EP1395291A2

EP1395291A2 - Novel nucleic acids and their therapeutic use in ophthalmology

Info

Publication number: EP1395291A2
Application number: EP02735545A
Authority: EP
Inventors: François Malecaze; Bettina Couderc
Original assignee: Individual
Current assignee: Individual
Priority date: 2001-05-22
Filing date: 2002-05-21
Publication date: 2004-03-10
Also published as: FR2825101A1; WO2002094177A3; FR2825101B1; AU2002310674A1; WO2002094177A2

Abstract

.The invention concerns a medicine consisting of a molecule of nucleic acids (gene, cDNA or RNA) comprising a sequence coding for an inducer of crystalline lens apoptosis under lens-specific transcriptional control, a vector comprising such a molecule of nucleic acids and its used in ophthalmology.

Description

New nucleic acid molecules and their therapeutic application in ophthalmology

The present invention relates to the therapeutic application in ophthalmology of nucleic acid molecules.

Cataract is an extremely common pathology, occurring inexorably with age. It corresponds to an opacification of the lens, the pathogenesis of which remains unknown. Its repercussions on visual functions are major. The only effective treatment is surgical: It consists of ablation of the lens with preservation of its envelope, that is to say the capsular bag in which the lens implant will be placed.

Despite its effectiveness, surgical treatment is constantly complicated in children and in approximately half of cases in adults, the appearance of a secondary cataract known as posterior capsular opacification (PCO) responsible for a new drop in visual acuity, the only treatment of which is currently using a YAG laser to make a central opening in the opacified posterior capsule. However, this opening is likely to cause serious complications which can lead to blindness. These functional complications also have economic repercussions and, for example, the cost of the YAG laser in this indication was estimated in 1993 in the USA at 250 million dollars.

Secondary cataract corresponds to an opacification of the lens capsule due to the proliferation and migration of residual crystalline epithelial cells left in place in the capsular bag at the end of the surgical procedure despite all the care taken therein.

Several approaches have been proposed in an attempt to reduce the incidence of secondary cataracts. Mechanical surgical methods such as careful cleaning of residual epithelial cells have been proposed.

Several studies using different geometries of intra- eyepieces and various bio-materials making a physical barrier to avoid the migration of residual epithelial cells from the periphery to the center of the lens have also been conducted. The use of a ring placed at the periphery of the capsular bag also aimed at preventing this centripetal migration of the cells has also been considered.

Pharmacological agents such as anti-metabolites or toxins linked to monoclonal antibodies directed against epithelial cells of the lens have also been the subject of experimental studies.

At present, the prevention of secondary cataracts is not resolved because the various strategies are only partially effective or are toxic for the surrounding eye tissue.

In order to prevent this secondary cataract, Malecaze et al. (Adenovirus-mediated suicide gene transduction: feasibility in lens epithelium and in prevention of posterior capsule opacification in rabbits, Human gene therapy, 1999, 10: 2365-2372) and Couderc et al, (Retrovirus-mediated transfer of the suicide gene into lens epithelial cells in vitro and in an experimental model of posterior capsule clouding) Curr. Eye Res., 1999. 19: p. 472-482) proposed to inhibit the proliferation of residual crystalline epithelial cells by suicide gene transfer in vivo associated with the administration of ganciclovir in high doses. The effectiveness of such a strategy was assessed on an experimental model of secondary cataract in rabbits. For this, the residual crystalline cells at the end of the surgical intervention were modified by the gene encoding the thymidine kinase of the Herpes Simplex 1 virus by using as adenovirus which is left in place at the end of the intervention. in the capsular bag. The treated rabbits did not develop a secondary cataract, but a slight corneal toxicity was observed.

The treatment was not fully effective as required for such an intervention. It was observed that a quarter of the animals treated developed a secondary cataract of at least grade III (see Malecaze et al. Human gene therapy, 1999, 2365-2372). In addition, a significant inflammatory reaction was observed.

To date, there is no preventive treatment for PCO. It would therefore be desirable to have an effective preventive treatment for PCO, which does not produce inflammation or toxicity. In particular, it would be desirable to kill the remaining lens cells but without damaging the corneal endothelial cells or adjacent eye structures.

Furthermore, Qin Chen et al., In "Investigative ophthalmology and isual science", December 2000, Vol. 41, No. 13, page 4223 et seq., Constructed human factor E2F1 and E2F cDNAs linked to the crystalline αA- promoter which it inserted into mouse embryos to create transgenic mice and thus study the mechanism of action apoptotic of these factors. The authors also wanted to check whether the factors E2F1 and E2F were capable of directly inducing apoptosis. Indeed, there was no consensus in the scientific world about E2F factors capable or not of inducing apc_> se. However, the applicants had the idea of using a gene construct comprising a nucleic acid sequence coding for an inducer of death of the crystalline cells, under a transcriptional control specific for the cells of the lens, to administer it as a medicament to humans. to treat secondary cataracts. This is why the present application relates to a nucleic acid molecule (gene, cDNA or RNA) comprising a sequence encoding an inducer of death of the crystalline cells, under a specific transcriptional control of the cells of the crystalline lens or a vector comprising such a nucleic acid molecule, for use in a method of therapeutic treatment of the human or animal body, that is to say as a medicament. This therapeutic approach constitutes the invention.

