CN109535232A - Polypeptide, preparation method and the purposes for inhibiting AIDS virus - Google Patents

Polypeptide, preparation method and the purposes for inhibiting AIDS virus Download PDF

Info

Publication number
CN109535232A
CN109535232A CN201811472964.0A CN201811472964A CN109535232A CN 109535232 A CN109535232 A CN 109535232A CN 201811472964 A CN201811472964 A CN 201811472964A CN 109535232 A CN109535232 A CN 109535232A
Authority
CN
China
Prior art keywords
amino acid
hiv
polypeptide
seq
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811472964.0A
Other languages
Chinese (zh)
Other versions
CN109535232B (en
Inventor
陆路
姜世勃
王茜
苏珊
杨霞
Original Assignee
Shanxi Jin Bo Biomedics Inc
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi Jin Bo Biomedics Inc, Fudan University filed Critical Shanxi Jin Bo Biomedics Inc
Priority to CN201811472964.0A priority Critical patent/CN109535232B/en
Publication of CN109535232A publication Critical patent/CN109535232A/en
Application granted granted Critical
Publication of CN109535232B publication Critical patent/CN109535232B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention provides polypeptide, preparation method and the purposes for inhibiting AIDS virus.Polypeptide includes the amino acid sequence according to shown in X-W/A-E/A-A/E-L/A-X-Y/A-L/A-W/A-N/A-L/A-L/A-Q/A-Y/A-W/A.Additionally provide nucleic acid, the carrier comprising the nucleic acid, host, preparation or the application method and purposes of coding polypeptide.Additionally provide fusion protein, pharmaceutical composition or conjugate comprising polypeptide.

