EP1364024A2 - Endogenous and non-endogenous versions of human g protein-coupled receptors - Google Patents
Endogenous and non-endogenous versions of human g protein-coupled receptorsInfo
- Publication number
- EP1364024A2 EP1364024A2 EP01997554A EP01997554A EP1364024A2 EP 1364024 A2 EP1364024 A2 EP 1364024A2 EP 01997554 A EP01997554 A EP 01997554A EP 01997554 A EP01997554 A EP 01997554A EP 1364024 A2 EP1364024 A2 EP 1364024A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- protein
- endogenous
- receptor
- seq
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- the present invention relates to transmembrane receptors, in some embodiments to
- G protein-coupled receptors and, in some preferred embodiments, to endogenous GPCRs that are altered to establish or enhance constitutive activity of -the receptor.
- the constitutively activated GPCRs will be used for the direct identification of candidate compounds as receptor agonists or inverse agonists having applicability as therapeutic agents.
- GPCR G protein-coupled receptor
- GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed. For example, in 1999, of the top 100 brand name prescription drugs, the following drugs interact with GPCRs (diseases and/or disorders treated are indicated in parentheses):
- GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-1), transmebrane-2 (TM-2), etc.).
- the transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or AREN-0309 PATENT
- extracellular side of the cell membrane (these are referred to as "extracellular” regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively).
- the transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular” side, of the cell membrane (these are referred to as "intracellular” regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively).
- the "carboxy" (“C”) terminus of the receptor lies in the intracellular space within the cell, and the "amino" (“N”) terminus of the receptor lies in the extracellular space outside of the cell.
- GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, G q , G s , Gi, G z and G 0 are G proteins that have been identified.
- Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. Although not wishing to be bound to theory, it is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein. Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active” state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response. Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G- protein) and produces a biological response.
- a receptor may be stabilized in an active state by a ligand or a compound such as a drug.
- Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a Ugand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation.”
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:2, non-endogenous, constitutively activated versions of the same, and host cells comprising the same- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:l and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:4, non-endogenous, constitutively activated versions of the same, and host cells comprising the same..
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:3, non-endogenous, constitutively activated versions of the same, and host cells comprising the same. Some embodiments of the present invention relate to G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:8, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:7, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:10, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:9 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 11 , and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 14, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 13 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 16, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 15 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 18, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:17 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO. :20, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 19 and host cells comprising the same.
- Figure 1 is a graphic representation of activation of RUP32, G q (del)/Gi, RUP32 co-transfected with G q (del)/Gj, and CMV (control; expression vector) in a second messenger assay measuring the accumulation of inositol phosphate (IP 3 ) utilizing 293 cells.
- FIG. 2 provides an illustration of second messenger IP 3 production from endogenous version RUP35 and RUP36 as compared with the control ("CMV").
- CMV control
- AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to membranes, hi some embodiments, AGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
- ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that competitively bind to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular responses by agonists.
- ANTAGONISTS do not diminish the baseline intracellular response in the absence of an agonist.
- ANTAGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
- CANDIDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique.
- the phrase "candidate compound” does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound”); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans.
- COMPOSITION means a material comprising at least one component; a "pharmaceutical composition” is an example of a composition.
- COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality; i.e. the ability to activate/inhibit a AREN-0309 PATENT signal transduction pathway, as opposed to receptor binding affinity. Exemplary means of detecting compound efficacy are disclosed in the Example section of this patent document.
- CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides) which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine (U) and thymidine (T)) coupled to a phosphate group and which, when translated, encodes an amino acid.
- A adenosine
- G guanosine
- C cytidine
- U uridine
- T thymidine
- CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subjected to constitutive receptor activation.
- a constitutively activated receptor can be endogenous or non-endogenous.
- CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a receptor in the active state by means other than binding of the receptor with its Ugand or a chemical equivalent thereof.
- CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.
- DIRECTLY IDENTIFYING or DIRECTLY IDENTIFHED in relationship to the phrase "candidate compound”, shall mean the screening of a candidate compound against a constitutively activated receptor, preferably a constitutively activated orphan receptor, and most preferably against a constitutively activated G protein-coupled cell surface orphan receptor, and assessing the compound efficacy of such compound.
- This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase "indirectly identifying" or "indirectly identified.”
- ENDOGENOUS shall mean a material that a mammal naturally produces.
- ENDOGENOUS in reference to, for example and not limitation, the term "receptor,” shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus.
- the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus.
- a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active is most preferably referred to herein as a "non-endogenous, constitutively activated receptor.”
- Both terms can be utilized to describe both "in vivo" and “in vitro” systems.
- the endogenous or non-endogenous receptor may be AREN-0309 PATENT in reference to an in vitro screening system.
- screening of a candidate compound by means of an in vivo system is viable.
- FUSION PROTEIN in the context of the invention disclosed herein, each mean a non- endogenous protein comprising an endogenous, constitutively activate GPCR or a non- endogenous, constitutively activated GPCR fused to at least one G protein, most preferably the alpha ( ) subunit of such G protein (this being the subunit that binds GTP), with the G protein preferably being of the same type as the G protein that naturally couples with endogenous orphan GPCR.
- G protein "G s " is the predominate G protein that couples with the GPCR
- a GPCR Fusion Protein based upon the specific GPCR would be a non-endogenous protein comprising the GPCR fused to G s ⁇ ; in some circumstances, as will be set forth below, a non-predominant G protein can be fused to the GPCR.
- the G protein can be fused directly to the C-terminus of the constitutively active GPCR or there may be spacers between the two.
- HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein.
- a Plasmid is typically replicated as a autonomous molecule as the Host Cell repUcates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell repUcates, the Plasmid repUcates.
- the Host Cell is eukaryotic, more preferably, mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells.
- INDIRECTLY IDENTIFYING or INDD ECTLY IDENTIFIED means the traditional approach to the drug discovery process involving identification of an endogenous ligand specific for an endogenous receptor, screening of candidate compounds against the receptor for determination of those which interfere and/or compete with the Ugand-receptor interaction, and assessing the efficacy of the compound for affecting at least one second messenger pathway associated with the activated receptor.
- INHIBIT or INHIBITING in relationship to the term "response” shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.
- INVERSE AGONISTS shall mean materials (e.g., Ugand, candidate compound) which bind to either the endogenous form of the receptor or to the constitutively activated form of the receptor, and which inhibit the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of agonists, or decrease GTP binding to membranes.
- the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% as compared with the baseline response in the absence of the inverse agonist.
- KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous Ugand specific for that receptor has been identified.
- LIGAND shall mean a molecule specific for a naturally occurring receptor.
- MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor.
- a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of a human receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99%.
- some preferred cassettes disclosed herein for achieving constitutive activation include a single amino acid and/or codon change between the endogenous and the non-endogenous forms of the GPCR, it is preferred that the percent sequence homology should be at least 98%.
- NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an identified ligand wherein the binding of a Ugand to a receptor activates an intracellular signaling pathway.
- ORPHAN RECEPTOR shall mean an endogenous receptor for which the Ugand specific for that receptor has not been identified or is not known.
- PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, and not limitation, a human).
- PLASMID shall mean the combination of a Vector and cDNA.
- a Plasmid is introduced into a Host Cell for the purposes of replication and/or expression of the cDNA as a protein.
- SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation.
- a second messenger can include, for example, inositol triphosphate (IP 3 ), diacycglycerol (DAG), cyclic AMP (cAMP), and cyclic GMP (cGMP).
- Second messenger response can be measured for a determination of receptor activation, hi addition, second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, agonists, and antagonists.
- SIGNAL TO NOISE RATIO shall mean the signal generated in response to activation, amplification, or stimulation wherein the signal is above the background noise or the basal level in response to non-activation, non-ampUfication, or non-stimulation.
- SPACER shall mean a translated number of amino acids that are located after the last codon or last amino acid of a gene, for example a GPCR of interest, but before the start codon or beginning regions of the G protein of interest, wherein the translated number amino acids are placed in-frame with the beginnings regions of the G protein of interest.
- the number of translated amino acids can be tailored according to the needs of the skilled artisan and is generally from about one amino acid, preferably two amino acids, more preferably three amino acids, more preferably four amino acids, more preferably five amino acids, more preferably six amino acids, more preferably seven amino acids, more preferably AREN-0309 PATENT eight amino acids, more preferably nine amino acids, more preferably ten amino acids, more preferably eleven amino acids, and even more preferably twelve amino acids.
- STIMULATE or STIMULATING in relationship to the term "response” shall mean that a response is increased in the presence of a compound as opposed to in the absence of the compound.
- SUBSTANTIALLY shall refer to a result which is within 40% of a control result, preferably within 35%, more preferably within 30%, more preferably within 25%, more preferably within 20%, more preferably within 15%, more preferably within 10%, more preferably within 5%, more preferably within 2%, and most preferably within 1% of a control result.
- a test receptor may exhibit substantially similar results to a control receptor if the transduced signal, measured using a method taught herein or similar method known to the art-skilled, if within 40% of the signal produced by a control signal.
- VECTOR in reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell.
- any search for therapeutic compounds should start by screening compounds against the Ugand-independent active state.
- Receptor homology is useful in terms of gaining an appreciation of a role of the receptors within the human body. As the patent document progresses, techniques for mutating these receptors to establish non-endogenous, constitutively activated versions of these receptors will be discussed.
- Screening candidate compounds against a non-endogenous, constitutively activated version of the GPCRs disclosed herein allows for the direct identification of candidate compounds which act at the cell surface receptor, without requiring use of the receptor's endogenous ligand.
- routine, and often commercially available techniques one can determine areas within the body where the endogenous version of human GPCRs disclosed herein is expressed and/or over-expressed.
- the expression location of a receptor in a specific tissue provides a scientist with the abiUty to assign a physiological functional role of the receptor. It is also possible using these techniques to determine related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document.
- expression of a receptor in diseased organs can assist one in determining the magnitude of the cUnical relevance of the receptor.
- inverse agonists and agonists to the non- endogenous, constitutively activated GPCR can be identified by the methodologies of this invention.
- Such inverse agonists and agonists are ideal candidates as lead compounds in drug discovery programs for treating diseases related to this receptor. Because of the ability to directly identify inverse agonists to the GPCR, thereby allowing for the development of pharmaceutical compositions, a search for diseases and disorders associated with the GPCR is relevant.
- the expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological function to the receptor.
- tissue scans can be conducted across a broad range of healthy and diseased tissues. Such tissue scans provide a potential first step in associating a specific receptor with a disease and/or disorder. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of clinical relevance of the receptor.
- the DNA sequence of the GPCR can be used to make a probe/primer.
- the DNA sequence is used to make a probe for (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples.
- the presence of a receptor in a tissue source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue can be used to correlate location to function and indicate the receptor's physiological role/function and create a treatment regimen, including but not limited to, a disease associated with that function/role.
- Receptors can also be localized to regions of organs by this technique.
- the putative physiological function of the receptor can be deduced.
- proteins located/expressed in areas of the thalamus are associated with sensorimotor processing and arousal (see, Goodman & Gilman's, The Pharmacological Basis of Therapeutics, 9 th Edition, page 465 (1996)).
- Proteins expressed in the hippocampus or in Schwann cells are associated with learning and AREN-0309 PATENT memory, and myehnation of peripheral nerves, respectively (see, Kandel, E. et al.,
- G protein receptor When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., G q , G s , Gêt G z , Go) and stimulates the binding of GTP to the G protein.
- the G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated.
- constitutively activated receptors continue to exchange GDP to GTP.
- a non-hydrolyzable analog of GTP [ 35 S]GTP ⁇ S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [ 35 S]GTP ⁇ S can be used to monitor G protein coupling to membranes in the absence and presence of Ugand.
- a compound identified by the "generic" assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain.
- G s stimulates the enzyme adenylyl cyclase.
- Gj (and G z and Go), on the other hand, inhibits adenylyl cyclase.
- Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the G s protein are associated with increased cellular levels of cAMP.
- GPCRs that couple Gi (or G z , Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3 rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992).
- assays that detect cAMP can be utiUzed to determine if a candidate compound is, e.g., an inverse AREN-0309 PATENT agonist to the receptor (i.e., such a compound would decrease the levels of cAMP).
- CycUc AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) that then binds to the promoter at specific sites (cAMP response elements) and drives the expression of the gene.
- CREB cAMP-responsive DNA binding protein or transcription factor
- Reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., ⁇ -galactosidase or luciferase.
- a constitutively activated G s -linked receptor causes the accumulation of cAMP that then activates the gene and leads to the expression of the reporter protein.
- the reporter protein such as ⁇ -galactosidase or luciferase can then be detected using standard biochemical assays (Chen et al. 1995).
- G 0 and G q are examples of the reporter protein that can then be detected using standard biochemical assays (Chen et al. 1995).
- G q and G 0 are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP 2 , releasing two intracellular messengers: diacycloglycerol (DAG) and inositol 1,4,5-triphoisphate (IP 3 ).
- DAG diacycloglycerol
- IP 3 inositol 1,4,5-triphoisphate
- Increased accumulation of IP is associated with activation of G q - and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3 rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992).
- Assays that detect IP accumulation can be utilized to determine if a candidate compound is, e.g., an inverse agonist to a G q - or Go-associated receptor (i.e., such a compound would decrease the levels of IP 3 ).
- G q - associated receptors can also be examined using an API reporter assay wherein G q - dependent phospholipase C causes activation of genes containing API elements; thus, activated G q -associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression.
- Commercially available assays for such detection are available.
- an endogenous, constitutively activated GPCR or a non-endogenous, constitutively activated GPCR for use in screening of candidate compounds for the direct identification of inverse agonists, agonists provide an interesting screening challenge in that, by definition, the receptor is active even in the absence of an endogenous Ugand bound thereto.
- an aim of such a differentiation to allow for an understanding as to whether such compound may be an inverse agonist or agonist or have no affect on such a receptor, it is preferred that an approach be utilized that can enhance such differentiation.
- a preferred approach is the use of a GPCR Fusion Protein.
- a non-endogenous GPCR has been constitutively activated using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. In some embodiments it is preferred that screening take place using a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the non-endogenous, constitutively activated GPCR will continuously signal.
- this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is contacted with the inverse agonist.
- the GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR.
- the GPCR Fusion Protein is preferred for screening with either an endogenous, constitutively active GPCR or a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is utilized in such screening techniques. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is preferred for the screening of candidate compounds as disclosed herein.
- GPCR Fusion Protein AREN-0309 PATENT construct include but are not limited to, that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence), and that the "stop" codon of the GPCR be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed.
- inventions include constructs wherein the endogenous GPCR sequence and the G protein sequence are not in-frame and or the "stop" codon is not deleted or replaced.
- the GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). Based upon convenience it is preferred to use a spacer.
- the G protein that couples to the non-endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct.
- a construct comprising the sequence of the G protein (i.e., a universal G protein construct (see Examples)) be available for insertion of an endogenous GPCR sequence therein; this provides for further efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences.
- G z and G 0 are expected to inhibit the formation of cAMP making assays based upon these types of GPCRs challenging (i.e., the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging.
- the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging.
- inverse agonists which would further decrease this signal
- an endogenous G; coupled receptor can be fused to a G s protein -such a fusion construct, upon expression, "drives” or “forces” the endogenous GPCR to couple with, e.g., G s rather than the "natural" Gj protein, such that a cyclase-based assay can be estabUshed.
- Gj, G z and G 0 coupled receptors in some embodiments it is preferred that when a GPCR Fusion Protein is used and the assay is based upon detection of adenylyl cyclase activity, that the fusion construct be established with G s (or an equivalent G protein that stimulates the formation of the enzyme adenylyl cyclase).
- G Protein Fusion construct that utilizes a G q Protein fused with a G s , Gj, G z or G 0 Protein.
- a preferred fusion construct can be accomplished with a G q Protein wherein the first six (6) amino acids of the G-protein ⁇ - subunit ("G ⁇ q") is deleted and the last five (5) amino acids at the C-terminal end of G ⁇ q is replaced with the corresponding amino acids of the G ⁇ of the G protein of interest.