The sequence (of gene, cDNA or RNA) coding for the inducer of death of the crystalline cells could code for example a protein capable of inducing the death of the crystalline cells by necrosis (gene coding for the granzyme for example) or a protein toxic to lens cells, and preferably code for a protein involved in the regulation of apoptosis. The nucleic acid sequence encoding an apoptosis regulator may correspond, for example, to a tumor suppressor gene such as p53, to a gene encoding FLICE (also called caspase 8), TRAIL or BAX, or to a gene encoding a protein involved in the regulation of apoptosis. The present application particularly relates to a nucleic acid molecule above characterized in that the sequence of said molecule (gene, cDNA or RNA) coding for an inducer of death of the crystalline cells is a sequence coding for an inducer of apoptosis, or encoding a compound involved in the apoptosis process, for its use in a method of therapeutic treatment of the human or animal body, that is to say as a medicament.

By way of example, these sequences can encode all the proteins involved in apoptosis according to different routes, for example the three currently known routes of induction of apoptosis. The first pathway is the pathway initiated by the binding of growth factors, regulated by the proteins of the Bcl-2 family, and which leads either to the release of cytochrome C from the mitochondria activating apaf-1 and activating the cascade of caspases either at activation of the Al F pathway.

The second pathway is the pathway involving cell death membrane receptors such as TNF or fas which, by means of adapter molecules, recruit and activate caspases.

The third pathway is initiated by DNA damage. It seems to be partially regulated by proteins like P53 and ATM.

It is possible in particular to use the nucleic acid molecules whose sequence code p53, BAX, FLICE (also called caspase 8) TRAIL or TRAIL-R.

Under preferential conditions for implementing the invention, BAX and p53 are preferred.

In general, the specific transcriptional control of gene expression in lens cells can be carried out using a promoter of a gene encoding a protein or a biochemical element specific to the lens. The specific transcriptional control of the expression of genes in cells of the lens can be carried out for example by the use of promoters of genes encoding specific proteins of the lens like the family of proteins "Major Intrinsic Protein (MIP) of the lens" (example MP26), or the LEP503 protein, but will preferably be produced using promoters specific to crystalline cells such as the promoters of the different families of α, β, γ or δ crystallines.

Preferably, a nucleic acid molecule is used above, characterized in that the specific transcriptional control of the cells of the lens is carried out by the promoter of the crystalline αA, the promoter of γDcristalline, the promoter of MIP (MP26), the LEP503 promoter or the promoter of a biochemical element specific to lens epithelial cells and especially the promoter of crystalline αA or the promoter of γDcristalline which are very specific of the lens. Under preferential conditions for implementing the invention, the nucleic acid molecule and in particular DNA is carried by a vector.

The vector may for example be a synthetic vector which will carry the nucleic acid molecule according to the invention either in the form of DNA or in the form of RNA, or a viral vector.

As a viral vector, it is possible to use a vector derived either from a virus of the family of retroviruses of the genus oncoviridae (Moloney strain) advantageously used in concentrated viral suspension, or from a virus of the genus lentiviridae. The viral vector can also be derived from the associated adenovirus virus (AAV) or from a virus of the adenovirus family.

It is possible to use the whole of a viral vector or simply a fragment of it insofar as it allows the gene coding for a protein inducing cell death to penetrate into the crystalline cells to be destroyed. The vector used is preferably an episomal vector, therefore not integrating into the genome of its target cells.

The vector is advantageously truncated from its parts inflammatory if it has them and / or any other part which can induce unwanted side effects.

The adenovirus is particularly of serotype 5. Such doubly truncated adenoviruses (E1-E3) are preferred. The vector used is advantageously capable of infecting

100% of the target crystalline cells.

Vectors which are objects of the present invention can for example be prepared as follows:

A plasmid construction of nucleic acids, preferably of DNA, is carried out comprising a nucleic acid sequence encoding an inducer of death of the crystalline cells under a specific transcriptional control of the cells of the crystalline lens in order to obtain the expected nucleic acid molecule that we isolate.

Under preferential conditions for implementing the process described above, a DNA plasmid construction is carried out comprising a sequence coding for an apoptosis-inducing protein (such as p53), under transcriptional control specific to lens cells (by example using a promoter specific to lens cells, in particular the αAcristalline promoter or the γDcristalline promoter), the gene coding for the apoptosis-inducing protein is preferably followed by a polyadenylation sequence.

