than those of HrpN by 96.0% and 44.6%, respectively. Therefore, Pioneer can be more effectively used as a pesticide than HrpN.
9) Control effect against blight of sweet pepper (Phytophthora capsici)
To evaluate the control effect of Pioneer against blight of sweet pepper
(Phytophthora capsici), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. Sweet peppers were implanted to a 25 cm port and cultivated at a glass house. The stems and leaves of sweet peppers were treated with Pioneer at a dose of
20 μg/ml, according to the recommended dose by EDEN Bioscience corporation.
HrpN, a control, was also given to the stems and leaves of sweet peppers at the same dose. The treatment was performed as follows: φ 8 days after implantation, the stems and leaves of sweet peppers were treated with both Pioneer and HrpN. Phytophthora capsici (2 X106 cells/ ml) was inoculated to sweet peppers, so treated, and disease severity was measured 45 days after treatment.
Table 13
As shown in table 13, it was noted that Pioneer exhibited better control effect than HrpN by 87.1%.
Therefore, Pioneer can be more effectively used as a pesticide than HrpN.
10) Enhanced production of sweet peppers
To ascertain the enhanced production of sweet peppers treated with Pioneer, the stems and leaves of sweet peppers were treated with Pioneer at a dose of 40 μg/ml 8 days after implantation. HrpN, a control, was also given to the stems and leaves of sweet peppers at the same dose.
Sweet peppers were implanted to a 25 cm port and cultivated at a glass house. Sweet peppers, so treated, were investigated at the implantation of day 41 and 45. Table 14
As shown in table 14, it was noted that Pioneer exhibits better enhanced production effect of sweet peppers than HrpN by 21.6%.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
11) Enhanced production of strawberries
To ascertain the enhanced production of strawberries treated with Pioneer, Pioneer, the stems and leaves of strawberries cultivated at a green house was treated with Pioneer at a dose of 20 μg/ml. HrpN, a control, was also given to the stems and leaves of green peppers at the same dose.
At the implantation of day 30, 33, 38, 41, 48 and 55, strawberries were harvested and indicated as total weight value (g).
Table 15
As shown in table 14, it was noted that Pioneer exhibited better facilitated production effect of strawberries than HrpN by 13.8%.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
12) Control effect against blight of rice (Magnaporthe grisea)
To evaluate the control effect of Pioneer against blight of rice (Magnaporthe grisea), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein.
Rice was cultivated by the conventional "open field culture" method prevailing in agricultural farms. The stems and leaves of rice was treated with Pioneer at the doses of 10 μg/ml, and immerged at 28 °C for 24 hours. Rice seeds were sowed to a seedbed, grown for 16 days and implanted to a test field.
Then, the stems and leaves of rice were sprayed with Pioneer at the intervals of day 45 and 52. HrpN, a control, was also given to the stems and leaves of rice at the same dose and method as aforementioned. The disease severity was measured 85 days after treatment. Table 16
As shown in table 16, it was noted that Pioneer (10 μg/ml) exhibited better control effect than HrpN (20 μg/ml).
Therefore, Pioneer can be more effectively used as a pesticide at a lower dose than HrpN.
13) Repellent effect against aphis To evaluate the repellent effect of Pioneer against aphis, a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein.
Cucumbers were selected as host plants of aphis.
Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms. The stems and leaves of cucumbers were treated with Pioneer at a dose of 20 μg/ml. HrpN, a control, was also given to the stems and leaves of cucumbers at the same dose.
When the height of cucumbers was lm, the stem and lead of cucumbers were treated with both Pioneer and HrpN.
The number of naturally occurring aphis at cucumbers was counted 7 days after treatment. Table 17
As shown in table 17, it was noted that Pioneer had better repellant effect against aphis at a lower dose than HrpN by 29.4%.
Therefore, Pioneer can be more effectively used as a repellent than HrpN. 14) Enhancement effect of growth in seeding culture of rice
To ascertain the enhancement effect of growth in seeding culture of rice treated with Pioneer, a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. The stems and leaves of rice were treated with Pioneer at the doses of 10, 20 and 40 μg/ml, diluted at MES buffer and immerged at 28 °C for 24 hrs. Rice seeds were sowed to a seedbed, grown for 16 days and implanted to a test field. HrpN, a control, was also given to the stems and leaves of rice at the same dose and method as aforementioned. As a result, better growth in seeding culture of rice treated with Pioneer was observed by about 3~4 cm vs. non-treatment and 1 cm higher than HrpN.
A higher dose (40 μg/ml) of Pioneer was required for better enhancement of rice's growth.
Therefore, Pioneer can be more effectively used as a seed-treating agent which can promote the growth of rice seeds than HrpN.
INDUSTRIAL APPLICABILITY
As mentioned above, a novel Erwinia pyrifoliae WT#3 (KCCM 10283) according to the present invention is isolated and identified, and a novel protein (Pioneer) or a polypeptide translated from a plant HR-inducing gene (KCCM 10282) of this strain shows that Pioneer has improved properties in inducing plant resistance, plant growth promotion, insect repellent effect, increase of photosynthesis and chlorophyll, and seed treatment effect than a HrpN from Erwinia amylovora ATCC155801. The former readily elicits the plant hypersensitive response at a lower dose and faster than HrpN, thus, the protein from Enυinia pyrifoliae WT#3 (KCCM 10283) is quite suitable for the development of a novel and better plant hypersensitive reaction eliciting biopesticide.
Therefore, this invention is advantageous in developing a novel and improved biopesticide and a fertilizer. BUDAPEST TREΛ1Υ ON THE INTERNATIONAL
RECOGNΓΠON OP THE DEPOSIT OF MICROORGANISMS
FOR THE PUKPOSKS OK PATENT PROCEDURE
INTERNATIONAL FORM
r To. ChuπKeuπ Liiπ
Λnhori 1 Seotπyuπ, Chunchon. RECEirr IN ΎHK CASE OF AN ORIGINAL Kaπffwoπ-Do 200 832. Korea issued pursuant to Rule 7. 1 by the INTERNATIONAL DEPOSITΛHY AUTHORTTY identified at the bottom of this lane
date on which the microorgansm was rece ve y t e nternat ona oiwutHiy aut ouity.
Form BP/4 Sole pa#c BUDAPEST TRFΛTY ON THE INTKKNΛTIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT' PROCEDURE
INTERNATIONAL FORM
r TO. ChunKctw im
Λnbori 1 Seomyuil, Chunchon, RECEIPT IN THR CASE OF AN OWGINΛL KatiRwon-Do 200-832, Korea issued pursuant to Rule 7. 1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the boMom of this μarø:
1 Where Rule 6. 4 (d) applies, such date is the date on which the status of international "depositary authority was acquired : where a dcjKisit made outside the Budapest Treaty after tbt: acquisition of the status of i πtemational depositary authority is converted into a deposit under the Budapest Treaty, such date is the date on which the microorganism was received by the international depositary authouity.
Form .BP/4 Sole ι«κu