- a fusion construct can have a G q (6 amino acid deletion) fused with a Gj Protein, resulting in a "G q /Gj Fusion Construct".
- This fusion construct will forces the endogenous Gj coupled receptor to couple to its non-endogenous G protein, G q , such that the second messenger, for example, inositol triphosphate or diacylgycerol, can be measured in lieu of cAMP production.
- G q non-endogenous G protein
- a Gj coupled receptor is known to inhibit adenylyl cyclase, and, therefore, decreases the level of cAMP production, which can make assessment of cAMP levels challenging.
- An effective technique in measuring the decrease in production of cAMP as an indication of constitutive activation of a receptor that predominantly couples Gj upon activation can be accomplished by co-transfecting a signal enhancer, e.g., a non-endogenous, constitutively activated receptor that predominantly couples with G s upon activation (e.g., TSHR-A623I, disclosed below), with the Gj linked GPCR.
- a signal enhancer e.g., a non-endogenous, constitutively activated receptor that predominantly couples with G s upon activation (e.g., TSHR-A623I, disclosed below
- constitutive activation of a G s AREN-0309 PATENT coupled receptor can be determined based upon an increase in production of cAMP.
- cAMP By then co-transfecting the signal enhancer with a constitutively activated version of the target receptor, cAMP would be expected to further decrease (relative to base line) due to the increased functional activity of the Gj target (i.e., which decreases cAMP).
- Screening of candidate compounds using a cAMP based assay can then be accomplished, with two 'changes' relative to the use of the endogenous receptor/G-protein fusion: first, relative to the G; coupled target receptor, "opposite" effects will result, i.e., an inverse agonist of the Gj coupled target receptor will increase the measured cAMP signal, while an agonist of the G; coupled target receptor will decrease this signal; second, as would be apparent, candidate compounds that are directly identified using this approach should be assessed independently to ensure that these do not target the signal enhancing receptor (this can be done prior to or after screening against the co-transfected receptors).
- Candidate compounds selected for further development can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers are available to those in the art; for example, see Remington's Pharmaceutical Sciences, 16 th Edition, 1980, Mack Publishing Co., (Osol et al., eds.).
- non-endogenous versions of the GPCRs disclosed herein may be for the direct identification of candidate compounds as inverse agonists or agonists (preferably for use as pharmaceutical agents), other uses of these versions of GPCRs exist.
- in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade.
- the endogenous receptors be "orphan receptors", i.e., the endogenous Ugand for the receptor has not been identified.
- the modified, non-endogenous GPCRs can be used to understand the role of endogenous receptors in the human body before the endogenous Ugand therefore is identified.
- Such receptors can also be used to further elucidate known receptors and the pathways through which they transduce a signal.
- Other uses of the disclosed receptors will become apparent to those in the art based upon, ter alia, a review of this patent document.
- AC073957 was identified as a human genomic sequence from chromosome 7.
- a 1.16kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :1 for the nucleic acid sequence and SEQ.ID.NO. :2 for the putative amino acid sequence.
- b. hRUP29 (Seq. Id. Nos. 3 & 4)
- the disclosed human RUP29 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC0083865 was identified as a human genomic sequence from chromosome 7. The full length RUP29 was cloned by PCR using primers: 5'-GTATGCCTGGCCACAATACCTCCAGG-3' (SEQ.ID.NO. :23; sense, containing the initiation codon),
- a 930bp PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems).
- RACE Rapid amplification of cDNA ends
- RUP29 specific primer (1) having the sequence: 5-GGTACCACAATGACAATCACCAGCGTCC-3 '(SEQ.ID.NO. :25) and API primer (Clontech) were used for the first-round PCR reaction
- RUP29 specific primer (2) having the following sequence: AREN-0309 PATENT
- GGAACGTGAGGTACATGTGGATGTGCAGC-3 ' (SEQ.ID.NO. :26) and AP2 primer (Clontech) were used for the second-round PCR reaction.
- the products of the RACE reactions were isolated and cloned into the pCRII-TOPO vector (rnvitrogen) and sequenced. See, SEQ.ID.NO. :3 for the nucleic acid sequence and SEQ.ID.NO. :4 for the putative amino acid sequence.
- c. hRUP30 (Seq. Id. Nos. 5 & 6) The disclosed human RUP30 was identified based upon the use of GenBank database information.
- a cDNA clone with Accession Number AC055863 was identified as a human genomic sequence from chromosome 17.
- the full length RUP30 was cloned by 5 'RACE -PCR with a human pancreas Marathon-ReadyTM cDNA (Clontech) as template and the following oligonucleotide: 5'-GCAGTGTAGCGGTCAACCGTGAGCAGG-3'(SEQ.ID.NO.:27; sense, containing the initiation codon), and API primer (Clontech) were used for the first round of RT-PCR and oligonucleotide:
- a 1.2 Kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and several clones were sequenced using the ABI Big Dye Terminator kit (P.E. Biosystems). See, SEQ.ID.NO.:5 for the nucleic acid sequence and SEQ.ID.NO. :6 for the putative amino acid sequence.
- AREN-0309 PATENT d. hRUP31 (Seq. Id. Nos. 7 & 8)
- the disclosed human RUP31 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
- a 1.1 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :7 for the nucleic acid sequence and SEQ.ID.NO. :8 for the putative amino acid sequence. e. hRUP32 (Seq. Id. Nos. 9 & 10)
- the disclosed human RUP32 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AL513524 was identified as a human genomic sequence from chromosome 6. The full length RUP32 was cloned by PCR using primers: 5'-GCGTTATGAGCAGCAATTCATCCCTGCTGG-3' (SEQ.ID.NO.:33; sense, containing the initiation codon),
- a 1.06 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :9 for the nucleic acid sequence and SEQ.ID.NO.: 10 for the putative amino acid sequence.
- AREN-0309 PATENT f. hRUP33 (Seq. Id. Nos. 11 & 12)
- the disclosed human RUP33 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
- a 1.1 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.: 11 for the nucleic acid sequence and
- the disclosed human RUP34 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AL513524 was identified as a human genomic sequence from chromosome 6. The full length RUP34 was cloned by PCR using primers:
- a 1.27 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit
- the disclosed human RUP35 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
- 5'-GTGGCAGACAGCGATATACCTGTCAATGG-3' SEQ.ID.NO.:40; antisense
- AP2 primer Clontech
- DNA fragments generated by the 5' RACE-PCR were cloned into the pCRTI-TOPO vector (Invitrogen) and sequenced using the SP6/T7 primers (Stratagene).
- RUP35 was cloned by RT-PCR, using primers 5'-GCGCTCATGGAGCACACGCACGCCCAC-3' (SEQ.ID.NO. :41; sense, ATG as the initiation codon) and
- a 1.0 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.:15 for the nucleic acid sequence and SEQ.ID.NO. : 16 for the putative amino acid sequence. i. hRUP36 (Seq. Id. Nos. 17 & 18) The disclosed human RUP36 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC090099 was identified as a human genomic sequence from chromosome 11. The full length RUP36 was cloned by PCR using primers:
- a 1.0 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.: 17 for the nucleic acid sequence and SEQ.ID.NO. : 18 for the putative amino acid sequence.
- j. hRUP37 (Seq. Id. Nos. 19 & 20)
- the disclosed human RUP37 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC090099 was identified as a human genomic sequence from chromosome 11. The full length RUP37 was cloned by PCR using primers:
- a 969 base pair was isolated from a 1%% agarose gel and cloned into the pCRII- TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.:19 for the nucleic acid sequence and SEQ.ID.NO.:20 for the putative amino acid sequence.
- Example 2
- Preparation of non-endogenous human GPCRs may be accomplished on human GPCRs using, inter alia, Transformer Site-DirectedTM Mutagenesis Kit (Clontech) according to the manufacturer instructions.
- two mutagenesis primers are used, preferably a lysine mutagenesis oUgonucleotide that creates the lysine mutation, and a selection marker oligonucleotide.
- the codon mutation to be incorporated into the human GPCR is also noted, in standard form (Table D):
- mammalian cells Although a variety of cells are available to the art-skilled for the expression of proteins, it is preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, i.e., utilization of, e.g., yeast cells for the expression of a
- tube A was prepared by mixing 4 ⁇ g DNA (e.g., pCMV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B was prepared by mixing 24 ⁇ l lipofectamine (Gibco BRL) in 0.5ml serum free DMEM. Tubes A and B were admixed by inversion (several times), followed by incubation at room temperature for 30- 45min. The admixture is referred to as the "transfection mixture”.
- Plated 293 cells were washed with 1XPBS, followed by addition of 5 ml serum free DMEM. One ml of the transfection mixture were added to the cells, followed by incubation for 4hrs at 37°C/5% CO 2 . The transfection mixture was removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at 37°C/5% CO 2 . After 48hr incubation, cells were harvested and utiUzed for analysis. b.
- 293 cells Approximately 12x10 6 293 cells will be plated on a 15cm tissue culture plate, and grown in DME High Glucose Medium containing 10% fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours following plating of 293 cells (to approximately -80% confluency), the cells will be transfected using 12 ⁇ g of DNA. The 12 ⁇ g of DNA is combined with 60 ⁇ l of lipofectamine and 2mL of DME High Glucose Medium without serum. The medium will be aspirated from the plates and the cells washed once with medium without serum. The DNA, Upofectamine, and medium mixture will be added to the plate along with lOmL of medium without serum.
- the medium will be aspirated and 25ml of medium containing serum wiU be added. Twenty-four hours following transfection, the medium will be aspirated again, and fresh medium with serum will be added. Forty-eight hours following transfection, the medium will be aspirated and medium with serum will be added containing geneticin (G418 drug) at a final concentration of 500 ⁇ g/mL.
- G418 drug geneticin
- a G protein-coupled receptor When a G protein-coupled receptor is in its active state, either as a result of Ugand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein.
- the alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Constitutively activated receptors continue to exchange GDP for GTP.
- the non-hydrolyzable GTP analog, [ 35 S]GTP ⁇ S can be utilized to demonstrate enhanced binding of [ 35 S]GTP ⁇ S to membranes expressing constitutively activated receptors.
- [ S]GTP ⁇ S binding to measure constitutive activation include but are not Umited to the following: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade.
- the assay takes advantage of the ability of G protein coupled receptors to stimulate
- [ 35 S]GTP ⁇ S binding to membranes expressing the relevant receptors can, therefore, be used in the direct identification method to screen candidate compounds to constitutively activated G protein-coupled receptors.
- the assay is generic and has application to drug discovery at all G protein-coupled receptors.
- the [ 35 S]GTP ⁇ S assay is incubated in 20 mM HEPES and between 1 and about
- membrane protein e.g., 293 cells expressing the G s Fusion Protein; this amount can be adjusted for optimization
- 10 ⁇ M GDP this amount can be changed for optimization
- Adenylyl Cyclase A Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes.
- the Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP.
- the cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody.
- the foUowing serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
- Transfected cells will be harvested approximately twenty four hours after transient transfection. Media will be carefully aspirated and discarded. Ten ml of PBS will gently be added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS will be added to each plate. Cells will be pipetted off the plate and the cell suspension collected into a 50ml comcal centrifuge tube. Cells will be centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet will be carefully re- suspended into an appropriate volume of PBS (about 3ml/plate).
- cAMP standards and Detection Buffer comprising 1 ⁇ Ci of tracer [ 125 I cAMP (50 ⁇ l] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions.
- Assay Buffer will be prepared fresh for screening and contained 50 ⁇ l of Stimulation Buffer, 3 ⁇ l of test compound (12 ⁇ M final assay concentration) and 50 ⁇ l cells, Assay Buffer will be stored on ice until utilized.
- the assay will be initiated by addition of 50 ⁇ l of cAMP standards to appropriate wells followed by addition of 50 ⁇ l of PBSA to wells H-ll and H12. Fifty ⁇ l of Stimulation Buffer will be added to all wells. DMSO (or selected candidate compounds) will be added to appropriate AREN-0309 PATENT wells using a pin tool capable of dispensing 3 ⁇ l of compound solution, with a final assay concentration of 12 ⁇ M test compound and lOO ⁇ l total assay volume. The cells will then be added to the wells and incubated for 60 min at room temperature. One hundred ⁇ l of Detection Mix containing tracer cAMP will then be added to the wells.
- TSHR is a G s coupled GPCR that causes the accumulation of cAMP upon activation.
- TSHR will be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue).
- a Gj coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging.
- An effective technique for measuring the decrease in production of cAMP as an indication of constitutive activation of a Gj coupled receptor can be accompUshed by co-transfecting, most preferably, non-endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active G s coupled receptor) as a "signal enhancer" with a Gj linked target GPCR to estabUsh a baseline level of cAMP.
- TSHR-A623I non-endogenous, constitutively activated TSHR
- Gj linked target GPCR to estabUsh a baseline level of cAMP.
- This approach will be utilized to effectively generate a signal when a cAMP assay is used; this approach is preferably used in the direct identification of candidate compounds against G; coupled receptors. It is noted that for a Gj coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.
- tube A will be prepared by mixing 2ug DNA of each receptor transfected into the mammatian cells, for a total of 4ug DNA (e.g., pCMV vector; pCMV vector with mutated THSR (TSHR-A623I); TSHR-A623I and GPCR, etc.) in 1.2ml serum free DMEM (Irvine Scientific, Irvine, CA); tube B will be prepared by mixing 120 ⁇ l lipofectamine (Gibco BRL) in 1.2ml serum free AREN-0309 PATENT
- DMEM fetal calf serum
- Tubes A and B will then be admixed by inversion (several times), followed by incubation at room temperature for 30-45min. The admixture is referred to as the "transfection mixture".
- Plated 293 cells will be washed with 1XPBS, followed by addition of 10ml serum free DMEM.
- 2.4ml of the transfection mixture will then be added to the cells, followed by incubation for 4hrs at 37°C/5% CO 2 .
- the transfection mixture will then be removed by aspiration, followed by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells will then be incubated at 37°C/5% CO 2 . After 24hr incubation, cells will be harvested and utilized for analysis.
- a Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) although designed for cell-based assays, can be modified for use with crude plasma membranes depending on the need of the skilled artisan.
- the Flash Plate wells will contain a scintillant coating which also contains a specific antibody recognizing cAMP.
- the cAMP generated in the wells can be quantified by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
- Transfected cells will be harvested approximately twenty four hours after transient transfection. Media will be carefully aspirated and discarded. Ten ml of PBS will be gently added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS will be added to each plate. Cells will be pipetted off the plate and the cell suspension will be collected into a 50ml conical centrifuge tube. Cells will be centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet will be carefully re-suspended into an appropriate volume of PBS (about 3ml/plate).
- cAMP standards and Detection Buffer comprising 1 ⁇ Ci of tracer [ 125 I cAMP (50 ⁇ l] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions.
- Assay Buffer should be prepared fresh for screening and contained 50 ⁇ l of Stimulation Buffer, 3 ⁇ l of test compound (12 ⁇ M final assay concentration) and 50 ⁇ l cells, Assay Buffer can be stored on ice until utilized.
- the assay can be initiated by addition of 50 ⁇ l of cAMP standards to appropriate wells followed by addition of 50 ⁇ l of PBSA to wells H-l 1 and H12. Fifty ⁇ l of Stimulation Buffer will be added to all wells. Selected compounds (e.g., TSH) will be added to appropriate wells AREN-0309 PATENT using a pin tool capable of dispensing 3 ⁇ l of compound solution, with a final assay concentration of 12 ⁇ M test compound and lOO ⁇ l total assay volume. The ceUs will then be added to the wells and incubated for 60 min at room temperature. One hundred ⁇ l of Detection Mix containing tracer cAMP will then be added to the wells. Plates will then be incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well will then be extrapolated from a standard cAMP curve which is contained within each assay plate.
- Selected compounds e.g., TSH
- CRE-LUC Reporter Assay (G s -associated receptors) 293 and 293T cells will be plated-out on 96 well plates at a density of 2 x 10 4 cells per well and will be transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions.