The DNA molecule described above can then be inserted into a vector such as a vector derived from an adenovirus to obtain the expected vector which is isolated. The adenovirus can be human or not and in particular canine. Indeed, the applicants have shown, by studying human ocular envelopes containing residual epithelial cells after surgical operation of the eye, that these epithelial cells have receptors for both human and canine adenoviruses. They also showed that these receptors were transfectable by these adenoviruses. They have also shown that the aqueous humor does not contain neutralizing factors, for example antibodies, to hinder the binding of adenoviruses to their receptors. By way of illustration, the plasmid DNA obtained above can be linearized and then cotransfected in transcomplementing cells 293, with viral DNA encoding the long arm of the genome of a vector such as an adenovirus (preferably the whole truncated genome of 'an ITR and its E1 and E3 genes). The recombination between these two DNAs in suitable host cells (such as 293 cells) will lead to the generation of viral particles encoding the construction of interest.

The desired vectors, in this case viral particles, can then be selected from the transfected host cells. Viral particle vectors can then be subcloned

(to be purified) then amplified by infection of suitable host cells (for example again 293 cells).

The nucleic acid molecules, in particular DNA and the vectors which are the subject of the present invention have very advantageous pharmacological properties. They are in particular capable of causing the death in particular "natural" of the crystalline cells remaining after the surgical treatment of the cataract, but without damaging the ocular endothelial cells and without unwanted side effects such as inflammation, in particular for the molecules of DNA encoding a molecule involved in the regulation of apoptosis as an inducer of cell death by apoptosis.

In addition, the vectors which are the subject of the present invention allow the development of surgical techniques for restoring the accommodation of presbyopia by lens surgery. These techniques essentially consist in putting in place an accommodative implant which makes it possible to optically correct presbyopia by an anteroposterior displacement of the lens implant or in restoring accommodation by replacing the interior of the lens with a substance allowing deformation of the lens. during the contraction of the ciliary muscle. These two techniques have so far been limited by the loss of elasticity of the capsular bag by fibrosis and the occurrence of a secondary cataract linked to the presence of residual epithelial cells in the capsular bag. The nucleic acid molecules and vectors of the invention are in particular capable of inducing the death of lens cells by necrosis (gene coding for granzyme for example), by toxicity for lens cells, and preferably by apoptosis. These properties are illustrated below in the experimental part. They justify the use of the nucleic acid molecules and the vectors described above as medicaments.

The medicaments according to the present invention find their use for example in the preventive treatment of the appearance of secondary cataract during the surgical intervention of the cataract or in the improvement of certain surgical corrective treatments of vision, such as the treatment presbyopia surgery.

The usual dose, which varies depending on the subject treated, can be, for example, from 10 ⁶ to 10 ¹⁵ viral vectors, in particular from 10 ⁸ to 10 ¹¹ adenovirus vectors according to the invention by injectable route into humans of the vector of the example 1, during or after cataract surgery.

A subject of the invention is also pharmaceutical compositions which contain at least one aforementioned nucleic acid molecule or vector, as active principle, whether or not combined with physical or chemical diffusion devices, such as biomatrices, liposomes, nanoparticles or extended release devices. The diffusion device is advantageously a gel, and preferably the diffusion device comprises hyaluronic acid.

In these compositions, the active ingredient is advantageously present at pharmacologically effective doses; the aforementioned compositions contain in particular an effective dose of at least one active ingredient above.

As medicaments, the vectors can be incorporated into pharmaceutical compositions intended for the parenteral or local route.

These pharmaceutical compositions can be, for example, semi-liquid or liquid and can be presented in the pharmaceutical forms commonly used in human medicine, such as for example the injectable preparations or usable in situ during the surgical intervention, or preparations for local use such as eye drops or ophthalmic gels; they are prepared according to the usual methods. They are in principle sterile insofar as they are intended for injection. The active ingredient (s) can be incorporated therein into excipients usually used in these pharmaceutical compositions, such as aqueous vehicles or not, various wetting agents, dispersants or emulsifiers, preservatives.

Advantageously, a mixture containing at least two nucleic acid molecules (gene, cDNA or RNA) comprising a sequence coding for an inducer of death of crystalline cells is used, under specific transcriptional control of at least two stages of differentiation of cells of the lens or a vector comprising such a nucleic acid molecule. The crystalline epithelial cell and crystalline fiber stages are preferred.

The present invention also relates to a process for the preparation of a composition described above, characterized in that the active ingredient (s) are mixed, according to methods known in themselves, with acceptable excipients, in particular pharmaceutically acceptable.

