EP1341553A1 - Silensed anti-cd28 antibodies and use thereof - Google Patents
Silensed anti-cd28 antibodies and use thereofInfo
- Publication number
- EP1341553A1 EP1341553A1 EP01995504A EP01995504A EP1341553A1 EP 1341553 A1 EP1341553 A1 EP 1341553A1 EP 01995504 A EP01995504 A EP 01995504A EP 01995504 A EP01995504 A EP 01995504A EP 1341553 A1 EP1341553 A1 EP 1341553A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- antibody
- cells
- seq
- ofthe
- antibodies
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P41/00—Drugs used in surgical methods, e.g. surgery adjuvants for preventing adhesion or for vitreum substitution
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/54—F(ab')2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- This invention relates to anti CD28 antibodies defective of mitogenic activity and to uses thereof.
- Immune reactions are chiefly attributed to the activation of T- lymphocytes.
- This activation of T cells is induced by a signal from antigen-presenting cells (APC).
- the signal from the APC involves a first signal via the T-cell receptor (TCR) and a second signal (costimulatory signal) via costimulatory molecules.
- the first signal is from the major histocompatibility antigen (MHC) complex of peptides antigen where the APC is presents the T-cell antigen through the TCR.
- MHC major histocompatibility antigen
- the second signal is mediated by several co-stimulatory molecules, examples of which include B7 (B7-1 (CD80) and B7-2 (CD86)) are known as ligands on the APC side and CD28, CTLA-4, etc.
- the ligand B7 is a glycoprotein belonging to the immunoglobulin super family and is expressed in B cells etc. which belong to the antigen-presenting cell group.
- Both CD28 and CTLA-4, which recognize B7 as the common ligand, are transmembrane glycoprotefns belonging to the immunoglobulin super family.
- the activation of T cells is regulated by the concurrent transduction ofthe first signal via TCR and the second signal from, e.g., the B7 and CD28/CTLA-4.
- the signal from B7-to CD28 is known to promote whereas the signal from B7 to CTLA-4 inhibits the activation of T cells [Waterhouse et al., Science, 270:985-988 (1995)].
- An anti-B7 antibody was also prepared and reported to have suppressed activation of T cells but just as in the case of CTLA-4Ig, it suppressed the CTLA-4 signal as well.
- An anti-CD28 antibody in an in vitro experiment, was found to produce a mitogenic effect on T cells, and the combination ofthe stimulation with this antibody and an anti-CD3 antibody promoted the growth and activation of T cells and enhanced the production of cytokines [WO 90/05541, Eur. J. Immunology, 16, 1289-1296 (1986), etc.]. Furthermore, mitogenic stimulation ofthe CD28 receptor ofthe T cell by an anti-CD28 antibody has been stimulated in vivo resulted in the generation of a T-cell activation signal similar to the second signal from B7 to
- CD28 [Yin et al, J. Immunology, 163:4328-4334 (1999)]. These T-cell activating functions suggested that an anti-CD28 antibody might be used as an immunopotentiator in the therapy of cancer and AIDS (WO 90/05541).
- the anti-CD28 antibodies prepared by conventional technologies exert a mitogenic action on T cells.
- IgG2M3 has two amino acid substitution in IgG gene. Furthermore, we demonstrated that the resulting silenced anti-CD28 antibody has no mitogenic activity which is very useful for inducing T cell tolerance.
- the present invention provides anti-CD28 antibodies having no mitogenic activity ( hereinafter referred to as silenced anti-CD28 antibodies), and a methods of suppressing immune reactions, particularly transplant rejections, and inducing immunotolerance by using said antibodies.
- An object of the present invention is a silenced anti-CD28 antibody, where the anti-CD28 antibody may be a chimeric antibody and/or a humanized antibody.
- the variable regions of he anti-CD28 antibodies may include the amino acid sequences shown in SEQ ID NOS: 2, 4, 6 and 8 and polynucleotides encoding such amino acid sequences.
- such polnucleotides include SEQ ID NOS: 1, 3, 5, and 7.
- Another object ofthe present invention is vectors and cell hosts comprising the polynucleotides which encode the anti-CD28 antibodies.
- Another object ofthe present invention is methods for producing the silenced anti-CD28 antibody by culturing a cell host comprising the polynucleotides which encode the anti-CD28 antibodies under conditions which allow expression ofthe polynucleotide and collecting the gene products produced.
- Another object ofthe present invention is a pharmaceutical composition comprising one or more ofthe silenced anti-CD28 antibodies, preferably admixed with one or more pharmaceutically acceptable ingredients.
- the silenced anti-CD28 antibodies are useful for inducing T-cell tolerance, immunosuppression and as a prophylactic/therapeutic drug for organ or tissue transplant rejection. Accordingly, the present invention provides methods for inducing T-cell tolerance, immunosuppression, and providing a prophylaxis or treatment therapy during an organ or tissue transplant rejection by administering one or more of the silenced anti-CD28 antibodies to a mammal. Preferably, such silenced anti-CD28 antibodies are administered in as a pharmaceutical composition as described herein and may include additional drug/pharmaceuticals where appropriate.
- FIG. 1 Plasmid constructs for ChTN228 antibody expression. VL and VH of murine TN228 were constructed as mini-exons flanked by Xbal sites. The VL sequence was incorporated into the expression vector pVk and the VH sequence was incorporated into the expression vector pVg2M3.
- Figure 2. Nucleotide sequences and deduced amino acid sequences ofthe light chain of ChTN228 in the mini-exons. The signal peptide sequences are in italics. The CDRs are underlined. The mature light chain begins with an aspartic acid residue (bold letter). Untranslated and intron sequences are in lower case . (SEQ ID NOS: l and 2).
