EP1390401A2 - Antigene von plasmodium falciparum und ihre verwendung als impfstoff und zur diagnose - Google Patents

Antigene von plasmodium falciparum und ihre verwendung als impfstoff und zur diagnose

Info

Publication number
EP1390401A2
EP1390401A2 EP02732872A EP02732872A EP1390401A2 EP 1390401 A2 EP1390401 A2 EP 1390401A2 EP 02732872 A EP02732872 A EP 02732872A EP 02732872 A EP02732872 A EP 02732872A EP 1390401 A2 EP1390401 A2 EP 1390401A2
Authority
EP
European Patent Office
Prior art keywords
malaria
seq
salsa
antibodies
sporozoites
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02732872A
Other languages
English (en)
French (fr)
Inventor
Pierre Druilhe
Anne-Charlotte GRÜNER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur de Lille
Original Assignee
Institut Pasteur de Lille
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from CA002345206A external-priority patent/CA2345206A1/fr
Priority claimed from CA002346968A external-priority patent/CA2346968A1/fr
Application filed by Institut Pasteur de Lille filed Critical Institut Pasteur de Lille
Publication of EP1390401A2 publication Critical patent/EP1390401A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445—Plasmodium
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to novel antigens of
  • Plasmodium falciparum and their vaccine and diagnostic applications More particularly, the present invention relates to immunogenic polynucleotide and polypeptide molecules, compositions comprising them, and methods of diagnosis and vaccination of malaria.
  • Malaria is a disease caused by the infection of protozoan parasites belonging to the apicomplexes of the Plasmodium species and transmitted by females of mosquitoes of the genus Anopheles.
  • WHO has ranked malaria among the three infectious diseases of major interest for global public health on the same level as tuberculosis and AIDS, there is not yet an effective vaccine against this disease. sickness.
  • the present invention relates to new polynucleotide and polypeptide molecules specific for the preerythrocytic stages and to their uses as active principle of anti-malaria vaccine or in methods of diagnosing the disease.
  • the Applicant has identified a series of 120 fragments of genomic DNA coding for proteins expressed at the pre-erythrocytic stages, that is to say at the sporozoite stage and / or at the hepatic stage.
  • the characterisation initial of this series of clones led to identify the antigen LSA-1, then SALSA, then STARP, then LSA-3.
  • More recent work on 10 fragments of the same bank of clones coding for pre-erythrocytic stages has made it possible to provide details concerning 8 of them, 3 have turned out to be genes already known to be expressed at the erythrocytic stage and the other 5 as new genes not described to date, and whose expression at the pre-erythrocytic stages has been confirmed.
  • DG747 and DG772 have several remarkable properties: they generate cellular responses to high levels of Interferon- ⁇ , detected by ELISPOT in volunteers protected by irradiated sporozoites, which are also found for several regions of the LSA-3 antigen but which are absent for 4 regions of the LSA-1 antigen, two of SALSA, two of STARP and two of the "CircumSporozoite protein". These same two clones are also positive in the same tests in chimpanzees protected by irradiated sporozoites.
  • the differential response profile between protected chimpanzees and those of chimpanzees having received sporozoites irradiated at too high a dose, and unprotected, is identical to that recorded with the molecule LSA-3 which is capable of inducing protection.
  • This response profile corresponds, according to work carried out in rodents, to the ability to induce specific cellular recruitment at the intrahepatic level.
  • the complete sequence of the two genes has been identified.
  • the corresponding proteins have a high antigenicity in individuals exposed to the parasite in the endemic area (reaction in 80% of adults in the endemic area). Their location on the surface of the sporozoite and their production during the intrahepatic maturation of the parasite was confirmed by various biological methods. Their immunogenicity in animals in the form of recombinant proteins, or in the form of plasmids (genetic immunization) has been demonstrated.
  • one aspect of the present invention relates to an isolated or purified polynucleotide comprising a nucleotide sequence having at least 60%, preferably at least 80% and more preferably at least 95% of identity with SEQ ID NO: 1 (DG747 ) or SEQ ID NO: 2 (DG772).
  • Another aspect of the present invention relates to an isolated or purified polynucleotide comprising at least 10 consecutive nucleotides identical to SEQ ID NO: 1 or SEQ ID NO: 2.
  • the invention also relates to isolated or purified polynucleotides which hybridize in high stringency conditions with a polynucleotide as defined above.
  • polypeptide of the invention has at least 60%, preferably at least 80% and more preferably at least 95% of homology with SEQ ID NO: 3 (DG747) or SEQ ID NO: 4 (DG772).
  • the polypeptide of the invention comprises at least 5 consecutive amino acids identical to one of SEQ ID NOs: 3 to 8.
  • the polypeptide of the invention has at least 40%, preferably at least 60%, more preferably at least 80% and even more preferably at least 95% identity with one of the SEQ ID NOs: 3 to 8, 10 and 12.
  • the invention covers also the recombinant or chimeric polypeptides comprising at least one polypeptide as defined above.
  • Another aspect of the present invention relates to an isolated or purified antigen consisting of a polynucleotide or a polypeptide as defined above.
  • the present invention relates to an antigenic conjugate consisting of a polynucleotide and / or a polypeptide as defined above; and a support on which said polynucleotides / polypeptides are adsorbed.
  • a conjugate can advantageously be used for immunization of individuals infected or likely to be infected with malaria.
  • Another aspect of the present invention relates to monoclonal or polyclonal antibodies, preferably humanized, specifically recognizing at least one of the polynucleotides, polypeptides and / or conjugates defined above.
  • a related aspect of the present invention relates to pharmaceutical compositions which comprise as active substance one or more of these polyclonal or monoclonal antibodies, in association with an acceptable pharmaceutical carrier.
  • the present invention relates to a cloning or expression vector (such as plasmids, cosmids and phages) comprising a polynucleotide sequence according to the present invention.
  • the invention also covers the host cells comprising such a vector, and more particularly the recombinant E.Coli cells deposited at the C.N.C.M. on May 23, 2001 under accession numbers 1-2671 and I-2672.
  • Another aspect of the present invention relates to an immunogenic composition
  • an immunogenic composition comprising polynucleotides, polypeptides and / or conjugates as defined above; and an acceptable pharmaceutical vehicle.
  • compositions and vaccines of the present invention are used for the manufacture of medicaments for the prevention and / or treatment of malaria.
  • the present invention relates to methods and kits (kits) for in vitro diagnosis of malaria in an individual susceptible to infection by Plasmodium falciparum.
  • the method comprises the following steps: a) bringing into contact, under conditions allowing an immunological reaction, a tissue and / or a biological fluid taken from an individual susceptible to being infected by Plasmodium falciparum with a antibodies as defined above to allow the formation of immune complexes; and b) in vitro detection of the immune complexes formed.