Whatever the active ingredient used, it can either be left in place in the capsular bag at the end of the surgical intervention, or administered into the eye after the surgical intervention, or released from the lens implant, or released from rings or diffusion devices, degradable or non-degradable, previously covered with the vector, and placed on the periphery of the capsular bag. The subject of the invention is finally the use of a nucleic acid molecule or of a vector above for obtaining a medicament intended for a preventive use of the appearance of secondary cataract during l cataract surgery.

It also relates to a method for the preventive treatment of the appearance of secondary cataracts during surgical intervention intended to correct presbyopia or any other condition, during intraocular lens surgery. It is then administered into the eye, or directly into the capsular bag, a pharmacologically effective dose of the nucleic acid molecule described above.

The preferential conditions for using the nucleic acid molecules and the vectors described above also apply to the other objects of the invention referred to above.

FIG. 1 represents the restriction map of Quantum P53 FIG. 2 represents the restriction map of Quantum BAX FIG. 3 represents the restriction map of Quantum FLICE FIG. 4 represents the restriction map of Quantum βGAL The examples which follow illustrate the present invention.

All restriction enzymes, taq polymerase, enzyme

Kleenow, T4DNA ligase, reverse transcriptase were purchased from the company

Roche (Roche - Boehringer, Meylan, France). The oligonucleotides used for the PCR reactions were purchased from the company GENSET (Genset Oligos, Paris, France).

Example 1: Adenoviral vector comprising the gene coding for p53 and whose expression is specific for Acristalline cells Preparation 1: Plasmid coding for p53 and whose expression is specific for crystalline cells.

Stage A: Preparation of DNA encoding βgalactosidase under the transcriptional control of the Acristalline promoter (pAdFRGAL) A first vector encoding βgalactosidase was synthesized under the dependence of the Acristalline promoter called pAdFRGAL.

PRSVGALIX (Légal Lasalle, Sciences, 1993, 12: 988-990) is subjected to digestion with Xba1 and Avril. The 9128 bp band is purified on agarose electrophoresis gel. We obtain an F1 fragment.

The DNA corresponding to the αAcristalline promoter described by Chepelinsky et al. Is amplified by PCR. in Mol. Cell Biol. 1987. The PCR is carried out using the primers: αA366 5 'GCTCTAGATATCAGATTCTCTGGAGGTTTCGG 3' and αA366 rev 5 'TTCGAAGGATCCCCGAAGGCTGGCAGTGAGTC 3' from Genset and determined from the sequence published by Chepelinsky et al. (Mol. Cell Biol. 1987).

We obtain a cDNA of 433 bpd. This DNA is digested by Xba1 and Avril. We obtain an F2 fragment.

The F1 and F2 fragments are ligated at 4 ° C for 16 hours in the presence of T4DNA ligase.

DH5α bacteria are then transformed with the ligation product. The plasmid vector pAdFRGAL of 9561 bp is obtained.

Stage B: Preparation of DNA coding for the p53 gene

First of all, a first vector coding for p53 was synthesized under the dependence of the αAcristalline promoter called pAdFRp53. Then from the genetic elements of this vector, we built the vector Quantump53.

1st step: Synthesis of the vector called pAdFRp53 encoding the p53 gene The vector pCDNA3p53 derived from the vector pCITEP53 published by Hegi et al., Cancer Res., 2000, 60: 3019-3024 is subjected to digestion with Xbalet BamHI. The 1160 bp band is purified on agarose electrophoresis gel. We obtain an F3 fragment.

2nd step: Construction of the vector pAdFRp53

PAdFRGAL obtained in Stage A above is subjected to digestion with Avril and Bel. The band of 8091 bpd is purified on agarose electrophoresis gel. We obtain an F4 fragment.

The F3 and F4 fragments are ligated at 4 ° C for 16 hours in the presence of T4DNA ligase.

DH5α bacteria are then transformed with the ligation product. The plasmid vector pAdFRp53 of 9301 bp is obtained. Stage C: QuantumP53 Plasmid

The plasmid vector pAdFRp53 is digested with Kpn1 and EcoRV. The 3544 bp band is purified by electrophoresis and geneclean gel. We obtain an F5 fragment. We submit the Adenoquest vector, pQBI-AdBN Quantum-

Biotechnologies (France) to digestion with EcoRV and Kpn1. We obtain an F6 fragment.

The fragments F5 and F6 are ligated for 3 hours at 20 ° C, then for 16 hours at 4 ° C in the presence of T4DNA ligase. DH5α bacteria are then transformed with the ligation product.

The plasmid vector QuantumP53 of 8994 bp is obtained.

In this example, the DNA was extracted and purified by using the maxiprep kit marketed by QUIAGEN (France). The concentration of DNA obtained was determined by measuring the OD of the plasmid solution. A restriction map has been produced.

The junction sequences with the Quantum vector and the entire sequence of the promoter and of the gene coding for p53 were verified by sequencing.