Description

Polypeptide, preparation method and the purposes for inhibiting AIDS virus
Technical field
The invention belongs to biomedicine fields, and in particular to the therapeutic agent for inactivating AIDS virus.
Background technique
It is shown according to the data that The Joint Programme on AIDS (UNAIDS) is provided, from last century since the eighties is found, Human immunodeficiency virus (HIV), which has had resulted in, to be added up to be infected more than seven million peoples and more than the death of three million peoples, show Still there is about 2,000,000 new infections case to occur every year.Due to up to the present still without healing drug and vaccine face Generation, so AIDS is still the significant threat of mankind's field of public health.The effectively concern of the treatment always area research Hot spot.The disease incidence for going out to have made HIV infection person's generation AIDS of Highly active antiretroviral therapy (HAART) and death It is greatly lowered, but the drug of clinical use the disadvantages of that all there is also toxic side effects is strong, easy induced mbc Strain now.And And they can not remove the latent library HIV and treatment of AIDS, need to use all the life, once the intracorporal disease of drug withdrawal AIDS patient Malicious carrying capacity will quickly rebound.Therefore, research and development target HIV novel targets and can remove HIV latent cells library to treatment of AIDS Newtype drug become hot spot and the forward position of global research field.
Polypeptide proposed by the present invention from intracellular section of HIV envelope protein gp41 subunit, targeting gp41 are more conservative Intracellular section, be a completely new inhibition HIV target spot.Meanwhile pervious AIDS-treating medicine acts on HIV infection target cell In the process, free inhibition of HIV cannot be targeted.Polypeptide proposed by the present invention can directly inactivate HIV free virus, for HIV's Prevention.More importantly currently proposed protide inactivator and wide spectrum neutralizing antibody can only neutralize HIV, can not still kill The cell for HIV infection of going out, the especially cell of HIV latent infection, therefore the latent library HIV and treatment of AIDS can not be removed.This It invents and proposes that one kind has inactivation inhibition of HIV particle and killing HIV infection cell (the HIV latent cells being especially activated) double The novel polypeptide class inactivator of function, with HIV hide activator combination when, be hopeful through current international hot spot strategy- " Shock and Kill " achievees the purpose that remove the latent library treatment of AIDS of HIV.
Summary of the invention
The present invention provides the following contents:
The present invention provides polypeptide and its derivatives, stereoisomer or its salt, specifically bind HIV envelope protein Intracellular section, preferably comprising with the lentivirus lytic peptide -1LLP1 of amino acid sequence shown in SEQ ID NO:28 (lentiviral lytic peptides-1) structural domain.Polypeptide destroys lipid bilayer, preferably inhibition of HIV particle packet Film and host cell membrane by HIV infection, and cause the HIV of inhibition of HIV particle, HIV infection cell and activation latent The cracking of cell.Refer to that polypeptide includes its derivative, stereoisomer or its salt.
In one embodiment, polypeptide includes the amino acid sequence according to shown in following general formula:
X-W/A-E/A-A/E-L/A-X-Y/A-L/A-W/A-N/A-L/A-L/A-Q/A-Y/A-W/A。
In one embodiment, polypeptide includes with amino acid sequence shown in SEQ ID NO:1: X-W-E-A-L-X-Y- L-W-N-L-L-Q-Y-W (formula 1)；
Wherein X indicates any amino acid, preferably G or A or has the amino acid residue of similar characteristic with them；Symbol "-" indicates that the peptide bond between amino acid residue, amino acid shown in the expression of symbol "/" can be used interchangeably；
Preferably, polypeptide includes with amino acid sequence shown in SEQ ID NO:2: GWEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:3: AWEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:4: GAEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:5: GWAALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:6: GWEELKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:7: GWEAAKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:8: GWEALAYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:9: GWEALKALWNLLQYW；
With amino acid sequence shown in SEQ ID NO:10: GWEALKYAWNLLQYW；
With amino acid sequence shown in SEQ ID NO:11: GWEALKYLANLLQYW；
With amino acid sequence shown in SEQ ID NO:12: GWEALKYLWALLQYW；
With amino acid sequence shown in SEQ ID NO:13: GWEALKYLWNALQYW；
With amino acid sequence shown in SEQ ID NO:14: GWEALKYLWNLAQYW；
With amino acid sequence shown in SEQ ID NO:15: GWEALKYLWNLLAYW；
With amino acid sequence shown in SEQ ID NO:16: GWEALKYLWNLLQAW；
With amino acid sequence shown in SEQ ID NO:17: GWEALKYLWNLLQYA.
Preferably, the polypeptide include (1) with amino acid sequence shown in any in SEQ ID NO:1-17 at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 93%, 94%, 95% identical amino acid sequence or (2) are with SEQ In ID NO:1-17 it is any shown in replace in amino acid sequence, add, lack or be inserted into one or more, preferably 2,3,4 or The amino acid sequence of 5 amino acid residues, it is described that preferably conserved amino acid is replaced to replace.
Sequence skeleton belongs to Qi Bao positioned at the position 789-803 of its envelope protein from HIV-1group M envelope protein LLP3 (lentiviral lytic peptides-3, aa 789-815) structural domain in film.In the present invention, polypeptide F9170 packet Containing 1 skeleton of formula, have the function of inactivation of viruses and infection cell.
In one embodiment, derivative is selected from: through the amine-modified obtained derivative of maleimide；Connect in amino terminal Connect the derivative that aminoterminal protecting group and/or carboxyl terminal connection c-terminus protecting group obtain；It is repaired through protein or polyethylene glycol Adorn obtained derivative；In the derivative that amino terminal and/or carboxyl terminal connection oligopeptides or lipophilic group or cholesterol obtain Object；Or be the amino acid of D- type with conformation, after rare amino acid existing for manually modified amino acid and nature replaces The derivative of acquisition is to improve the bioavilability, stability and/or antiviral activity of polypeptide.
In one embodiment, aminoterminal protecting group is acetyl group, amino, maleoyl, succinyl group, tertiary butyloxycarbonyl Base or benzyl or other hydrophobic groupings, the c-terminus protecting group be NH2, carboxyl, amide groups, tertbutyloxycarbonyl or other dredge Aqueous group.
In one embodiment, oligopeptides includes 2-10 amino acid, and the lipophilic group is former containing 3-20 carbon The fatty acid chain of son.
On the other hand, the present invention provides fusion protein, pharmaceutical composition or conjugates.The fusion protein may include The derivative of polypeptide according to the present invention or the polypeptide, stereoisomer or salt and for treating or preventing the another of HIV infection A kind of protein, or it is directed to intracellular section of HIV envelope protein, it preferably includes with amino acid sequence shown in SEQ ID NO:28 The antibody of lentivirus lytic peptide -1LLP1 structural domain.Pharmaceutical composition may include polypeptide according to the present invention or the polypeptide The one or more HIV therapy agent listed in derivative, stereoisomer or salt and table 2 or HIV latent cells activator.Conjugation Object may include polypeptide and carrier protein according to the present invention.Carrier protein can be selected from seralbumin, immunoglobulin, iron Albumen, transferrins, α -2- macroglobulin, Thyroxine binding protein and steroid binding protein.
In one embodiment, fusion protein or conjugate specifically bind intracellular section of HIV envelope protein, preferably wrap Containing with the lentivirus lytic peptide -1LLP1 structural domain of amino acid sequence shown in SEQ ID NO:28, and preferred destroy double points of lipid Sublayer, preferably inhibition of HIV particle envelope and the host cell membrane by HIV infection, and cause inhibition of HIV particle, HIV sense Contaminate the cracking of the HIV latent cells of cell and activation.
On the other hand, the present invention provides nucleotide sequence, spreading out for polypeptide according to the present invention or the polypeptide is encoded Biology, stereoisomer or salt or fusion protein.
On the other hand, the present invention provides carriers, and it includes nucleotide sequences according to the present invention.
On the other hand, the present invention provides host cells, and it includes support according to the present invention.
On the other hand, the present invention provides the methods for generating polypeptide or fusion protein according to the present invention comprising:
(1) support according to the present invention is imported in host cell；
(2) host cell is cultivated in suitable culture medium；And
(3) it harvests and separates polypeptide or fusion protein according to the present invention；Or
Chemically synthesize polypeptide or fusion protein according to the present invention.
On the other hand, the present invention provides polypeptide, fusion protein, pharmaceutical composition or conjugate, nucleotide, carrier, places The purposes of chief cell and optional another polypeptide in medicine preparation, the drug is for treating or preventing and/or assisting to control HIV infection associated diseases, such as AIDS are treated, wherein the another kind polypeptide is the one or more HIV therapies listed in table 2 Agent.
On the other hand, the present invention provides polypeptide, fusion protein, pharmaceutical composition or conjugate, nucleotide, carrier, places Chief cell and optional another reagent are used for any one of following purposes in vitro:
(1) inhibit HIV infection；
(2) HIV is cracked；
(3) cell of HIV infection is cracked；
(4) the HIV latent cells of cracking activation,
(5) preparation has the external inhibition active biological agent of HIV infection,
Wherein another reagent is the one or more HIV therapy agent listed in table 2.
In the present invention, the dosage form of drug be tablet, capsule, dripping pill, aerosol, pill, pulvis, solution, suspension, Emulsion, granule, liposome, transdermal agent, buccal tablet, suppository, freeze drying powder injection.In one embodiment, drug by with Under type administration: drug administration by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intraperitoneal injection, intracisternal injection or implantation Deng；Cavity/canal drug administration, such as per rectum, vagina and sublingual；Respiratory tract administration, such as via intranasal application；Mucosa delivery；Surface administration.At one In embodiment, drug is used as HIV prophylactic.
Polypeptide F9170 of the invention has the advantage that compared to pervious HIV drug
1) present invention targeting from intracellular section of LLP1 of HIV envelope protein (lentiviral lytic peptides-1, Aa 828-856) structural domain 835-849 amino acids residue, be the inhibition HIV novel targets never having been reported that. HIV envelope protein Intracellular domain is highly conserved, and the drug for targeting the target spot will have many advantages, such as wide spectrum and be not likely to produce persister.
2) present invention energy specifically inactivating HIV free virus, without inhibiting the virus containing other envelope proteins.Present HIV drug act on HIV in conjunction with target cell after process, and the present invention can directly contribute the cracking of HIV free virus, The release of virus genome RNA is the raw material for being preferably transformed into microbicide.Microbicide energy topical application is used In the prevention of HIV, it can overcome the disadvantages that there are currently no the defects of effective HIV vaccine.
3) present invention can cause the cell cracking of expression HIV envelope protein.After HIV infection target cell, host cell is utilized Self structure and non-structural protein are synthesized, releases cell finally by the form of budding, other cells is infected, is passed in enlarged body It broadcasts.So also expressing the envelope protein of HIV on HIV infection cell envelope.The present invention equally passes through to be caused in conjunction with LLP1 structural domain The cracking of infected cell.Double action of the present invention for inhibition of HIV and HIV infection cell, is conducive to the clear of internal HIV It removes.
4) present invention can cause by hidden activator activate HIV latent cells cracking.The weight that HIV can not be cured Wanting factor is exactly the latent infection of HIV.In order to remove HIV latent cells to treatment of AIDS, just focus in the world at present Study " Shock and Kill " strategy.The core of the strategy be by HIV latent cells activator and HIV Drug combination, First with HIV latent cells activator turn on life cycle generate new virus then again with existing AIDS drug (such as HAART) inhibit the infection of new life HIV.But in-depth study is found, the latent cells of " Shock " activation will not voluntarily quickly Death, still can long-term existence in vivo, and the AIDS-treating medicines such as HAART can not also dispose these latent cells.In order to solve This problem, main strategy is desirable to be induced by therapeutic type vaccine for the latent cells being activated in the world at present Specific cytotoxic T lymphocyte (CTL) is removed, but since the immune system of AIDS patient itself is by larger Destruction, in its Immune inducing in vivo, largely efficient specific cytotoxic T lymphocyte is extremely difficult.Also, CTL is formed The inhibition of HIV genome of immunologic escape is the main body of the HIV genome in AIDS patient's body contained by HIV latent cells.And The present invention targets the conserved sequence of HIV, and can effectively crack the HIV latent cells of activation, will be " Shock and Kill " plan The advantageous candidate of slightly required composition of medicine.
It 5), can be by blood-brain barrier, into the brain of mouse after polypeptide of the present invention enters in vivo.HIV cannot be by thoroughly clear Another major reason removed is exactly that HIV can enter the region that the immunocytes such as brain are hard to reach.Polypeptide of the present invention can enter greatly Brain, Direct Pyrolysis HIV free virus and HIV infection cell, are conducive to thoroughly removing for patient's body HIV.
6) polypeptide proposed by the invention does not show toxicity for mouse, and can be uniformly distributed in Mice Body, does not have There is the aggregation shown in certain organ or system, is conducive to its inhibition of HIV for removing each system.
7) HIV fusion inhibitor equally targets HIV envelope protein gp41 subunit, and the present invention is for fusion inhibitor resistance Strain still has inhibition and inactivating efficacy.
8) the currently the only HIV polypeptide fusion inhibitor-by U.S. Food and Drug Administration (FDA) approval listing T20 (SEQ ID NO:18) sequence includes 36 amino acid residues, and the present invention only includes 15 amino acid residues, is beneficial to Reduce pharmaceutical synthesis cost.
The present invention is further research and development treating AIDS is cured and prophylactic agent provides thinking.In order to more clearly illustrate The present invention is illustrated below in conjunction with specific legend and embodiment.