- BBL Lipofectamine Reagent
- a DNA/lipid mixture will be prepared for each 6-well transfection as follows: 260ng of plasmid DNA in lOO ⁇ l of DMEM are gently mixed with 2 ⁇ l of lipid in lOO ⁇ l of DMEM (the 260ng of plasmid DNA consisted of 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non-endogenous receptor or pCMN alone, and lOng of a GPRS expression plasmid (GPRS in pcD ⁇ A3 (Invitrogen)).
- the 8XCRE-Luc reporter plasmid is prepared as follows: vector SRIF- ⁇ -gal will be obtained by cloning the rat somatostatin promoter (-71/+51) at BglN-Hindlll site in the p ⁇ gal-Basic Vector (Clontech). Eight (8) copies of cAMP response element will be obtained by PCR from an adenovirus template Ad ⁇ CF126CCRE8 (see, 7 Human Gene Therapy 1883 (1996)) and cloned into the SRIF- ⁇ -gal vector at the Kpn-BglV site, resulting in the 8xCRE- ⁇ -gal reporter vector.
- the 8xCRE-Luc reporter plasmid will be generated by replacing the beta-galactosidase gene in the 8xCRE- ⁇ -gal reporter vector with the luciferase gene obtained from the pGL3- basic vector (Promega) at the Hindlll-BamHI site. Following 30 min. incubation at room temperature, the D ⁇ A/lipid mixture will be diluted with 400 ⁇ l of DMEM and lOO ⁇ l of the diluted mixture will be added to each well. One hundred ⁇ l of DMEM with 10%) FCS will be added to each well after a 4hr incubation in a cell culture incubator. The following day the transfected cells will be changed with 200 ⁇ l well of DMEM with 10% FCS.
- a method to detect G q stimulation depends on the known property of G q - dependent phospholipase C to cause the activation of genes containing API elements in their promoter.
- a PathdetectTM AP-1 cis-Reporting System (Stratagene, Catalogue # 219073) can be utilized following the protocol set forth above with respect to the CREB reporter assay, except that the components of the calcium phosphate precipitate were 410 ng pAPl-Luc, 80 ng pCMV-receptor expression plasmid, and 20 ng CMV-SEAP.
- SRF-LUC Reporter Assay G q - associated receptors
- G q stimulation depends on the known property of G q - dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter.
- a PathdetectTM SRF-Luc-Reporting System (Stratagene) can be utilized to assay for G q coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian TransfectionTM Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions.
- 410 ng SRF-Luc, 80 ng pCMV-receptor expression plasmid and 20 ng CMV-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
- CMV-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
- ceUs comprising the receptors are plated onto 24 well plates, usually lxl 0 5 cells/well (although his number can be optimized.
- cells are transfected by firstly mixing 0.25ug DNA in 50 ⁇ l serum free DMEM/well and 2 ⁇ l lipofectamine in 50 ⁇ l serum free DMEM/well. The solutions are gently mixed and incubated for 15-30 min at room temperature. Cells are then washed with 0.5 ml PBS and 400 ⁇ l of serum free media and then mixed with the transfection media and added to the cells.
- the cells are incubated for 3-4 hrs at 37°C/5%CO 2 and then the transfection media is removed and replaced with lml/well of regular growth media.
- the cells are labeled with 3 H-myo-inositol. Briefly, the media is removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol- free/serum free media (GIBCO BRL) are added/well with 0.25 ⁇ Ci of 3 H-myo-inositol/ well and the cells incubated for 16-18 hrs overnight at 37°C/5%CO 2 .
- GEBCO BRL inositol- free/serum free media
- the cells are washed with 0.5 ml PBS and 0.45 ml of assay medium is added containing inositol- free/serum free media 10 ⁇ M pargyline 10 mM lithium chloride or 0.4 ml of assay medium and 50 ⁇ l of lOx ketanserin (ket) to final concentration of lO ⁇ M.
- the cells are then incubated for 30 min at 37°C.
- the cells are then washed with 0.5 ml PBS and 200 ⁇ l of fresh/ice cold stop solution (1M KOH; 18 mM Na-borate; 3.8 mM EDTA) is added to each well.
- the solution is kept on ice for 5-10 min (or until cells are lysed) and then neutralized by 200 ⁇ l of fresh/ice cold neutralization solution (7.5 % HCL).
- the lysate is then transferred into 1.5 ml Eppendorf tubes and 1 ml of chloroform/methanol (1:2) is added/tube.
- the solution is vortexed for 15 sec and the upper phase is applied to a Biorad AG1-X8TM anion exchange resin (100-200 mesh). First, the resin is washed with water at 1:1.25 W/V and 0.9 ml of upper phase is loaded onto the column.
- the column is then washed with 10 ml of 5 mM myo-inositol and 10 ml of 5 mM Na-borate/60mM Na- formate.
- the inositol tris phosphates are eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate.
- the columns are regenerated by washing with 10 ml of 0.1 M formic aci ⁇ VBM ammonium formate and rinsed twice with dd H 2 O and stored at 4°C in water.
- RUP35 and RUP36 receptor are endogenously, constitutively active.
- RUP35 evidences about a six (6) fold increase in intracellular inositol phosphate accumulation when compared to pCMV and
- RUP36 evidences about a four (4) fold increase when compared to pCMV.
- the design of the constitutively activated GPCR-G protein fusion construct can be accomplished as follows: both the 5' and 3' ends of the rat G protein G s ⁇ (long form; Itoh, H. et al., 83 PNAS 3776 (1986)) is engineered to include a HindHI (5'-AAGCTT-3') sequence thereon. Following confirmation of the correct sequence (including the flanking Hindlll sequences), the entire sequence is shuttled into pcDNA3.1(-) (Invitrogen, cat. no. N795-20) by subcloning using the Hindlll restriction site of that vector. The correct orientation for the G s ⁇ sequence will be determined after subcloning into pcD ⁇ A3.1(-).
- the modified pcDNA3.1(-) containing the rat G s ⁇ gene at Hindi ⁇ sequence is then verified; this vector will then be available as a "universal" G s ⁇ protein vector.
- the pcDNA3.1(-) vector contains a variety of well-known restriction sites upstream of the Hindi ⁇ site, thus beneficially providing the ability to insert, upstream of the G s protein, the coding sequence of an endogenous, constitutively active GPCR.
- This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized.
- the important criteria is that the sequence for the GPCR be upstream and in-frame with that of the G protein.
- Spacers in the restriction sites between the G protein and the GPCR are optional.
- the sense and anti-sense primers included the restriction sites for Xbal and EcoRN, respectively, such that spacers (attributed to the restriction sites) exist between the G protein and the GPCR.
- PCR will then be utilized to secure the respective receptor sequences for fusion within the G s ⁇ universal vector disclosed above, using the following protocol for each: lOOng cD ⁇ A for GPCR will be added to separate tubes containing 2 ⁇ l of each primer (sense and anti-sense), 3 ⁇ l of lOmM d ⁇ TPs, lO ⁇ l of lOXTaqPlusTM Precision buffer, l ⁇ l of TaqPlusTM Precision polymerase (Stratagene: #600211), and 80 ⁇ l of water.
- Reaction temperatures and cycle times for the GPCR will be as follows with cycle steps 2 through 4 were repeated 35 times: 94°C for 1 min; 94°C for 30 seconds; 62°C for 20 sec; 72°C 1 min 40sec; and 72°C 5 min.
- PCR products will be run on a 1% agarose gel and then purified.
- the purified products will be digested with Xbal and EcoRN and the desired inserts purified and ligated into the G s universal vector at the respective restriction sites.
- the positive clones will be isolated following transformation and determined by restriction enzyme digestion; expression using 293 cells will be accompUshed following the protocol set forth infra. Each positive clone for GPCR- G s Fusion Protein will be sequenced to verify correctness. b.
- G q (6 amino acid deletion)/Gi Fusion Construct
- the design of a G q (del)/G; fusion construct was accomplished as follows: the ⁇ - terminal six (6) amino acids (amino acids 2 through 7), having the sequence of TLESIM (SEQ.ID.NO. :47) G ⁇ q-subunit was deleted and the C-terminal five (5) amino acids, having the sequence EYNLV (SEQ.ID.NO.:48) was replaced with the corresponding amino acids of the G ⁇ i Protein, having the sequence DCGLF (SEQ.ID.NO.:49).
- This fusion construct was obtained by PCR using the following primers:
- Plasmid 63313 which contains the mouse G ⁇ q-wild type version with E hemagglutinin tag as template. Nucleotides in lower caps are included as spacers. TaqPlus ® Precision DNA polymerase (Stratagene) was utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95°C for
- the PCR AREN-0309 PATENT product will be cloned into a pCP I-TOPO vector (Invitrogen) and sequenced using the
- RT-PCR was applied to confirm the expression and to dete ⁇ nine the tissue distribution of several novel human GPCRs. Oligonucleotides utilized were GPCR- specific and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) were utilized for the amplification in a 40 ⁇ l reaction according to the manufacturer's instructions. Twenty ⁇ l of the reaction will be loaded on a 1.5% agarose gel to analyze the RT-PCR products. Table E, below, lists the receptors, the cycle conditions and the primers utilized, and also lists exemplary diseases/disorders linked to the receptors.
- Diseases and disorders related to receptors located in these tissues or regions include, but are not limited to, cardiac disorders and diseases (e.g. thrombosis, myocardial infarction; atherosclerosis; cardiomyopathies); kidney disease/disorders (e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); eosinophilia; leukocytosis; leukopenia; ovarian cancer; sexual dysfunction; polycystic ovarian syndrome; pancreatitis and pancreatic cancer; irritable bowel syndrome; colon cancer; Crohn's disease; ulcerative colitis; diverticulitis; Chronic Obstructive Pulmonary Disease (COPD); Cystic Fibrosis; pneumonia; pulmonary hypertension; tuberculosis and lung cancer; Parkinson's disease; movement disorders and ataxias; learning and memory disorders; eating disorders (e.g., anorexia
- Membranes comprising the constitutively active orphan GPCR Fusion Protein of interest and for use in the direct identification of candidate compounds as inverse agonists or agonists are preferably prepared as follows: a. Materials "Membrane Scrape Buffer” is comprised of 20mM HEPES and lOmM EDTA, pH 7.4; “Membrane Wash Buffer” is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; “Binding Buffer” is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl 2 , pH 7.4 b. Procedure All materials will be kept on ice throughout the procedure.
- the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 4°C). Thereafter, the supernatant will be aspirated and the pellet will be resuspended in 30ml Membrane Wash Buffer followed by centrifugation at 20,000 rpm for 17 minutes at 4°C. The supernatant will then be aspirated and the pellet resuspended in Binding Buffer. The resuspended pellet will then be homogenized using a Brinkman PolyfronTM homogenizer (15-20 second bursts until the material is in suspension). This is referred to herein as "Membrane Protein". 2.
- protein concentration of the membranes will be determined, for example, using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polyfron at about 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizer is thoroughly cleaned between homogenization of different preparations).
- Bradford Protein Assay protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polyfron at about 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizer is thoroughly
- Duplicate tubes will be prepared, one including the membrane, and one as a control "blank". Each contains 800 ⁇ l Binding Buffer. Thereafter, lO ⁇ l of Bradford
- each well comprising a candidate compound has a final volume of 200 ⁇ l consisting of lOO ⁇ l GDP Buffer (final concentration, 0.1 ⁇ M GDP), 50 ⁇ l Membrane Protein in Binding Buffer, and 50 ⁇ l [ 35 S]GTP ⁇ S (0.6 nM) in Binding Buffer (2.5 ⁇ l [ 35 S]GTP ⁇ S per 10ml Binding Buffer).
- Candidate compounds will be preferably screened using a 96-well plate format (these can be frozen at -80°C).
- Membrane Protein or membranes with expression vector excluding the GPCR Fusion Protein, as control
- Protein concentration will then be determined using, for example, the Bradford Protein Assay set forth above.
- Membrane Protein (and controls) will then be diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5 ⁇ g/well). Thereafter, 100 ⁇ l GDP Buffer is added to each well of a Wallac ScintistripTM (Wallac).
- a 5 ⁇ l pin-tool will then be used to transfer 5 ⁇ l of a candidate compound into such well (i.e., 5 ⁇ l in total assay volume of 200 ⁇ l is a 1 :40 ratio such that the final screening concentration of the candidate compound is lO ⁇ M).
- the pin tool is rinsed in three reservoirs comprising water (IX), ethanol (IX) and water (2X) - excess AREN-0309 PATENT liquid is shaken from the tool after each rinse and the tool is dried with paper and Kim wipes. Thereafter, 50 ⁇ l of Membrane Protein will be added to each well (a control well comprising membranes without the GPCR Fusion Protein was also utilized), and pre- incubated for 5-10 minutes at room temperature.
- Binding Buffer 50 ⁇ l of [ 35 S]GTP ⁇ S (0.6 nM) in Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil). The assay will be stopped by spinning the plates at 4000 RPM for 15 minutes at 22°C. The plates will then be aspirated with an 8 channel manifold and sealed with plate covers. The plates will then be read on a Wallac 1450 using setting "Prot. #37" (as per manufacturer's instructions).
- Another assay approach to directly identify candidate compound will be accomplished utilizing a cyclase-based assay.
- this assay approach can be utilized as an independent approach to provide confirmation of the results from the [ 35 S]GTP ⁇ S approach as set forth above.
- a modified Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) will be preferably utiUzed for direct identification of candidate compounds as inverse agonists and agonists to GPCRs in accordance with the following protocol. Transfected cells will be harvested approximately three days after transfection.
- Membranes will be prepared by homogenization of suspended cells in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl 2 . Homogenization will be performed on ice using a Brinkman PolyfronTM for approximately 10 seconds. The resulting homogenate will be centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be stored at -80°C until utilized.
- the membrane pellet On the day of direct identification screening, the membrane pellet will slowly be thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl 2 , to yield a final protein concentration of 0.60mg/ml (the resuspended membranes will be placed on ice until use).
- cAMP standards and Detection Buffer comprising 2 ⁇ Ci of tracer [ 125 I cAMP (100 ⁇ l] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the AREN-0309 PATENT manufacturer's instructions.
- Assay Buffer will be prepared fresh for screening and contain 20mM HEPES, pH 7.4, lOmM MgCl 2 , 20mM phosphocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 ⁇ M GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer will be stored on ice until utiUzed.
- Candidate compounds identified as per above if frozen, thawed at room temperature • will be added, preferably, to 96-well plate wells (3 ⁇ l/well; 12 ⁇ M final assay concentration), together with 40 ⁇ l Membrane Protein (30 ⁇ g/well) and 50 ⁇ l of Assay Buffer.
- a method for identifying candidate agonists or inverse agonists for a GPCR can be preformed by introducing tests cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GCPR.
- a stimulant e.g., Ught
- the tests cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound coupUng to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear light.
- the vector utilized be pCMV. This vector was deposited with the American Type Culture Collection (ATCC) on October 13, 1998 (10801 AREN-0309 PATENT).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention disclosed in this patent document relates to transmembrane receptors, more particularly to a human G protein-coupled receptor for which the endogenous ligand is unknown, and to mutated (non-endogenous) versions of the human GPCRs for evidence of constitutive activity.
Description
ENDOGENOUS AND NON-ENDOGENOUS VERSIONS OF HUMAN G PROTEIN-COUPLED RECEPTORS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. Serial Number 09/170,496, filed with the United States Patent and Trademark Office on October 13, 1998 and its corresponding PCT application number PCT/US99/23938, published as WO 00/22129 on April 20, 2000. This document claims the benefit of priority from the following provisional applications, all filed via U.S.' Express Mail with the United States Patent and Trademark Office on the indicated dates: U.S. Provisional Number 60/253,404, filed November 27, 2000; U.S. Provisional Number 60/255,366, filed December 12, 2000; U.S. Provisional Number 60/270,286 filed February 20, 2001; U.S. Provisional Number 60/282,356, filed April 6, 2001, which claims priority from U.S. Provisional Number 60/270,266, filed February 20, 2001; U.S. Provisional Number 60/282,032, filed April 6, 2001; U.S. Provisional Number 60/282,358, filed April 6, 2001; U. S. Provisional Number 60/282,365, filed April 6, 2001; U.S. Provisional Number 60/290,917, filed May 14, 2001; U.S. Provisional Number 60/309,208, filed July 31, 2001; the disclosures of which are incorporated in their entirety by reference.
