EP1353937A2 - Anticorps humains specifiques pour la therapie selective du cancer - Google Patents

Anticorps humains specifiques pour la therapie selective du cancer

Info

Publication number
EP1353937A2
EP1353937A2 EP01994329A EP01994329A EP1353937A2 EP 1353937 A2 EP1353937 A2 EP 1353937A2 EP 01994329 A EP01994329 A EP 01994329A EP 01994329 A EP01994329 A EP 01994329A EP 1353937 A2 EP1353937 A2 EP 1353937A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
peptide
cell
seq
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01994329A
Other languages
German (de)
English (en)
Other versions
EP1353937A4 (fr
Inventor
Yocheved Hagai
Janette Lazarovits
Rachel Guy
Orly Lipschitz
Esther Szanton
Avigdor Levanon
Daniel Plaksin
Tuvia Peretz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Savient Pharmaceuticals Inc
Original Assignee
Savient Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Savient Pharmaceuticals Inc filed Critical Savient Pharmaceuticals Inc
Publication of EP1353937A2 publication Critical patent/EP1353937A2/fr
Publication of EP1353937A4 publication Critical patent/EP1353937A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472—Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • MAbs rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate to malignant cells in lymphatic tissue, thus making lymphoid tumors excellent candidates for MAb-based therapy.
  • An ideal system would entail identifying a MAb that recognizes a marker on the cell surface of stem cells that produce malignant progeny cells.
  • anti-viral agents including acyclovir, ganciclovir and zidovudine
  • anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin
  • anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid
  • anti- autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide
  • anti-adhesion/anti-aggregation agents including limaprost, clorcromene
  • the subject invention provides for peptides or polypeptides that comprise an Fv molecule, a construct thereof, a fragment thereof, a construct of a fragment thereof, or a fragment of a construct, all of which have enhanced binding characteristics. These binding characteristics allow the peptide or polypeptide molecule to bind selectively and/or specifically to a target cell in favor of other cells, the binding specificity and/or selectivity being primarily determined by a first hypervariable region.
  • the scFv that is produced by the phage display technique is comprised of the variable domains of each of the antibody heavy and light chains, linked by a flexible amino-acid polypeptide spacer (Nissim et al, EMBO J, 13, 692-698 (1994)).
  • the present invention provides for a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment.
  • a construct may be a multimer (e.g., diabody, triabody, tetrabody) or a full-size Ig molecule; a fragment might be a minibody or a microbody. All derived constructs and fragments retain enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells.
  • the binding selectivity and/or specificity is primarily determined by a first hypervariable region, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group comprising SEQ ID NOs:8-24.
  • the present invention provides for a Yl or Y17 peptide or polypeptide comprising an scFv molecule.
  • a scFv is defined as a molecule which is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
  • the purity of the folded protein was >95%, and >100 mg were obtained from a 1-L culture (small-scale, non-optimized conditions).
  • the molecular weight of this form was found to be similar to that of the scFv according to HPLC, SDS-PAG ⁇ , and mass spectroscopy.
  • Yl-biotag was found to be the most consistent reagent for FACS analysis. However, when Yl-biotag binding to KG-1 cells was examined in the presence of serum, high concentrations (10-fold more) are required for comparable binding in the absence of serum. Nevertheless, this construct offered the advantage of specific biotinylation in which the binding site of the molecule remains intact. Further, each molecule is labeled by only one biotin — each molecule receives one biotin on the carboxyl end.
  • the blood of a leukemia patient can be circulated ex vivo through a system comprising a peptide or polypeptide of the invention conjugated to an anti-cancer agent. After removal of bound cells and unbound anti-cancer agent, the blood cells can be reintroduced into the body of a patient.