Detailed description of the invention
Fig. 1 a-c: each structural domain on F9170 and HIV envelope protein is detected by enzyme-linked immunosorbent assay (ELISA) Combination.Gp120 (SEQ ID NO:19): HIV envelope protein gp120 subunit；Gp140 (SEQ ID NO:20): HIV coating Albumen removes the part for wearing spanning domain and sequence intracellular；N63 (SEQ ID NO:21): on HIV envelope protein subunits gp41 NHR structural domain；C34 (SEQ ID NO:22): CHR structural domain on HIV envelope protein subunits gp41；MPER(SEQ ID NO: 23): nearly spanning domain on HIV envelope protein subunits gp41；LLP1(SEQ ID NO:24)/LLP2(SEQ ID NO:25)/ LLP3 (SEQ ID NO:26): intracellular section of LLP1/LLP2/LLP3 structural domain of HIV envelope protein subunits gp41；LLP1-RH (SEQ ID NO:27): the upper 828-842 amino acids sequence of LLP1；LLP1-GQ (SEQ ID NO:28): the upper 835-849 of LLP1 Amino acids sequence；LLP1-HL (SEQ ID NO:29): the upper 842-856 amino acids sequence of LLP1.F9170 is special as the result is shown The opposite sex combines the LLP1-GQ section of LLP1 structural domain.
Fig. 2 a-d is the amount that HIV structural proteins P24 is detected by ELISA, to detect F9170 going out for inhibition of HIV strain Viability.Tetra- figure of a, b, c, d respectively indicate various concentration F9170 to HIV-1IIIB plants, Bal plants, TZA68/125A plants and 92TH009 plants of inactivating efficacy.After F9170 and inhibition of HIV are incubated for as the result is shown, it can effectively inhibit infection of the virus to target cell Ability.The out-of-order polypeptide (SEQ ID NO:30) and HIV fusion inhibitor T20 (SEQ ID NO:18) of F9170 be not then this Effect.
Fig. 3 a-b is inhibiting effect of the F9170 to pseudovirus.HIV envelope protein plasmid or MERS-CoV envelope protein Grain is used to pack together with HIV skeleton plasmid HIV (a) or MERS-CoV (b) pseudovirus respectively.F9170 is for HIV cape horn fever Poison has the inhibiting effect of concentration dependant, but does not have then for MERS-CoV pseudovirus.The inhibitor HR2PM2 of MERS-CoV (SEQ ID NO:31) then has reverse effect.
Fig. 4 a-c is splitting action of the F9170 to HIV.A uses RNA enzyme after the F9170 and inhibition of HIV of various concentration are incubated for Digest the HIV postgenome that is released, then in test sample residue HIV RNA amount.5 μM of F9170 just makes as the result is shown It is cracked at 80% or more HIV.B, c are having after being incubated for inhibition of HIV and TritonX-100, F9170 and DMSO respectively Have in the sucrose solution of gradient concentration and is centrifuged.The amount of each component HIV RNA and the amount of P24 are detected respectively.The results show that TritonX-100 group RNA concentrates on component 7-9, and its capsid protein P24 concentrates on component 1-3, and F9170 group RNA concentrates on group Divide 6-8, and its capsid protein P24 concentrates on component 1-3, DMSO group RNA concentrates on component 4-7, and capsid protein P24 is concentrated on Component 4-6.The distribution of both DMSO groups is more consistent, and TritonX-100 and F9170 group RNA and capsid protein distribution are inconsistent, Illustrate that TritonX-100 and F9170 can cause the cracking of inhibition of HIV particle, causes the release of RNA.
Fig. 5 a-b is cracking of the F9170 to infected by HIV cell.A, H9/IIIB cell line are infected by HIV-steady in a long-term 1IIIB plants of H9 cell line.F9170 can crack H9/IIIB cell and in concentration dependant approach as the result is shown, not have then to H9 cell It is toxic.B, Jurkat HXBc2 cell are the Jurkat cell system for stablizing HIVHXB2 plants of envelope proteins of expression, Jurkat713STOP cell is the Jurkat cell system for stablizing HIVHXB2 plants of envelope protein extracellular fragments of expression.As the result is shown F9170 is only capable of the Jurkat HXBc2 cell of cracking expression envelope protein overall length and in concentration dependant approach, to without coating egg White intracellular section of Jurkat713STOP cell is then without toxicity.
Fig. 6 a-b is cracking of the F9170 to the HIV latent cells of activation.F9170, which can be cracked, as the result is shown reactivates HIV latent cells and be in concentration dependant approach, to latent cells then without toxicity.F9170 random ordering polypeptide is not imitated similarly then Fruit.
Fig. 7 is the activity that F9170 mutant polypeptide inhibits inhibition of HIV infection.F9170 polypeptide is by (SEQ after single-site mutant NO:3-17), still there is inhibitory activity to HIV-1IIIB virus.
Fig. 8 a-d is F9170 in the intracorporal distribution of mouse.A, b, small animal living body imaging display mouse are injected F9170 Afterwards, F9170 is uniformly distributed in mouse liver, bladder and brain.The statistical data of c, a.The statistical data of d, b.
Fig. 9 is the safety of F9170.Injection F9170 will not change the body weight increase of mouse.
Specific embodiment
The present invention provides polypeptides, specifically bind intracellular section of HIV envelope protein, preferably comprising with SEQ ID NO: Lentivirus lytic peptide -1LLP1 (lentiviral lytic peptides-1) structural domain of amino acid sequence shown in 28.It is more Peptide includes its derivative, stereoisomer or its salt.
Lipid bilayer is also known as phospholipid bilayer, is the basic bracket for constituting cell membrane.Herein, lipid is double Molecular layer includes inhibition of HIV particle envelope and the host cell membrane by HIV infection.The destruction of lipid bilayer causes HIV Virion, by the cracking of HIV infection cell and the HIV latent cells of activation.
Herein, polypeptide may include to replace in amino acid sequence shown in any in SEQ ID NO:1-17, It adds, lack or be inserted into one or more, the amino acid sequence of preferably 2,3,4 or 5 amino acid residues.
Amino acid addition refers to C-terminal or N-terminal addition amino any in amino acid sequence, such as SEQ ID NO:1-17 Acid causes inhibition of HIV as long as polypeptide of the invention retains specificity and destroys the lipid bilayer comprising HIV envelope protein Grain, by HIV infection cell and the HIV latent cells of activation cracking effect.
Amino acid substitution refers to some position of any sequence in amino acid sequence, such as SEQ ID NO:1-17 Some amino acid residue is substituted by other amino acid residues, as long as polypeptide of the invention retains said effect.
Amino acid insertion refers to that the appropriate location of any sequence in amino acid sequence such as SEQ ID NO:1-17 is inserted Enter amino acid residue, the amino acid residue of insertion can also be completely or partially adjacent to each other, or between the amino acid of insertion not Adjacent to each other, as long as polypeptide of the invention retains said effect.
Amino acid deletions refer to can be any from amino acid sequence, such as SEQ ID NO:1-17 sequence in delete 1, 2 or 3 with upper amino acid, as long as polypeptide of the invention retains said effect.
In the present invention, replace and can be conserved amino acid substitution, refer to and amino any in SEQ ID NO:1-17 Acid sequence is compared, and has 3, more preferably 2 amino acid or 1 amino acid are replaced and shape by amino acid with similar or analogous properties At peptide.These conservative variation's peptides can carry out amino acid substitution according to table 1 and generate.
Table 1: conservative replaces
Initial residue Representative substitution It is preferred to replace
Ala(A) Val；Leu；Ile Val
Arg(R) Lys；Gln；Asn Lys
Asn(N) Gln；His；Lys；Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro；Ala Ala
His(H) Asn；Gln；Lys；Arg Arg
Ile(I) Leu；Val；Met；Ala；Phe Leu
Leu(L) Ile；Val；Met；Ala；Phe Ile
Lys(K) Arg；Gln；Asn Arg
Met(M) Leu；Phe；Ile Leu
Phe(F) Leu；Val；Ile；Ala；Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr；Phe Tyr
Tyr(Y) Trp；Phe；Thr；Ser Phe
Val(V) Ile；Leu；Met:Phe:Ala Leu
All amino acid in the polypeptide sequence of this paper can be L-type amino acid, one or more (such as 2-5,2- 4 or 2-3) amino acid can also be rare existing for the amino acid, manually modified amino acid, nature of D type with conformation Amino acid etc. is replaced, to improve the bioavilability, stability and/or antiviral activity of polypeptide.Wherein D type amino acid is Refer to amino acid corresponding with the L-type amino acid of constitutive protein matter；Manually modified amino acid refers to through Hypermethylation, phosphorylation etc. The common L-type amino acid of the constitutive protein matter of modification；Rare amino acid existing for nature includes the uncommon of constitutive protein matter Amino acid and the not amino acid of constitutive protein matter, such as 5- oxylysine, methylhistidin, gamma aminobutyric acid, homoserine Deng.
Pharmaceutical salts of the invention, including acetate, lactobionate, benzene sulfonate, laurate, benzoate, apple Tartaric acid salt, heavy carbonate, maleate, disulfate, mandelate, biatrate, mesylate, borate, bromomethane, Bromide, methyl nitrate, Ca-EDTA, Methylsulfate, d-camphorsulfonic acid, mucate, carbonate, naphthalene sulfonate, chlorination Object, nitrate, clavulanate, N- methylglucamine, citrate, ammonium salt, dihydrochloride, oleate, edetate, grass Hydrochlorate, ethanedisulphonate, pamoate, palmitate, esilate, pantothenate, fumarate, phosphate/diphosphonic acid, Portugal heptan Sugar lime, Polygalacturonate, Portugal (grape) sugar lime, salicylate, glutamate, stearate, to hydroxyl acetyl amino phenyl Arsenic acid, sulfate, hydroxy benzoate, succinate, hydrobromate, tannate, hydrochloride, tartrate, hydroxyl naphthoic acid Salt, teoclate, iodide, toluene fulfonate, triethiodide, lactate, valerate etc..Depending on purposes, pharmaceutical salts can It, can also be by alkali such as ammonia, ethylenediamine, N- methyl-paddy ammonia to be formed by cation such as sodium, potassium, aluminium, calcium, lithium, manganese and zinc, bismuth etc. Amide, lysine, arginine, ornithine, choline, N, N'- dibenzyl-ethylenediamin, chloroprocanine, diethanolamine, Proca Cause, diethylamine, piperazine, trishydroxymethylaminomethane and tetramethylammonium hydroxide etc. are formed.These salt can use standard method system It is standby, such as reacting by free acid and organic or inorganic alkali.In the presence of a basic group such as amino, ackd salt Such as hydrochloride, hydrobromide, acetate, pamoate can be used as dosage form；It is deposited in an acidic-group (such as-COOH) or alcohol radical In case, well known in pharmaceutical ester such as acetate, maleate, trimethylace tonitric chloromethyl ester and document to be used for Improving soluble and water-disintegrable ester may be used as sustained release and precursor medicine preparation.
Above, lipophilic compound can connect on the side chain of end amino acid, can also be connected directly between on peptide chain.
In said derivative, the aminoterminal protecting group can be acetyl group, amino, maleoyl, succinyl group, tertiary fourth oxygen Any group in carbonyl or benzyloxy or other hydrophobic groupings or macromolecular carrier group；The c-terminus protecting group can be ammonia Any group in base, amide groups, carboxyl or tertbutyloxycarbonyl or other hydrophobic groupings or macromolecular carrier group.
In conjugate, carrier protein is following one kind or any combination thereof: seralbumin, immunoglobulin, iron egg White, transferrins, α -2- macroglobulin, Thyroxine binding protein and steroid binding protein.
Polypeptide provided by the present invention or its pharmaceutical salts, its derivative or its pharmaceutical salts, above-mentioned conjugate, above-mentioned polymer And above-mentioned composition, it can be used for the treatment of HIV infection, the prevention of HIV infection can also be used, including expose preceding or suspicious exposure Afterwards, such as blood transfusion, organ transplant, body fluid are exchanged, are bitten, being exposed to blood samples of patients etc. in accidental needle sticks or operation.
The polypeptide and its derivative and pharmaceutical salts that the present invention includes can be applied to HIV infection individually or as composition The treatment of person.It can be mixed with various suitable carrier materials or excipient in practical application, can be made into a variety of dosage forms.It can be general Logical preparation, controlled release preparation, sustained release preparation and various particulate delivery systems.It can inhibit with reverse transcriptase inhibitor, protease The inverases such as agent are applied to the treatment of AIDS together.It can be using gel form as HIV microbicide.Can with it is inverse Turn healing strategy of the latent drug combination of HIV as HIV.It can connect or be used in combination with HIV broad spectrum neutralizing antibody, use In the treatment of HIV.
It in practical applications, can be by polypeptide of the invention or its pharmaceutical salts, its derivative or its pharmaceutical salts, above-mentioned coupling After object, above-mentioned polymer and above-mentioned composition are directly given patient as drug or are mixed with suitable carrier or excipient Patient is given, to achieve the purpose that treatment and/or pre- preventing HIV infection.Here carrier material includes but is not limited to water-soluble carries Body material (such as polyethylene glycol, polyvinylpyrrolidone, organic acid), slightly solubility carrier material (such as ethyl cellulose, cholesterol Stearate etc.), enteric solubility carrier material (such as the first and second cellulose of cellulose acetate phthalate and carboxylic).Wherein it is preferred that water Solubleness carrier material.A variety of dosage forms can be made using these materials, including but not limited to tablet, capsule, dripping pill, aerosol, Pill, pulvis, solution, suspension, emulsion, granule, liposome, transdermal agent, buccal tablet, suppository, freeze drying powder injection etc..Its In, suppository can be vaginal suppository, be also possible to pesseulum, be also possible to ointment, creams or gel suitable for vaginal application.It can be with It is ordinary preparation, sustained release preparation, controlled release preparation and various particulate delivery systems.It, can in order to which tablet is made in unit dosage forms for administration Various carriers well known in the art are widely used.Example about carrier is, such as diluent and absorbent, such as starch, paste Essence, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, white bole, microcrystalline cellulose, alumina silicate Deng；Wetting agent and adhesive, as water, glycerol, polyethylene glycol, ethyl alcohol, propyl alcohol, starch slurry, dextrin, syrup, honey, glucose are molten Liquid, mucialga of arabic gummy, gelatine size, sodium carboxymethylcellulose, lac, methylcellulose, potassium phosphate, polyvinylpyrrolidone etc.； Disintegrating agent, such as dry starch, alginate, agar powder, laminaran, sodium bicarbonate and citric acid, calcium carbonate, polyoxy second Alkene, sorbitan fatty acid ester, dodecyl sodium sulfate, methylcellulose, ethyl cellulose etc.；Disintegration inhibitor, such as sugarcane Sugar, glyceryl tristearate, cocoa butter, hydrogenated oil and fat etc.；Sorbefacient, such as quaternary ammonium salt, lauryl sodium sulfate etc.；Lubrication Agent, such as talcum powder, silica, cornstarch, stearate, boric acid, atoleine, polyethylene glycol etc..It can also be by piece Coating tablet, such as sugar coated tablet, thin membrane coated tablet, enteric coated tablets or double-layer tablets and multilayer tablet is further made in agent.In order to incite somebody to action Pill is made in unit dosage forms for administration, and various carriers well known in the art can be widely used.Example about carrier is, such as dilute Agent and absorbent are released, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, Gelucire, height Ridge soil, talcum powder etc.；Adhesive such as Arabic gum, bassora gum, gelatin, ethyl alcohol, honey, liquid sugar, rice paste or batter etc.；Disintegration Agent, such as agar powder, dry starch, alginate, dodecyl sodium sulfate, methylcellulose, ethyl cellulose.In order to will be single Suppository is made in position form of administration, and various carriers well known in the art can be widely used.Example about carrier is, such as poly- second Glycol, lecithin, cocoa butter, higher alcohol, the ester of higher alcohol, gelatin, semi-synthetic glyceride etc..In order to by unit dosage forms for administration system All diluents commonly used in the art can be used such as solution, emulsion, freeze drying powder injection and suspension at injection preparation, For example, water, ethyl alcohol, polyethylene glycol, 1,3-PD, the isooctadecanol of ethoxylation, polyoxygenated isooctadecanol, polyoxyethylene Span etc..In addition, in order to prepare isotonic injection, can be added into injection preparation suitable sodium chloride, Glucose or glycerol, further, it is also possible to add conventional cosolvent, buffer, pH adjusting agent etc..In addition, if desired, can also be with Colorant, preservative, fragrance, corrigent, sweetener or other materials are added into pharmaceutical preparation.