Preparation 2: Quantump53 adenoviral vector

The DNA coding for the p53 gene is incorporated under the transcriptional control of the αAcristalline promoter, into the chosen adenoviral vector.

Stage A: Preparation of DNA molecules.

10 μg of QuantumP53 DNA molecules prepared in Stage C above are linearized by digestion with the restriction enzyme Asp700. After digestion, the plasmid DNA is purified by two extractions with phenol chloroform and precipitation with ethanol.

The viral particles are obtained by co-transfection of QBI293A cells (75,000 cells, seeded the day before, per diameter petri dish 6) using 5 μg of Quantump53 and 10 μg of QBl viral DNA (Adenovirus type 5, AdCMVLacZΔEI ΔE3) marketed by Quantum-Appligène), by the calcium phosphate method with the products marketed by Quantum -Appligène. QBI293A cells are transcomplementing human embryonic kidney cells synthesizing E1A and E1B marketed by Quantum-Appligène (Q. Biogène, Illkirch, France). They are cultivated in Eagle medium modified according to Dulbecco (DMEM) supplemented with 2 mM glutamine and 10% fetal calf serum (SVF). They are kept in culture for 3 to 4 months maximum

24 hours after transfection, the cells are treated with trypsin and seeded in 6 wells 3.5 cm in diameter. 5 hours later, the cells are covered with culture medium containing 1.25% agarose.

1 ml of Eagle medium modified according to Dulbecco (DMEM) Seaplaque is added to the cell cultures every 5 days.

Lysis ranges appear between 10 and 21 days after transfection.

Stage B: Constitution of the viral stock: The plaques are recovered like agarose carrots and are eluted for 24 hours in 0.5 ml of 5% DMEM. These viral suspensions undergo 4 cycles of freezing - thawing at -80 ° C / + 37 ° C.

Then infected with 200 μl of viral solution, wells of 24-well dishes (2 wells / range) containing 293A cells at 60% confluence (10,000 cells / well) in 0.8 ml of DMEM, 5% FCS. A minimum of 20 lysis ranges are tested per construction.

The content of the wells is taken when all the cells have shown a complete cytopathic effect (CPE). These viral suspensions undergo 4 freeze-thaw cycles at -80 ° C / + 37 ° C.

Stage C: Selection of the Quantump53 clones

Each clone was tested for the expression of the gene inserted into the vector.

The wild-type vector with which the recombination is carried carries the βgalactosidase gene under the control of the RSV promoter.

Quantum p53 viruses are identified with respect to wild-type RSV βgal vectors by an βgalactosidase expression test. Crystalline cells are infected using the different viral suspensions corresponding to the different viral clones. 48 hours later, the infected cells are tested for βgalactosidase activity. The cells are washed twice with phosphate buffer (PBS) and then fixed for 5 min with a 1% formaldehyde, 0.1% glutaraldehyde in PBS solution. After two washes with PBS, they are stained with a solution of Xgal (5 bromo-4-chloro-3-indolyl-β-D-galactoside sold by Sigma Chemical, Saint Quentin Failavier, France).

Using a phase contrast microscope, at 20 magnification, cell fields are evaluated. The presence of cells expressing βgalactosidase is evaluated relative to the total number of cells. If the cells express βgalactosidase, it is because they are infected with the non-recombinant virus. These clones of viral particles are eliminated. The other clones of viral particles are used for the infection of lens cells.

The infected cells are lysed 24 hours after infection and a western blot is carried out on the protein extracts originating from the infected cells using an anti-p53 antibody (Pharmingen, France).

The viral suspensions selected as those corresponding to the construction of interest are tested by an analysis of the viral DNA. A 10 cm diameter dish at 60% confluence of crystalline cells is infected with 200 μl of viral suspension obtained from the viral particles selected after western blotting. The viral DNA of the infected cells is extracted and then purified by extraction with phenol / chloroform and precipitation with ethanol.

The viral DNA pellet is taken up in 100 μl of water containing 20 μg of Rnase. Then restriction mapping and polymerase chain reaction (PCR) analysis are performed.

The viral particles constituting the selected clone are subcloned by 3 successive cloning in lysis ranges. The expected Quantump53 vector adenovirus particles are obtained.

Example 2 Adenoviral Vector Comprising the Gene Encoding BAX

A plasmid comprising the crystalline αA promoter and a polyadenylation sequence was prepared, which was used to insert various genes inducing cell death therein.

Stage A: Plasmid comprising a polyadenylation sequence

We digest an Adenoquest vector, pQBI-AdBN marketed by the company Quantum-Biotechnologies (France) by Bglll and Xhol (fragment 7).

A PUT EMCV ZEO vector (Douin et al. Cancer Gene Ther., 2000, 12: 1545-1553) is digested with the enzymes SaM and Bglll. The 141 bp band (fragment 8) is purified on agarose gel electrophoresis.