  • the blood of a leukemia patient can be circulated ex vivo through a system comprising a peptide or polypeptide of the invention attached to a solid phase. The cells that pass through the system and that do not bind to the peptide or polypeptide of the invention attached to a solid phase can be reintroduced into the body of a patient.
  • linker compounds include: Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid; Maleimido hydrazides such as N-[ ⁇ -maleimidocaproic acid] hydrazide, 4-[N- maleimidomethyl]cyclohexan- 1 -carboxylhydrazide, and N-[ ⁇ -maleimidoundcanoic acid] hydrazide]; PDPH linker such as (3-[2-pyridyldithio]propionyl hydrazide) conjugated to sulfurhydryl reactive protein; Carboxylic acid hydrazides selected from 2-5 carbon atoms; and direct coupling using small peptide linkers between the free sugar of, for example, the anti-cancer drug doxorubicin and a scFv.
  • Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid
  • Maleimido hydrazides such as N-[
  • the invention further provides a composition comprising an effective amount of an imaging agent, the peptide of the invention and a physiologically acceptable carrier.
  • the indicative marker molecule is any known marker known in the art, which includes, but is not limited to, a radioactive isotope, an element that is opaque to X-rays, a paramagnetic ion, or a fluorescent molecule, and the like.
  • the invention also provides a method for imaging an organ or cells that involves contacting the organ or cells to be imaged with an imaging agent of the invention under conditions such that the imaging agent binds to the organ and cells, imaging the bound imaging agent and, thereby, imaging the organ or cells.
  • the subject invention further provides a method of treating an organ in vivo that involves contacting the organ to be treated with a composition of the invention under conditions such that the composition binds to the organ, thereby treating the organ.
  • the subject invention provides for a peptide or polypeptide having, the formula or structure:
  • Repertoires of antibody fragments were first generated by PCR from rea ⁇ anged V-genes of peripheral blood lymphocytes of unimmunized human (refe ⁇ ed to as "naive repertoires"). To diversify the repertoire, random nucleotide sequences encoding heavy chain CDR3 lengths of 4-12 residues were introduced into a bank of 49 cloned human V H gene segments. The fused V L fragment in all the clones it derived from a single unmutated V gene of germline IGLV3S1, creating a single pot library of approximately 10 clones.
  • a phagemid stock was prepared individually from each of the selected clones.
  • AACTCGAGTGAGCTGACACAGGACCCT and the anti-sense oligonucleotide 5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the V L PCR reaction.
  • the cDNA product of the expected size of ⁇ 350 bp was purified, sequenced, and digested with Xhol and Notl restriction enzymes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne un peptide ou un polypeptide comprenant une molécule Fv, un produit de recombinaison, un fragment ou un produit de recombinaison d'un fragment présentant des caractéristiques de liaison améliorées afin de se lier de manière sélective et/ou spécifique à une cellule cible en faveur des autres cellules. La sélectivité ou la spécificité de liaison est déterminée essentiellement par une première zone hypervariable, et où le Fv est un scFv ou un dsFv, et éventuellement une ou plusieurs étiquettes. La liaison améliorée concerne essentiellement un site de liaison exposé et/ou sur-exprimé sur ou dans une cible comprenant une cellule en faveur des autres cellules sur ou dans laquelle le site de liaison n'est pas sensiblement disponible et/ou exprimé. L'invention traite également d'un procédé pour isoler ces peptides et ces polypeptides à partir d'une bibliothèque de phages et des molécules d'acide nucléique les codant. L'invention traite d'une composition pharmaceutique comprenant le peptide ou le polypeptide et des kits pour diagnostiquer et traiter la maladie, en particulier, le cancer, et plus précisément la leucémie myéloïde aigue.
EP01994329A 2000-12-29 2001-12-31 Anticorps humains specifiques pour la therapie selective du cancer Withdrawn EP1353937A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US751181 1996-11-15
US75118100A 2000-12-29 2000-12-29
PCT/US2001/049440 WO2002059264A2 (fr) 2000-12-29 2001-12-31 Anticorps humains specifiques pour la therapie selective du cancer

Publications (2)

Publication Number Publication Date
EP1353937A2 true EP1353937A2 (fr) 2003-10-22
EP1353937A4 EP1353937A4 (fr) 2005-04-13