Using above-mentioned dosage form can with administrated by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intraperitoneal injection, Intracisternal injection or implantation etc.；Cavity/canal drug administration, such as per rectum, vagina and sublingual；Respiratory tract administration, such as via intranasal application；Mucosa delivery. Above-mentioned administration route is preferably drug administration by injection, and preferred injecting pathway is subcutaneous injection.
Polypeptide of the invention or its pharmaceutical salts, its derivative or its pharmaceutical salts, above-mentioned conjugate, above-mentioned polymer and above-mentioned The dosage of composition depends on many factors, such as to be prevented or be treated the property and severity of disease, Huan Zhehuo Gender, age, weight and the individual reaction of animal, concrete activity ingredient used, administration route and administration number of times etc..Above-mentioned dose Amount with single dose form or can be divided into several, such as two, three or four dosage forms for administration.For any specific patient, Specific treatment effective dose level must be depending on many factors, and the factor includes the tight of treated obstacle and the obstacle Weight degree；The activity of used concrete activity ingredient；Used concrete composition；The age of patient, weight, general health Situation, gender and diet；Administration time, administration route and the excretion rate of used concrete activity ingredient；Duration for the treatment of； The drug for being applied in combination or using simultaneously with used concrete activity ingredient；And similar factor well known to medical field.For example, The way of this field is, the dosage of active constituent gradually increases since less than obtaining required therapeutic effect and desired level Add dosage, until obtaining required effect.
The HIV therapy agent of table 2:FDA approval
Following embodiment is provided to be illustrated the present invention.
Embodiment
Embodiment 1: the Binding experiment of polypeptide of the invention
1.1 experimental materials and method
Based on enzyme-linked immunosorbent assay (ELISA) detection F9170 polypeptide (SEQ ID NO:2) (Synpeptide Co., Ltd. synthesize) it can be with the albumen or polypeptide (being Synpeptide Co., Ltd. synthesis) in following HIV envelope protein source In conjunction with: gp120 (SEQ ID NO:19): HIV envelope protein gp120 subunit；Gp140 (SEQ ID NO:20): HIV coating egg The part of spanning domain and sequence intracellular is worn in white removing；N63 (SEQ ID NO:21): NHR on HIV envelope protein subunits gp41 Structural domain；C34 (SEQ ID NO:22): CHR structural domain on HIV envelope protein subunits gp41；MPER (SEQ ID NO:23): Nearly spanning domain on HIV envelope protein subunits gp41；LLP1(SEQ ID NO:24)/LLP2(SEQ ID NO:25)/LLP3 (SEQ ID NO:26): intracellular section of LLP1/LLP2/LLP3 structural domain of HIV envelope protein subunits gp41；LLP1-RH(SEQ ID NO:27): the upper 828-842 amino acids sequence of LLP1；LLP1-GQ (SEQ ID NO:28): the upper 835-849 amino acids of LLP1 Sequence；LLP1-HL (SEQ ID NO:29): the upper 842-856 amino acids sequence of LLP1.
Specifically, by the above-mentioned albumen of each 20 μ g/ml of 50 μ l or polypeptide, (solvent is that the PBS containing 0.5% dimethyl sulfoxide is molten Liquid) it is individually coated in 96 orifice plate of high adsorption (Corning, article No. 3690), 4 DEG C of overnight incubations.Second day, with PBST solution (PBS buffer solution containing 0.5%Tween, it is all PBST solution that cleaning solution used is cleaned in other embodiments) 96 holes of cleaning Plate is closed with 5% skimmed milk solution afterwards three times, 37 DEG C of two hours of incubation.It is cleaned after three times with PBST solution and 50 μ l is added Various concentration (in gp120 and gp140 protein binding assays be 10000,2500,625,156.25 nanograms/milliliters；Its In his Binding experiment be 10000,1000,100,10,1 nanograms/milliliters) biotin modification F9170 polypeptide F9170-bio (Synpeptide Co., Ltd. synthesis, biotin modification is in polypeptide aminoterminal) uses PBST solution after 37 DEG C of one hours of incubation Cleaning three times.50 μ l SA-HRP (1:3000 dilution) (Invitrogen, article No. 434323) are added, and 37 DEG C of incubations are one small afterwards When.It is cleaned after three times with PBST solution and 50 μ l chromogenic substrate 3,3,5,5-TMB solution (Sigma-Aldrich, article No. is added 860336), it is eventually adding the 10% sulfuric acid color development stopping of 50 μ l.It is every with microplate reader (TECAN infinite M200pro) detection Absorption of the hole to 450nm light.The absorption records of values is made into change curve (Fig. 1 a-c).
1.2 experimental results and analysis
As shown in Fig. 1 a-c, F9170 not with the extracellular fragment of HIV envelope protein (gp120, gp140, N63, C34, MPER) Reaction.F9170 can only be in conjunction with the LLP1 polypeptide from intracellular section of HIV envelope protein.LLP1 is truncated to LLP1RH/GQ/HL tri- After polypeptide, F9170 only combines LLP1-GQ, other two polypeptide abilities in connection are greatly lowered, and illustrates that F9170 is combined What LLP1 was relied primarily on is the 835-849 amino acids residue that LLP1-GQ is included.
Embodiment 2: polypeptide of the invention inactivates inhibition of HIV
2.1 experimental materials and method
Detect F9170 polypeptide (SEQ ID NO:2), F9170 random ordering polypeptide (F9-scr) (SEQ ID NO:30) and T20 (SEQ ID NO:18) (is synthesized) inactivation inhibition of HIV strain HIV-1IIIB, Bal, TZA68/ by Synpeptide Co., Ltd. 125A and 92TH009 Strain (NIH AIDS Reagent Program is come from, article No. is respectively 398,510,11255, 1656) method of ability is as follows: each above-mentioned every kind of inhibition of HIV of 50 μ L (is used 1640 culture medium of serum-free (Meilunbio, article No. MA0215,1640 culture mediums used in all embodiments are the product) dilution, ultimate density is 200 times of TCID50) and 50 μ L It (is diluted with 1640 culture medium of serum-free, initial concentration by the F9170 polypeptide, F9170 random ordering polypeptide and T20 of doubling dilution (4 times) It is 5 μM) it is incubated for 1 hour at 4 DEG C.Be added PEG6000 (Sigma-Aldrich, article No. 1546580), make its final concentration of 3%, 4 It DEG C is incubated for again 1 hour.After 13,000rpm centrifugation 30 minutes, the 3%PEG6000 containing 10mg/ml BSA is added and is cleaned, 13,000rpm is centrifuged 30 minutes again.Last precipitating is resuspended with 1640 culture medium of serum-free of 100 μ l, is added in 96 orifice plates. Adding 100 μ L MT-2 (X4) or M7 (R5) cell, (MT-2 comes from NIH AIDS Reagent Program, article No. 237； M7 cell comes from Sigma-Aldrich, article No. 94022543) (105A/ml is dilute with the 1640 culture medium that 10% serum is added Release), using only added same final concentration MT-2 M7 cell hole as negative control, joined same final concentration Inhibition of HIV and cell but the hole that drug is not added are positive control.5th day morning collected 50 μ L of supernatant, and was added in supernatant 50 PBS buffer solution of the μ L containing 5%triton, stand overnight for 4 DEG C after mixing.It is quantified with the content of P24 in ELISA detection supernatant The case where HIV-1 target cell infection.Specifically, detection P24 needs to be added in evening before that day in halfth area, 96 orifice plate (Corning) The HIV IgG (5 μ g/ml) of carbonate buffer solution (0.05M sodium carbonate, 0.05M sodium bicarbonate, pH 9.6) diluted 50 μ l (comes From NIH AIDS Reagent Program, article No. 3957).4 DEG C of 12 hours of placement, with being added 5% after PBST solution board-washing The molten milk of PBS closed, 37 DEG C place 2 hours.The supernatant collected and it joined 5% with being added after PBST solution board-washing The 10 μ L of mixture of the PBS (ratio of supernatant and PBS are 1:1) of triton, adds 40 μ L PBS, 37 DEG C are placed 1 hour.With Diluted 183 antibody of primary antibody of 50 μ L PBS is added after PBST solution board-washing, and (1.5 μ g/ml, culture come from NIH AIDS Reagent The Anti-HIV-1p24Hybridoma hybridoma cell line of Program, article No.: 1513；Protein G is utilized after collecting supernatant Magnetic Beads (New England Biolabs, article No.: S1430S, bibliography: Sisson, T.H.and Castor, C.W. (1990) .J.Immunol.Methods.127,215.) 183 antibody in specificity purifying supernatant) 50 μ L, 37 DEG C are placed one hour.(3000 times are diluted, Dako Denmark HRP with the diluted secondary antibody of PBS is added after PBST solution board-washing The rabbit-anti mouse monoclonal antibody of modification, article No. P0260) 50 μ L, 37 DEG C are placed one hour.Be added after PBST solution board-washing 50 μ l colour developing bottom 3,3,5,5-TMB solution of object (Sigma-Aldrich, article No. 860336) was added 10% sulfuric acid and terminates reaction to 3-5 minutes.With Microplate reader (TECAN infinite M200pro) detects the OD450 in every hole, obtains data.Calculate each concentration samples inhibiting rate
2.2 experimental results and analysis
After inhibition of HIV strain HIV-1IIIB, Bal, TZA68/125A and 92TH009 virus and F9170 are incubated for, no longer can Target cell infection is simultaneously replicated, so the viral suppression of high concentration F9170 group is 100%, and concentration is presented in inactivation curves The trend of dependence.F9170 random ordering polypeptide (F9-scr) and T20 are then without this effect.Illustrate F9170 sequence energy specifically inactivating Inhibition of HIV (Fig. 2 a-d).
Embodiment 3.F9170 specificity inhibits HIV pseudovirus.
3.1 experimental materials and method
Pseudovirus packaging: by HIV envelope protein plasmid or MERS-CoV envelope protein plasmid (HIV envelope protein plasmid From AIDS Reagent Program, article No. 324；MERS-CoV envelope protein plasmid comes from joint study group New York blood Center virological immunology seminar) (pNL4-3.Luc.R-E comes from NIH AIDS Reagent with HIV skeleton plasmid respectively Program, article No.: 3418) together for packing HIV and MERS-CoV pseudovirus.By two kinds of plasmid HIV envelope protein plasmids Or MERS-CoV envelope protein plasmid and HIV skeleton plasmid (5 μ g DNA are melted into 100 μ l physiological saline) while using VigoFect Reagent (prestige lattice Lars biotechnology (Beijing) Co., Ltd, article No. T001) (2 μ l reagent dilutions to 100 μ l physiological saline) basis The operation instruction transfection of manufacturer enters 293T cell (being purchased from ATCC), and (200,000-400,000 cell is added extremely in the previous day 35mm culture dish).After 37 DEG C of 12 hours of culture, DMEM culture medium (Meilunbio, article No. MB4732) is substituted for fresh The DMEM culture medium containing 10% serum.Continue after cultivating 48 hours at 37 DEG C, the supernatant of culture is collected, with 0.45- μm The filter membrane in aperture filters, and includes HIV and MERS-CoV pseudovirus in supernatant, saves backup for -80 DEG C after packing.
Inhibit pseudovirus infection experiment: 50 μ L HIV or MERS-CoV pseudovirus (are diluted, most with plasma-free DMEM medium Final concentration of 100 times of TCID50) with 50 μ L by the F9170 polypeptide or anti-MERS-CoV of doubling dilution (2 times, initial concentration be 5 μM) Polypeptide HR2PM2 (synthesis of SEQ ID NO:31, Synpeptide Co., Ltd.) (it is diluted with plasma-free DMEM medium, with F9170 comparable sodium) it is incubated for 30 minutes at 37 DEG C.100 μ L U87CD4 are added+CXCR4+Cell (comes from NIH AIDS Reagent Program, article No.: 4036) (105A/ml is diluted with the DMEM culture medium that 10% serum is added).It is trained at 37 DEG C After supporting 12-16 hour, the DMEM culture medium of fresh 10% serum of addition is changed into.It is further cultured for after 48 hours, discards Clearly, addition 50 μ l lysates (Progema, article No.: E153A) is glimmering using carrying out according to the operation instruction lytic cell of manufacturer Light detection kit (Promega, Madison, WI) is detected according to the operation instruction of manufacturer.Due to pseudovirus skeleton matter Grain can express fluorescence, and fluorescence is higher, and the pseudovirus for illustrating infection is more.The inhibition in the hole can be calculated according to the fluorescent value in every hole Rate, calculation formula is the same as embodiment 2.
3.2 experimental results and analysis
F9170 can inhibit to concentration dependent HIV pseudovirus to infect, but cannot inhibit containing MERS-CoV envelope protein Pseudovirus infects (Fig. 3 a).Anti- MERS-CoV polypeptide HR2PM2 can inhibit MERS-CoV pseudovirus to infect, but HIV cannot be inhibited false The infection (Fig. 3 b) of virus.Based on the above results, illustrate that F9170 specifically acts on the virus containing HIV envelope protein On grain.
Embodiment 4.F9170 polypeptide cleavage virion
4.1 experimental materials and method
RNA enzyme digestion experiment: 50 μ L HIV-1Bal (are come from into NIH AIDS Reagent Program, PBS dilutes, most Final concentration of 100 times of TCID50) viral and 50 μ L various concentrations, respectively 0,5,10,25,50 μM of F9170 or 1% 4 μ L micrococcal nuclease stoste (New England BioLabs, article No.s are added after being incubated at room temperature two hours in Triton One hour is incubated at 37 DEG C 10011S) to crack free HIV rna gene group.Inactivation (65 DEG C are incubated for 20 minutes) is remaining After RNA enzyme, Qiagen QIAamp Viral RNA Mini Kit kit (Valencia, article No. 1020953) basis is utilized The operation instruction of manufacturer extracts the RNA inside remaining intact virus, and utilizes RT Reagent Kit kit (Takara Bio, article No. RR037B) according to the operation instruction reverse transcription of manufacturer at cDNA.Recycle Master Cycler Ep Realplex PCR System (Eppendorf) quantitative fluorescent PCR detects the amount of cDNA, quantifies remaining complete disease with this The quantity of poison (experiment condition is formulated according to laboratory apparatus and the incidental Guide Book of kit).In fluorescent quantitative PCR experiment In, we used two pairs of different primers, to ensure the accuracy detected: HIV-Env-F1: GGAGCAGCAGGAAGCACTATGG；HIV-Env-R1:
GCCTCAATAGCCCTCAGCAGAT；HIV-Env-F2:
CATCAAGCAGCTCCAGGCAAGA；HIV-Env-R2:
TGTCCCACTCCATCCAGGTCAT
The setting of q-PCR used by the present embodiment are as follows: 95 DEG C of 10s, (95 DEG C of 5s+60 DEG C of 30s) * 40 circulations, 95 DEG C 15s, 60 DEG C of 60s, 95 DEG C of 15s.
The experiment of 4.2 sucrose gradient centrifugations: 50 μ L HIV-1Bal (are come from into NIH AIDS Reagent Program, PBS Dilution, ultimate density are 100 times of TCID50) respectively with 50 μ L 1%DMSO, 100 μ Μ F9170,1%Triton X-100 are 37 DEG C be incubated for 2 hours.Prepare sucrose solution (20%, 30%, 40%, 50%, 60%, 70%) 1.5ml of gradient concentration, presses from height The sequence of concentration to low concentration is added in centrifuge tube.Then in sucrose solution top plus the mixtures incubated of virus and drug (100μL).After 4 DEG C, 25,000rpm centrifugations 3 hours, go out solution and mark to take with the measurement of 1ml/ component since top Sequence out, respectively component 1-9.Each component utilizes RT Reagent Kit kit (Takara Bio, article No. RR037B) according to the operation instruction reverse transcription of manufacturer at cDNA.Recycle Master Cycler Ep Realplex PCR (the setting of q-PCR used by the present embodiment are as follows: 95 DEG C of 10s, (95 DEG C of 5s+60 of System (Eppendorf) quantitative fluorescent PCR DEG C 30s) * 40 circulations, 95 DEG C of 15s, 60 DEG C of 60s, 95 DEG C of 15s) detect the amount of cDNA, each component is quantified with this The quantity of contained viral RNA (experiment condition is formulated according to the incidental Guide Book of laboratory apparatus).Utilize Western Blot Detect HIV capsid protein P24 contained by each component.Specifically, each component sample (20 μ l) is directly loaded to 10% In SDS-PAGE glue well.Glue is concentrated and uses 80V voltage, separation gel uses 120V voltage.Band on protein adhesive is transferred to Pvdf membrane.Using the standard wet type membrane-transferring device of Bio-Rad, transferring film electric current is set as 300-400mA, the transferring film time is 30 points Clock.After transferring film, protein film is placed into preprepared PBS buffer solution immediately, is rinsed 1-2 minutes, to wash away film On transferring film liquid.5% skimmed milk solution is added to close film, is slowly shaken on shaking table, room temperature is closed 60 minutes.It adopts With 183 antibody in embodiment 2, room temperature slowly shakes incubation one hour on the side shaker.Using the secondary antibody in embodiment 2, Room temperature slowly shakes incubation one hour on the side shaker.It is seen using Tanon4600 Full-automatic chemiluminescence image analysis system It examines and records slice result.
4.3 experimental results and analysis
As shown in fig. 4 a, and do not have to concentration F9170 polypeptide be incubated for after, in sample remaining complete inhibition of HIV particle with The raising of peptide concentration and successively decrease.When F9170 peptide concentration is 5 μM, complete structure is kept only less than 20% virion Type and so that internal rna gene group is saved.As shown in Fig. 4 b and c, after virion and drug incubation, DMSO group RNA collection In in component 4-7, and its capsid protein P24 concentrates on component 4-6, more unified, illustrates that the virus structure of DMSO group has been kept Whole, capsid protein and RNA are among a component.In contrast, TritonX-100 group RNA concentrates on component 7-9, and its clothing Glutelin P24 concentrates on component 1-3.Similarly, F9170 group RNA concentrates on component 6-8, and its capsid protein P24 concentrates on group Divide 1-3, illustrates that TritonX-100 and F9170 can cause the cracking of inhibition of HIV particle, and then lead to the release of RNA.
Embodiment 5.F9170 polypeptid specificity cracks the HIV latent cells of HIV infection cell and activation
5.1 experimental materials and method
100 μ l various concentrations, i.e., 0.3125,0.625,1.25,2.5,5 and 10 μM of F9170 polypeptide and the H9/ of 100 μ l IIIB H9 cell and Jurkat HXBc2 cell or Jurkat713STOP cell (come from NIH AIDS Reagent Program, article No. are respectively 87,400,3953,3956) it is incubated at 37 DEG C.After three days be added CCK8 (Sigma-Aldrich, Article No. C2581) reagent, and continue to be incubated for 1-4 hour.Every hole is detected with microplate reader (TECAN infinite M200pro) OD450.Using not with F9170 be incubated for allogenic cell OD value as 100% activity.
For the latent cells experiment of activation, the above-mentioned various cells elder generations of 100 μ l and 50 μ l Chidamide (1 μM) (Cayman, article No. 13686) is incubated for 30 minutes at 37 DEG C, then adds 50 μ l F9170 (5 μM) (active cell experimental group), It is un-activation cell experiment group not with Chidamide but with the cell of F9170 incubation, tests according to above step.It is similar Ground is tested with F9170 random ordering polypeptide replacement F9170.Using not with F9170 be incubated for allogenic cell OD value as 0% poison Property.
5.2 experimental results and analysis
The activity of CCK8 reagent energy detection hole cell.The experimental result of Fig. 5 a shows F9170 polypeptide energy specific effect quilt The activity of the H9 cell of HIV-1IIIB virus infection, and the effect is in the trend of concentration dependant.And have no to H9 cell itself It influences.
As shown in Figure 5 b, F9170 is toxic to the Jurkat HXBc2 cell comprising HIV envelope protein overall length, and in dense Dependence trend is spent, but the Jurkat713STOP cell for expressing extracellular fragment is then in detectable concentration all without toxicity.Explanation F9170 depends on its interaction with intracellular section of HIV envelope protein to the deactivation of HIV infection cell.
As shown in Figure 6 a, for the latent cells not being activated, F9170 polypeptide has no effect on the activity of these cells, But the cell for being activated again, F9170 concentration is higher, and the activity for the cell being activated is poorer.As shown in Figure 6 b, F9170 random ordering polypeptide, then no matter to either with or without the latent cells being activated all without inhibitory activity.Illustrate that F9170 polypeptide can be special The cell of opposite sex cracking expression HIV envelope protein.
Embodiment 6.F9170 mutant polypeptide has inhibiting effect to HIV-1IIIB strain
6.1 experimental materials and method
(ultimate density is 100 times of TCID to 50 μ L HIV-1IIIB viruses50, diluted with 1640 culture medium of serum-free) and 50 μ L (is by the F9170 polypeptide and its mutant polypeptide 1-15 (sequence is respectively SEQ NO:3-17) of doubling dilution (2 times) The synthesis of Synpeptide Co., Ltd., initial concentration are 6 μM, are diluted with 1640 culture medium of serum-free) 30 points are incubated at 37 DEG C Clock.100 μ L MT-2 cells (10 are added5A/ml is diluted with 1640 culture mediums that 10% serum is added).In 37 DEG C of culture 12- After 16 hours, 1640 culture mediums of fresh 10% serum of addition are changed into.It is further cultured for after 72 hours, collects 50 μ of supernatant L, and 50 PBSs of the μ L containing 5%triton are added in supernatant, it is stood overnight for 4 DEG C after mixing.As described in example 2 above, use ELISA detects the content of P24 in supernatant come the case where quantifying HIV-1 target cell infection.Specifically, detection P24 is needed previous Carbonate buffer solution (0.05M sodium carbonate, 0.05M sodium bicarbonate, pH 9.6) is added in halfth area, 96 orifice plate (Corning) at night in it Diluted HIV IgG (5 μ g/ml) (coming from NIH AIDS Reagent Program).It is 4 DEG C of 12 hours of placement, molten with PBST The molten milk of PBS that 5% is added after liquid board-washing is closed, and 37 DEG C are placed 2 hours.It is collected with 10 μ L are added after PBST solution board-washing Supernatant and the PBS that joined triton mixture, add 40 μ L PBS, 37 DEG C are placed 1 hour.With PBST solution board-washing 183 antibody of primary antibody is added afterwards, and (1.5 μ g/ml cultivate the Anti-HIV- from NIH AIDS Reagent Program 1p24Hybridoma hybridoma cell line utilizes 183 antibody in protein A specificity purifying supernatant after collecting supernatant) 50 μ L, 37 DEG C are placed one hour.With after PBST solution board-washing be added secondary antibody (dilution 3000 times, Dako Denmark HRP modification Rabbit-anti mouse monoclonal antibody, article No. P0260) 50 μ L, 37 DEG C are placed one hour.Chromogenic substrate 3,3 is added with addition after PBST solution board-washing, 5,5-TMB (Sigma-Aldrich, article No.s 860336) were added 10% sulfuric acid and terminate reaction to 3-5 minutes.Use microplate reader (TECAN infinite M200pro) detects the OD450 in every hole, obtains data.Calculate each concentration samples inhibiting rate.It calculates Method is the same as embodiment 2.
6.2 experimental results and analysis
Mutant polypeptide 1-15 (sequence is respectively SEQ NO:3-17) after single-site mutant still has the suppression to inhibition of HIV System activity, half-inhibitory concentration (IC50) between 0.04-1.05 μM (Fig. 7).To F9170 the 2nd, 3,4,5,7,8,9,10,11, It after 12,13,14 or 15 amino acid mutations, is affected to its inhibitory activity, illustrating these is that F9170 exercises inhibition work Property key amino acid mutation, polypeptide 1 and 6 (sequence is respectively SEQ NO:3 and 8) substantially retains the inhibitory activity of F9170, It is smaller to show that the 1st and 6 amino acid mutation influences the inhibitory activity of original polypeptide F9170, can with other amino acid into Row replaces and substantially retains identical activity.
Embodiment 7.F9170 polypeptide is in the intracorporal distribution of mouse
7.1 experimental materials and method
Small animal living body imaging technique (referring to J.Cell.Biochem.118:2571-2580,2017, it is incorporated by reference into Herein) for detecting F9170 polypeptide in the detection of rat kidney tissue situation.6 ICR female mices (are purchased from Vital River Laboratories) (6-8 week old) is probabilistically assigned into two groups.One group of intraperitoneal injection 100mg is connected with the F9170 of fluorescent marker (synthesis of F9170-Cy5, Synpeptide Co., Ltd., it is more that Cy5 is connected to F9170 to polypeptide (being dissolved in PBS buffer solution, 100 μ L) Peptide c-terminus), another group of 100 μ L of intraperitoneal injection nontoxic PBS buffer solution.IVIS lumina K series III imaging system (PerkinElmer) detection for fluorescence in Mice Body.It is above in order to detect the distribution of the F9170 polypeptide in mouse organs After operation, mouse is put to death using yellow Jackets.The liver and brain that solution is cut are used for the detection of fluorescence.
7.2 experimental results and analysis
After F9170 polypeptide is injected into mouse, fluorescence signal (Fig. 8 a, b, c can be detected in liver, bladder and brain And d).Confirm that F9170 can enter mouse brain really after dissection.And brain is always the natural escape sanctuary of HIV, so that The F9170 polypeptide of brain be can enter in treatment HIV infection, there is very big advantage.
Embodiment 8.F9170 does not have apparent toxicity to mouse
8.1 experimental materials and method
15 ICR female mices (being purchased from Vital River Laboratories) (6-8 week old) are randomly assigned into three groups.Experiment The F9170 polypeptide (being dissolved in PBS buffer solution, 100 μ L) of 1 intraperitoneal injection 20mg/ml of group, experimental group 2 are injected intraperitoneally 100mg/ml's F9170 polypeptide (is dissolved in PBS buffer solution, 100 μ L), and the nontoxic PBS buffer solution of 100 μ L is only injected intraperitoneally in control group.Continuous injection Three days, the changes of weight of mouse was detected for different time points (4 days, 6 days, 8 days, 10 days, 12 days, 14 days, 16 days) after injection.
8.2 experimental results and analysis
According to Fig. 9, continuous three days injection F9170 polypeptides do not have any impact to the weight of mouse.It is small The variation of mouse weight and negative control (PBS) group are consistent, illustrate that F9170 polypeptide does not have toxicity to mouse in detectable concentration.
Embodiment 9.F9170 has the effect of wide spectrum AntiHIV1 RT activity
Since this kind of retrovirus of HIV is extremely easy to happen genome mutation, inventor has detected F9170 polypeptide again (NIH AIDS Reagent Program is come from, article No. is marked in a manner of bracket in table to a series of clinical strains shown in table 2 In lattice) antiviral activity.Clinical strain can be there are many hypotype.The experiment is control with F9170 random ordering polypeptide and T20.Together When, we also have detected F9170 to the inhibitory effect of T20 resistant strain.T20 is that currently the only approval inhibits for clinical fusion Agent, but it is easy to inducible resistance mutation, leads to the reduction of curative effect.So developing the New Fusion that can inhibit T-20 resistant strain Inhibitor will be problem clinically in the urgent need to address.
Method is as follows: every hole is added every kind of inhibition of HIV strain of 50 μ L and (is diluted with serum-free 1640, ultimate density in 96 orifice plates For 100 times of TCID50) and 50 μ L by doubling dilution (2 times) F9170 polypeptide (with serum-free 1640 dilute, initial concentration be 6 μ M), it is incubated for 30 minutes for 37 DEG C, adds 100 μ L MT-2 or M7 cells (with embodiment 2) (105A/ml, with 10% blood is added Clear 1640 culture medium dilution), using only added same final concentration target cell hole as negative control, joined same end The inhibition of HIV of concentration and target cell but the hole that drug is not added are positive control.The next morning every hole siphons away 150 μ L of supernatant, The fresh 1640 culture medium containing 10% serum of 150 μ L is added.5th day morning collected 50 μ L of supernatant, and 50 are added in supernatant PBS of the μ L containing 5%triton is stood overnight for 4 DEG C after mixing.As described in Example 2 with the content of P24 in ELISA detection supernatant Come the case where quantifying HIV-1 target cell infection.Specifically, detection P24 is needed in evening before that day in halfth area, 96 orifice plate (Corning) carbonate buffer solution (0.05M sodium carbonate, 0.05M sodium bicarbonate, pH 9.6) diluted HIV IgG (5 μ g/ are added Ml) (NIH AIDS Reagent Program, article No. 3957 are come from).4 DEG C of 12 hours of placement are added with after PBST solution board-washing The molten milk of PBS for entering 5% is closed, and 37 DEG C are placed 2 hours.With the supernatant collected is added and joined after PBST solution board-washing The 10 μ L of mixture of the PBS of 5%triton adds 40 μ L PBS, and 37 DEG C are placed 1 hour.With being added after PBST solution board-washing (1.5 μ g/ml cultivate the Anti- from NIH AIDS Reagent Program to diluted 183 antibody of primary antibody of 50 μ L PBS HIV-1p24Hybridoma hybridoma cell line, article No.: 1513；Protein G Magnetic is utilized after collecting supernatant Beads (New England Biolabs, article No.: S1430S, bibliography: Sisson, T.H.and Castor, C.W. (1990) .J.Immunol.Methods.127,215.) 183 antibody in specificity purifying supernatant) 50 μ L, 37 DEG C to place one small When.(3000 times are diluted, the rabbit-anti mouse of Dako Denmark HRP modification with the diluted secondary antibody of PBS is added after PBST solution board-washing Monoclonal antibody, article No. P0260) 50 μ L, 37 DEG C are placed one hour.With 50 μ l chromogenic substrate 3,3,5,5- are added after PBST solution board-washing TMB solution (Sigma-Aldrich, article No. 860336) was added 10% sulfuric acid and terminates reaction to 3-5 minutes.Use microplate reader (TECAN infinite M200pro) detects the OD450 in every hole, obtains data.Inhibiting rate is according to formula meter listed by embodiment 2 It obtains.Inhibiting rate according to each concentration is calculated often using Calcusyn software (Biosoft, Ferguson, MO) The IC of a sample50Value.Experimental result such as table 3, the clinical strain of hypotypes various for A, B, C, D, O etc. and accounts for leading in Chinese prevalence The recombination A/E Strain of status, F9170 all have preferable inhibitory activity.For T20 resistant strain, T20 polypeptide cannot inhibit again The infection of these strains, but F9170 still can inhibit, and show the advantage as HIV drug.F9170 is demonstrated to HIV disease Poison has the inhibitory effect of wide spectrum, illustrates that it is hopeful to be developed to the HIV drug for a new generation.