FIELD OF THE INVENTION
The present invention relates to transmembrane receptors, in some embodiments to
G protein-coupled receptors and, in some preferred embodiments, to endogenous GPCRs that are altered to establish or enhance constitutive activity of -the receptor. In some embodiments, the constitutively activated GPCRs will be used for the direct identification of candidate compounds as receptor agonists or inverse agonists having applicability as therapeutic agents.
PATENT
BACKGROUND OF THE INVENTION
Although a number of receptor classes exist in humans, by far the most abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR) class. It is estimated that there are some 30,000-40,000 genes within the human genome, and of these, approximately 2% are estimated to code for GPCRs. Receptors, including GPCRs, for which the endogenous ligand has been identified, are referred to as "known" receptors, while receptors for which the endogenous ligand has not been identified are referred to as "orphan" receptors.
GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed. For example, in 1999, of the top 100 brand name prescription drugs, the following drugs interact with GPCRs (diseases and/or disorders treated are indicated in parentheses):
Claritin® (allergies) Prozac® (depression) Vasotec® (hypertension) Paxil® (depression) Zolofit® (depression) Zyprexa ® (psychotic disorder) Cozaar® (hypertension) Imitrex® (migraine) Zantac® (reflux) Propulsid® (reflux disease) Risperdal® (schizophrenia) Serevent® (asthma) Pepcid® (reflux) Gaster® (ulcers) Atrovent® (bronchospasm) Effexor® (depression) Depakote® (epilepsy) Cardura® (prostatic hypertrophy) Allegra® (allergies) Lupron® (prostate cancer) Zoladex® (prostate cancer) Diprivan® (anesthesia) BuSpar® (anxiety) Ventolin® (bronchospasm) Hytrin® (hypertension) Wellbutrin® (depression) Zyrtec® (rhinitis) Plavix® (Ml/stroke) Toprol-XL® (hypertension) Tenormin® (angina) Xalatan® (glaucoma) Singulair® (asthma) Diovan® (hypertension) Harnal® (prostatic hyperplasia)
(Med Ad News 1999 Data).
GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-1), transmebrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or
AREN-0309 PATENT
"extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively). The transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space outside of the cell.
Generally, when an endogenous ligand binds with the receptor (often referred to as "activation" of the receptor), there is a change in the conformation of the intracellular region that allows for coupling between the intracellular region and an intracellular "G-protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, Gz and G0 are G proteins that have been identified. Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. Although not wishing to be bound to theory, it is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein. Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response. Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G- protein) and produces a biological response.
A receptor may be stabilized in an active state by a ligand or a compound such as a drug. Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor, provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a Ugand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation."
AREN-0309 PATENT
SUMMARY OF THE INVENTION
Disclosed herein are endogenous and non-endogenous versions of human GPCRs and uses thereof.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:2, non-endogenous, constitutively activated versions of the same, and host cells comprising the same- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:l and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:4, non-endogenous, constitutively activated versions of the same, and host cells comprising the same..
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:3, non-endogenous, constitutively activated versions of the same, and host cells comprising the same. Some embodiments of the present invention relate to G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:8, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:7, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:10, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:9 and host cells comprising the same.
AREN-0309 PATENT
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 11 , and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 14, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 13 and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 16, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 15 and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 18, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:17 and host cells comprising the same.
Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO. :20, constitutively activated versions of the same, and host cells comprising the same.
Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 19 and host cells comprising the same.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graphic representation of activation of RUP32, Gq(del)/Gi, RUP32 co-transfected with Gq(del)/Gj, and CMV (control; expression vector) in a second messenger assay measuring the accumulation of inositol phosphate (IP3) utilizing 293 cells.
Figure 2 provides an illustration of second messenger IP3 production from endogenous version RUP35 and RUP36 as compared with the control ("CMV").
AREN-0309 PATENT
DETAILED DESCRIPTION
The scientific literature that has evolved around receptors has adopted a number of terms to refer to ligands having various effects on receptors. For clarity and consistency, the following definitions will be used throughout this patent document. To the extent that these definitions conflict with other definitions for these terms, the following definitions shall control:
AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to membranes, hi some embodiments, AGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
AMINO ACID ABBREVIATIONS used herein are set out in Table A:
TABLE A
AREN-0309 PATENT
ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that competitively bind to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular responses by agonists. ANTAGONISTS do not diminish the baseline intracellular response in the absence of an agonist. In some embodiments, ANTAGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
CANDIDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique. Preferably, the phrase "candidate compound" does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound"); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans.
COMPOSITION means a material comprising at least one component; a "pharmaceutical composition" is an example of a composition. COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality; i.e. the ability to activate/inhibit a
AREN-0309 PATENT signal transduction pathway, as opposed to receptor binding affinity. Exemplary means of detecting compound efficacy are disclosed in the Example section of this patent document.
CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides) which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine (U) and thymidine (T)) coupled to a phosphate group and which, when translated, encodes an amino acid.
CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subjected to constitutive receptor activation. A constitutively activated receptor can be endogenous or non-endogenous.
CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a receptor in the active state by means other than binding of the receptor with its Ugand or a chemical equivalent thereof.
CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.
DIRECTLY IDENTIFYING or DIRECTLY IDENTIFHED, in relationship to the phrase "candidate compound", shall mean the screening of a candidate compound against a constitutively activated receptor, preferably a constitutively activated orphan receptor, and most preferably against a constitutively activated G protein-coupled cell surface orphan receptor, and assessing the compound efficacy of such compound. This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase "indirectly identifying" or "indirectly identified."
ENDOGENOUS shall mean a material that a mammal naturally produces. ENDOGENOUS in reference to, for example and not limitation, the term "receptor," shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. By contrast, the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus. For example, and not limitation, a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active, is most preferably referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can be utilized to describe both "in vivo" and "in vitro" systems. For example, and not limitation, in a screening approach, the endogenous or non-endogenous receptor may be
AREN-0309 PATENT in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate compound by means of an in vivo system is viable. G PROTEIN COUPLED RECEPTOR FUSION PROTEIN and GPCR
FUSION PROTEIN, in the context of the invention disclosed herein, each mean a non- endogenous protein comprising an endogenous, constitutively activate GPCR or a non- endogenous, constitutively activated GPCR fused to at least one G protein, most preferably the alpha ( ) subunit of such G protein (this being the subunit that binds GTP), with the G protein preferably being of the same type as the G protein that naturally couples with endogenous orphan GPCR. For example, and not Umitation, in an endogenous state, if the G protein "Gs " is the predominate G protein that couples with the GPCR, a GPCR Fusion Protein based upon the specific GPCR would be a non-endogenous protein comprising the GPCR fused to Gsα; in some circumstances, as will be set forth below, a non-predominant G protein can be fused to the GPCR. The G protein can be fused directly to the C-terminus of the constitutively active GPCR or there may be spacers between the two.
HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein. In the case of a prokaryotic Host Cell, a Plasmid is typically replicated as a autonomous molecule as the Host Cell repUcates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell repUcates, the Plasmid repUcates. In some embodiments the Host Cell is eukaryotic, more preferably, mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells. INDIRECTLY IDENTIFYING or INDD ECTLY IDENTIFIED means the traditional approach to the drug discovery process involving identification of an endogenous ligand specific for an endogenous receptor, screening of candidate compounds against the receptor for determination of those which interfere and/or compete with the Ugand-receptor interaction, and assessing the efficacy of the compound for affecting at least one second messenger pathway associated with the activated receptor.
AREN-0309 PATENT
INHIBIT or INHIBITING, in relationship to the term "response" shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.
INVERSE AGONISTS shall mean materials (e.g., Ugand, candidate compound) which bind to either the endogenous form of the receptor or to the constitutively activated form of the receptor, and which inhibit the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of agonists, or decrease GTP binding to membranes. Preferably, the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% as compared with the baseline response in the absence of the inverse agonist.
KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous Ugand specific for that receptor has been identified.
LIGAND shall mean a molecule specific for a naturally occurring receptor. MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor. In terms of equivalents to specific sequences, a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of a human receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99%. In some embodiments, owing to the fact that some preferred cassettes disclosed herein for achieving constitutive activation include a single amino acid and/or codon change between the endogenous and the non-endogenous forms of the GPCR, it is preferred that the percent sequence homology should be at least 98%.
AREN-0309 PATENT
NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an identified ligand wherein the binding of a Ugand to a receptor activates an intracellular signaling pathway.
ORPHAN RECEPTOR shall mean an endogenous receptor for which the Ugand specific for that receptor has not been identified or is not known.
PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, and not limitation, a human).
Those of ordinary skill in the art will understand and appreciate the techniques appropriate for determining whether an active ingredient has a desired efficacious outcome based upon the needs of the artisan.
PLASMID shall mean the combination of a Vector and cDNA. Generally, a Plasmid is introduced into a Host Cell for the purposes of replication and/or expression of the cDNA as a protein. SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation. A second messenger can include, for example, inositol triphosphate (IP3), diacycglycerol (DAG), cyclic AMP (cAMP), and cyclic GMP (cGMP). Second messenger response can be measured for a determination of receptor activation, hi addition, second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, agonists, and antagonists.
SIGNAL TO NOISE RATIO shall mean the signal generated in response to activation, amplification, or stimulation wherein the signal is above the background noise or the basal level in response to non-activation, non-ampUfication, or non-stimulation.
SPACER shall mean a translated number of amino acids that are located after the last codon or last amino acid of a gene, for example a GPCR of interest, but before the start codon or beginning regions of the G protein of interest, wherein the translated number amino acids are placed in-frame with the beginnings regions of the G protein of interest. The number of translated amino acids can be tailored according to the needs of the skilled artisan and is generally from about one amino acid, preferably two amino acids, more preferably three amino acids, more preferably four amino acids, more preferably five amino acids, more preferably six amino acids, more preferably seven amino acids, more preferably
AREN-0309 PATENT eight amino acids, more preferably nine amino acids, more preferably ten amino acids, more preferably eleven amino acids, and even more preferably twelve amino acids.
STIMULATE or STIMULATING, in relationship to the term "response" shall mean that a response is increased in the presence of a compound as opposed to in the absence of the compound.
SUBSTANTIALLY shall refer to a result which is within 40% of a control result, preferably within 35%, more preferably within 30%, more preferably within 25%, more preferably within 20%, more preferably within 15%, more preferably within 10%, more preferably within 5%, more preferably within 2%, and most preferably within 1% of a control result. For example, in the context of receptor functionality, a test receptor may exhibit substantially similar results to a control receptor if the transduced signal, measured using a method taught herein or similar method known to the art-skilled, if within 40% of the signal produced by a control signal.
VECTOR in reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell.
The order of the following sections is set forth for presentational efficiency and is not intended, nor should be construed, as a Umitation on the disclosure or the claims to follow.
A. Introduction
The traditional study of receptors has typically proceeded from the a priori assumption (historically based) that the endogenous ligand must first be identified before discovery could proceed to find antagonists and other molecules that could affect the receptor. Even in cases where an antagonist might have been known first, the search immediately extended to looking for the endogenous Ugand. This mode of thinking has persisted in receptor research even after the discovery of constitutively activated receptors. What has not been heretofore recognized is that it is the active state of the receptor that is most useful for discovering agonists and inverse agonists of the receptor. For those diseases which result from an overly active receptor or an under-active receptor, what is desired in a therapeutic drug is a compound which acts to diminish the active state of a receptor or enhance the activity of the receptor, respectively, not necessarily a drug which is an antagonist to the endogenous Ugand. This is because a compound that reduces or enhances
AREN-0309 PATENT the activity of the active receptor state need not bind at the same site as the endogenous ligand. Thus, as taught by a method of this invention, any search for therapeutic compounds should start by screening compounds against the Ugand-independent active state. B. Identification of Human GPCRs
The efforts of the Human Genome project has led to the identification of a plethora of information regarding nucleic acid sequences located within the human genome; it has been the case in this endeavor that genetic sequence information has been made available without an understanding or recognition as to whether or not any particular genomic sequence does or may contain open-reading frame information that translate human proteins. Several methods of identifying nucleic acid sequences within the human genome are within the purview of those having ordinary skill in the art. For example, and not limitation, a variety of human GPCRs, disclosed herein, were discovered by reviewing the GenBank™ database. Table B, below, Usts several endogenous GPCRs that we have discovered, along with other GPCRs that are homologous to the disclosed GPCR.
TABLE B
AREN-0309 PATENT
Receptor homology is useful in terms of gaining an appreciation of a role of the receptors within the human body. As the patent document progresses, techniques for mutating these receptors to establish non-endogenous, constitutively activated versions of these receptors will be discussed.
The techniques disclosed herein are also applicable to other human GPCRs known to the art, as will be apparent to those skilled in the art. C. Receptor Screening
Screening candidate compounds against a non-endogenous, constitutively activated version of the GPCRs disclosed herein allows for the direct identification of candidate compounds which act at the cell surface receptor, without requiring use of the receptor's endogenous ligand. Using routine, and often commercially available techniques, one can determine areas within the body where the endogenous version of human GPCRs disclosed herein is expressed and/or over-expressed. The expression location of a receptor in a specific tissue provides a scientist with the abiUty to assign a physiological functional role of the receptor. It is also possible using these techniques to determine related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of the cUnical relevance of the receptor.
Constitutive activation of the GPCRs disclosed herein is based upon the distance from the proline residue at which is presumed to be located within TM6 of the GPCR; this algorithmic technique is disclosed in co-pending and commonly assigned patent document PCT Application Number PCT/US99/23938, published as WO 00/22129 on April 20, 2000, which, along with the other patent documents listed herein, is incorporated herein by reference. The algorithmic technique is not predicated upon traditional sequence "alignment" but rather a specified distance from the aforementioned TM6 proline residue (or, of course, endogenous constitutive substitution for such proline residue). By mutating the amino acid residue located 16 amino acid residues from this residue (presumably located in the IC3 region of the receptor) to, most preferably, a lysine residue, constitutive
AREN-0309 PATENT activation of the receptor may be obtained. Other amino acid residues may be useful in the mutation at this position to achieve this objective and will be discussed in detail, below. D. Disease/Disorder Identification and/or Selection
As will be set forth in greater detail below, inverse agonists and agonists to the non- endogenous, constitutively activated GPCR can be identified by the methodologies of this invention. Such inverse agonists and agonists are ideal candidates as lead compounds in drug discovery programs for treating diseases related to this receptor. Because of the ability to directly identify inverse agonists to the GPCR, thereby allowing for the development of pharmaceutical compositions, a search for diseases and disorders associated with the GPCR is relevant. The expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological function to the receptor. For example, scanning both diseased and normal tissue samples for the presence of the GPCR now becomes more than an academic exercise or one which might be pursued along the path of identifying an endogenous Ugand to the specific GPCR. Tissue scans can be conducted across a broad range of healthy and diseased tissues. Such tissue scans provide a potential first step in associating a specific receptor with a disease and/or disorder. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of clinical relevance of the receptor.
The DNA sequence of the GPCR can be used to make a probe/primer. In some preferred embodiments the DNA sequence is used to make a probe for (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples. The presence of a receptor in a tissue source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue, can be used to correlate location to function and indicate the receptor's physiological role/function and create a treatment regimen, including but not limited to, a disease associated with that function/role. Receptors can also be localized to regions of organs by this technique. Based on the known or assumed roles/functions of the specific tissues to which the receptor is localized, the putative physiological function of the receptor can be deduced. For example and not limitation, proteins located/expressed in areas of the thalamus are associated with sensorimotor processing and arousal (see, Goodman & Gilman's, The Pharmacological Basis of Therapeutics, 9th Edition, page 465 (1996)). Proteins expressed in the hippocampus or in Schwann cells are associated with learning and
AREN-0309 PATENT memory, and myehnation of peripheral nerves, respectively (see, Kandel, E. et al.,
Essentials of Neural Science and Behavior pages 657, 680 and 28, respectively (1995)).