Family

ID=25020844

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01994329A Withdrawn EP1353937A4 (fr) 2000-12-29 2001-12-31 Anticorps humains specifiques pour la therapie selective du cancer

Country Status (15)

Country Link
EP (1) EP1353937A4 (fr)
JP (1) JP2004524023A (fr)
KR (1) KR20030091952A (fr)
CN (1) CN100374456C (fr)
AU (1) AU2002246737B2 (fr)
BR (1) BR0116763A (fr)
CA (1) CA2433227A1 (fr)
CZ (1) CZ20031983A3 (fr)
HU (1) HUP0400775A2 (fr)
IL (1) IL156690A0 (fr)
MX (1) MXPA03005944A (fr)
NZ (1) NZ527173A (fr)
PL (1) PL365758A1 (fr)
RU (1) RU2316564C2 (fr)
WO (1) WO2002059264A2 (fr)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA05000271A (es) * 2002-07-01 2005-03-31 Savient Pharmaceuticals Inc Composiciones y metodos para tratamiento terapeutico.
WO2005005455A2 (fr) * 2003-06-30 2005-01-20 Bio-Technology General (Israel)Ltd. Anticorps humains specifiques
EA012970B1 (ru) 2005-04-26 2010-02-26 Пфайзер Инк. Антитела против р-кадгерина
CA2747154C (fr) 2008-12-19 2015-11-10 Philogen S.P.A. Immunocytokines pour therapie tumorale avec agents chimiotherapiques
CN110437321A (zh) * 2010-07-09 2019-11-12 阿菲博迪公司 多肽
CN101948534B (zh) * 2010-08-19 2014-05-28 中国科学院生物物理研究所 一种筛选抗体的方法
GB201310544D0 (en) * 2013-06-13 2013-07-31 Ucb Pharma Sa Obtaining an improved therapeutic ligand
DK3590962T3 (da) * 2014-10-23 2021-12-13 Singh Molecular Medicine Llc Enkeltdomæneantistoffer rettet mod intracellulære antigener
CA2970255A1 (fr) * 2014-12-17 2016-06-23 Intrexon Corporation Fragments variables intercales a chaine unique
GB201506868D0 (en) * 2015-04-22 2015-06-03 Ucb Biopharma Sprl Method for protein purification
CN108290940B (zh) * 2015-10-01 2021-12-07 圣拉斐尔医院有限公司 Tcr及其用途
WO2017087789A1 (fr) * 2015-11-19 2017-05-26 Revitope Limited Complémentation de fragment d'anticorps fonctionnel pour un système à deux composants pour la destruction redirigée de cellules indésirables
CR20220408A (es) * 2016-09-14 2022-10-20 Teneobio Inc ANTICUERPOS DE UNIÓN A CD3(Divisional del Expediente 2019-198)
CA3197828A1 (fr) * 2020-11-13 2022-05-19 Laurens Kruidenier Methodes, systemes et kits pour le traitement d'une maladie inflammatoire ciblant tl1a

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997002479A2 (fr) * 1995-06-30 1997-01-23 Yale University Anticorps anti-tumoraux monoclonaux humains

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR9806793A (pt) * 1997-01-22 2000-05-16 Univ Texas Processos e composições de fator tissular para coagulação e tratamento de tumores.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997002479A2 (fr) * 1995-06-30 1997-01-23 Yale University Anticorps anti-tumoraux monoclonaux humains