Inhibitory activity of the table 3.F9170 to different clinical strains
Embodiment 10: polypeptide broad spectrum activity inactivates inhibition of HIV
It detects F9170 polypeptide inactivation various HIV-1 virus as shown in table 3 and (comes from NIH AIDS Reagent Program, article No. are marked in table in a manner of bracket) method of ability is as follows: each above-mentioned every kind of inhibition of HIV of 50 μ L (used 1640 culture medium of serum-free (Meilunbio, article No. MA0215,1640 culture mediums used in all embodiments are the product) is dilute It releases, ultimate density is 200 times of TCID50) and 50 μ L press doubling dilution (2 times) F9170 polypeptide, F9170 random ordering polypeptide and T20 (being diluted with 1640 culture medium of serum-free, initial concentration is 6 μM) is incubated for 1 hour at 4 DEG C.PEG6000 (Sigma- is added Aldrich, article No. 1546580), make its final concentration of 3%, 4 DEG C are incubated for 1 hour again.After 13,000rpm centrifugations 30 minutes, add Enter the 3%PEG6000 containing 10mg/ml BSA to be cleaned, 13,000rpm is centrifuged 30 minutes again.With the serum-free of 100 μ l Last precipitating is resuspended in 1640 culture mediums, is added in 96 orifice plates.It adds 100 μ L MT-2 (X4) or M7 (R5) cell (comes from NIH AIDS Reagent Program)(105A/ml is diluted with the 1640 culture medium that 10% serum is added), it is same only to have added The hole of the MT-2 M7 cell of equal final concentrations as negative control, with joined same final concentration inhibition of HIV and cell but The hole that drug is not added is positive control.5th day morning collected 50 μ L of supernatant, and 50 μ L are added containing 5%triton in supernatant PBS buffer solution, stood overnight for 4 DEG C after mixing.It is quantified as described in Example 2 with the content of P24 in ELISA detection supernatant The case where HIV-1 target cell infection.Specifically, detection P24 needs to be added in evening before that day in halfth area, 96 orifice plate (Corning) Carbonate buffer solution (0.05M sodium carbonate, 0.05M sodium bicarbonate, pH 9.6) diluted HIV IgG (5 μ g/ml) (comes from NIH AIDS Reagent Program, article No. 3957).It is 4 DEG C of 12 hours of placement, molten with the PBS that 5% is added after PBST solution board-washing Milk is closed, and 37 DEG C are placed 2 hours.The supernatant collected and it joined 5%triton's with being added after PBST solution board-washing The 10 μ L of mixture of PBS adds 40 μ L PBS, and 37 DEG C are placed 1 hour.It is diluted with 50 μ L PBS are added after PBST solution board-washing 183 antibody of primary antibody (1.5 μ g/ml, cultivate the Anti-HIV- from NIH AIDS Reagent Program 1p24Hybridoma hybridoma cell line, article No.: 1513；Protein G Magnetic Beads is utilized after collecting supernatant (New England Biolabs, article No.: S1430S, bibliography: Sisson, T.H.and Castor, C.W. (1990) .J.Immunol.Methods.127,215.) 183 antibody in specificity purifying supernatant) 50 μ L, 37 DEG C are placed one hour.With After PBST solution board-washing be added the diluted secondary antibody of PBS (dilution 3000 times, Dako Denmark HRP modification rabbit-anti mouse monoclonal antibody, Article No. P0260) 50 μ L, 37 DEG C are placed one hour.With 50 μ l chromogenic substrate 3,3,5,5-TMB solution are added after PBST solution board-washing (Sigma-Aldrich, article No. 860336) was added 10% sulfuric acid and terminates reaction to 3-5 minutes.With microplate reader (TECAN Infinite M200pro) the every hole of detection OD450, obtain data.Inhibiting rate is calculated according to formula listed by embodiment 2. Inhibiting rate according to each concentration calculates each sample using Calcusyn software (Biosoft, Ferguson, MO) IC50Value.Experimental result such as table 4, the clinical strain of hypotypes various for A, B, D, F, O etc. and Chinese popular prevailing A/E Strain is recombinated, F9170 all has preferable inactivation activities.Meanwhile for T20 resistant strain, F9170 can also inactivate these Virus prevents it from infecting host cell again.The present embodiment determines that F9170 derives from it to virus for the inhibitory effect of virus Deactivation.
Inactivation activities (EC of the table 4:F9170 to different HIV-1 clinical strain50)
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>Shanxi Jin Bo Biomedics Inc.
Fudan University
<120>polypeptide, preparation method and the purposes for inhibiting AIDS virus
<130> 1
<160> 30
<170> PatentIn version 3.3
<210> 1
<211> 15
<212> PRT
<213>human immunodeficiency virus
<220>
<221> misc_feature
<222> (1)..(1)
<223>Xaa can be any naturally occurring amino acid
<220>
<221> misc_feature
<222> (6)..(6)
<223>Xaa can be any naturally occurring amino acid
<400> 1
Xaa Trp Glu Ala Leu Xaa Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 2
<211> 15
<212> PRT
<213>human immunodeficiency virus
<400> 2
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 3
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 3
Ala Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 4
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 4
Gly Ala Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 5
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 5
Gly Trp Ala Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 6
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 6
Gly Trp Glu Glu Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 7
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 7
Gly Trp Glu Ala Ala Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 8
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 8
Gly Trp Glu Ala Leu Ala Tyr Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 9
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 9
Gly Trp Glu Ala Leu Lys Ala Leu Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 10
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 10
Gly Trp Glu Ala Leu Lys Tyr Ala Trp Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 11
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 11
Gly Trp Glu Ala Leu Lys Tyr Leu Ala Asn Leu Leu Gln Tyr Trp
1 5 10 15
<210> 12
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 12
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Ala Leu Leu Gln Tyr Trp
1 5 10 15
<210> 13
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 13
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Ala Leu Gln Tyr Trp
1 5 10 15
<210> 14
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 14
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Ala Gln Tyr Trp
1 5 10 15
<210> 15
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 15
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Ala Tyr Trp
1 5 10 15
<210> 16
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 16
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Ala Trp
1 5 10 15
<210> 17
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 mutant
<400> 17
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Ala
1 5 10 15
<210> 18
<211> 36
<212> PRT
<213>human immunodeficiency virus
<400> 18
Tyr Thr Ser Leu Ile His Ser Leu Ile Glu Glu Ser Gln Asn Gln Gln
1 5 10 15
Glu Lys Asn Glu Gln Glu Leu Leu Glu Leu Asp Lys Trp Ala Ser Leu
20 25 30
Trp Asn Trp Phe
35
<210> 19
<211> 480
<212> PRT
<213>human immunodeficiency virus
<400> 19
Glu Glu Lys Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys
1 5 10 15
Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Arg Lys Ala Tyr Asp
20 25 30
Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp
35 40 45
Pro Asn Pro Gln Glu Val Glu Leu Lys Asn Val Thr Glu Asn Phe Asn
50 55 60
Met Trp Lys Asn Asn Met Val Glu Gln Met His Glu Asp Ile Ile Ser
65 70 75 80
Leu Trp Asp Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys
85 90 95
Val Thr Leu Asn Cys Thr Asp Leu Arg Asn Ala Thr Asn Gly Asn Asp
100 105 110
Thr Asn Thr Thr Ser Ser Ser Arg Gly Met Val Gly Gly Gly Glu Met
115 120 125
Lys Asn Cys Ser Phe Asn Ile Thr Thr Asn Ile Arg Gly Lys Val Gln
130 135 140
Lys Glu Tyr Ala Leu Phe Tyr Lys Leu Asp Ile Ala Pro Ile Asp Asn
145 150 155 160
Asn Ser Asn Asn Arg Tyr Arg Leu Ile Ser Cys Asn Thr Ser Val Ile
165 170 175
Thr Gln Ala Cys Pro Lys Val Ser Phe Glu Pro Ile Pro Ile His Tyr
180 185 190
Cys Ala Pro Ala Gly Phe Ala Ile Leu Lys Cys Lys Asp Lys Lys Phe
195 200 205
Asn Gly Lys Gly Pro Cys Thr Asn Val Ser Thr Val Gln Cys Thr His
210 215 220
Gly Ile Arg Pro Val Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu
225 230 235 240
Ala Glu Glu Glu Val Val Ile Arg Ser Ala Asn Phe Ala Asp Asn Ala
245 250 255
Lys Val Ile Ile Val Gln Leu Asn Glu Ser Val Glu Ile Asn Cys Thr
260 265 270
Arg Pro Asn Asn Asn Thr Arg Lys Ser Ile His Ile Gly Pro Gly Arg
275 280 285
Ala Phe Tyr Thr Thr Gly Glu Ile Ile Gly Asp Ile Arg Gln Ala His
290 295 300
Cys Asn Leu Ser Arg Ala Lys Trp Asn Asp Thr Leu Asn Lys Ile Val
305 310 315 320
Ile Lys Leu Arg Glu Gln Phe Gly Asn Lys Thr Ile Val Phe Lys His
325 330 335
Ser Ser Gly Gly Asp Pro Glu Ile Val Thr His Ser Phe Asn Cys Gly
340 345 350
Gly Glu Phe Phe Tyr Cys Asn Ser Thr Gln Leu Phe Asn Ser Thr Trp
355 360 365
Asn Val Thr Glu Glu Ser Asn Asn Thr Val Glu Asn Asn Thr Ile Thr
370 375 380
Leu Pro Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln Glu Val Gly
385 390 395 400
Arg Ala Met Tyr Ala Pro Pro Ile Arg Gly Gln Ile Arg Cys Ser Ser
405 410 415
Asn Ile Thr Gly Leu Leu Leu Thr Arg Asp Gly Gly Pro Glu Asp Asn
420 425 430
Lys Thr Glu Val Phe Arg Pro Gly Gly Gly Asp Met Arg Asp Asn Trp
435 440 445
Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Lys Ile Glu Pro Leu Gly
450 455 460
Val Ala Pro Thr Lys Ala Lys Arg Arg Val Val Gln Arg Glu Lys Arg
465 470 475 480
<210> 20
<211> 636
<212> PRT
<213>human immunodeficiency virus
<400> 20
Asn Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala
1 5 10 15
Lys Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Ala Glu
20 25 30
Val His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn
35 40 45
Pro Gln Glu Met Val Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp
50 55 60
Glu Asn Asp Met Val Glu Gln Met His Gln Asp Ile Ile Ser Leu Trp
65 70 75 80
Asp Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr
85 90 95
Leu His Cys Ser Asn Arg Thr Ile Asp Tyr Asn Asn Arg Thr Asp Asn
100 105 110
Met Gly Gly Glu Ile Lys Asn Cys Ser Phe Asn Met Thr Thr Glu Val
115 120 125
Arg Asp Lys Arg Glu Lys Val His Ala Leu Phe Tyr Arg Leu Asp Ile
130 135 140
Val Pro Leu Lys Asn Glu Ser Ser Asn Thr Ser Gly Asp Tyr Arg Leu
145 150 155 160
Ile Asn Cys Asn Thr Ser Ala Ile Thr Gln Ala Cys Pro Lys Val Ser
165 170 175
Phe Asp Pro Ile Pro Ile His Tyr Cys Ala Pro Ala Gly Tyr Ala Ile
180 185 190
Leu Lys Cys Asn Asn Lys Thr Phe Asn Gly Thr Gly Pro Cys Asn Asn
195 200 205
Val Ser Thr Ile Gln Cys Thr His Gly Thr Lys Pro Val Val Ser Thr
210 215 220
Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg
225 230 235 240
Ser Lys Asn Leu Thr Asp Asn Val Lys Thr Ile Ile Val His Leu Asn
245 250 255
Glu Ser Val Glu Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys
260 265 270
Ser Ile Arg Ile Gly Pro Gly Gln Ala Phe Tyr Ala Thr Gly Glu Ile
275 280 285
Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Arg Thr Ala Trp
290 295 300
Asn Lys Thr Leu Gln Glu Val Gly Lys Lys Leu Ala Glu His Phe Pro
305 310 315 320
Asn Lys Ala Ile Lys Phe Ala Lys His Ser Gly Gly Asp Leu Glu Ile
325 330 335
Thr Thr His Ser Phe Asn Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr
340 345 350
Ser Ser Leu Phe Asn Ser Thr Tyr Thr Pro Asn Ser Thr Glu Asn Ile
355 360 365
Thr Gly Thr Glu Asn Ser Ile Ile Thr Ile Pro Cys Arg Ile Lys Gln
370 375 380
Ile Ile Asn Met Trp Gln Gly Val Gly Arg Ala Met Tyr Ala Pro Pro
385 390 395 400
Ile Glu Gly Ile Leu Thr Cys Arg Ser Asn Ile Thr Gly Leu Leu Leu
405 410 415
Thr Arg Asp Gly Gly Thr Gly Met His Asp Thr Glu Ile Phe Arg Pro
420 425 430
Glu Gly Gly Asp Met Arg Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr
435 440 445
Lys Val Val Glu Ile Lys Pro Leu Gly Ile Ala Pro Thr Lys Ala Lys
450 455 460
Arg Arg Val Val Glu Arg Glu Lys Arg Ala Val Gly Ile Gly Ala Val
465 470 475 480
Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly Ala Ala Ser
485 490 495
Ile Thr Leu Thr Val Gln Val Arg Gln Leu Leu Ser Gly Ile Val Gln
500 505 510
Gln Gln Ser Asn Leu Leu Arg Ala Ile Glu Ala Gln Gln His Met Leu
515 520 525
Gln Leu Thr Val Trp Gly Ile Lys Gln Leu Gln Thr Arg Val Leu Ala
530 535 540
Ile Glu Arg Tyr Leu Arg Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys
545 550 555 560
Ser Gly Lys Leu Ile Cys Thr Thr Ala Val Pro Trp Asn Ser Ser Trp
565 570 575
Ser Asn Arg Ser Gln Glu Asp Ile Trp Asn Asn Met Thr Trp Met Gln
580 585 590
Trp Asp Arg Glu Ile Ser Asn Tyr Thr Asn Thr Ile Tyr Arg Leu Leu
595 600 605
Glu Asp Ser Gln Asn Gln Gln Glu Lys Asn Glu Gln Asp Leu Leu Ala
610 615 620
Leu Asp Lys Trp Gln Asn Leu Trp Thr Trp Phe Gly
625 630 635
<210> 21
<211> 63
<212> PRT
<213>human immunodeficiency virus
<400> 21
Ser Thr Met Gly Ala Ala Ser Met Thr Leu Thr Val Gln Ala Arg Gln
1 5 10 15
Leu Leu Ser Gly Ile Val Gln Gln Gln Asn Asn Leu Leu Arg Ala Ile
20 25 30
Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp Gly Ile Lys Gln
35 40 45
Leu Gln Ala Arg Ile Leu Ala Val Glu Arg Tyr Leu Lys Asp Gln
50 55 60
<210> 22
<211> 34
<212> PRT
<213>human immunodeficiency virus
<400> 22
Trp Met Glu Trp Asp Arg Glu Ile Asn Asn Tyr Thr Ser Leu Ile His
1 5 10 15
Ser Leu Ile Glu Glu Ser Gln Asn Gln Gln Glu Lys Asn Glu Gln Glu
20 25 30
Leu Leu
<210> 23
<211> 16
<212> PRT
<213>human immunodeficiency virus
<400> 23
Ser Leu Trp Asn Trp Phe Asp Ile Thr Asn Trp Leu Trp Tyr Ile Lys
1 5 10 15
<210> 24
<211> 29
<212> PRT
<213>human immunodeficiency virus
<400> 24
Arg Val Ile Glu Val Val Gln Gly Ala Cys Arg Ala Ile Arg His Ile
1 5 10 15
Pro Arg Arg Ile Arg Gln Gly Leu Glu Arg Ile Leu Leu
20 25
<210> 25
<211> 21
<212> PRT
<213>human immunodeficiency virus
<400> 25
Tyr His Arg Leu Arg Asp Leu Leu Leu Ile Val Thr Arg Ile Val Glu
1 5 10 15
Leu Leu Gly Arg Arg
20
<210> 26
<211> 27
<212> PRT
<213>human immunodeficiency virus
<400> 26
Gly Trp Glu Ala Leu Lys Tyr Leu Trp Asn Leu Leu Gln Tyr Trp Ser
1 5 10 15
Gln Glu Leu Lys Asn Ser Ala Val Ser Leu Leu
20 25
<210> 27
<211> 15
<212> PRT
<213>human immunodeficiency virus
<400> 27
Arg Val Ile Glu Val Val Gln Gly Ala Cys Arg Ala Ile Arg His
1 5 10 15
<210> 28
<211> 15
<212> PRT
<213>human immunodeficiency virus
<400> 28
Gly Ala Cys Arg Ala Ile Arg His Ile Pro Arg Arg Ile Arg Gln
1 5 10 15
<210> 29
<211> 15
<212> PRT
<213>human immunodeficiency virus
<400> 29
His Ile Pro Arg Arg Ile Arg Gln Gly Leu Glu Arg Ile Leu Leu
1 5 10 15
<210> 30
<211> 15
<212> PRT
<213>artificial
<220>
<223>F9170 is out-of-order
<400> 30
Leu Trp Leu Glu Leu Ala Asn Lys Gln Gly Tyr Trp Trp Tyr Leu
1 5 10 15
<210> 31
<211> 36
<212> PRT
<213>Middle East respiration syndrome coronavirus
<400> 31
Ser Leu Thr Gln Ile Asn Thr Thr Leu Leu Asp Leu Glu Tyr Glu Met
1 5 10 15
Lys Lys Leu Glu Glu Val Val Lys Lys Leu Glu Glu Ser Tyr Ile Asp
20 25 30
Leu Lys Glu Leu
35