  • the diagnostic method comprises the following steps: a) bringing into contact, under conditions allowing an immunological reaction, a tissue and / or a biological fluid taken from an individual susceptible to 'be infected with Plasmodium falciparum with polynucleotides, polypeptides, and / or as defined above, in order to allow the formation of immune complexes involving at least one of said elements and antibodies possibly present in said tissue or said biological fluid; and b) the in vitro detection of the immune complexes possibly formed.
  • the kit of the invention for the in vitro diagnosis of malaria comprises the following elements: a) - at least one of the elements chosen from the group consisting of: polynucleotides, polypeptides, and conjugates such as defined above; b) reagents for constituting a medium suitable for a bonding reaction between a sample to be tested and at least one of the elements defined in (a); and c) reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents may also carry a label or be capable of being recognized in turn by a labeled reagent.
  • the kit of the invention comprises the following elements:
  • reagents for the constitution of a medium suitable for a binding reaction between a test sample and at least one of said antibodies; and - reagents for the detection of antigen-antibody complexes produced by said binding reaction these reagents can also carry a marker or be capable of being recognized in turn by a labeled reagent.
  • One of the major advantages of the present invention is that it provides new polynucleotide and polypeptide molecules specific for the preerythrocytic stages of malaria.
  • the polynucleotide and polypeptide molecules of the invention have several remarkable properties. In particular, they generate cellular responses to a high rate of interferon- ⁇ .
  • the results obtained also suggest that the polynucleotide and polypeptide molecules of the invention have the capacity to induce specific cell recruitment at the intrahepatic level.
  • the invention also provides effective malaria vaccines and methods for sensitive diagnosis of malaria.
  • Figures 1A, 1B, 1C and 1D show the list of nucleotide (SEQ ID NOs: 1 and 2) and amino acid sequences (SEQ ID NOs: 3 and 4) of DG747 and DG772.
  • Figure 1E shows degenerate repeated sequences characteristic of the clone DG747 (SEQ ID NOs: 5-8).
  • Figure 2A shows the sequence of the gene encoding DG747 (SEQ ID NO: 1
  • Plasmodium falciparum (Gene PfB00155). Gray (
  • Figure 2B shows the sequence of the gene encoding DG772 (SEQ ID NO: 1
  • Figures 3.1 (a) and 3.1 (b) are schematic representations of the proteins corresponding to DG747 (a) and DG772 (b).
  • the full arrows indicate the location of the primers used for the study of the conservation of the fragments.
  • the empty arrows indicate the primers used in the RT-PCR reaction.
  • the dotted part represents the supposed transmembrane and non-transcribed regions.
  • Figures 3.2A, 3.2B, 3.2C and 3.2D show IFATs of the sporozoite and blood stages of P. falciparum and the sporozoites of P. yoelii with anti-DG747 or anti-DG772 antibodies.
  • Fig. 3.2A, Fig. 3.2B sporozoite of P. falciparum (A) or P. yoelii (B) labeled with anti-747 or anti-772;
  • Fig. 3.2C, Fig. 3.2D asynchronous blood stage marked with anti-747 (C) or anti-772 (D); a, t, s: ring, trophozoite or schizont forms, respectively.
  • Figures 3.3 (a) and 3.3 (b) show Western blots of P. falciparum, P. yoelii and P. berghei using anti-His 6 -747 (a) and anti-His 6 -772 (b) antibodies .
  • Line 1 P. falciparum sporozoites
  • Line 2 P. falciparum blood stage ring shapes
  • Line 3 P. falciparum blood stage schizont forms
  • Line 4 asynchronous culture supernatant
  • Line 5 Human red blood cells
  • Line 6 P. yoelii sporozoites
  • Line 7 P. yoelii blood stage
  • Line 8 P. berghei blood stage
  • 9 Red blood cells of mice.
  • Figures 3.4 (a), 3.4 (b) and 3.4 (c) show in the form of photographs the DNA PCR results of 12 different strains with specific primers of DG747 3.4 (a) and DG772 3.4 (b).
  • the control, 3.4 (c) is a constituent gene, the PCNA [Kilbey, 1993 # 519].
  • the DNAs used come from the strains: NF54, B1, F32, D7, D25, D28, D41, D50, D51, H1, L1, Mad20, T9.96, PA (wells 1 to 14, from left to right). Well 15 does not contain DNA.
  • the size of the PCR product, corresponding to that expected is indicated next to the arrows.
  • Figures 3.5 (a) and 3.5 (b) graphically illustrate the prevalence of humoral responses against His 6 -747 (a) and His 6 -772 (b) in two age groups and in two areas d different endemic.
  • Figures 3.6 (a) and 3.6 (b) graphically illustrate the cellular responses against His 6 -747 and His 6 -772 in humans and chimpanzees immunized with irradiated sporozoites.
  • Fig. 3.6a Detection by Elispot of the secretion of IFN- ⁇ from cells from humans immunized with irradiated sporozoites; Fig.
  • 3.6b cellular responses of chimpanzees immunized by irradiated sporozoites, detected by stimulation of proliferation of T lymphocytes and secretion of IFN- ⁇ (by assay and Elispots).
  • IS Stimulation index
  • Ul International Units
  • LC Leukocytes (mononuclear cells of peripheral blood). His 6 " 729, PC-pGEX: Recombinants belonging to the LSA3 protein; pGEX: GST protein.
  • the threshold values are indicated by a horizontal line on the graph.
  • Figures 3.7 (a) and 3.7 (b) illustrate with graphs the distribution of IgG isotypes in the humoral responses against His 6 -747 and His 6 -772 of individuals differentially exposed to malaria.
  • ISS Volunteers immunized with irradiated sporozoites; SHI: Hyperimmune serum; Transfusion: Serum of people who contracted malaria by transfusion of infected blood. The response rates detected in ELISA are represented in relation to the total IgG levels obtained. The standard deviation is shown on the graph.
  • Figures 3.8 (a) and 3.8 (b) graphically illustrate the humoral responses of mice immunized with four formulations of recombinant proteins.
  • Fig. 3.8a anti-747 responses
  • Fig. 3.8b anti-772 responses
  • SB with the adjuvant SBS2A
  • micro recombinant adsorbed on microparticles
  • IFA Freund's incomplete adjuvant
  • Vi In the form of DNA in the vector VR1020 in PBS.
  • the originality of the present invention relates to the discovery of new polynucleotide and polypeptide molecules specific to the pre-erythrocytic stage of malaria and to their uses as active principle of malaria vaccine or in methods of diagnosing the disease. .
  • the invention relates to polynucleotides having a nucleotide sequence of at least 10, 20, 30, 40, 50, 75, 100, 150, or 200 consecutive nucleotides and having at least 60%, 65%, 70%, 75% preferably
  • SEQ. ID NO: 1 or NO 2 80%, 85%, 90% and more preferably at least 95%, 97% or even 100% identity with the SEQ. ID NO: 1 or NO 2.
  • Other molecules according to the invention hybridizes under high stringency conditions with the above nucleotide sequences, and more particularly with SEQs. ID NOs: 1 and / or NO 2.
  • conditions of high stringency the following method is found: a) pre-hybridization and hybridization at 68 ° C in a solution containing: 5X
  • the invention also relates to the polypeptides (and fragments thereof) which derive from the above-mentioned nucleotide sequences and preferably the polypeptides having at least 10, 20, 30, 40, 50, 75, 100, 150, or 200 consecutive amino acids and at least 60%, 70%, 80%, 85% and more preferably at least 90%, 95%, 97% or even 100% homology with one of the sequences chosen from the group consisting of SEQ ID NOs: 3 to 8, 10 and 12.
  • Other molecules according to the invention contain at least 10, 20, 30, 40, 50, 75, 100, 150, or even 200 consecutive amino acids having at least 60% , 70%, 80%, 85% and more preferably at least 90%, 95%, 97% or even 100% identity with SEQ ID NOs: 3 to 8, 10 and 12.