Fragments 7 and 8 are ligated at 4 ° C for 16 hours in the presence of T4DNA ligase.

DH5α bacteria are transformed with the ligation product. The Quantum PoiyA plasmid vector of 5591 bp is obtained. Quantum poly A is digested with EcoRV and HindIII (fragment 9).

Stage B:

DNA corresponding to the acrystalline promoter is amplified by PCR. The PCR is carried out using the DNA 366alphaApromoter CAT previously described, using the primers aA366 5 'GCTCTAGATATCAGATTCTCTGGAGGTTTCGG 3' and aA366 rev 5 'TTCGAAGGATCCCCGAAGGCTGGCAGTGAGTC 3' of the company Genset and determined from the sequence published by Chep and alp. (Mol. Cell Biol. 1987). We obtain a cDNA of 433 bpd. This DNA is digested with EcoRV and HindIII (fragment 10).

Fragments 9 and 10 are ligated for 3 hours at 20 ° C. and then for 16 hours at 4 ° C. in the presence of T4DNA ligase.

DH5α bacteria are transformed with the ligation product. We obtain the plasmid vector Quantum αA366 - PolyA of 6024 bpd.

Stage C: Preparation of the adenovirus vector encoding BAX

The vector of 6024 bpd of stage B is digested with HindIII and treated with alkaline phosphatase (fragment 11). The human cDNA corresponding to BAX is amplified by PCR from the vector published by Oltvai et al. (Cell, 1993, 74: 609-619) with the primers 5 'CCCAAGCTTATGGACGGGTCCGGGGAGCAGC 3' and 5 'CCCAAGCTTCAGCCCATCTTCTTCCAG 3'. A 590 bp fragment is obtained which is digested with HindIII (fragment 12). Fragments 11 and 12 are ligated at 4 ° C for 16 hours in the presence of T4DNA ligase.

DH5α bacteria are transformed with the ligation product. A Quantum αA366 BAX plasmid vector of 6604 bp is obtained.

In this example, the DNA was extracted and purified by using the maxiprep kit marketed by QUIAGEN (France).

The DNA concentration obtained was determined by measuring the OD of the plasmid solution. A restriction map has been produced.

The viral particles corresponding to this Quantum αA366 BAX construction are obtained as indicated in stages A, B and C of preparation 2 of Example 1.

Example 3 Adenoviral Vector Comprising the Gene Encoding FLICE

The vector of Quantum αA366 - PolyA of 6024 bpd example 2 is digested with Hindlll and treated with alkaline phosphatase (fragment 13). The human cDNA corresponding to FLICE is amplified by PCR from the sequence published in J. Mol. Biol, 1997, 272, 17255-17257, by Hu et al, with primers 5 'CCCAAGCTTGGATCCATGGACTTCAGCAG 3' and

5 'CCCAAGCTTCCTCAATCAGAAGGGAAGAC 3'

A 1439 bp fragment is obtained which is digested with HindIII (fragment 14). Fragments 13 and 14 are ligated at 4 ° C for 16 hours in the presence of T4DNA ligase.

DH5α bacteria are transformed with the ligation product. We obtain the plasmid vector Quantum αA366 FLICE of 7463 bpd.

The viral particles Quantum αA366 FLICE are obtained, corresponding to this construction as indicated in stages A, B and C of preparation 2 of Example 1.

EXAMPLE 4 Injectable Ophthalmic Preparations

Injectable ampoules corresponding to the formula Adenovirus p53 of Example 1 were prepared. 3.10 ⁹ Formant units Excipient range: saline buffer for injectable preparations qs for an ampoule terminated at 200 μl.

EXAMPLE 5 Injectable Ophthalmic Preparations

Ampoules corresponding to the formula Adenovirus p53 of Example 1 were prepared lyophilized 3.10 ⁹ Beach-forming Units

Ampoule of excipient: Saline buffer for injections 200 μl.

EXAMPLE 5 Injectable Ophthalmic Preparations

Ampoule of excipient: Saline buffer for injections 200 μl Hyaluronic acid 200 μl.

PHARMACOLOGICAL STUDY

Preparation of rabbits: Phacoemulsification Prior to the phacoemulsification operation, the rabbits are treated with anti-inflammatory eye drops of 0.1% diclofenac and dexamethasone. These two types of eye drops are administered in the hours before surgery.

Mydriatic eye drops (1% atropine, 2.5% phenylephrine hydrochloride and 1% tropicamide) are administered 3 times in the hour before surgery. Rabbits are anesthetized using ketamine (60 mg / kg intramuscularly).