E. Screening of Candidate Compounds 1. Generic GPCR screening assay techniques
When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., Gq, Gs, G„ Gz, Go) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activated receptors continue to exchange GDP to GTP. A non-hydrolyzable analog of GTP, [35S]GTPγS, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [35S]GTPγS can be used to monitor G protein coupling to membranes in the absence and presence of Ugand. An example of this monitoring, among other examples well-known and available to those in the art, was reported by Traynor and Nahorski in 1995. The use of this assay system is typically for initial screening of candidate compounds because the system is generically applicable to all G protein-coupled receptors regardless of the particular G protein that interacts with the intracellular domain of the receptor. 2. Specific GPCR screening assay techniques Once candidate compounds are identified using the "generic" G protein-coupled receptor assay (i.e., an assay to select compounds that are agonists or inverse agonists), further screening to confirm that the compounds have interacted at the receptor site is preferred. For example, a compound identified by the "generic" assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain. a. Gs, Gz and G[. Gs stimulates the enzyme adenylyl cyclase. Gj (and Gz and Go), on the other hand, inhibits adenylyl cyclase. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the Gs protein are associated with increased cellular levels of cAMP. On the other hand, constitutively activated GPCRs that couple Gi (or Gz, Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can be utiUzed to determine if a candidate compound is, e.g., an inverse
AREN-0309 PATENT agonist to the receptor (i.e., such a compound would decrease the levels of cAMP). A variety of approaches known in the art for measuring cAMP can be utilized; a most preferred approach reUes upon the use of anti-cAMP antibodies in an ELISA-based format. Another type of assay that can be utiUzed is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes. CycUc AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) that then binds to the promoter at specific sites (cAMP response elements) and drives the expression of the gene. Reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., β-galactosidase or luciferase. Thus, a constitutively activated Gs-linked receptor causes the accumulation of cAMP that then activates the gene and leads to the expression of the reporter protein. The reporter protein such as β-galactosidase or luciferase can then be detected using standard biochemical assays (Chen et al. 1995). b. G0 and Gq.
Gq and G0 are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP2, releasing two intracellular messengers: diacycloglycerol (DAG) and inositol 1,4,5-triphoisphate (IP3). Increased accumulation of IP is associated with activation of Gq- and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP accumulation can be utilized to determine if a candidate compound is, e.g., an inverse agonist to a Gq- or Go-associated receptor (i.e., such a compound would decrease the levels of IP3). Gq- associated receptors can also be examined using an API reporter assay wherein Gq- dependent phospholipase C causes activation of genes containing API elements; thus, activated Gq-associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression. Commercially available assays for such detection are available.
3. GPCR Fusion Protein
AREN-0309 PATENT
The use of an endogenous, constitutively activated GPCR or a non-endogenous, constitutively activated GPCR, for use in screening of candidate compounds for the direct identification of inverse agonists, agonists provide an interesting screening challenge in that, by definition, the receptor is active even in the absence of an endogenous Ugand bound thereto. Thus, in order to differentiate between, e.g., the non- endogenous receptor in the presence of a candidate compound and the non-endogenous receptor in the absence of that compound, ith an aim of such a differentiation to allow for an understanding as to whether such compound may be an inverse agonist or agonist or have no affect on such a receptor, it is preferred that an approach be utilized that can enhance such differentiation. A preferred approach is the use of a GPCR Fusion Protein.
Generally, once it is determined that a non-endogenous GPCR has been constitutively activated using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. In some embodiments it is preferred that screening take place using a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the non-endogenous, constitutively activated GPCR will continuously signal. In some embodiments it is preferred that this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is contacted with the inverse agonist.
The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR. The GPCR Fusion Protein is preferred for screening with either an endogenous, constitutively active GPCR or a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is utilized in such screening techniques. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is preferred for the screening of candidate compounds as disclosed herein.
The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator. Important criteria on the construction of such a GPCR Fusion Protein
AREN-0309 PATENT construct include but are not limited to, that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence), and that the "stop" codon of the GPCR be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed. Other embodiments include constructs wherein the endogenous GPCR sequence and the G protein sequence are not in-frame and or the "stop" codon is not deleted or replaced. The GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). Based upon convenience it is preferred to use a spacer. Preferably, the G protein that couples to the non-endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct (see Examples)) be available for insertion of an endogenous GPCR sequence therein; this provides for further efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences.
As noted above, constitutively activated GPCRs that couple to G;, Gz and G0 are expected to inhibit the formation of cAMP making assays based upon these types of GPCRs challenging (i.e., the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging. As will be disclosed herein, we have ascertained that for these types of receptors, it is possible to create a GPCR Fusion Protein that is not based upon the GPCRs endogenous G protein, in an effort to establish a viable cyclase-based assay. Thus, for example, an endogenous G; coupled receptor can be fused to a Gs protein -such a fusion construct, upon expression, "drives" or "forces" the endogenous GPCR to couple with, e.g., Gs rather than the "natural" Gj protein, such that a cyclase-based assay can be estabUshed. Thus, for Gj, Gz and G0 coupled receptors, in some embodiments it is preferred that when a GPCR Fusion Protein is used and the assay is based upon detection of adenylyl cyclase activity, that the fusion construct be established with Gs (or an equivalent G protein that stimulates the formation of the enzyme adenylyl cyclase).
Equally effective is a G Protein Fusion construct that utilizes a Gq Protein fused with a Gs, Gj, Gz or G0 Protein. In some embodiments a preferred fusion construct can be accomplished with a Gq Protein wherein the first six (6) amino acids of the G-protein α- subunit ("Gαq") is deleted and the last five (5) amino acids at the C-terminal end of Gαq is replaced with the corresponding amino acids of the Gα of the G protein of interest. For example, a fusion construct can have a Gq (6 amino acid deletion) fused with a Gj Protein, resulting in a "Gq/Gj Fusion Construct". This fusion construct will forces the endogenous Gj coupled receptor to couple to its non-endogenous G protein, Gq, such that the second messenger, for example, inositol triphosphate or diacylgycerol, can be measured in lieu of cAMP production.
4. Co-transfection of a Target Gi Coupled GPCR with a Signal- Enhancer Gs Coupled GPCR (cAMP Based Assays)
A Gj coupled receptor is known to inhibit adenylyl cyclase, and, therefore, decreases the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique in measuring the decrease in production of cAMP as an indication of constitutive activation of a receptor that predominantly couples Gj upon activation can be accomplished by co-transfecting a signal enhancer, e.g., a non-endogenous, constitutively activated receptor that predominantly couples with Gs upon activation (e.g., TSHR-A623I, disclosed below), with the Gj linked GPCR. As is apparent, constitutive activation of a Gs
AREN-0309 PATENT coupled receptor can be determined based upon an increase in production of cAMP.
Constitutive activation of a Gj coupled receptor leads to a decrease in production cAMP. Thus, the co-transfection approach is intended to advantageously exploit these "opposite" affects. For example, co-transfection of a non-endogenous, constitutively activated Gs coupled receptor (the "signal enhancer") with the endogenous Gj coupled receptor (the "target receptor") provides a baseUne cAMP signal (i.e., although the Gj coupled receptor will decrease cAMP levels, this "decrease" will be relative to the substantial increase in cAMP levels established by constitutively activated Gs coupled signal enhancer). By then co-transfecting the signal enhancer with a constitutively activated version of the target receptor, cAMP would be expected to further decrease (relative to base line) due to the increased functional activity of the Gj target (i.e., which decreases cAMP).
Screening of candidate compounds using a cAMP based assay can then be accomplished, with two 'changes' relative to the use of the endogenous receptor/G-protein fusion: first, relative to the G; coupled target receptor, "opposite" effects will result, i.e., an inverse agonist of the Gj coupled target receptor will increase the measured cAMP signal, while an agonist of the G; coupled target receptor will decrease this signal; second, as would be apparent, candidate compounds that are directly identified using this approach should be assessed independently to ensure that these do not target the signal enhancing receptor (this can be done prior to or after screening against the co-transfected receptors).
F. Medicinal Chemistry
Generally, but not always, direct identification of candidate compounds is conducted in conjunction with compounds generated via combinatorial chemistry techniques, whereby thousands of compounds are randomly prepared for such analysis. Generally, the results of such screening will be compounds having unique core structures; thereafter, these compounds may be subjected to additional chemical modification around a preferred core structure(s) to further enhance the medicinal properties thereof. Such techniques are known to those in the art and will not be addressed in detail in this patent document.
G. Pharmaceutical compositions
AREN-0309 PATENT
Candidate compounds selected for further development can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers are available to those in the art; for example, see Remington's Pharmaceutical Sciences, 16th Edition, 1980, Mack Publishing Co., (Osol et al., eds.).
H. Other Utilities
Although a preferred use of the non-endogenous versions of the GPCRs disclosed herein may be for the direct identification of candidate compounds as inverse agonists or agonists (preferably for use as pharmaceutical agents), other uses of these versions of GPCRs exist. For example, in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade. In some embodiments it is preferred that the endogenous receptors be "orphan receptors", i.e., the endogenous Ugand for the receptor has not been identified. In some embodiments, therefore, the modified, non-endogenous GPCRs can be used to understand the role of endogenous receptors in the human body before the endogenous Ugand therefore is identified. Such receptors can also be used to further elucidate known receptors and the pathways through which they transduce a signal. Other uses of the disclosed receptors will become apparent to those in the art based upon, ter alia, a review of this patent document.
EXAMPLES The following examples are presented for purposes of elucidation, and not limitation, of the present invention. While specific nucleic acid and amino acid sequences are disclosed herein, those of ordinary skiU in the art are credited with the ability to make minor modifications to these sequences while achieving the same or substantially similar results reported below. The traditional approach to application or understanding of sequence cassettes from one sequence to another (e.g. from rat receptor to human receptor or from human receptor A to human receptor B) is generally predicated upon sequence alignment techniques whereby the sequences are aUgned in an effort to determine areas of commonality. The mutational approach disclosed herein does not rely upon this approach but is instead based upon an algorithmic approach and a positional distance from a conserved proline residue located within the TM6 region of human GPCRs. Once this
AREN-0309 PATENT approach is secured, those in the art are credited with the abiUty to make minor modifications thereto to achieve substantially the same results (i.e., constitutive activation) disclosed herein. Such modified approaches are considered within the purview of this disclosure. Example 1
ENDOGENOUS HUMAN GPCRS
1. Identification of Human GPCRs The disclosed endogenous human GPCRs were identified based upon a review of the GenBank™ database information. While searching the database, the following cDNA clones were identified as evidenced below (Table C).
TABLE C
2. FuU Length Cloning a. hRUP28 (Seq. Id. Nos. 1 & 2) The disclosed human RUP28 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number
AC073957 was identified as a human genomic sequence from chromosome 7.
The full length RUP28 was cloned by PCR using primers:
AREN-0309 PATENT
5'- CAGAGCTCTGGTGGCCACCTCTGTCC-
3' (SEQ.ID.NO.:21; sense, 5' of initiation codon),
5'-CTGCGTCCACCAGAGTCACGTCTCC-3' (SEQ.ID.NO. :22; antisense, 3' of stop codon), and human adult liver Marathon-Ready™ cDNA (Clontech) as template. Advantage™ cDNA polymerase (Clontech) was used for the amplification in a 50μl reaction by the following cycle with step 2 to 4 repeated 35 times: 95°C for 5 min; 94°C for 30 sec; 58°C for 30 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 1.16kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :1 for the nucleic acid sequence and SEQ.ID.NO. :2 for the putative amino acid sequence. b. hRUP29 (Seq. Id. Nos. 3 & 4) The disclosed human RUP29 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC0083865 was identified as a human genomic sequence from chromosome 7. The full length RUP29 was cloned by PCR using primers: 5'-GTATGCCTGGCCACAATACCTCCAGG-3' (SEQ.ID.NO. :23; sense, containing the initiation codon),
5'-GTTTGTGGCTAACGGCACAAAACACAATTCC-3' (SEQ.ID.NO. :24; antisense, containing the stop codon) and human genomic DNA as template. TaqPlus® Precision DNA polymerase (Stratagene) was used for the amplification in a 50μl reaction by the following cycle with step 2 to 4 repeated 35 times: 94°C for 5 min; 94°C for 30 sec; 54°C for 30 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 930bp PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems).
Rapid amplification of cDNA ends (RACE) was performed using human leukocyte and ovary Marathon-Ready™ cDNA (Clontech) to determine the precise 5' end of RUP29 cDNA. RUP29 specific primer (1) having the sequence: 5-GGTACCACAATGACAATCACCAGCGTCC-3 '(SEQ.ID.NO. :25) and API primer (Clontech) were used for the first-round PCR reaction, and RUP29 specific primer (2) having the following sequence:
AREN-0309 PATENT
5'-
GGAACGTGAGGTACATGTGGATGTGCAGC-3 ' (SEQ.ID.NO. :26) and AP2 primer (Clontech) were used for the second-round PCR reaction. The products of the RACE reactions were isolated and cloned into the pCRII-TOPO vector (rnvitrogen) and sequenced. See, SEQ.ID.NO. :3 for the nucleic acid sequence and SEQ.ID.NO. :4 for the putative amino acid sequence. c. hRUP30 (Seq. Id. Nos. 5 & 6) The disclosed human RUP30 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC055863 was identified as a human genomic sequence from chromosome 17. The full length RUP30 was cloned by 5 'RACE -PCR with a human pancreas Marathon-Ready™ cDNA (Clontech) as template and the following oligonucleotide: 5'-GCAGTGTAGCGGTCAACCGTGAGCAGG-3'(SEQ.ID.NO.:27; sense, containing the initiation codon), and API primer (Clontech) were used for the first round of RT-PCR and oligonucleotide:
5'-TGAGCAGGATGGCGATCCAGACTGAGGCGTGG-3'(SEQ.ID.NO.:28; antisense, containing the stop codon) and AP2 primer (Clontech) were used for the second round of PCR. DNA fragments generated by the 5' RACE-PCR were cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the SP6/T7 primers (Stratagene). Based on the sequence of the 5' RACE products, the full length RUP30 was cloned by RT-PCR, using primers:
5'-GAGGTACAGCTGGCGATGCTGACAG-3' (SEQ.ID.NO. :29; sense, ATG as the initiation codon); 5'-GTGGCCATGAGCCACCCTGAGCTCC-3' (SEQ.ID.NO.:30; antisense, 3' of the stop codon) and human pancreas Marathon-Ready™ cDNA (Clontech) as template. Taq DNA polymerase (Stratagene) was used for the amplification in 50 μl reaction by the following cycle with step 2 to step 4 repeated 35 times: 94°C for 40 seconds; 94°C for 20 seconds; 64°C for 20 seconds; 72°C for 2 minutes; and 72°C for 5 minutes.
A 1.2 Kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and several clones were sequenced using the ABI Big Dye Terminator kit (P.E. Biosystems). See, SEQ.ID.NO.:5 for the nucleic acid sequence and SEQ.ID.NO. :6 for the putative amino acid sequence.
AREN-0309 PATENT d. hRUP31 (Seq. Id. Nos. 7 & 8)
The disclosed human RUP31 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
Number AL356214 was identified as a human genomic sequence from chromosome 10. The full length RUP31 was cloned by RT-PCR using primers:
5'-GGAATGTCCACTGAATGCGCGCGG-3' (SEQ.ID.NO. :31; sense, containing the initiation codon),
5'-AGCTCGCCAGGTGTGAGAAACTCGG-3' (SEQ.ID.NO. :32; antisense, 3' of stop codon) and human mammary gland Marathon-Ready™ cDNA (Clontech) as template. Advantage™ cDNA polymerase (Clontech) was used for the amplification in 50 μl reaction by the following cycle with step 2 to step 4 repeated 35 times: 94°C for 40 sec; 94°C for 20 sec; 66°C for 20 sec; 72°C for 1 min 30 sec; and 72°C for 5 min.