  • a method for aligning nucleotide and peptide sequences according to the invention is advantageously the GAP program GCG TM (Genetic Computer Group) of the UNIX TM programming manual (Wisconsin Sequence Analysis Package TM), algorithm by Needieman and Wunsch.
  • the peptides according to the present invention can be prepared by any suitable method. They can in particular be obtained by chemical synthesis, but it is also possible to obtain them by biological means, in particular by using different vectors in appropriate cell cultures as will be described below.
  • the molecules of the invention can be used as they are or can be modified (chemical conjugates, fusion protein) if necessary.
  • modifications chemical or nucleotide or peptide
  • the nucleotides / peptides can cross certain biological barriers, to show better solubilization, to facilitate their incorporation in particular galenical forms such as for example liposomes or microparticles.
  • the peptides according to the present invention can be in deglycosylated or glycosylated form, if necessary.
  • a person skilled in the field of the invention will be able to obtain different polynucleotides / polypeptides and he will also be able to determine which of the polynucleotides / polypeptides obtained have those which have adequate biological activity.
  • the subject of the invention is also a process for the preparation of a peptide of the invention, by transformation of a cellular host using an expression vector (plasmid, cosmid, virus, etc.) comprising the DNA sequences coding for the peptides of the invention, followed by the cultivation of the cell host thus transformed, and the recovery of the peptide from the culture medium.
  • an expression vector plasmid, cosmid, virus, etc.
  • the invention therefore therefore also relates to any vector (cloning and / or expression) and any cellular host (prokaryotic or eukaryotic) transformed by such a vector, and comprising the regulatory elements allowing the expression of the nucleotide sequence coding for a peptide according to the invention.
  • the invention relates to recombinant E. Coli cells containing an insert corresponding to the polynucleotides defined by SEQ IDs NOs: 1 and 2. More preferably the E. Coli cells are those which were deposited at the CNCM on May 23, 2001 under accession numbers 1-2671 and I-2672. Briefly, these cells were obtained by transformation of a plasmid containing either an insert corresponding to the polynucleotides defined by SEQ ID NO: 1, or an insert corresponding to the polynucleotides defined by SEQ ID NO: 2. in the E. Coli Dh5 strain. Each of the plasmids was obtained from a recombinant phage ⁇ gtl 1 containing the insert. A PCR was carried out with primers flanking the insert and this amplified insert was digested with EcoR1 and subcloned into the vector pTreHis ⁇ (Invitrogen) in the EcoR sites
  • vectors for the expression of proteins and peptides in the cells of a host in particular the human, is known and will not be described in more detail. It may be advantageous to use vectors incorporating sequences capable of increasing the immunogenicity of the polynucleotides / polypeptides of the present invention, such as the CPG sequences, the GMCSF (Granulocyte Macrophage Colony Stimulating Factor) gene or cytokine genes .
  • CPG sequences the CPG sequences
  • GMCSF Gramulocyte Macrophage Colony Stimulating Factor
  • the peptides of the present invention and the polynucleotides encoding them can also be used to prepare polyclonal or monoclonal antibodies capable of binding (preferably specifically) to at least one peptide / polynucleotide object of the invention.
  • the present invention therefore also relates to such purified antibodies which can be obtained by very well known techniques such as for example the technique described by Kolher and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity, Nature (1975), 262: 495 -four hundred ninety seven).
  • the immunogenic peptides / polynucleotides according to the invention is conjugated to a support on which it is absorbed or fixed covalently or non-covalently at its C end and / or N-terminal.
  • the support can consist of carrier molecules (natural or synthetic), physiologically acceptable and non-toxic. These carrier molecules can allow in particular to increase the immunogenicity of the peptides of the invention by means of complementary reactive groups carried respectively by the carrier molecule and the peptide.
  • carrier molecules include natural proteins such as tetanus toxoid, ovalbumin, serum albumin, hemocyamines, PPD (purified protein derivative) of tuberculin, etc.
  • polylysines or poly (DL-alanine) -poly (L-lysine) will be mentioned, for example.
  • hydrocarbon or lipid carriers mention will be made of saturated or unsaturated fatty acids.
  • the support can also take the form of liposomes, particles and microparticles, vesicles, microspheres of latex beads, polyphosphoglycans (PGLA), or polystyrene.
  • the invention also relates to vaccine / therapeutic (drug) compositions comprising peptides / polynucleotides, conjugates and / or polyclonal or monoclonal antibodies as described above, and an acceptable pharmaceutical carrier.
  • the invention also relates to immunogenic compositions capable of inducing protection by a challenge infection by Plasmodiums, both in vivo and in vitro and, preferably, protection by a challenge infection by Plasmodium falciparum.
  • compositions according to the invention allow the production of interferon- ⁇ by leukocytes from subjects immunized by irradiated sporozoites and / or the obtaining of an IgG humoral response of the lgG1, lgG2, lgG3 and / or lgG4 type.
  • compositions may be advantageous for the purpose of being administered in vivo for the treatment or prevention of malaria in humans.
  • use of antibody-based compositions generally requires that these be compatible with administration to humans. They may in particular be antibodies humanized by known techniques or directly expressed in situ from the DNA sequence, for example the technique described in Ren EC, Cellular and Molecular approaches to developping human monoclonal antibodies as drugs (1991 ), Ann. Acad. Med. Singapore, 20: 66-70.
  • the compositions according to the present invention can be in any solid or liquid form customary for pharmaceutical administration, that is to say for example forms of liquid administration, in gel, or any other support allowing for example the controlled release.
  • injectable compositions more particularly intended for injections into the blood circulation in humans.
  • compositions of the invention may also contain components increasing or capable of increasing the immunogenicity of the peptides, in particular other immunogenic peptides, specific or non-specific immunity adjuvants such as alum, QS21, the adjuvant de Freund, the adjuvant SBA 2 , montanide, polysaccharides or equivalent compounds.
  • specific or non-specific immunity adjuvants such as alum, QS21, the adjuvant de Freund, the adjuvant SBA 2 , montanide, polysaccharides or equivalent compounds.
  • the present invention further relates to compositions for administration in order to express in situ the peptides described above.
  • compositions for administration in order to express in situ the peptides described above.
  • this injection leads, in a certain number of cases, to the expression of the coded peptide and to an immune response against said peptide.
  • naked DNA systems but comprising their own expression system or expression vectors as described above.
  • Expression vectors are capable, in certain cases, of improving the activity of the expressed peptides.
  • Vaccination systems using DNA sequences are known and are already widely described in the literature.