Claims

CLAIMSWhat is claimed is:
1. Erwinia pyrifoliae WT#3 (KCCM 10283), an Erwinia pathogen effective in controlling plant diseases and activating plant growth.
2. A gene (KCCM 10282) encoding a protein or a polypeptide in a non-infectious form originated from Erwinia pyrifoliae which induces a hypersensitive reaction or resistance to pests in plants when plant cells are in contact with or treated by said gene.
3. A gene (KCCM 10282) according to claim 2, wherein said DNA molecule has a nucleotide sequences of No. 5.
4. A gene according to claim 2, wherein said protein or polypeptide has amino acid sequences of No. 6.
5. A gene according to claim 2, wherein said Erwinia pyrifoliae is Erwinia pyrifoliae WT#3 (KCCM 10283).
6. An expression system containing the gene according to claim 2.
7. An expression system according to claim 6, wherein the gene has a nucleotide sequences of No. 5.
8. Transformants containing the gene according to claim 2.
9. Tansformants according to 8, wherein said transformants are selected from the group consisting of bacteria and plants.
10. A protein or polypeptide in a non-infectious form derived from Erwinia pyrifoliae which induces a hypersensitive reaction or resistance to pathogens in plants when in contact with plant cells.
11. The protein or polypeptide according to claim 10, wherein said Enυinia pyrifoliae is Enυinia pyrifoliae WT#3 (KCCM 10283).
12. The protein or polypeptide according to claim 10, wherein said protein or polypeptide has a nucleotide sequences of No. 6.
13. The protein or polypeptide according to claim 10, wherein said protein or polypeptide is a recombinant.
14. A biopesticide composition containing said protein or polypeptide and a carrier according to claim 11.
15. A pesticide using said protein or polypeptide and a carrier according to claim 11.
16. A plant growth activator using the protein or polypeptide and carriers according to claim 11.
17. A seed-treating agent using said protein or polypeptide and a carrier according to claim 11.
18. An insect repellent using said protein or polypeptide and a carrier according to claim 11.
19. A fertilizer using said protein or polypeptide and a carrier according to claim 11.
20. A method for producing a protein or polypeptide that induces a hypersensitive response or resistance on a mass-scale by isolating and purifying said protein or polypeptide from cultures of Erwinia pyrifoliae WT#3 (KCCM 10283) and transformants containing a plant HR-inducing gene of the strain (KCCM 10282) from Enυinia pyrifoliae WT#3 (KCCM 10283) .
EP02758919A 2001-08-14 2002-08-14 New biopesticide using gene from erwinia pyrifoliaewt 3, novel pathogen that affects asian pear trees Withdrawn EP1417299A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR2001049047 2001-08-14
KR1020010049047A KR20030015010A (en) 2001-08-14 2001-08-14 New biopesticide using WT#3-1 gene from Erwinia pyrifoliae WT#3, novel pathogen that affects Asian pear trees
PCT/KR2002/001553 WO2003016510A1 (en) 2001-08-14 2002-08-14 New biopesticide using gene from erwinia pyrifoliaewt#3, novel pathogen that affects asian pear trees