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ADAMS G P ET AL: "Prolonged in vivo tumour retention of a human diabody targeting the extracellular domain of human HER2/neu" BRITISH JOURNAL OF CANCER, vol. 77, no. 9, May 1998 (1998-05), pages 1405-1412, XP009037431 ISSN: 0007-0920 *
DE KRUIF J ET AL: "New perspectives on recombinant human antibodies" IMMUNOLOGY TODAY, ELSEVIER PUBLICATIONS, CAMBRIDGE, GB, vol. 17, no. 10, 1 October 1996 (1996-10-01), pages 453-455, XP004034704 ISSN: 0167-5699 *
DE KRUIF J ET AL: "Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 92, no. 9, 25 April 1995 (1995-04-25), pages 3938-3942, XP002149535 ISSN: 0027-8424 *
HOOGENBOOM H R ET AL: "Antibody phage display technology and its applications" IMMUNOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS BV, NL, vol. 4, no. 1, 1 June 1998 (1998-06-01), pages 1-20, XP004127382 ISSN: 1380-2933 *
HOOGENBOOM H R: "Designing and optimizing library selection strategies for generating high-affinity antibodies" TRENDS IN BIOTECHNOLOGY, ELSEVIER PUBLICATIONS, CAMBRIDGE, GB, vol. 15, no. 2, 1 February 1997 (1997-02-01), pages 62-70, XP004034115 ISSN: 0167-7799 *
HUDSON P J ET AL: "High avidity scFv multimers; diabodies and triabodies" JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 231, no. 1-2, 10 December 1999 (1999-12-10), pages 177-189, XP004186084 ISSN: 0022-1759 *
NISSIM A ET AL: "ANTIBODY FRAGMENTS FROM A 'SINGLE POT' PHAGE DISPLAY LIBRARY AS IMMUNOCHEMICAL REAGENTS" EMBO JOURNAL, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 13, no. 3, 1994, pages 692-698, XP002926488 ISSN: 0261-4189 *
See also references of WO02059264A2 *

Also Published As

Publication number Publication date
CN1551886A (zh) 2004-12-01
WO2002059264A2 (fr) 2002-08-01
MXPA03005944A (es) 2005-04-29
PL365758A1 (en) 2005-01-10
KR20030091952A (ko) 2003-12-03
EP1353937A4 (fr) 2005-04-13
RU2003123100A (ru) 2005-03-10
BR0116763A (pt) 2004-03-09
CZ20031983A3 (cs) 2005-07-13
HUP0400775A2 (en) 2007-05-02
IL156690A0 (en) 2004-01-04
CN100374456C (zh) 2008-03-12
RU2316564C2 (ru) 2008-02-10
JP2004524023A (ja) 2004-08-12
NZ527173A (en) 2006-03-31
WO2002059264A3 (fr) 2003-03-06
AU2002246737B2 (en) 2007-03-01
CA2433227A1 (fr) 2002-08-01

Similar Documents

Publication Publication Date Title
US20070149768A1 (en) Specific human antibodies for selective cancer therapy
AU2001249760B2 (en) Mucin-1 specific binding members and methods of use thereof
US20040002450A1 (en) Y17 - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001822A1 (en) Y1-isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001839A1 (en) Multimers - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
AU2002246737B2 (en) Specific human antibodies for selective cancer therapy
AU2001249760A1 (en) Mucin-1 specific binding members and methods of use thereof
AU2002246737A1 (en) Specific human antibodies for selective cancer therapy
MXPA03005945A (es) Moleculas aisladas que comprenden epitopes que contienen grupos sulfato, anticuerpos para tales epitopes y usos de ellos.
JP2005503756A5 (fr)
JP2004524023A5 (fr)
US20040202665A1 (en) Compositions and methods for therapeutic treatment
CA2491363A1 (fr) Anticorps et leurs applications
KR20050059001A (ko) 치료적 처리를 위한 조성물 및 방법
US20110117602A1 (en) Human antibody capable of inducing apoptosis
US20040208877A1 (en) Antibodies and uses thereof
KR102698752B1 (ko) 암 치료법에서 괴사를 표적화하기 위한 인간화 항-핵 항체
AU2002246738A1 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030728

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1060133

Country of ref document: HK

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SAVIENT PHARMACEUTICALS, INC.

A4 Supplementary search report drawn up and despatched

Effective date: 20050225

17Q First examination report despatched

Effective date: 20080121

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080603

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1060133

Country of ref document: HK