Claims (10)

1. polypeptide, the polypeptide includes amino acid sequence shown in following general formula:
X-W/A-E/A-A/E-L/A-X-Y/A-L/A-W/A-N/A-L/A-L/A-Q/A-Y/A-W/A；
It is preferred that with amino acid sequence shown in SEQ ID NO:1: X-W-E-A-L-X-Y-L-W-N-L-L-Q-Y-W；
Wherein X indicates any amino acid, preferably G or A or has the amino acid residue of similar characteristic with them；Symbol "-" table Show the peptide bond between amino acid residue, amino acid shown in the expression of symbol "/" can be used interchangeably or the derivative of the polypeptide, Stereoisomer or salt.
2. polypeptide according to claim 1, it includes with amino acid sequence shown in SEQ ID NO:2: GWEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:3: AWEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:4: GAEALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:5: GWAALKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:6: GWEELKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:7: GWEAAKYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:8: GWEALAYLWNLLQYW；
With amino acid sequence shown in SEQ ID NO:9: GWEALKALWNLLQYW；
With amino acid sequence shown in SEQ ID NO:10: GWEALKYAWNLLQYW；
With amino acid sequence shown in SEQ ID NO:11: GWEALKYLANLLQYW；
With amino acid sequence shown in SEQ ID NO:12: GWEALKYLWALLQYW；
With amino acid sequence shown in SEQ ID NO:13: GWEALKYLWNALQYW；
With amino acid sequence shown in SEQ ID NO:14: GWEALKYLWNLAQYW；
With amino acid sequence shown in SEQ ID NO:15: GWEALKYLWNLLAYW；
With amino acid sequence shown in SEQ ID NO:16: GWEALKYLWNLLQAW；Or
With amino acid sequence shown in SEQ ID NO:17: GWEALKYLWNLLQYA；
Or derivative, stereoisomer or the salt of the polypeptide, it is preferable that the polypeptide is comprising (1) and with SEQ ID NO:1- In 17 it is any shown in amino acid sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 93%, 94% or 95% identical amino acid sequence or (2) to replace in amino acid sequence shown in any in SEQ ID NO:1-17, addition, It lacks or is inserted into one or more, the amino acid sequence of preferably 2,3,4 or 5 amino acid residues, the preferably conservative ammonia of the substitution Base acid replaces, and condition is described intracellular section of polypeptid specificity combination HIV envelope protein, preferably comprising with SEQ ID NO:28 institute Lentivirus lytic peptide -1LLP1 the structural domain of the amino acid sequence shown, and preferably destroy lipid bilayer, preferably inhibition of HIV Particle envelope and host cell membrane by HIV infection, and cause inhibition of HIV particle, HIV infection cell and activation The cracking of HIV latent cells.
3. the derivative of polypeptide according to claim 1 or 2 or the polypeptide, stereoisomer or salt, wherein described spread out Biology is selected from: through the amine-modified obtained derivative of maleimide；Aminoterminal protecting group and/or carboxyl terminal are connected in amino terminal The derivative that connection c-terminus protecting group obtains；Through protein or polyethyleneglycol modified obtained derivative；Amino terminal and/ Or the derivative that carboxyl terminal connection oligopeptides or lipophilic group or cholesterol obtain；Or be the amino acid of D- type with conformation, The derivative that rare amino acid existing for manually modified amino acid and nature obtains after replacing；
Wherein preferably, the aminoterminal protecting group be acetyl group, amino, maleoyl, succinyl group, tertbutyloxycarbonyl or Benzyl or other hydrophobic groupings, the c-terminus protecting group are NH2, carboxyl, amide groups, tertbutyloxycarbonyl or other hydrophobicity bases Group；
Preferably, the oligopeptides includes 2-10 amino acid, and the lipophilic group is the fatty acid containing 3-20 carbon atom Chain, the salt are preferably selected from the salt in specification.
4. fusion protein, pharmaceutical composition or conjugate, wherein the fusion protein includes according to claim 1 or 2 The derivative of polypeptide or the polypeptide, stereoisomer or salt and another protein for treating or preventing HIV infection, example As with protein shown in SEQ ID NO:18, or it is directed to intracellular section of HIV envelope protein, preferably included with SEQ ID NO:28 Shown in amino acid sequence lentivirus lytic peptide -1LLP1 structural domain antibody；Described pharmaceutical composition includes to be wanted according to right The one kind or more listed in the derivative of polypeptide described in asking 1 or 2 or the polypeptide, stereoisomer or salt and optional table 2 Kind HIV therapy agent or HIV latent cells activator；The conjugate includes polypeptide according to claim 1 or 2 or described Derivative, stereoisomer or the salt and carrier protein of polypeptide, wherein the carrier protein is selected from seralbumin, immune globulin White, ferritin, transferrins, α -2- macroglobulin, Thyroxine binding protein and steroid binding protein；
Wherein the fusion protein or conjugate specifically bind intracellular section of HIV envelope protein, preferably comprising with SEQ ID Lentivirus lytic peptide -1LLP1 the structural domain of amino acid sequence shown in NO:28, and lipid bilayer is preferably destroyed, preferably Inhibition of HIV particle envelope and host cell membrane by HIV infection, and cause inhibition of HIV particle, HIV infection cell and The cracking of the HIV latent cells of activation.
5. nucleotide sequence encodes polypeptide according to any one of claim 1-3 or fusion according to claim 4 Albumen.
6. carrier, it includes nucleotide sequences according to claim 5.
7. host cell, it includes carriers according to claim 6.
8. generating derivative, stereoisomer or the salt of polypeptide according to any one of claim 1-3 or the polypeptide Or the method for fusion protein according to claim 4 comprising:
It (1) will be in vector introduction host cell according to claim 6；
(2) host cell is cultivated in suitable culture medium；And
(3) it harvests and separates the derivative of polypeptide according to any one of claim 1-3 or the polypeptide, alloisomerism Body or salt or fusion protein according to claim 4；Or
Derivative, the solid for chemically synthesizing polypeptide according to any one of claim 1-3 or the polypeptide are different Structure body or salt or fusion protein according to claim 4.
9. the derivative of polypeptide according to any one of claim 1-3 or the polypeptide, stereoisomer or salt, basis Fusion protein, pharmaceutical composition or conjugate as claimed in claim 4, nucleotide according to claim 5, according to right It is required that carrier described in 6, host cell according to claim 7 and optional another HIV therapy reagent are preparing medicine Purposes in object, the drug are used to treating or preventing and/or assisting in the treatment of disease caused by HIV infection, such as AIDS, wherein It is described another kind reagent be the one or more HIV therapy agent listed in table 2, wherein the dosage form of the drug be preferably tablet, Capsule, dripping pill, aerosol, pill, pulvis, solution, suspension, emulsion, granule, liposome, transdermal agent, buccal tablet, bolt Agent, freeze drying powder injection, the drug are preferably administered in the following manner: drug administration by injection, including subcutaneous injection, intravenous injection, flesh Meat injection and intraperitoneal injection, intracisternal injection or implantation etc., cavity/canal drug administration, such as per rectum, vagina and sublingual, respiratory tract administration, Such as via intranasal application；Mucosa delivery or surface administration；The drug is preferably used as HIV prophylactic agent.
10. according to the derivative of polypeptide according to any one of claim 1-3 or the polypeptide, stereoisomer or Salt, fusion protein according to claim 4, pharmaceutical composition or conjugate, nucleotide according to claim 5, Carrier, host cell according to claim 7 and optional another reagent according to claim 6 are used in vitro In any one of following purposes:
(1) inhibit HIV infection；
(2) HIV is cracked；
(3) cell of HIV infection is cracked；
(4) the HIV latent cells of cracking activation,
(5) preparation has the external inhibition active biological agent of HIV infection,
Wherein another reagent is the one or more HIV therapy agent listed in table 2.
CN201811472964.0A 2018-12-04 2018-12-04 Polypeptide, preparation method thereof and application of polypeptide in inhibiting HIV (acquired immune deficiency syndrome virus) Active CN109535232B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811472964.0A CN109535232B (en) 2018-12-04 2018-12-04 Polypeptide, preparation method thereof and application of polypeptide in inhibiting HIV (acquired immune deficiency syndrome virus)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811472964.0A CN109535232B (en) 2018-12-04 2018-12-04 Polypeptide, preparation method thereof and application of polypeptide in inhibiting HIV (acquired immune deficiency syndrome virus)