  • the invention also relates to methods of in vitro diagnosis of malaria in an individual susceptible to infection by Plasmodium falciparum.
  • the method comprises the following steps: a) bringing into contact, under conditions allowing an immunological reaction, a tissue or a biological fluid taken from a individual likely to be infected with Plasmodium falciparum with an antibody as described above in order to allow the formation of immune complexes; and b) in vitro detection of the immune complexes formed.
  • the diagnostic method comprises the following steps: a) bringing into contact, under conditions allowing an immunological reaction, a tissue or a biological fluid taken from an individual capable of be infected with Plasmodium falciparum with polynucleotide / polypeptide molecules as described above in order to allow the formation of immune complexes involving at least one of said molecules and antibodies possibly present in said tissue or said biological fluid; and b) the in vitro detection of the immune complexes possibly formed.
  • kits for the diagnosis of malaria in an individual.
  • the kit comprises the following elements: a) at least one of the elements chosen from the group consisting of: polynucleotide molecules; polypeptide molecules and conjugates as described above; b) reagents for constituting a medium suitable for a bonding reaction between a test sample and at least one of the molecules defined in (a); and c) reagents for the detection of antigen-antibody complexes produced by said binding reaction, these reagents may also carry a label or be capable of being recognized in turn by a labeled reagent.
  • the kit comprises the following elements: - antibodies as described above;
  • these reagents can also carry a marker or be capable of being recognized in turn by a labeled reagent
  • a marker or be capable of being recognized in turn by a labeled reagent
  • the present invention also covers immunogenic polymers comprising between two and ten peptides chosen from the polypeptides defined above.
  • the present invention includes oligonucleotides having a nucleotide sequence coding for oligonucleotides incorporating one or more polynucleotides as defined above.
  • Malaria is a disease caused by the infection of protozoan parasites belonging to the apicomplexes of the Plasmodium species and transmitted by females of mosquitoes of the genus Anopheles.
  • the sustained efforts and the eradication program started in the 1950s, funded by WHO, allowed to limit the areas where the disease spread and to reduce the number of infected people. Since then, the decline in the effectiveness of the means of combating the parasite has caused an increase in malaria cases compared to 20 years ago.
  • Today malaria remains concentrated in the subtropical belt where between 300 and 500 million clinical cases are recorded annually, of which at least 3 million succumb mainly due to infection by P. falciparum.
  • POMS Following the appearance and extension of global resistance to effective drugs only, and because the regions affected are expanding, POMS has classified, since 1998, malaria among the three infectious diseases of major interest for the global public health on a par with tuberculosis and AIDS.
  • Natural immunity against malaria is characterized by very slow development and the fact that it does not lead to sterilizing protection.
  • the acquisition of natural immunity against erythrocytic stages is manifested in children first by tolerance to the parasite (anti-toxic immunity) then with age by a reduction in the parasitic load in the blood (anti-parasitic immunity).
  • the hepatic stage has unique characteristics.
  • the hepatocyte is a very active metabolically nucleated cell and expresses molecules of the major histocompatibility complex.
  • Hepatic schizogony leads to the formation of between 10,000 and 30,000 merozoites while 4 to 32 merozoites are released by a blood schizont.
  • Merozoites from these two stages have morphological differences, but it is not known whether there are functional or molecular differences, since only blood merozoites have been extensively studied.
  • stage-specific antigens The first strategy for establishing stage-specific expression is the generation of complementary DNA libraries from messenger RNAs of the different stages. This has been done several times in the blood stages (Chakrabarti et al., 1994; Watanabe et al., 2001) and more recently once in the sporozoite stage (Fidock et al., 2000). However, this approach is not possible for the hepatic stage of human parasites. Another way is the generation of specific antibodies in animal models. This is easy in the erythrocytic stages but for the hepatic stage, several attempts have failed, since injections of hepatic stages of P. falciparum have produced very little antibody in the mice.
  • a final approach is immunological screening based on the use of antibodies from naturally immunized individuals. This approach made it possible to demonstrate for the first time that other antigens than CS were present on the surface of the sporozoite (Galey et al., 1990).
  • LSA-1 Liver Stage Antigen 1
  • SALSA and LSA-3 antigens were selected based on various criteria and characterized at the molecular level (Bottius et al., 1996; Daubersies et al., 2000; Fidock et al., 1994a), and immunologically by L. Benmohammed, K. Brahimi, JP Sauzet and B. Perlaza. (BenMohamed et al., 1997; Perlaza et al., 1998; Sauzet et al., 2001). These antigens are expressed both on the surface of the sporozoite and in the hepatic stage.
  • LSA3 is the only antigen recognized differentially by sera from volunteers or chimpanzees protected by immunization with irradiated sporozoites. It is the only one to have induced long-term sterilizing protection in chimpanzees (Daubersies et al., 2000), and will soon be tested in phase I and II clinical trials.
  • DH5 ⁇ supE ⁇ A ⁇ / acU 169 ( ⁇ 580 / acZ ⁇ M15) hsdRIT recAl gyrAQ ⁇ thi- ⁇ 1 relAl.
  • NF54 from an isolate from a European patient infected in Africa (ATCC MRA151) (Walliker et al., 1987).
  • 3D7 the reference strain used in the genome project, is a clone derived from the strain (ATCC MRA151) (Walliker et al., 1987).
  • the sporozoites are from the NF54 strain and obtained by passage through Anopheles Gambiae REF 2.1.3. PCR from phage extracts or phage DNA
  • the Expand High Fidelity Kit TM (Mannheim Boehringer, Germany) was used as indicated by the supplier with 2 mM of MgCI 2 ⁇ 3.5 units of Taq polymerase, 0.2 mM of deoxyribonucleotides (dNTP), 50 nM of 21 D primers in 5 '( CCTGGAGCCCGTCAGTATCGGCGG; SEQ ID NO: 13) and 26D in 3 '(GGTAGCGACCGGCGCTCAGCTGG; SEQ ID NO: 14) and 2 ⁇ l of purified DNA or phage extract.
  • dNTP deoxyribonucleotides
  • the reaction involved an initial denaturation of 2 minutes at 94 ° C, followed by 35 consecutive cycles of 15 seconds of denaturation at 94 ° C, 30 seconds of hybridization at 50 ° C, and 2 minutes of elongation at 68 ° C .
  • the cyclic circuit was followed by an incubation at 68 ° C for 5 minutes.
  • PCR products having a smear or a very small yield and being of smaller size almost impossible to detect by digesting the DNA of the corresponding phage were cloned through a vector allowing direct cloning of the PCR product without successive digestion of a restriction enzyme using the TopoTA Cloning TM kit (Invitrogen, The Netherlands). Topo cloning was also carried out for the fragments whose sequence we only wanted to determine.
  • PCR products smaller than 1 Kbp were digested, precipitated with ethanol, and resuspended in half of the initial volume of H 2 ⁇ , then digested with 10 U of the restriction enzyme EcoR1, for 1 hour at 37 ° C, drawn on a 2% agarose gel, purified on gel by the gel extraction kit procedure