A 1.1 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :7 for the nucleic acid sequence and SEQ.ID.NO. :8 for the putative amino acid sequence. e. hRUP32 (Seq. Id. Nos. 9 & 10)
The disclosed human RUP32 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AL513524 was identified as a human genomic sequence from chromosome 6. The full length RUP32 was cloned by PCR using primers: 5'-GCGTTATGAGCAGCAATTCATCCCTGCTGG-3' (SEQ.ID.NO.:33; sense, containing the initiation codon),
5'-GTATCCTGAACTTCGTCTATACAACTGC-3' (SEQ.ID.NO. :34; antisense) and human genomic DNA (Clontech) as template. TaqPlus® Precision DNA polymerase (Stratagene) was used for the ampUfication by the following cycle with step 2 to step 4 repeated 35 times: 94°C for 3 min; 94°C for 20 sec; 58°C for 20 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 1.06 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO. :9 for the nucleic acid sequence and SEQ.ID.NO.: 10 for the putative amino acid sequence.
AREN-0309 PATENT f. hRUP33 (Seq. Id. Nos. 11 & 12)
The disclosed human RUP33 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
Number AL513524 was identified as a human genomic sequence from chromosome 6. The full length RUP33 was cloned by PCR using primers:
5'-CCCTCAGGAATGATGCCCTTTTGCCACAA-3' (SEQ.ID.NO. :35; sense, containing the initiation codon),
5'-ATCCATGTGGTTGGTGCATGTGGTTCGT-3' (SEQ.ID.NO.:36; antisense) and human genomic DNA (Clontech) as template. TaqPlus® Precision DNA polymerase (Stratagene) was used for the ampUfication by the following cycle with step 2 to step 4 repeated 35 times: 94°C for 3 min; 94°C for 20 sec; 56°C for 20 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 1.1 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.: 11 for the nucleic acid sequence and
SEQ.ID.NO.: 12 for the putative amino acid sequence. g. hRUP34 (Seq. Id. Nos. 13 & 14)
The disclosed human RUP34 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AL513524 was identified as a human genomic sequence from chromosome 6. The full length RUP34 was cloned by PCR using primers:
5'-AAACAACAAACAGCAGAACCATGACCAGC-3' (SEQ.ID.NO. :37; sense, containing the initiation codon),
5'-ACATAGAGACAAGTGACATGTGTGAACCAC-3' (SEQ.ID.NO.:38; antisense) and human genomic DNA (Clontech) as template. TaqPlus® Precision DNA polymerase
(Stratagene) was used for the ampUfication by the following cycle with step 2 to step 4 repeated 35 times: 94°C for 3 min; 94°C for 20 sec; 60°C for 20 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 1.27 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit
(P.E. Biosystems). See, SEQ.ID.NO.: 13 for the nucleic acid sequence and
SEQ.ID.NO.: 14 for the putative amino acid sequence.
AREN-0309 PATENT h. hRUP35 (Seq. Id. Nos. 15 & 16)
The disclosed human RUP35 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession
Number AC021089 was identified as a human genomic sequence from chromosome 16. The 5' sequence of RUP35 was determined by 5' RACE- PCR with a human fetal brain Marathon-Ready™ cDNA (Clontech) as template. Oligonucleotide
5'-GGTATGAGACCGTGTGGTACTTGAGC-3' (SEQ.ID.NO. :39; sense) and API primer (Clontech) were used for the first round of RT-PCR and oligonucleotide
5'-GTGGCAGACAGCGATATACCTGTCAATGG-3' (SEQ.ID.NO.:40; antisense) and AP2 primer (Clontech) were used for the second round of PCR. DNA fragments generated by the 5' RACE-PCR were cloned into the pCRTI-TOPO vector (Invitrogen) and sequenced using the SP6/T7 primers (Stratagene).
Based upon the sequence of the 5' RACE products, the full length RUP35 was cloned by RT-PCR, using primers 5'-GCGCTCATGGAGCACACGCACGCCCAC-3' (SEQ.ID.NO. :41; sense, ATG as the initiation codon) and
5'-GAGGCAGTAGTTGCCACACCTATGG-3' (SEQ.ID.NO. :42; antisense, 3' of the stop codon) and human brain Marathon-Ready™ cDNA (Clontech) as template. Advantage™ cDNA polymerase (Clontech) was used for the amplification in 100 μl reaction by the following cycle with step 2 to step 4 repeated 45 times: 95°C for 2 min; 95°C for 20 sec; 60°C for 20 sec; 72°C for 1 min 30 sec; and 72°C for 5 min.
A 1.0 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.:15 for the nucleic acid sequence and SEQ.ID.NO. : 16 for the putative amino acid sequence. i. hRUP36 (Seq. Id. Nos. 17 & 18) The disclosed human RUP36 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC090099 was identified as a human genomic sequence from chromosome 11. The full length RUP36 was cloned by PCR using primers:
5'- CATCTGGTTTGTGTTCCCAGGGGCACCAG -3' (SEQ.JX>.NO.:43; sense, 5' of start codon),
AREN-0309 PATENT
5'-
GACAGTGTTGCTCTCAAAGTCCCGTCTGACTG -3' (SEQ.ID.NO. :44; antisense, 3' of stop codon) and human genomic DNA (Clontech) as template. TaqPlus® Precision DNA polymerase (Stratagene) was used for the amplification in a 50μl reaction by the following cycle with step 2 to step 4 repeated 30 times: 95°C, 5 min; 95°C for 30 sec; 70°C for 30 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 1.0 kb PCR fragment was isolated from a 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.: 17 for the nucleic acid sequence and SEQ.ID.NO. : 18 for the putative amino acid sequence. j. hRUP37 (Seq. Id. Nos. 19 & 20) The disclosed human RUP37 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with Accession Number AC090099 was identified as a human genomic sequence from chromosome 11. The full length RUP37 was cloned by PCR using primers:
5'-CTGTTTCCAGGGTCATCAGACTGGG-3' (SEQ.ID.NO. :45; sense); 5'-GCAGCATTGCTCTCAAAGTCCTGTCTG-3' (SEQ.ID.NO. :46; antisense) and human genomic DNA (Clontech) as template. TaqPlus® Precision DNA polymerase (Stratagene) was used for the ampUfication by the following cycle with step 2 to step 4 repeated 35 times: 95°C for 5 min; 95°C for 30 sec; 62°C for 30 sec; 72°C for 1 min 30 sec; and 72°C for 7 min.
A 969 base pair was isolated from a 1%% agarose gel and cloned into the pCRII- TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator Kit (P.E. Biosystems). See, SEQ.ID.NO.:19 for the nucleic acid sequence and SEQ.ID.NO.:20 for the putative amino acid sequence. Example 2
PREPARATION OF NON-ENDOGENOUS, CONSTITUTIVELY ACTIVATED GPCRS
Those skilled in the art are credited with the ability to select techniques for mutation of a nucleic acid sequence. Presented below are approaches utilized to create non-endogenous versions of several of the human GPCRs disclosed above. The mutations disclosed below are based upon an algorithmic approach whereby the 16th amino acid (located in the IC3 region of the GPCR) from a conserved proline (or an
AREN-0309 PATENT endogenous, conservative substitution therefore) residue (located in the TM6 region of the GPCR, near the TM6/IC3 interface) is mutated, preferably to an alanine, histimine, arginine or lysine amino acid residue, most preferably to a lysine amino acid residue. 1. Transformer Site-Directed ™Mutagenesis
Preparation of non-endogenous human GPCRs may be accomplished on human GPCRs using, inter alia, Transformer Site-Directed™ Mutagenesis Kit (Clontech) according to the manufacturer instructions. In some embodiments two mutagenesis primers are used, preferably a lysine mutagenesis oUgonucleotide that creates the lysine mutation, and a selection marker oligonucleotide. For convenience, the codon mutation to be incorporated into the human GPCR is also noted, in standard form (Table D):
TABLE D
Example 3
RECEPTOR EXPRESSION
Although a variety of cells are available to the art-skilled for the expression of proteins, it is preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, i.e., utilization of, e.g., yeast cells for the expression of a
GPCR, while possible, introduces into the protocol a non-mammalian cell which may not
(indeed, in the case of yeast, does not) include the receptor-coupling, genetic-mechanism
AREN-0309 PATENT and secretary pathways that have evolved for mammalian systems — thus, results obtained in non-mammalian cells, while of potential use, are not as preferred as those obtained using mammalian cells. Of the mammalian cells, COS-7, 293 and 293T cells are particularly preferred, although the specific mammalian cell utilized can be predicated upon the particular needs of the artisan. a. Transient Transfection
On day one, 6xl06 cells/10 cm dish of 293 cells well were plated out. On day two, two reaction tubes were prepared (the proportions to follow for each tube are per plate): tube A was prepared by mixing 4μg DNA (e.g., pCMV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B was prepared by mixing 24μl lipofectamine (Gibco BRL) in 0.5ml serum free DMEM. Tubes A and B were admixed by inversion (several times), followed by incubation at room temperature for 30- 45min. The admixture is referred to as the "transfection mixture". Plated 293 cells were washed with 1XPBS, followed by addition of 5 ml serum free DMEM. One ml of the transfection mixture were added to the cells, followed by incubation for 4hrs at 37°C/5% CO2. The transfection mixture was removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at 37°C/5% CO2. After 48hr incubation, cells were harvested and utiUzed for analysis. b. Stable Cell Lines Approximately 12x106293 cells will be plated on a 15cm tissue culture plate, and grown in DME High Glucose Medium containing 10% fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours following plating of 293 cells (to approximately -80% confluency), the cells will be transfected using 12μg of DNA. The 12μg of DNA is combined with 60μl of lipofectamine and 2mL of DME High Glucose Medium without serum. The medium will be aspirated from the plates and the cells washed once with medium without serum. The DNA, Upofectamine, and medium mixture will be added to the plate along with lOmL of medium without serum. Following incubation at 37°C for four to five hours, the medium will be aspirated and 25ml of medium containing serum wiU be added. Twenty-four hours following transfection, the medium will be aspirated again, and fresh medium with serum will be added. Forty-eight hours following transfection, the medium will be aspirated and medium with serum will be added containing geneticin (G418 drug) at a final concentration of 500μg/mL. The transfected cells will then
AREN-0309 PATENT undergo selection for positively transfected cells containing the G418 resistant gene.
The medium will be replaced every four to five days as selection occurs. During selection, cells will be grown to create stable pools, or spUt for stable clonal selection. Example 4 ASSAYS FOR DETERMINATION OF CONSTITUTIVE ACTIVITY OF NON-ENDOGENOUS GPCRs
A variety of approaches are available for assessment of constitutive activity of the non-endogenous human GPCRs. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan.
1. Membrane Binding Assays: [35S]GTPγS Assay
When a G protein-coupled receptor is in its active state, either as a result of Ugand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Constitutively activated receptors continue to exchange GDP for GTP. The non-hydrolyzable GTP analog, [35S]GTPγS, can be utilized to demonstrate enhanced binding of [35S]GTPγS to membranes expressing constitutively activated receptors. Advantages of using [ S]GTPγS binding to measure constitutive activation include but are not Umited to the following: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade. The assay takes advantage of the ability of G protein coupled receptors to stimulate
[35S]GTPγS binding to membranes expressing the relevant receptors. The assay can, therefore, be used in the direct identification method to screen candidate compounds to constitutively activated G protein-coupled receptors. The assay is generic and has application to drug discovery at all G protein-coupled receptors. The [35S]GTPγS assay is incubated in 20 mM HEPES and between 1 and about
20mM MgCl2 (this amount can be adjusted for optimization of results, although 20mM is preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM [35S]GTPγS
AREN-0309 PATENT
(this amount can be adjusted for optimization of results, although 1.2 is preferred ) and
12.5 to 75 μg membrane protein (e.g., 293 cells expressing the Gs Fusion Protein; this amount can be adjusted for optimization) and 10 μM GDP (this amount can be changed for optimization) for 1 hour. Wheatgerm agglutinin beads (25 μl; Amersham) will then be added and the mixture incubated for another 30 minutes at room temperature. The tubes will be then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a scintillation counter.
2. Adenylyl Cyclase A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes. The Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The foUowing serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
Transfected cells will be harvested approximately twenty four hours after transient transfection. Media will be carefully aspirated and discarded. Ten ml of PBS will gently be added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS will be added to each plate. Cells will be pipetted off the plate and the cell suspension collected into a 50ml comcal centrifuge tube. Cells will be centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet will be carefully re- suspended into an appropriate volume of PBS (about 3ml/plate). The cells will be then counted using a hemocytometer and additional PBS will be added to give the appropriate number of cells (to a final volume of about 50μl/well). cAMP standards and Detection Buffer (comprising 1 μCi of tracer [125I cAMP (50 μl] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer will be prepared fresh for screening and contained 50μl of Stimulation Buffer, 3μl of test compound (12μM final assay concentration) and 50μl cells, Assay Buffer will be stored on ice until utilized. The assay will be initiated by addition of 50μl of cAMP standards to appropriate wells followed by addition of 50μl of PBSA to wells H-ll and H12. Fifty μl of Stimulation Buffer will be added to all wells. DMSO (or selected candidate compounds) will be added to appropriate
AREN-0309 PATENT wells using a pin tool capable of dispensing 3μl of compound solution, with a final assay concentration of 12μM test compound and lOOμl total assay volume. The cells will then be added to the wells and incubated for 60 min at room temperature. One hundred μl of Detection Mix containing tracer cAMP will then be added to the wells. Plates will be incubated for an additional 2 hours followed by counting in a Wallac MicroBeta™ scintillation counter. Values of cAMP/well will then be extrapolated from a standard cAMP curve which will be contained within each assay plate.
3. Cell-Based cAMP for Gj Coupled Target GPCRs TSHR is a Gs coupled GPCR that causes the accumulation of cAMP upon activation. TSHR will be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue). A Gj coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique for measuring the decrease in production of cAMP as an indication of constitutive activation of a Gj coupled receptor can be accompUshed by co-transfecting, most preferably, non-endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active Gs coupled receptor) as a "signal enhancer" with a Gj linked target GPCR to estabUsh a baseline level of cAMP. Upon creating a non-endogenous version of the Gj coupled receptor, this non-endogenous version of the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening. This approach will be utilized to effectively generate a signal when a cAMP assay is used; this approach is preferably used in the direct identification of candidate compounds against G; coupled receptors. It is noted that for a Gj coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.
On day one, 2x104293 cells/well will be plated out. On day two, two reaction tubes will be prepared (the proportions to follow for each tube are per plate): tube A will be prepared by mixing 2ug DNA of each receptor transfected into the mammatian cells, for a total of 4ug DNA (e.g., pCMV vector; pCMV vector with mutated THSR (TSHR-A623I); TSHR-A623I and GPCR, etc.) in 1.2ml serum free DMEM (Irvine Scientific, Irvine, CA); tube B will be prepared by mixing 120μl lipofectamine (Gibco BRL) in 1.2ml serum free
AREN-0309 PATENT
DMEM. Tubes A and B will then be admixed by inversion (several times), followed by incubation at room temperature for 30-45min. The admixture is referred to as the "transfection mixture". Plated 293 cells will be washed with 1XPBS, followed by addition of 10ml serum free DMEM. 2.4ml of the transfection mixture will then be added to the cells, followed by incubation for 4hrs at 37°C/5% CO2. The transfection mixture will then be removed by aspiration, followed by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells will then be incubated at 37°C/5% CO2. After 24hr incubation, cells will be harvested and utilized for analysis.