Surgery begins with a 3 mm corneal incision. A viscous product (Viscoat ^® ) is then injected into the anterior chamber. A 4mm capsulorhexis is then produced and after hydrodissection, phacoemulsification is carried out using a saline solution (BSS) containing heparin (100 IU / ml) as infusion liquid. The residual peripheral masses are cleaned using an irrigation-suction handpiece. The corneal incision is then sutured. After the operation, anti-inflammatory eye drops (diclofenac and

Chibrocadron) and mydriatic eye drops (Neosynephrine and Mydriaticum) are administered 4 times / day.

Experiment 1: Preventive effect on the secondary cataract of the administration of the vector QuantumP53 prepared in Example 1 in the rabbit At the end of the phacoemulsification and after suturing of the corneal incision, 100 μl of the viral suspension tested (5 10 ⁹ viruses / ml) are injected into the anterior chamber opposite the capsular bag through the incision using a needle (30 gauje).

The evaluation of the secondary cataract after the intervention is carried out in double blind by two examiners. These exams are done two days after surgery and then weekly during the first month after surgery.

Capsular clouding is evaluated after pupillary dilation using a biomicroscopic slit lamp and an operating microscope. The area of the opacified surface was considered using capsular opacification scores according to the Odrich method.

The scale of scores varies from 0 to 4,

0: no clouding,

1: clouding of less than one dial, 2: less than two dials,

3: less than three dials,

4: opacification for the 4 dials with or without central opacification.

Results The 5 rabbits which received at the end of phacoemulsification a control adenovirus without gene inducing cell death developed a secondary cataract of score 4 in one month.

On the other hand, the 6 operated rabbits having received at the end of phacoemulsification the adenovirus QuantumP53 did not develop a secondary cataract.

In order to demonstrate the tolerance of the treatment, the degree of post-operative inflammation was assessed clinically using a slit lamp by studying the fibrinous reaction, the tyndall of aqueous humor. A biomicroscopic examination of the cornea was also performed. No eye inflammation, damage to adjacent structures, or corneal toxicity was detected in the 6 rabbits treated with adenovirus

QuantumP53.

Experiment 2: Specificity for lens cells after infection of rabbit cells in vitro

Preparation A: Construction of the QuantumβGAL vector

The plasmid vector pAdFRGAL prepared in stage A of the Preparation 1 of Example 1 is linearized by digestion with Kpn1 then a partial digestion with EcoRV is carried out. The 3804 bp strip is purified by electrophoresis and geneclean gel. An F15 fragment is obtained.

The Adenoquest vector, pQBI-AdBN Quantum-Biotechnologies (France) is subjected to digestion with EcoRV and Kpnl. An F16 fragment is obtained.

The F15 and F16 fragments are ligated for 3 hours at 20 ° C, then for 16 hours at 4 ° C in the presence of T4DNA ligase.

DH5α bacteria are then transformed with the ligation product.

QuantumβGAL viral particles are obtained which are tested in experiments 2, 3, and 4.

Preparation B: Cell cultures: Rabbit lens cells are cultured in medium

Hamster formula 12 (HAM / F12) supplemented with 20% of SVF (Life technologies, Inc. Cergy Pontoise, France) and 10 mg / ml of glutamine, 50 μg / ml of gentamycin and 25 μg / ml of amphotericin (Sigma Chemical , Saint Quentin Fallavier, France). The cells from biopsies are passed to 1/3 and are only kept in culture for a maximum of two months (10 passages).

Different cell lines including human pigment epithelium cells, human fibroblasts of different origins and human tumor cells were cultivated in these same culture media. The crystalline epithelial cells prepared above and the cells of the different lines are seeded at the density of 10 ⁵ cells / dish 6 cm in diameter the day before infection.

The cells are then infected with 10 ⁸ viral particles (100 μl), either of pRSVGALIX control virus or of QuantumβGAL viral vector obtained according to the mode of preparation presented above, in 2 ml of culture medium without SVF.

The viral infection control adenovirus is the vector pRSVGALIX (Legal Lasalle, Sciences, 1993, 12 (259): 988-990) because it allows expression of βgalactosidase constitutively whatever the origin of the infected cell. Indeed, the cDNA coding for βgalactosidase is under the transcriptional control of the promoter of the Roux sarcoma virus (RSV).

The cells are incubated for 1 hour with shaking at 37 ° C., then 3 ml of 10% FCS medium are added.

48 hours later, the cells are tested for βgalactosidase activity. The cells are washed twice with PBS and then fixed for 5 min with a 1% formaldehyde, 0.1% glutaraldehyde in PBS solution. After two washes with PBS they are stained with a solution of Xgal (5 bromo-4-chloro-3-indolyl-β-D-galactoside) (Sigma Chemical, Saint Quentin Fallavier, France).

Using a phase contrast microscope, the percentage of cells that express βgalactosidase is counted relative to the total number of cells.