Publications (2)

Publication Number Publication Date
EP1417299A1 true EP1417299A1 (en) 2004-05-12
EP1417299A4 EP1417299A4 (en) 2005-02-16

Family

ID=19713198

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02758919A Withdrawn EP1417299A4 (en) 2001-08-14 2002-08-14 New biopesticide using gene from erwinia pyrifoliaewt 3, novel pathogen that affects asian pear trees

Country Status (11)

Country Link
EP (1) EP1417299A4 (en)
JP (1) JP3976731B2 (en)
KR (2) KR20030015010A (en)
CN (1) CN100494344C (en)
AU (1) AU2002324348B2 (en)
BR (1) BR0210787A (en)
CA (1) CA2457060A1 (en)
HU (1) HU225133B1 (en)
PL (1) PL368981A1 (en)
WO (1) WO2003016510A1 (en)
ZA (1) ZA200400008B (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100718549B1 (en) 2006-04-25 2007-06-21 대한민국 A vector containing the Harpin gene derived from black blight pathogen, Agrobacterium tumefaciens and pathogen resistant transgenic plants transformed therefrom
US9181592B2 (en) * 2007-03-30 2015-11-10 Case Western Reserve University Method for detecting a bacterial pathogen
KR101249854B1 (en) 2011-01-11 2013-04-03 재단법인 제주테크노파크 Composition and Method for Controlling Plant Disease Occurred by Magnaporthe grisea Using a Fruit Extract of Pittosporum tobira Ait or Saponin ⅢA3 Isolated from the Fruit Extract
FR3106834B1 (en) * 2020-01-30 2024-11-29 Ocean Diagnostics New multiplex PCR method and use
WO2023288294A1 (en) 2021-07-16 2023-01-19 Novozymes A/S Compositions and methods for improving the rainfastness of proteins on plant surfaces
US20250311734A1 (en) 2022-05-14 2025-10-09 Novozymes A/S Compositions and Methods for Preventing, Treating, Suppressing and/or Eliminatting Phytopathogenic Infestations and Infections
WO2025131903A1 (en) 2023-12-21 2025-06-26 Chr. Hansen A/S Priestia megaterium and uses thereof
PY2504864A (en) 2024-01-26 2025-08-06 Chr Hansen As Phytoprotective combinations of bacilli that thrive in low temperature conditions
WO2025217017A1 (en) 2024-04-08 2025-10-16 Novozymes A/S Compositions and methods for increasing phosphorous availability

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994001546A1 (en) * 1992-07-01 1994-01-20 Cornell Research Foundation, Inc. Elicitor of the hypersensitive response in plants
US5850015A (en) * 1995-06-07 1998-12-15 Cornell Research Foundation, Inc. Hypersensitive response elicitor from Erwinia chrysanthemi
JP3961023B2 (en) * 1995-06-07 2007-08-15 コーネル・リサーチ・ファンデーション・インコーポレイテッド Hypersensitive response-induced tolerance in plants
CN1126817C (en) * 2000-12-15 2003-11-05 南京农业大学 Gene for coding plant growth regulator and its expression product and application