  • PCRs were performed on an Appligene Crocodile III TM. The products were then analyzed on agarose gel.
  • the PCR positive colonies were inoculated in 3 ml of medium containing the antibiotic corresponding to the vector used (100 ⁇ g / ml ampicillin for Topo and Histidine, 20 ⁇ g / ml kanamycin for the Vical vector) and 2 ml of inoculum were used in the preparation of plasmid DNA with the Qiagen TM Miniprep Kit.
  • the DNA obtained was successively digested with the restriction enzymes used in the cloning and subjected to electrophoresis on an agarose gel, in order to detect the insertion of the fragment.
  • the DNA of the constructs was purified from 2 l of culture of recombinant bacteria, by Qiagen EndoFree Plasmid. Giga TM kit (Qiagen, Germany).
  • the phages were re-amplified on LB agarose dishes, by depositing 5 ⁇ l on Topagar taken with 200 ⁇ l of Y1090 inoculum, and leaving at 37 ° C. overnight.
  • a patch pricked on the dish was incubated with 200 ⁇ l of Y1090 inoculum, left at 37 ° C. with shaking for 15 minutes. Then, 5 ml of medium without antibiotic supplemented with 10 mM of MgSO 4 was added, and the culture left in agitation for 4 hours, until the appearance of lysis. 50 ⁇ l of Chloroform was added, and the whole centrifuged at 7000 g for 10 minutes. After centrifugation, the supernatant released from cell debris was recovered.
  • This stock was used in the production of 500 ml of phage in liquid culture: the equivalent of 7.5 ⁇ 10 8 pfu (units forming plaques) was added to 500 ⁇ l of cells from a culture inoculated on the night of Y1090, and 500 ⁇ l of 10 mM MgC / CaC. Everything was incubated at 37 ° C for 15 minutes, and added to 500 ml of LB medium without antibiotic. The lysis of bacteria observed by the appearance of filaments in the culture was followed until total lysis (4-5 h). Then, the culture was centrifuged at 6000 g for 15 minutes at 4 ° C, the supernatant collected, and stored at 4 ° C overnight.
  • RT-PCR was carried out with the RT-PCR kit from Qiagen (Germany). Primers specific for each gene and located, if possible, in such a way that a distinction can be made between the products derived from amplification of genomic DNA and RNA (around the introns) were used.
  • a first reverse transcription reaction was carried out at 50 ° C. for 30 minutes, then a PCR reaction was carried out, under the same conditions as that described for a parasite DNA PCR with the selected primers, sometimes followed by a second reaction (nested PCR) with primers located in the sequence of the first amplified PCR product.
  • the hybridization temperature varies depending on the primers used (between 50 and 60 ° C).
  • the cell suspension was subjected to sonications of 10 shocks of 1 minute each, and the supernatant containing the recombinant proteins was recovered by centrifugation at 10,000 g for 10 minutes, and filtered at 0.22 ⁇ m.
  • an affinity purification step on a Nickel column was carried out.
  • a 1 ml column (HiTrap TM, Pharmacia, Sweden) was washed as directed by the supplier and 1 ml of NiCI 2 was applied, followed by further washes. Then, the column was washed with 5 ml TU, and the supernatant applied to the column.
  • Optimal conditions were determined with 100 ⁇ l of antigen solution with a concentration of 10, 5 or 1 ⁇ g / ml coated on the plates in 50 mM Carbonate pH 9.6 or 1X PBS pH 7.4 by incubating the plates overnight at 4 ° C. Saturation was carried out, either in PBS supplemented with 3% skim milk, or 1% BSA (calf serum albumin) at room temperature or at 37 ° C for 2 hours. Dilution of sera 100 or 200 times was carried out either with 1.5% PBS / milk or with 1% PBS / BSA, and the incubation was carried out at room temperature or at 37 ° C for 1 h .
  • BSA calf serum albumin
  • variable acrylamide percentage gels (BioRad TM 29.1: 1 ratio) (5, 7.5, 10 or 12%) were used. After migration in Tris / glycine buffer (pH 8.5) with the minigel kit (Biorad, USA) the gels were either stained with Coomassie blue or subjected to transfer onto nitrocellulose filters (0.45 ⁇ m), in the Trans-Blot cell TM (BioRad.)
  • the proteins were visualized by staining with 0.2% Ponceau red in a solution of acetic acid (5%), then the filter was saturated with TBS / 5% skimmed milk for 30 minutes. Immunopurified human antibodies without dilution, and sera diluted 1/100 or 1/200 in TBS / 5% milk / 0.05% Tween TM were incubated for 1 to 2 hours at room temperature. Then, the filter was washed 3 times 10 minutes in 0.05% TBS / Tween TM, and incubated with the antisera coupled with alkaline phosphatase diluted 1/5000, for 30 minutes. After washing in the same buffer, the colored reactions were produced by the addition of NBT (330 ⁇ g / ml) and BCIP (165 ⁇ g / ml) (Promega, Germany) diluted in Tris pH 9 buffer.
  • NBT 330 ⁇ g / ml
  • BCIP 165 ⁇ g / ml
  • the blood smears were fixed for 10 minutes with acetone, and boxes for each sample to be tested were delimited by drawing edges with a Pentel-red marker on the smear.
  • the rest of the technique was identical for the three stages: After fixation, the antibodies to be tested (diluted in PBS) were deposited on each well, cup or cell, and the slide incubated at 37 ° C. in a humid chamber for 1 hour.
  • the slides were washed 3 times 10 minutes in 1 ⁇ PBS, then incubated with an anti-human or mouse anti-IgG IgG (depending on the specific antibodies used), coupled to fluorescein (Alexis) diluted 1/200 in PBS and Evans blue 1/50000, incubated for 30 minutes at 37 ° C in a humid chamber, washed three times in PBS 1X, and covered with a coverslip after a drop of buffer glycerin (PBS 30% glycerol) has been deposited.
  • the slide was read under a microscope at UN (Olympus TM BH2))
  • Protocols a, b and c were mainly applied to obtain specific sera, while protocols b, c and d were used to carry out challenge infections with P. yoelii.
  • 6-week-old female BALB / c mice received a first intraperitoneal injection of 500 ⁇ l, with 1 mixture of 20 ⁇ g of antigen (His 6 -249, His ⁇ - 680, His 6 -747. His 6 -772) , 2 mg / ml Alum (AI (OH) 3 , and incomplete Freund's Adjuvant (AIF), volume in volume, supplemented with 0.9% ⁇ aCI
  • the next 2 injections, each 15 days apart were performed with the same amount of antigen in the same volume, but without AIF, and with methiolate, a preservative, at 0.05%.
  • mice were removed (500 ⁇ l) before the immunization 2 weeks, 1 month and 6 weeks after the first immunization, on EDTA and the plasma recovered and stored at -20 ° C.
  • 6-week-old female BALB / c mice received 3 subcutaneous injections every 15 days at the base of the tail of a mixture consisting of 100 ⁇ l of complete Freund's adjuvant and 10 ⁇ g of antigen (His 6 -114 or His 6 - 662) in 100 ⁇ l of PBS. 1 week after the third injection, the sera of the mice were collected and the responses tested in ELISAs against the recombinant and in IFI on the sporozoites. 18 days after the last injection, the mice underwent challenge infection with P. yoelii sporozoites. c) SBAS 2 (Smith and Klein Beecham adjuvant)
  • mice received three subcutaneous injections at the base of the tail of 100 ⁇ l of a mixture consisting of 57 ⁇ l of adjuvant mixed with 43 ⁇ l of antigen (His 6 -249, His 6 - 747 or His 6 -772) corresponding to 10 ⁇ g, the injections being spaced 3 weeks apart. 10 days after the last immunization, the mice were collected and the corresponding sera collected.
  • mice received three subcutaneous injections at the base of the tail of 100 ⁇ l of a mixture consisting of microbial coatings with the antigen corresponding to 10 ⁇ g, the injections being spaced 3 weeks apart. 10 days after the last immunization, the mice were collected and the corresponding sera collected.