A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) although designed for cell-based assays, can be modified for use with crude plasma membranes depending on the need of the skilled artisan. The Flash Plate wells will contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantified by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
Transfected cells will be harvested approximately twenty four hours after transient transfection. Media will be carefully aspirated and discarded. Ten ml of PBS will be gently added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS will be added to each plate. Cells will be pipetted off the plate and the cell suspension will be collected into a 50ml conical centrifuge tube. Cells will be centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet will be carefully re-suspended into an appropriate volume of PBS (about 3ml/plate). The cells will then be counted using a hemocytometer and additional PBS is added to give the appropriate number of cells (to a final volume of about 50μl/well). cAMP standards and Detection Buffer (comprising 1 μCi of tracer [125I cAMP (50 μl] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer should be prepared fresh for screening and contained 50μl of Stimulation Buffer, 3μl of test compound (12μM final assay concentration) and 50μl cells, Assay Buffer can be stored on ice until utilized. The assay can be initiated by addition of 50μl of cAMP standards to appropriate wells followed by addition of 50μl of PBSA to wells H-l 1 and H12. Fifty μl of Stimulation Buffer will be added to all wells. Selected compounds (e.g., TSH) will be added to appropriate wells
AREN-0309 PATENT using a pin tool capable of dispensing 3μl of compound solution, with a final assay concentration of 12μM test compound and lOOμl total assay volume. The ceUs will then be added to the wells and incubated for 60 min at room temperature. One hundred μl of Detection Mix containing tracer cAMP will then be added to the wells. Plates will then be incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well will then be extrapolated from a standard cAMP curve which is contained within each assay plate.
4. Reporter-Based Assays a. CRE-LUC Reporter Assay (Gs -associated receptors) 293 and 293T cells will be plated-out on 96 well plates at a density of 2 x 104 cells per well and will be transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture will be prepared for each 6-well transfection as follows: 260ng of plasmid DNA in lOOμl of DMEM are gently mixed with 2μl of lipid in lOOμl of DMEM (the 260ng of plasmid DNA consisted of 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non-endogenous receptor or pCMN alone, and lOng of a GPRS expression plasmid (GPRS in pcDΝA3 (Invitrogen)). The 8XCRE-Luc reporter plasmid is prepared as follows: vector SRIF-β-gal will be obtained by cloning the rat somatostatin promoter (-71/+51) at BglN-Hindlll site in the pβgal-Basic Vector (Clontech). Eight (8) copies of cAMP response element will be obtained by PCR from an adenovirus template AdρCF126CCRE8 (see, 7 Human Gene Therapy 1883 (1996)) and cloned into the SRIF- β-gal vector at the Kpn-BglV site, resulting in the 8xCRE-β-gal reporter vector. The 8xCRE-Luc reporter plasmid will be generated by replacing the beta-galactosidase gene in the 8xCRE-β-gal reporter vector with the luciferase gene obtained from the pGL3- basic vector (Promega) at the Hindlll-BamHI site. Following 30 min. incubation at room temperature, the DΝA/lipid mixture will be diluted with 400 μl of DMEM and lOOμl of the diluted mixture will be added to each well. One hundred μl of DMEM with 10%) FCS will be added to each well after a 4hr incubation in a cell culture incubator. The following day the transfected cells will be changed with 200 μl well of DMEM with 10% FCS. Eight hours later, the wells will be changed to 100 μl /well of DMEM without phenol red, after one wash with PBS. Luciferase activity will be measured the next day using the LucLite™ reporter gene assay kit (Packard) following manufacturer's
AREN-0309 PATENT instructions and read on a 1450 MicroBeta™ scintillation and luminescence counter (Wallac). b. API reporter assay (Gq-associated receptors)
A method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing API elements in their promoter. A Pathdetect™ AP-1 cis-Reporting System (Stratagene, Catalogue # 219073) can be utilized following the protocol set forth above with respect to the CREB reporter assay, except that the components of the calcium phosphate precipitate were 410 ng pAPl-Luc, 80 ng pCMV-receptor expression plasmid, and 20 ng CMV-SEAP. c. SRF-LUC Reporter Assay (Gq- associated receptors)
One method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter. A Pathdetect™ SRF-Luc-Reporting System (Stratagene) can be utilized to assay for Gq coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian Transfection™ Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions. Briefly, 410 ng SRF-Luc, 80 ng pCMV-receptor expression plasmid and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) are combined in a calcium phosphate precipitate as per the manufacturer's instructions. Half of the precipitate is equally distributed between 3 wells in a 96-well plate, kept on the cells in a serum free media for 24 hours. The last 5 hours the cells are incubated with lμM Angiotensin, where indicated. Cells are then lysed and assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. # 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data can be analyzed using GraphPad Prism™ 2.0a (GraphPad Software Inc.). d. Intracellular IP3 Accumulation Assay (Gq-associated receptors)
AREN-0309 PATENT
On day 1, ceUs comprising the receptors (endogenous and/or non- endogenous) are plated onto 24 well plates, usually lxl 05 cells/well (although his number can be optimized. On day 2 cells are transfected by firstly mixing 0.25ug DNA in 50 μl serum free DMEM/well and 2 μl lipofectamine in 50 μl serum free DMEM/well. The solutions are gently mixed and incubated for 15-30 min at room temperature. Cells are then washed with 0.5 ml PBS and 400 μl of serum free media and then mixed with the transfection media and added to the cells. The cells are incubated for 3-4 hrs at 37°C/5%CO2 and then the transfection media is removed and replaced with lml/well of regular growth media. On day 3 the cells are labeled with 3H-myo-inositol. Briefly, the media is removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol- free/serum free media (GIBCO BRL) are added/well with 0.25 μCi of 3H-myo-inositol/ well and the cells incubated for 16-18 hrs overnight at 37°C/5%CO2. On Day 4 the cells are washed with 0.5 ml PBS and 0.45 ml of assay medium is added containing inositol- free/serum free media 10 μM pargyline 10 mM lithium chloride or 0.4 ml of assay medium and 50 μl of lOx ketanserin (ket) to final concentration of lOμM. The cells are then incubated for 30 min at 37°C. The cells are then washed with 0.5 ml PBS and 200 μl of fresh/ice cold stop solution (1M KOH; 18 mM Na-borate; 3.8 mM EDTA) is added to each well. The solution is kept on ice for 5-10 min (or until cells are lysed) and then neutralized by 200 μl of fresh/ice cold neutralization solution (7.5 % HCL). The lysate is then transferred into 1.5 ml Eppendorf tubes and 1 ml of chloroform/methanol (1:2) is added/tube. The solution is vortexed for 15 sec and the upper phase is applied to a Biorad AG1-X8™ anion exchange resin (100-200 mesh). First, the resin is washed with water at 1:1.25 W/V and 0.9 ml of upper phase is loaded onto the column. The column is then washed with 10 ml of 5 mM myo-inositol and 10 ml of 5 mM Na-borate/60mM Na- formate. The inositol tris phosphates are eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate. The columns are regenerated by washing with 10 ml of 0.1 M formic aciάVBM ammonium formate and rinsed twice with dd H2O and stored at 4°C in water.
Reference is made to Figure 1. In Figure I, 293 cells were transfected with Gq protein containing a six amino acid deletion, "Gq(del)"; Gq protein fused to a Gj protein, "Gq(del)/Gj"; endogenous RUP32; and RUP32 with Gq(del) ("RUP32+ Gq(del)/Gj"). The data indicate, based upon measuring IP3 accumulation of RUP32 co-transfection of
AREN-0309 PATENT
Gq(del)/Gj, that RUP32 does not endogenously couple to Gq protein.
However when RUP32 was co-transfected with Gq(del)/Gj fusion protein, RUP32 was forced to couple to Gq protein. RUP27+ Gq(del)/Gj evidence about a nine (9) fold increase in IP3 accumulation when compared to endogenous RUP32. This data demonstrates that the Gq(del)/Gj Fusion Construct can be co-transfected with a GPCR and used to screen for agonists or inverse agonists.
Reference is made to Figure 2. hi Figure 2, 293 cells were transfected with RUP35 and RUP36 receptor and compared to the control, pCMV. The data indicate that both
RUP35 and RUP36 receptor are endogenously, constitutively active. RUP35 evidences about a six (6) fold increase in intracellular inositol phosphate accumulation when compared to pCMV and RUP36 evidences about a four (4) fold increase when compared to pCMV.
Example 5
FUSION PROTEIN PREPARATION a. GPCR: Gs Fusion Construct
The design of the constitutively activated GPCR-G protein fusion construct can be accomplished as follows: both the 5' and 3' ends of the rat G protein Gsα (long form; Itoh, H. et al., 83 PNAS 3776 (1986)) is engineered to include a HindHI (5'-AAGCTT-3') sequence thereon. Following confirmation of the correct sequence (including the flanking Hindlll sequences), the entire sequence is shuttled into pcDNA3.1(-) (Invitrogen, cat. no. N795-20) by subcloning using the Hindlll restriction site of that vector. The correct orientation for the Gsα sequence will be determined after subcloning into pcDΝA3.1(-). The modified pcDNA3.1(-) containing the rat Gsα gene at Hindiπ sequence is then verified; this vector will then be available as a "universal" Gsα protein vector. The pcDNA3.1(-) vector contains a variety of well-known restriction sites upstream of the Hindiπ site, thus beneficially providing the ability to insert, upstream of the Gs protein, the coding sequence of an endogenous, constitutively active GPCR. This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized. In some embodiments, the important criteria is that the sequence for the GPCR be upstream and in-frame with that of the G protein.
AREN-0309 PATENT
Spacers in the restriction sites between the G protein and the GPCR are optional. The sense and anti-sense primers included the restriction sites for Xbal and EcoRN, respectively, such that spacers (attributed to the restriction sites) exist between the G protein and the GPCR. PCR will then be utilized to secure the respective receptor sequences for fusion within the Gsα universal vector disclosed above, using the following protocol for each: lOOng cDΝA for GPCR will be added to separate tubes containing 2μl of each primer (sense and anti-sense), 3μl of lOmM dΝTPs, lOμl of lOXTaqPlus™ Precision buffer, lμl of TaqPlus™ Precision polymerase (Stratagene: #600211), and 80μl of water. Reaction temperatures and cycle times for the GPCR will be as follows with cycle steps 2 through 4 were repeated 35 times: 94°C for 1 min; 94°C for 30 seconds; 62°C for 20 sec; 72°C 1 min 40sec; and 72°C 5 min. PCR products will be run on a 1% agarose gel and then purified. The purified products will be digested with Xbal and EcoRN and the desired inserts purified and ligated into the Gs universal vector at the respective restriction sites. The positive clones will be isolated following transformation and determined by restriction enzyme digestion; expression using 293 cells will be accompUshed following the protocol set forth infra. Each positive clone for GPCR- Gs Fusion Protein will be sequenced to verify correctness. b. Gq(6 amino acid deletion)/Gi Fusion Construct The design of a Gq (del)/G; fusion construct was accomplished as follows: the Ν- terminal six (6) amino acids (amino acids 2 through 7), having the sequence of TLESIM (SEQ.ID.NO. :47) Gαq-subunit was deleted and the C-terminal five (5) amino acids, having the sequence EYNLV (SEQ.ID.NO.:48) was replaced with the corresponding amino acids of the Gαi Protein, having the sequence DCGLF (SEQ.ID.NO.:49). This fusion construct was obtained by PCR using the following primers:
5'-gatcAAGCTTCCATGGCGTGCTGCCTGAGCGAGG-3' (SEQ.ID.NO.:50) and 5'-gatcGGATCCTTAGAACAGGCCGCAGTCCTTCAGGTTCAGCTGCAGGATGGTG-3' (SEQ.JD.NO.:51) and Plasmid 63313 which contains the mouse Gαq-wild type version with E hemagglutinin tag as template. Nucleotides in lower caps are included as spacers. TaqPlus® Precision DNA polymerase (Stratagene) was utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95°C for
2 min; 95°C for 20 sec; 56°C for 20 sec; 72°C for 2 min; and 72°C for 7 min. The PCR
AREN-0309 PATENT product will be cloned into a pCP I-TOPO vector (Invitrogen) and sequenced using the
ABI Big Dye Terminator kit (P.E. Biosystems). Inserts from a TOPO clone containing the sequence of the fusion construct will be shuttled into the expression vector ρcDNA3.1(+) at the Hindlll/BamHI site by a 2 step cloning process.
Example 6
TISSUE DISTRIBUTION OF THE DISCLOSED HUMAN GPCRs: RT-PCR
RT-PCR was applied to confirm the expression and to deteπnine the tissue distribution of several novel human GPCRs. Oligonucleotides utilized were GPCR- specific and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) were utilized for the amplification in a 40μl reaction according to the manufacturer's instructions. Twenty μl of the reaction will be loaded on a 1.5% agarose gel to analyze the RT-PCR products. Table E, below, lists the receptors, the cycle conditions and the primers utilized, and also lists exemplary diseases/disorders linked to the receptors.
TABLE E
AREN-0309 PATENT
Diseases and disorders related to receptors located in these tissues or regions include, but are not limited to, cardiac disorders and diseases (e.g. thrombosis, myocardial infarction; atherosclerosis; cardiomyopathies); kidney disease/disorders (e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); eosinophilia; leukocytosis; leukopenia; ovarian cancer; sexual dysfunction; polycystic ovarian syndrome; pancreatitis and pancreatic cancer; irritable bowel syndrome; colon cancer; Crohn's disease; ulcerative colitis; diverticulitis; Chronic Obstructive Pulmonary Disease (COPD); Cystic Fibrosis; pneumonia; pulmonary hypertension; tuberculosis and lung cancer; Parkinson's disease; movement disorders and ataxias; learning and memory disorders; eating disorders (e.g., anorexia; bulimia, etc.); obesity; cancers; fhymoma; myasthenia gravis; circulatory disorders; prostate cancer; prostatitis; kidney disease/disorders(e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); sensorimotor processing and arousal disorders; obsessive-compulsive disorders; testicular cancer; priapism; prostatitis; hernia; endocrine disorders; sexual dysfunction; allergies; depression; psychotic disorders; migraine; reflux; schizophrenia; ulcers; bronchospasm; epilepsy; prostatic hypertrophy; anxiety; rhinitis; angina; and glaucoma. Accordingly, the methods of the present invention may also be useful in the diagnosis and/or treatment of these and other diseases and disorders.
Example 7
Protocol: Direct Identification of Inverse Agonists and Agonists
A. [35S]GTPγS Assay Although endogenous, constitutively active GPCRs have been used for the direct identification of candidate compounds as, e.g., inverse agonists, for reasons that are not altogether understood, infra-assay variation can become exacerbated. In some embodiments a GPCR Fusion Protein, as disclosed above, is also utilized with a non- endogenous, constitutively activated GPCR. When such a protein is used, infra-assay variation appears to be substantially stabilized, whereby an effective signal-to-noise ratio is
AREN-0309 PATENT obtained. This has the beneficial result of allowing for a more robust identification of candidate compounds. Thus, in some embodiments it is preferred that for direct identification, a GPCR Fusion Protein be used and that when utihzed, the following assay protocols be utilized. 1. Membrane Preparation
Membranes comprising the constitutively active orphan GPCR Fusion Protein of interest and for use in the direct identification of candidate compounds as inverse agonists or agonists are preferably prepared as follows: a. Materials "Membrane Scrape Buffer" is comprised of 20mM HEPES and lOmM EDTA, pH 7.4; "Membrane Wash Buffer" is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; "Binding Buffer" is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl2, pH 7.4 b. Procedure All materials will be kept on ice throughout the procedure. Firstly, the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 4°C). Thereafter, the supernatant will be aspirated and the pellet will be resuspended in 30ml Membrane Wash Buffer followed by centrifugation at 20,000 rpm for 17 minutes at 4°C. The supernatant will then be aspirated and the pellet resuspended in Binding Buffer. The resuspended pellet will then be homogenized using a Brinkman Polyfron™ homogenizer (15-20 second bursts until the material is in suspension). This is referred to herein as "Membrane Protein". 2. Bradford Protein Assay
Following the homogenization, protein concentration of the membranes will be determined, for example, using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polyfron at about 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizer is thoroughly cleaned between homogenization of different preparations).