Also Published As

Publication number Publication date
HUP0402172A2 (en) 2005-02-28
CN100494344C (en) 2009-06-03
AU2002324348B2 (en) 2005-09-15
PL368981A1 (en) 2005-04-04
JP2005500062A (en) 2005-01-06
EP1417299A4 (en) 2005-02-16
KR20030015010A (en) 2003-02-20
CN1582329A (en) 2005-02-16
ZA200400008B (en) 2005-01-05
HU225133B1 (en) 2006-06-28
KR100389143B1 (en) 2003-06-25
KR20030015163A (en) 2003-02-20
BR0210787A (en) 2004-08-17
HUP0402172A3 (en) 2005-07-28
WO2003016510A1 (en) 2003-02-27
JP3976731B2 (en) 2007-09-19
CA2457060A1 (en) 2003-02-27

Similar Documents

Publication Publication Date Title
Fu et al. Biocontrol of tomato bacterial wilt by foliar spray application of a novel strain of endophytic Bacillus sp.
KR20130032100A (en) Novel bacillus vallismortis bs07m with promoting effect of plant growth and improving effect of cold-tolerance, and microbial agent containing the same
Scala et al. Biological control of fruit and vegetable diseases with fungal and bacterial antagonists: Trichoderma and Agrobacterium
Stockwell et al. Fate of Agrobacterium radiobacter K84 in the environment
Kawaguchi et al. Evaluation of the nonpathogenic Agrobacterium vitis strain ARK-1 for crown gall control in diverse plant species
CN108148794A (en) A kind of the bacillus subtilis DYr3.3 and preparation method and application of broad-spectrum antibacterial activity
CN115478035A (en) Pseudomonas bryostelii GT31, application thereof and obtained control agent
Tan et al. Ribosomal-sequence-directed selection for endophytic streptomycete strains antagonistic to Ralstonia solanacearum to control tomato bacterial wilt
AU2002324348B2 (en) New biopesticide using gene from Erwinia pyrifoliaeWT#3, novel pathogen that affects Asian pear trees
AU2002324348A1 (en) New biopesticide using gene from Erwinia pyrifoliaeWT#3, novel pathogen that affects Asian pear trees
Hamidi Banayem et al. Survey of fluorescent pseudomonads from rhizosphere and rhizoplane of tomato for biocontrol of Clavibacter michiganensis subsp. michiganensis
Habbadi et al. Grapevine crown gall: Current data and research perspectives
Suk et al. Effects of a soil-born Paenibacillus spp. strain KPB3 on suppression of bacterial wilt disease caused by Ralstonia solanacearum
Lee et al. Bacterial Soft Rot of Dendrobium Phalaenopsis and Phalaenopsis sp. by Erwinia chrysanthemi
Kim et al. A Semiselective Medium for the Detection of Soybean Sprout Soft-Rot Causing Bacteria from Soybean Seeds
Lee et al. Chemical and Cultural Control of Kiwifruit Bacterial Blossom Rot
Lim et al. Bacterial Branch Blight of the Peach Tree (Prunus persica var. vulgaris Max.) by Xanthomonas arboricora pv. pruni (Smith) Vauterin et. al.
Park et al. The Roles of Domains of a Chitinase from Chromobacterium sp. Strain C-61 in Chitin Degradation
Yoo et al. The Promoting Effect on Viability in Ginseng Rhizosphere Soil by Formulation of Antagonistic Bacteria
Jung et al. Isolation, Partial Sequencing and Expression of Pathogenesis-Related cDNA Genes from Pepper Leaves Infected by Xanthomonas pv. vesicatoria
Lee et al. Population Genetic Analyses of Pseudomonas syringae pv. actinidiae Strains from Kiwifruit Orchards
Park et al. Aggressiveness Function of avrXa7 in Xanthomonas oryzae pv. oryzae
Seo et al. Soft Rot of Red-pepper Fruit Caused by Pseudomonas fluorescens Type II (p. marginalis)
Park et al. Characterization of a Pathogenicity Island of Xanthomnas campestris pv. glycines.
Yoo et al. Treatment of Formulated Antagonistic Rhizobacteria for Biocontrol of Root Rot Disease of Ginseng in Pot

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040102

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 01N 63/02 B

Ipc: 7C 12N 1/20 B

Ipc: 7C 07K 14/27 A

A4 Supplementary search report drawn up and despatched

Effective date: 20050104

17Q First examination report despatched

Effective date: 20070719

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20071130