  • 6-week BALB / c and C3H mice were injected 3 times 8 weeks apart intramuscularly with 100 ⁇ l of antigen (pNAK114, pNAK249, pNAK438, pNAK571, pNAK747, pNAK772) in PBS pH 7.4, then a 4th time 12 weeks after the 3rd injection.
  • Blood samples were taken 1 week after the 3rd and 4th immunization on EDTA, and the sera collected after incubation of the sample overnight at 4 ° C.
  • mice Spleens from 3 mice / group were removed after the 4th immunization, and the stimulation of the cellular responses studied. After the fifth boost, 8 weeks after the 4 th injection, the mice underwent challenge infection with P. yoelii sporozoites. 2.2.6. Infection of tests with sporozoites and by blood stage
  • the sporozoites from Anopheles stephensii mosquitoes infected with clone 1.1 of P. yoelii yoelii were obtained by a method (Ozaki et al., 1984) which consists in isolating the rib cage of the mosquito and obtaining it by centrifugation at through glass wool sporozoites, which were washed by successive resuspensions in PBS after centrifugation.
  • mice were infected with P. yoelii sporozoites retro-orbitally with 150 to 200 sporozoites (200 ⁇ l / injection), and the parasitaemia followed by smears from day 3 following infection until the 12th day post- infection, both in immunized animals and in naive mice infected with the same batch of sporozoites.
  • mice The spleens were removed from the mice, the splenocyte suspensions were washed twice in RPMI 1640 TM (Gibco, France) and the cells resuspended at a final concentration of 5 ⁇ 10 6 cells / ml in RPMI supplemented with 100 U / ml penicillin, 2 mM L-glutamine, 10 mM Hepes, 50 ⁇ M ⁇ -mercaptoethanol, 1.5% fetal calf serum (FCS) and 0.5% normal mouse serum. 100 ⁇ l / well of each suspension was distributed in 96-well round bottom plates (Costar, USA) and the recombinant proteins to be tested were added at a concentration of 50 mg / ml.
  • FCS fetal calf serum
  • the cells were harvested in an automatic cell harvester (Skatron Inc., Sterling, VA, USA), and the incorporation of Thymidine 3 H quantified by scintillation. The results are expressed in Stimulation Index (SI) and proliferation was considered positive, when the Sl is above 2.
  • SI Stimulation Index
  • the IFN- ⁇ titers in the culture supernatants were determined by a double capture ELISA method. Maxisorp TM plates (Nunc, Denmark) with flat bottom were coated with a primary mouse anti-IFN- ⁇ rat monoclonal antibody (R4-6A2) (Pharmingen, San Diego, CA) diluted in 0.1 M buffer. carbonate, pH 9.6, and left overnight at 4 ° C. Between each step of the procedure, the plates were washed several times with PBS buffer supplemented with 0.05% Tween TM (PBS-T). Next, the plates were saturated with 3% calf serum albumin (BSA, Sigma Chemicals, St Louis, USA) in PBS-T.
  • R4-6A2 primary mouse anti-IFN- ⁇ rat monoclonal antibody
  • the number of IFN- ⁇ secreting cells was determined in unstimulated splenocytes 40 hours after they were freshly isolated and incubated with the antigens.
  • Microtiter plates (Multiscreen-HA TM, sterile plate, Millipore) were coated with 50 ⁇ l of a solution containing 5 ⁇ g / ml of anti-IFN- ⁇ antibody (18181D TM, Becton Dickinson Co). After one overnight incubation at 4 ° C, the wells were washed and saturated with a solution of 5% FCS. Cell suspensions of 5 ⁇ 10 5 cells / well were incubated with the antigen at 50 ⁇ g / ml in a total volume of 200 ⁇ l for 40 h, at 37 ° C.
  • spots were detected by development of a colored reaction with the BCIP / NBT reagents at 50 ⁇ g / ml at the place where individual cells secreted IFN- ⁇ .
  • the results are expressed as the number of spot-forming cells relative to the 5 x 10 6 splenocytes.
  • Ndiop is located in an endemic area with around 20 infectious bites / year
  • Dielmo in an area with around 150 infectious bites / year.
  • Each serum in one of the two regions corresponds in age and sex to a serum in the other region.
  • Two chimpanzees were immunized either with sporozoites irradiated at 18 kRad, or at 30 kRad by 4 injections of 5 x 10 6 sporozoites each by route intravéneuse. The first 3 immunizations were performed 1 month apart, while the 4 th was performed 4 months after the 3 rd . Their serum and peripheral blood cells were studied in cellular and humoral response tests after 3 immunizations. Both animals were infected by intravenous injection of 4 x 10 4 sporozoites (low dose) each of P. falciparum and only the chimpanzee immunized with sporozoites irradiated at 18 kRad was protected (did not develop blood parasitaemia ).
  • Clones DG 747 and DG772 were selected not only because of the initial criteria set (detection on sporozoites and the hepatic stage, as well as recognition by hyperimmune sera), but because several additional characteristics interested us: DG747 had no cross-reactivity with other PM library proteins, and DG772 had only one cross-reactivity, with LSA1, the only antigen identified as expressed only in the hepatic stage of P. falciparum. In addition, antibodies specific to the two proteins labeled P. yoelii sporozoites. Initial sequencing revealed that these two clones contained inserts belonging to previously unknown genes, but whose sequence was available on the P. falciparum genome databases.
  • DG747 codes for a polypeptide of 59 amino acids of which the 40 amino acids (aa) C-terminals are part of a repeating structure of 5 x 8 aa rich in arginine and in lysine.
  • This sequence is identical to aa 81-140 of the PfB0155c gene (1524 bp, 508 aa) located on chromosome 2 ( Figure 3.1a).
  • This gene which codes for a putative protein (Gardner et al., 1999), contains neither introns, nor predicted signal peptides, nor regions homologous to other proteins, whether Plasmodium or other organisms.
  • the corresponding protein has a theoretical molecular mass of 59 kDa, and a neutral isoelectric point (7.5), but certain regions have very variable pi, for example the region found in DG747 has a positive charge at neutral pH.
  • DG772 contains an insert of 333 bp, which are translated into 111 aa contained in an open reading frame.
  • This polypeptide corresponds to the region of aa 1146-1256 of a protein of 1493 amino acids encoded by a gene located on chromosome 1 ( Figure 3.1b).
  • the theoretical mass of the protein is 173 kDa and the isoelectric point is 5.05.
  • Protein consists mainly of acids polar amines and does not contain hydrophobic sites, except in the N-terminal part, where there could be a GPI anchor site.
  • the gene does not contain repeats and the translated nucleotide sequence has a strong homology with proteins of the “EBP” family (Adams et al., 1992), that is to say with 5 ′ cys and 3 ′ regions. cys which are characteristic of this family.
  • the surface of the sporozoites of P. falciparum was marked by antibodies (human or mouse) specific for DG747 and DG772, but the erythrocytic stages were marked differently for the two groups of antibodies.
  • the anti-His 6 -747 (anti-747) antibodies scarcely mark the young stages, but strongly the mature schizont stages, with localized labeling around the knob structures ( Figure 3.2 image A), while the anti-HiS 6 antibodies - 772 (anti-772) mark the parasite more evenly throughout the erythrocyte stage.
  • the surface of the sporozoites was strongly marked by the antibodies specific for the two antigens.
  • yoelii detected a 70 kDa polypeptide for anti-747 in sporozoites and blood stages and a 60 kDa polypeptide for anti-772, only detected in P. yoelii sporozoites .
  • Anti-772 serum labeled all sporozoites, while only 7 out of 10 of the isolates tested were labeled with anti-747.
  • PCR amplifications with specific primers for the two gene fragments indicated in FIGS.
  • the anti-772 response increases like the anti-747 according to age, but with a much less significant increase, compared to the rate of transmission observed between Ndiop and Dielmo and compared to age.