Results:

100% of the infected lens cells express βgalactosidase after being infected with the pRSVGALIX control virus. 100% of the crystalline cells express βgalactosidase after infection with the vector QuantumβGAL. No cell other than the lens cells expresses betagalactosidase after infection by Quantumβgal. The QuantumβGAL construction is therefore specific for lens cells.

Experiment 3: Specificity for lens cells after infection of human cells in vitro Human corneas from organoculture and capsules obtained from human capsulorhexis were placed in culture dishes containing 500 μl of HAM / F12 medium 20% SVF . The suspensions viral, either RSVβgal control virus or QuantumβGAL viral vector (100 μl) were deposited as appropriate in the concavity of the corneas and on the surface of the capsules for 4 hours. The corneas and the capsules are then replaced in their original containers and immersed in the HAMF12 20% FCS culture medium.

These samples are tested for the expression of βgalactosidase 48 hours later and according to the methodology described above.

100% of infected crystalline or corneal cells express βgalactosidase after being infected with the pRSVGALIX control virus.

Cornea cells (organoculture) do not express βgalactosidase after being infected with QuantumβGAL. 100% of the crystalline cells (capsulorhexis cells) express βgalactosidase after infection with the vector QuantumβGAL.

Experiment 4: Specificity for lens cells after infection of rabbit cells in vivo

At the end of phacoemulsification and after suturing of the corneal incision, an intraocular injection of a pRSVGALIX or

QuantumβGAL is made through the incision. Two days after surgery, the eyeballs are dissected using an operating microscope and stained with X-GAL to detect βgalactosidase activity.

100% of infected crystalline or corneal cells express βgalactosidase after being infected with the pRSVGALIX control virus. Corneal cells do not express βgalactosidase after being infected with QuantumβGAL. 100% of the crystalline cells express βgalactosidase after infection with the vector QuantumβGAL. Neuroretin does not express βgalactosidase.

Claims

1. A nucleic acid molecule (gene, cDNA or RNA) comprising a sequence encoding an inducer of death of the crystalline cells, under a specific transcriptional control of the cells of the crystalline lens or a vector comprising such a molecule of nucleic acids, for its use in a method of therapeutic treatment of the human or animal body.

2. A nucleic acid molecule according to claim 1 characterized in that it codes for an inducer of death of the crystalline cells chosen from the proteins inducing cell death and the proteins involved in the induction of this cell death or a vector according to claim 1 comprising such a nucleic acid molecule.

3. A nucleic acid molecule according to claim 1 characterized in that the sequence of said molecule encoding an inducer of death of the crystalline cells is a sequence encoding an apoptosis inducer, or encoding a compound involved in the process of apoptosis or a vector according to claim 1 comprising such a nucleic acid molecule.

4. A nucleic acid molecule according to one of claims

1 to 3 characterized in that the nucleic acid molecule encoding an inducer of death of the crystalline cells is chosen from the sequences encoding p53, BAX, FLICE (also called caspase 8) TRAIL and TRAIL-R or a vector according to claim 1 comprising such a nucleic acid molecule.

5. A nucleic acid molecule according to one of claims 1 to 4 characterized in that the specific transcriptional control of the cells of the lens is carried out using a promoter of a gene encoding a protein or a biochemical element specific for the lens or a vector according to claim 1 comprising such a nucleic acid molecule.

6. A nucleic acid molecule according to one of claims 1 to 5 characterized in that the specific transcriptional control of the cells of the lens is carried out by the promoter of crystalline αA, the promoter of γDcristalline, the promoter of MIP (MP26), the promoter of LEP503 or the promoter of a biochemical element specific to the epithelial cells of the lens or a vector according to the claim 1 comprising such a nucleic acid molecule.

7. A vector according to one of claims 1 to 6 characterized in that said vector is of the genus adenovirus.

8. A vector according to one of claims 1 to 7 characterized in that said vector is deleted from its inflammatory parts if it has any, or from any part which can induce unwanted side effects.

9. Method for preparing a vector as defined in one of claims 1 to 8, characterized in that a nucleic acid molecule as defined in one of claims 1 to 6 is inserted into a vector such as an adenovirus to obtain the expected vector which is isolated.

10. A pharmaceutical composition characterized in that it contains, as active principle, at least one of the compounds (nucleic acid molecule or vector) as defined in one of claims 1 to 8, as well as a pharmaceutically acceptable excipient.

11. A pharmaceutical composition according to claim 10, characterized in that a nucleic acid or vector molecule is used, as defined in one of claims 1 to 8, associated with a diffusion device.

12. A pharmaceutical composition according to claim 11, characterized in that the diffusion device is a gel.

13. A pharmaceutical composition according to claim 10, characterized in that the diffusion device comprises hyaluronic acid.

14. Use of a nucleic acid molecule or of a vector as defined in one of claims 1 to 8, for obtaining a medicament intended for a preventive use of the occurrence of secondary cataracts during cataract surgery.