Publications (2)

Publication Number Publication Date
CN109535232A true CN109535232A (en) 2019-03-29
CN109535232B CN109535232B (en) 2020-03-06

Family

ID=65853669

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811472964.0A Active CN109535232B (en) 2018-12-04 2018-12-04 Polypeptide, preparation method thereof and application of polypeptide in inhibiting HIV (acquired immune deficiency syndrome virus)

Country Status (1)

Country Link
CN (1) CN109535232B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113563433A (en) * 2021-06-04 2021-10-29 复旦大学 Polypeptide, preparation method and application thereof
CN114729008A (en) * 2019-09-13 2022-07-08 奥洛穆茨帕拉茨基大学 Polypeptides that mimic the epitope of broadly neutralizing antibody VRC01 as antigen for vaccines against HIV-1 infection
WO2023024552A1 (en) * 2021-08-23 2023-03-02 山西锦波生物医药股份有限公司 Recombinant type-i humanized collagen polypeptide, and preparation method therefor and use thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020169279A1 (en) * 2001-02-16 2002-11-14 Montelaro Ronald C. Virus derived antimicrobial peptides
CN104788548A (en) * 2014-01-20 2015-07-22 中国人民解放军军事医学科学院毒物药物研究所 Novel anti-HIV infection polypeptide and use thereof
CN106397548A (en) * 2015-07-29 2017-02-15 复旦大学 Polypeptide for inhibiting HIV infection, and pharmaceutical uses thereof
CN106749558A (en) * 2017-02-04 2017-05-31 中国医学科学院病原生物学研究所 Wide spectrum suppresses lipopeptid, its derivative, its medical composition and its use of HIV

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020169279A1 (en) * 2001-02-16 2002-11-14 Montelaro Ronald C. Virus derived antimicrobial peptides
CN104788548A (en) * 2014-01-20 2015-07-22 中国人民解放军军事医学科学院毒物药物研究所 Novel anti-HIV infection polypeptide and use thereof
CN106397548A (en) * 2015-07-29 2017-02-15 复旦大学 Polypeptide for inhibiting HIV infection, and pharmaceutical uses thereof
CN106749558A (en) * 2017-02-04 2017-05-31 中国医学科学院病原生物学研究所 Wide spectrum suppresses lipopeptid, its derivative, its medical composition and its use of HIV

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114729008A (en) * 2019-09-13 2022-07-08 奥洛穆茨帕拉茨基大学 Polypeptides that mimic the epitope of broadly neutralizing antibody VRC01 as antigen for vaccines against HIV-1 infection
CN113563433A (en) * 2021-06-04 2021-10-29 复旦大学 Polypeptide, preparation method and application thereof
WO2023024552A1 (en) * 2021-08-23 2023-03-02 山西锦波生物医药股份有限公司 Recombinant type-i humanized collagen polypeptide, and preparation method therefor and use thereof

Also Published As

Publication number Publication date
CN109535232B (en) 2020-03-06

Similar Documents

Publication Publication Date Title
Zhu et al. Broad-spectrum antiviral agents
Sharpless et al. Human immunodeficiency virus type 1 tropism for brain microglial cells is determined by a region of the env glycoprotein that also controls macrophage tropism
Javaherian et al. The principal neutralization determinant of simian immunodeficiency virus differs from that of human immunodeficiency virus type 1.
JP3587538B2 (en) Synthetic polypeptides as inhibitors of HIV-1
CN109535232A (en) Polypeptide, preparation method and the purposes for inhibiting AIDS virus
CN1954066A (en) Cellular and viral inactivation
CN102631666A (en) Preparation method for biological agent for preventing and controlling human papilloma virus infection
US10155947B2 (en) Method for inhibiting Ebola virus via miRNA
Yahi et al. SPC3, a synthetic peptide derived from the V3 domain of human immunodeficiency virus type 1 (HIV-1) gp120, inhibits HIV-1 entry into CD4+ and CD4-cells by two distinct mechanisms.
JP2010209097A (en) Peptide derivative fusion inhibitor of hiv infection
CN108727475A (en) Potent lipopeptid, its derivative, its medical composition and its use for inhibiting HIV
CN106749558A (en) Wide spectrum suppresses lipopeptid, its derivative, its medical composition and its use of HIV
WO2024001265A1 (en) Use of ophiopogonin d in preparing anti-rotavirus medicament
US20120009286A1 (en) Water-soluble antiviral product containing momordica balsamina, for the treatment and prevention of acquired immunodeficiency syndrome (aids) and the variants thereof
CN111574588B (en) Polypeptide and application thereof in resisting Ebola virus
CN102178926B (en) Peptide for preventing or treating liver damage
CN101198692A (en) HIV vaccine
CN104356220B (en) A kind of have AntiHIV1 RT activity Aedes albopictus albumen of anticoagulant function and preparation method thereof
CN103189386B (en) Recombinant human immunodeficiency virus（HIV）Envelope antigen albumen and the vaccine containing it
WO2011014561A1 (en) Extracts of medicinal plant and uses thereof
TWI359669B (en)
CN103709232B (en) A kind ofly suppress the polypeptide of AIDS viral infection activity and relevant phage thereof
JP2023535570A (en) Broad-spectrum antiviral agents against enteroviruses and their applications
CN100390200C (en) Recombinant targeted fusion protein for treating acquired immunodeficiency syndrome
JP4121957B2 (en) Indigo preparation and its use in preventing or treating human immunodeficiency virus infection

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20190729

Address after: 030032 Shanxi city of Taiyuan province by the economic and Technological Development Zone No. 18 North Street

Applicant after: Shanxi Jin Bo Biomedics Inc.

Address before: 030032 Shanxi city of Taiyuan province by the economic and Technological Development Zone No. 18 North Street

Applicant before: Shanxi Jin Bo Biomedics Inc.

Applicant before: Fudan University

GR01 Patent grant
GR01 Patent grant
CP02 Change in the address of a patent holder
CP02 Change in the address of a patent holder

Address after: 030032 No.18, Jinbo street, Tanghuai Park, Taiyuan comprehensive reform demonstration zone, Taiyuan City, Shanxi Province

Patentee after: SHANXI JINBO BIOMEDICAL Co.,Ltd.

Address before: 030032 Shanxi city of Taiyuan province by the economic and Technological Development Zone No. 18 North Street

Patentee before: SHANXI JINBO BIOMEDICAL Co.,Ltd.