  • the rate of anti-772 responses measured in% of prevalence and intensity is higher for young people than that of anti-747 responses, but lower (75%) than anti-747 (85%) at Dielmo in immune individuals.
  • Lymphocyte proliferation is at the limit of the threshold value, while the secretion rates of IFN- ⁇ are high, both for the quantity of cytokine detected and for the number of secretory cells (detected by Elispot). This applies both to animals that are effectively immunized and those that are not protected. However, it appears that response rates are higher for animals immunized with irradiated sporozoites of 30 kRad. The responses induced by 747 are stronger than those induced by 772, and both stronger than those induced by LSA3.
  • cytophilic isotype lgG1 the level of which is much higher in the serum of immune individuals (SHl) than in the serum obtained from the patient infected by transfusion or from ISS volunteers.
  • SHl serum of immune individuals
  • the responses of these last two groups are quite similar and do not show any imbalance between cytophilic antibodies (lgG1 and lgG3) and non-cytophilic (lgG2 and lgG4).
  • PM permanent prophylaxis
  • mice of two different strains were immunized with the recombinants in the form of proteins, with different adjuvants or in the form of “naked” DNA constructs, without adjuvant.
  • mice immunized with pNAK747 there are both stimulation of proliferation and secretion of IFN- ⁇ , while that for pNAK772, the proliferation of T cells was very little stimulated compared to the stimulation of secretion of IFN- ⁇ which is considerable.
  • the highest level of IFN- ⁇ secretions is observed when the level of stimulation of proliferation is the lowest.
  • the anti-747 responses have a similar profile for all the immunized mice and all the formulations used, with an isotypic response predominantly lgG2b.
  • the anti-772 responses are also similar between mice and vaccine formulations, but with a clear predominance of lgG1.
  • the isotypic profile therefore depends on the immunogen more than on the mode of presentation used.
  • the endpoint titers are much higher when immunized with recombinant proteins (1 / 200,000) compared to DNA (1/2000), and the titers of sera from mice immunized with HiS 6 - 772 are higher than those of His 6 -747.
  • RT-PCR By RT-PCR on the total RNA from sporozoites and blood parasites, the inventors were able to determine the splicing sites of the messenger RNA corresponding to the coding gene.
  • the primer sequence was extracted from the Plasmodium falciparum genome data.
  • Amplification products are identical in size; sporozoite stages and blood stages, and differ in size from the product obtained by amplification of genomic DNA and by sequencing the splice sites were found to be identical (see the introns shown in the figure).
  • the gene encoding DG772 belongs to a family of proteins identified by a shared motif. All the proteins of the EBR (Erythrocyte Binding Proteins) family share conserved motifs of cysteine residues whose arrangement is similar for all the proteins. However, the degree of identity does not exceed 31% (max. 57% homology), even in the most conserved regions.
  • mice From our results obtained in mice, we can confirm that the antigens DG747 and DG772 used both in the form of DNA and in the form of recombinant protein are immunogenic. In addition, the fact that the recombinant proteins are recognized by individuals immunized and protected against infection by sporozoites of Plasmodium falciparum indicates a role for these antigens in pre-erythrocytic immunity. A test in primates, and in particular in chimpanzees, will make it easy to choose the optimal formulation for clinical trials in humans.
  • Hybridization by Southern blot under standard stringent conditions 0.1 ⁇ SSC, 60 ° C. would not give rise to any other hybridization except with the corresponding gene.
  • the parameters used are the default parameters found on the http://www.ncbi.nlm.nih.gov/BLAST/ sites.
  • the absence observed may be due to a real deletion of the gene or to experimental procedures.
  • one of the primers used for the detection of the coding part for DG747 overlaps the repeating part, which can cause a difficulty in amplifying a gene containing a greater repetition, or in detecting a gene containing less repetitions.
  • this is also the case for detection in indirect immunofluorescence where a possible number of repetition variations can change the affinity of the specific antibodies, if the target epitope overlaps this region.
  • the expression detected by IFI seems to be present throughout the asexual parasite cycle in the host vertebrate (we did not analyze the sexual stages).
  • Despite the presence of repeats in DG747 we did not detect cross-reactivity with other P. falciparum antigens.
  • the entire gene sequence has no homology with other plasmodial proteins so far identified, and we have no information yet on a possible biological function.
  • DG772 does not contain repeats and its presence seems to be constant, whether detected by PCR or by IFI.
  • the gene coding for DG772 turns out to be interesting.
  • this gene of 5300 bp of open reading frame belongs to the family of EBP (Erythrocyte Binding Protein) (Adams et al., 1992), but that the sequence of DG772 does not belong to conserved regions of this family, it only shares a small part of sequences with the N-terminal end of the 3'cys region. Moreover, it has no cross-reactivities nor sequence homology with DG249, another clone belonging to one of the consensus parts of the gene coding for EBA-175.
  • DG772 is part of a region which confers a particularity on each molecule of this family.
  • EBP family EBA-175 and 772
  • the antigens in gray are the antigens characterized in this application.
  • MSP-1 The presence at the pre-erythrocytic stages of other antigens (MSP-1) has also been suggested, but the preliminary results remain to be confirmed.
  • the underlined references indicate the year of discovery of the pre-erythrocytic expression.
  • S sporozoite
  • H Young and mature liver stage
  • SSA Young and mature asexual blood stage
  • SSS sexual blood stage.
  • ST sub-telomeric. The bold characters indicate the shape of the stage where the marking is most intense.
  • Table 3.1b Stimulation of cell proliferation and secretion of IFN- ⁇ by His 6 -772 after 3 immunizations with pNAK772.
  • Table 4.1 Cellular responses of mice after 5 immunizations with pNAK438 *.
  • the response rates are represented in relation to the responses obtained by a threshold value.
  • the threshold value is calculated by averaging the responses of non-immunized animals and that of animals immunized against a non-relevant antigen, such as OspC, a protein from Borrelia burgdorfe.
  • the spasmozoites of Plasmodium falciparum come from the strain NF54.
  • T23 strain of Thai origin; NF54 strain of African origin.
  • Table 5.1 Cross-reactivities detected in Western blots between members of the Pf11-1 family
  • E immunopurified antibodies (eluted) on the corresponding recombinant proteins.
  • P recombinant protein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
EP02732872A 2001-05-16 2002-05-15 Antigene von plasmodium falciparum und ihre verwendung als impfstoff und zur diagnose Withdrawn EP1390401A2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
CA002345206A CA2345206A1 (fr) 2001-05-16 2001-05-16 Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques
CA2345206 2001-05-16
CA002346968A CA2346968A1 (fr) 2001-05-23 2001-05-23 Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques
CA2346968 2001-05-23
PCT/FR2002/001637 WO2002092628A2 (fr) 2001-05-16 2002-05-15 Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques

Publications (1)

Publication Number Publication Date
EP1390401A2 true EP1390401A2 (de) 2004-02-25

Family

ID=25682532

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02732872A Withdrawn EP1390401A2 (de) 2001-05-16 2002-05-15 Antigene von plasmodium falciparum und ihre verwendung als impfstoff und zur diagnose

Country Status (4)

Country Link
US (2) US7498037B2 (de)
EP (1) EP1390401A2 (de)
AU (1) AU2002304480A1 (de)
WO (1) WO2002092628A2 (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2672290B1 (fr) * 1991-02-05 1995-04-21 Pasteur Institut Sequences peptidiques specifiques des stades hepatiques de p. falciparum porteuses d'epitopes capables de stimuler les lymphocytes t.
US20030161840A1 (en) 1992-10-19 2003-08-28 Institut Pasteur Plasmodium falciparum antigens inducing protective antibodies
DK200201741A (da) * 2002-11-12 2003-09-16 Statens Seruminstitut Vaccine comprising chimeric malaria proteins derived from Plasmodium falciparum
US20050112133A1 (en) * 2003-10-24 2005-05-26 Pierre Druilhe GLURP-MSP3 fusion protein, immunogenic compositions and malarial vaccines containing it
WO2006081308A2 (en) 2005-01-25 2006-08-03 The Johns Hopkins University Plasmodium diagnostic assay device
US8703147B2 (en) * 2007-11-05 2014-04-22 The Walter And Eliza Hall Institute Of Medical Research Methods and compositions for treating and preventing malaria (2)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2735478B1 (fr) * 1995-06-13 1997-08-22 Pasteur Institut Molecules polypeptidiques de stade pre-erythrocytaire du paludisme
AU1818200A (en) * 1998-11-05 2000-05-22 Daniel Carucci Chromosome 2 sequence of the human malaria parasite (plasmodium falciparum) and proteins of said chromosome useful in anti-malarial vaccines and diagnostic reagents

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO02092628A2 *

Also Published As

Publication number Publication date
AU2002304480A1 (en) 2002-11-25
US7498037B2 (en) 2009-03-03
US20050075496A1 (en) 2005-04-07
WO2002092628A3 (fr) 2003-09-25
US20110002916A1 (en) 2011-01-06
WO2002092628A2 (fr) 2002-11-21

Similar Documents

Publication Publication Date Title
EP0666916B1 (de) Schützende antikörper induzierende antigene aus plasmodium falciparum
López et al. What is known about the immune response induced by Plasmodium vivax malaria vaccine candidates?
Jelínková et al. An epitope-based malaria vaccine targeting the junctional region of circumsporozoite protein
FR2963241A1 (fr) Vaccin contre le paludisme gestationnel
WO1997030158A9 (fr) Proteine recombinante contenant un fragment c-terminal de msp-1 de plasmodium
US20110002916A1 (en) Plasmodium falciparum antigens and their vaccine and diagnostic applications
Good et al. Whole parasite vaccines for the asexual blood stages of Plasmodium
Vijayan et al. Antibody interference by a non-neutralizing antibody abrogates humoral protection against Plasmodium yoelii liver stage
EP1621547B1 (de) Gegen Malaria polypeptidische Molekulen von vorerythrozytären Stadium und lipiden Konjugate
EP0301961B1 (de) Spezifische Sekretions-Exkretions-Antigene von Toxoplasma gondii, deren Expressionsprodukte, Verfahren zu deren Herstellung und deren diagnostische und prophylaktische Anwendungen
Vijayan et al. Development of blood stage malaria vaccines
WO1984002472A1 (fr) Fractions polypeptidiques inductrices d'anticorps protecteurs contre des parasites du paludisme et compositions immunogenes les contenant
Perraut et al. Induction of opsonizing antibodies after injection of recombinant Plasmodium falciparum vaccine candidate antigens in preimmune Saimiri sciureus monkeys
EP2945648A1 (de) Impfstoffe gegen schwangerschaftsassoziierte malaria
EP0407230B1 (de) Antigen-Protein der Sporozoit- und hepatischen Phase von P. falciparum
CA2346968A1 (fr) Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques
EP0542845B1 (de) Schützende antikörper erregende plasmodium falciparum antigene und deren verwendung in impfstoffen
Fotoran et al. Merozoite-protein loaded liposomes protect against challenge in two murine models of plasmodium infection
CA2382977A1 (fr) Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques
Ferreira-da-Cruz et al. Antibody responses to Plasmodium falciparum sporozoite-, liver-and blood-stage synthetic peptides in migrant and autochthonous populations in malaria endemic areas.
CA2345206A1 (fr) Antigenes de plasmodium falciparum et leurs applications vaccinales et diagnostiques
EP2145003A2 (de) Polynukleotide und polypeptide in zusammenhang mit schwangerschaftsmalaria sowie biologische anwendungen
Venkatesh DESIGNING mRNA BASED MULTISTAGE VACCINE FOR MALARIA
Vijayan et al. Antibody interference by a non-neutralizing antibody abrogates humoral protection against Plasmodium liver stage
Namazi The immune response and immunization studies in avirulent DK and virulent DS strains of Plasmodium chabaudi adami and a synthetic peptide immunization in P. chabaudi AS

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20031106

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20050316

17Q First examination report despatched

Effective date: 20050316

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20111201