AREN-0309 PATENT a. Materials
Binding Buffer (as discussed above); Bradford Dye Reagent; Bradford Protein
Standard will be utilized, following manufacturer instructions (Biorad, cat. no. 500-
0006). b. Procedure
Duplicate tubes will be prepared, one including the membrane, and one as a control "blank". Each contains 800μl Binding Buffer. Thereafter, lOμl of Bradford
Protein Standard (lmg/ml) will be added to each tube, and lOμl of membrane Protein will then be added to just one tube (not the blank). Thereafter, 200μl of Bradford Dye Reagent will be added to each tube, followed by vortexing. After five minutes, the tubes will be re-vortexed and the material therein will be transferred to cuvettes. The cuvettes will then be read using a CECIL 3041 spectrophotometer, at wavelength 595.
3. Direct Identification Assay a. Materials GDP Buffer consisted of 37.5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-
7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 μM GDP (final concentration of GDP in each well was 0.1 μM GDP); each well comprising a candidate compound, has a final volume of 200μl consisting of lOOμl GDP Buffer (final concentration, 0.1 μM GDP), 50μl Membrane Protein in Binding Buffer, and 50μl [35S]GTPγS (0.6 nM) in Binding Buffer (2.5 μl [35S]GTPγS per 10ml Binding Buffer). b. Procedure
Candidate compounds will be preferably screened using a 96-well plate format (these can be frozen at -80°C). Membrane Protein (or membranes with expression vector excluding the GPCR Fusion Protein, as control), will be homogenized briefly until in suspension. Protein concentration will then be determined using, for example, the Bradford Protein Assay set forth above. Membrane Protein (and controls) will then be diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5μg/well). Thereafter, 100 μl GDP Buffer is added to each well of a Wallac Scintistrip™ (Wallac). A 5μl pin-tool will then be used to transfer 5 μl of a candidate compound into such well (i.e., 5μl in total assay volume of 200 μl is a 1 :40 ratio such that the final screening concentration of the candidate compound is lOμM). Again, to avoid contamination, after each transfer step the pin tool is rinsed in three reservoirs comprising water (IX), ethanol (IX) and water (2X) - excess
AREN-0309 PATENT liquid is shaken from the tool after each rinse and the tool is dried with paper and Kim wipes. Thereafter, 50 μl of Membrane Protein will be added to each well (a control well comprising membranes without the GPCR Fusion Protein was also utilized), and pre- incubated for 5-10 minutes at room temperature. Thereafter, 50 μl of [35S]GTPγS (0.6 nM) in Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil). The assay will be stopped by spinning the plates at 4000 RPM for 15 minutes at 22°C. The plates will then be aspirated with an 8 channel manifold and sealed with plate covers. The plates will then be read on a Wallac 1450 using setting "Prot. #37" (as per manufacturer's instructions).
B. Cyclic AMP Assay
Another assay approach to directly identify candidate compound will be accomplished utilizing a cyclase-based assay. In addition to direct identification, this assay approach can be utilized as an independent approach to provide confirmation of the results from the [35S]GTPγS approach as set forth above.
A modified Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) will be preferably utiUzed for direct identification of candidate compounds as inverse agonists and agonists to GPCRs in accordance with the following protocol. Transfected cells will be harvested approximately three days after transfection.
Membranes will be prepared by homogenization of suspended cells in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl2. Homogenization will be performed on ice using a Brinkman Polyfron™ for approximately 10 seconds. The resulting homogenate will be centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be stored at -80°C until utilized. On the day of direct identification screening, the membrane pellet will slowly be thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl2, to yield a final protein concentration of 0.60mg/ml (the resuspended membranes will be placed on ice until use). cAMP standards and Detection Buffer (comprising 2 μCi of tracer [125I cAMP (100 μl] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the
AREN-0309 PATENT manufacturer's instructions. Assay Buffer will be prepared fresh for screening and contain 20mM HEPES, pH 7.4, lOmM MgCl2, 20mM phosphocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 μM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer will be stored on ice until utiUzed. Candidate compounds identified as per above (if frozen, thawed at room temperature) •will be added, preferably, to 96-well plate wells (3μl/well; 12μM final assay concentration), together with 40 μl Membrane Protein (30μg/well) and 50μl of Assay Buffer. This admixture will be incubated for 30 minutes at room temperature, with gentle shaking. Following the incubation, lOOμl of Detection Buffer will be added to each well, followed by incubation for 2-24 hours. Plates will then be counted in a Wallac MicroBeta™ plate reader using "Prot. #31" (as per manufacturer instructions). C. Melanophore Screening Assay A method for identifying candidate agonists or inverse agonists for a GPCR can be preformed by introducing tests cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GCPR. A stimulant, e.g., Ught, sets an initial state of pigment disposition wherein the pigment is aggregated within the test cells if activation of the GPCR induces pigment dispersion. However, stimulating the cell with a stimulant to set an initial state of pigment disposition wherein the pigment is dispersed if activation of the GPCR induces pigment aggregation. The tests cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound coupUng to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear light.
Materials and methods will be followed according to the disclosure of U.S. Patent Number 5,462,856 and U.S. Patent Number 6,051,386, each of which are incorporated by reference.
Although a variety of expression vectors are available to those in the art, for purposes of utilization for both the endogenous and non-endogenous human GPCRs, in some embodiments it is preferred that the vector utilized be pCMV. This vector was deposited with the American Type Culture Collection (ATCC) on October 13, 1998 (10801
AREN-0309 PATENT
University Blvd., Manassas, VA 20110-2209 USA) under the provisions of the Budapest
Treaty for the International Recogmtion of the Deposit of Microorganisms for the Purpose of Patent Procedure. The DNA was tested by the ATCC and determined to be viable. The ATCC has assigned the following deposit number to pCMV: ATCC #203351.
References cited throughout this patent document, including co-pending and related patent appUcations, unless otherwise indicated, are fully incorporated herein by reference. Modifications and extension of the disclosed inventions that are within the purview of the skilled artisan are encompassed within the above disclosure and the claims that follow.
Claims
1. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:2.
2. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 1.
3. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 1.
4. A host cell comprising the plasmid of claim 3.
5. A G protein-coupled receptor encoded by an amino acid sequence of
SEQ.ID.NO. :4.
6. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 5.
7. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :3.
8. A host cell comprising the plasmid of claim 7.
9. A G protein-coupled receptor encoded by an amino acid sequence of SEQJD.NO.:6.
10. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 9.
11. A plasmid comprising a vector and the cDNA of SEQXD.NO.:5.
12. A host cell comprising the plasmid of claim 11.
13. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:8.
14. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 13.
15. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :7.
16. A host cell comprising the plasmid of claim 15.
17. A G protein-coupled receptor encoded by an amino acid sequence of SEQJD.NO.:10.
18. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 17 .
19. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :9. AREN-0309 PATENT
20. A host cell comprising the plasmid of claim 19.
21. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12.
22. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 21.
23. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 11.
24. A host cell comprising the plasmid of claim 23.
25. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.TD.NO.: 14.
26. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 25.
27. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.: 13.
28. A host cell comprising the plasmid of claim 27.
29. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 16.
30. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 29.
31. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 15.
32. A host cell comprising the plasmid of claim 31.
33. A G protein-coupled receptor encoded by an amino acid sequence of
SEQ.ID.NO.:18.
34. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 33.
35. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.: 17.
36. A host cell comprising the plasmid of claim 35.
37. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:20.
38. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 37.
39. A plasmid comprising a vector and the cDNA of SEXD.NO.:19.
40. A host cell comprising the plasmid of claim 39.
Applications Claiming Priority (21)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US25340400P | 2000-11-27 | 2000-11-27 | |
US253404P | 2000-11-27 | ||
US25536600P | 2000-12-12 | 2000-12-12 | |
US255366P | 2000-12-12 | ||
US27028601P | 2001-02-20 | 2001-02-20 | |
US27026601P | 2001-02-20 | 2001-02-20 | |
US270286P | 2001-02-20 | ||
US270266P | 2001-02-20 | ||
US28235601P | 2001-04-06 | 2001-04-06 | |
US28235801P | 2001-04-06 | 2001-04-06 | |
US28236501P | 2001-04-06 | 2001-04-06 | |
US28203201P | 2001-04-06 | 2001-04-06 | |
US282365P | 2001-04-06 | ||
US282032P | 2001-04-06 | ||
US282358P | 2001-04-06 | ||
US282356P | 2001-04-06 | ||
US29091701P | 2001-05-14 | 2001-05-14 | |
US290917P | 2001-05-14 | ||
US30920801P | 2001-07-31 | 2001-07-31 | |
US309208P | 2001-07-31 | ||
PCT/US2001/044386 WO2002042461A2 (en) | 2000-11-27 | 2001-11-26 | Endogenous and non-endogenous versions of human g protein-coupled receptors |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1364024A2 true EP1364024A2 (en) | 2003-11-26 |
Family
ID=27581193
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01997554A Withdrawn EP1364024A2 (en) | 2000-11-27 | 2001-11-26 | Endogenous and non-endogenous versions of human g protein-coupled receptors |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1364024A2 (en) |
JP (3) | JP2004533211A (en) |
CN (1) | CN1549858A (en) |
AU (2) | AU1989002A (en) |
CA (1) | CA2429860A1 (en) |
WO (1) | WO2002042461A2 (en) |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7115375B2 (en) | 2000-11-14 | 2006-10-03 | Bristol-Myers Squibb | Methods of diagnosing renal tumors by determining the expression level of RNA encoding the HGPRBMY18 polypeptide |
EP1364024A2 (en) * | 2000-11-27 | 2003-11-26 | Arena Pharmaceuticals, Inc. | Endogenous and non-endogenous versions of human g protein-coupled receptors |
GB0101739D0 (en) * | 2001-01-23 | 2001-03-07 | Pfizer Ltd | Novel polypeptide |
EP1372690A4 (en) * | 2001-03-01 | 2005-08-24 | Millennium Pharm Inc | 93870, a human g-protein coupled receptor and uses therefor |
WO2002101043A2 (en) * | 2001-06-08 | 2002-12-19 | Bayer Aktiengesellschaft | Regulation of human ta4 receptor |
CA2477348A1 (en) * | 2002-01-04 | 2003-07-24 | Metabolex, Inc. | Nucleic acids encoding a g-protein coupled receptor involved in islet cell signaling |
US20040161799A1 (en) * | 2003-02-14 | 2004-08-19 | Murphy Andrew J. | KOR3like-proteins and methods of modulating KOR3L-mediated activity |
WO2004104596A2 (en) * | 2003-05-22 | 2004-12-02 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with igs70 (igs70) |
DOP2006000008A (en) | 2005-01-10 | 2006-08-31 | Arena Pharm Inc | COMBINED THERAPY FOR THE TREATMENT OF DIABETES AND RELATED AFFECTIONS AND FOR THE TREATMENT OF AFFECTIONS THAT IMPROVE THROUGH AN INCREASE IN THE BLOOD CONCENTRATION OF GLP-1 |
AU2006285393A1 (en) | 2005-04-27 | 2007-03-08 | Arena Pharmaceuticals, Inc. | Combination therapy for the treatment of obesity and diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood GLP-1 level |
GB0520568D0 (en) * | 2005-10-10 | 2005-11-16 | Paradigm Therapeutics Ltd | Receptor |
KR101281962B1 (en) | 2006-04-11 | 2013-07-08 | 아레나 파마슈티칼스, 인크. | Methods of using GPR119 receptor to identify compounds useful for increasing bone mass in an individual |
EP2108960A1 (en) | 2008-04-07 | 2009-10-14 | Arena Pharmaceuticals, Inc. | Methods of using A G protein-coupled receptor to identify peptide YY (PYY) secretagogues and compounds useful in the treatment of conditons modulated by PYY |
WO2013151982A1 (en) | 2012-04-03 | 2013-10-10 | Arena Pharmaceuticals, Inc. | Methods and compounds useful in treating pruritus, and methods for identifying such compounds |
Family Cites Families (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000000515A2 (en) * | 1998-06-29 | 2000-01-06 | Hyseq, Inc. | A CHEMOKINE RECEPTOR OBTAINED FROM A cDNA LIBRARY OF FETAL LIVER-SPLEEN |
WO2000000611A2 (en) * | 1998-06-30 | 2000-01-06 | Millennium Pharmaceuticals, Inc. | 14273 receptor, a g-protein coupled receptor |
EP1114155A2 (en) * | 1998-09-17 | 2001-07-11 | Incyte Pharmaceuticals, Inc. | Human gpcr proteins |
CA2645717A1 (en) * | 1998-11-20 | 2000-06-02 | Arena Pharmaceuticals, Inc. | Human orphan g protein-coupled receptors |
JP2001211885A (en) * | 2000-02-02 | 2001-08-07 | Kyowa Hakko Kogyo Co Ltd | New polypeptide |
EP1265925A2 (en) * | 2000-02-23 | 2002-12-18 | PHARMACIA & UPJOHN COMPANY | G protein-coupled receptors |
EP1232266A2 (en) * | 2000-03-20 | 2002-08-21 | Curagen Corporation | Polypeptides and nucleic acids encoding same |
JP2002355050A (en) * | 2000-06-15 | 2002-12-10 | Takeda Chem Ind Ltd | New g protein-coupled receptor protein and its dna |
JP2002355053A (en) * | 2000-07-14 | 2002-12-10 | Takeda Chem Ind Ltd | New g protein-coupled receptor protein and its dna |
EP1364024A2 (en) * | 2000-11-27 | 2003-11-26 | Arena Pharmaceuticals, Inc. | Endogenous and non-endogenous versions of human g protein-coupled receptors |
-
2001
- 2001-11-26 EP EP01997554A patent/EP1364024A2/en not_active Withdrawn
- 2001-11-26 CA CA002429860A patent/CA2429860A1/en not_active Abandoned
- 2001-11-26 JP JP2002545166A patent/JP2004533211A/en not_active Withdrawn
- 2001-11-26 AU AU1989002A patent/AU1989002A/en active Pending
- 2001-11-26 WO PCT/US2001/044386 patent/WO2002042461A2/en active IP Right Grant
- 2001-11-26 CN CNA018222714A patent/CN1549858A/en active Pending
- 2001-11-26 AU AU2002219890A patent/AU2002219890B2/en not_active Ceased
-
2008
- 2008-02-05 JP JP2008025795A patent/JP2008154594A/en not_active Withdrawn
-
2010
- 2010-03-15 JP JP2010058352A patent/JP2010166925A/en not_active Withdrawn
Non-Patent Citations (1)
Title |
---|
See references of WO0242461A3 * |
Also Published As
Publication number | Publication date |
---|---|
CN1549858A (en) | 2004-11-24 |
JP2010166925A (en) | 2010-08-05 |
WO2002042461A2 (en) | 2002-05-30 |
CA2429860A1 (en) | 2002-05-30 |
AU2002219890B2 (en) | 2007-06-14 |
JP2004533211A (en) | 2004-11-04 |
JP2008154594A (en) | 2008-07-10 |
WO2002042461A3 (en) | 2003-09-12 |
AU1989002A (en) | 2002-06-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2005244540B2 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
US20060240523A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
JP2010166925A (en) | Endogenous and non-endogenous version of human g protein-coupled receptor | |
WO2000022131A2 (en) | Non-endogenous, constitutively activated human g protein-coupled receptors | |
AU2001249885A1 (en) | Non-endogenous, constitutively activated known g protein-coupled receptors | |
EP1412372A2 (en) | Endogenous and non-endogenous versions of human g protein-coupled receptors | |
US20140162358A2 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
US20130165633A1 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
AU2002219890A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
US7119190B2 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
US20100317046A1 (en) | Non-Endogenous, Constitutively Activated Versions of Human G Protein Coupled Receptor: FSHR | |
AU2007216751A1 (en) | Endogenous and non-endogenous versions of the human G protein-coupled receptor hRUP30 | |
US20150153327A1 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
AU2002248497A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
AU6299199A (en) | Non-endogenous, constitutively activated human g protein-coupled receptors | |
EP2264068A1 (en) | Non-endogenous, constitutively activated human G protein-coupled receptors | |
CA2732120A1 (en) | Endogenous and non-endogenous versions of human g protein-coupled receptors | |
EP1137776A2 (en) | Non-endogenous, constitutively activated human g protein-coupled receptors |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20030625 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
17Q | First examination report despatched |
Effective date: 20070614 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20120329 |