- FIG. 3 Nucleotide sequences and deduced amino acid sequences ofthe heavy chain variable regions of ChTN228 in the mini-exons.
- the signal peptide sequences are in italics.
- the CDRs are underlined.
- the mature heavy chain begins with a glutamine residue (bold letter).
- Untranslated and intron sequences are in lower case. (SEQ ID NOS: 3 and 4).
- FIG. 4 Competition experiment. P815/CD28 + cells were incubated with 25 ng of MuTN228-FITC and two-fold serial dilutions of either ChTN228 or MuTN228 as described. P815/CD28' cells were also incubated with MuTN228-FITC alone, without any competitor. The mean channel fluorescence for each sample was plotted against the concentration of competitor. Figure 5. Inhibition effect of TN228-IgG2m3 on human primary MLR(l). Percentage inhibition of primary MLR from four individuals were shown separately.
- [ 3 H]-thymidrne uptake rn 2nd MLR were presented as percentage of dpm of Raj 1 stimulation alone in 1st MLR as 100 TN228-IgG2m3 0 lug/mL Figure 8.
- Plasmid constructs for HuTN228 antibody expression VL and VH of humanized TN228 were constructed as mrm-exons flanked by Xbal sites. The VL sequence was mcorporated into the expression vector pVk and the VH sequence was mcorporated into the expression vector p Vg2M3
- FIG. 9 Nucleotide sequences and deduced ammo acid sequences ofthe heavy cham variable regions of HuTN228 in the mini exons
- the signal peptide sequences are in italics.
- the CDRs are underlmed.
- the mature heavy cham begms with a glutamme residue (bold letter) (SEQ ID NOS- 5 and 6)
- FIG. 10 Nucleotide sequences and deduced amino acid sequences ofthe light cham variable regions of HuTN228 in the mini exons
- the signal peptide sequences are in italics.
- the CDRs are underlmed.
- the mature light cham begms with an aspartic acid residue (bold letter) (SEQ ID NOS:7 and 8)
- FIG. 12 ELISA competition assay.
- the bmdmg of biotmylated MuTN228 to sCD28-Fc in the presence of various amounts of competitor MuTN228 or HuTN228 antibody was analyzed in an ELISA competition experiment as described m the examples Figure 13.
- 1-125 competition assay The bmdmg of I25 I labeled MuTN228 to P815/CD28 + cells in the presence of various amounts of competitor MuTN228 or HuTN228 antibody was analyzed in an 125 I labeled antibody competition experiment as described m the examples.
- FIG. 14 Plasmid constructs for PVl-IgG3 antibody expression.
- VL and VH of PV1 were constructed as mrm-exons flanked by Xbal sites.
- the VL sequence was mcorporated mto the expression vector pMVk rg dE, and the V_ sequence mto the expression vector pMVg3.D.Tt
- the two plasmids were then recombined to generate a single plasmid co-expressmg the heavy and light chains of PVl-IgG3.
- FIG 15A Sequences of cDNA and deduced ammo acid sequences ofthe light cham and heavy cham m the mrm-exons.
- the CDRs are underlmed.
- the mature light cham begms with an aspartic acid residue (double underlmed) at position 20 (SEQ ID NOS 9 and 10)
- Figure 15B Sequences of cDNA and deduced amino acid sequences of variable regions of PV1 in the mini-exons.
- the CDRs are underlined.
- the mature heavy chain with glutamine double underlined
- FIG. 16 Analysis of PV-l-IgG3 by size exclusion chromatography using HPLC as described in Methods. The protein was monitored by its absorbance at 280 nM.
- FIG. 1 SDS-PAGE analysis of mouse IgG3 isotype control (lane 1), PV1 (lane 2), and PVl-IgG3 (lane 3). Proteins in Panel A were run under nonreducing conditions, and in Panel B reducing conditions. MW represents molecular weight markers. The numbers are MW standards in kD.
- FIG. 18 EL4 cells stained with PV1 (A), 37.51 (B), or PVl-IgG3 (C), and analyzed by flow cytometry. Secondary antibodies used were: FITC-conjugated donkey anti-Armenian hamster IgG (H+L) for PV1, FITC- conjugated donkey anti-Syrian hamster IgG for 37.51, and FITC-conjugated goat anti-mouse kappa for PVl-IgG3. The solid line profiles represent cells stained with secondary antibodies only. The broken line profiles represent cells stained with both primary and secondary antibodies as described in Methods . Mouse IgG3 isotype control did not stain EL4 cells (data not shown). Figure 19. (A). Excess PV1, or PVI-IgG3 competes with R-PE-conjugated PV1 for binding to
- EL4 cells Thin solid line (black) in flow cytometry histogram represents cells without any staining, thick solid line (dark blue) cells stained with R-PE-PV1 alone, thin broken line (magenta) cells stained with R-PE-PV1 and excess unconjugated PV1, and thin double broken line (light blue) cells stained with R-PE-PV1 and excess unconjugated PVl-IgG3. Excess mouse IgG3 isotype control had no effect on R-PE-PVl's binding to EL4 cells (data not shown). (B). Excess 145.2C11, or 145.2C1 l-IgG3 compete with R-PE-conjugated 145.2C11 for binding to EL4.
- Thin solid line represents cells without any staining, thick solid line (dark blue) cells stained with R-PE-145.2C11 alone, thin broken line (magenta) cells stained with R-PE-145.2C11 and excess unconjugated 145.2C11, and thin double broken line (light blue) cells stained with R-PE-145.2C11 and excess unconjugated 145.2Cll-IgG3.
- C Excess PV1 competes with PVl-IgG3 for binding to EL4 cells.
- EL4 cells were stained with PVl-IgG3 with or without excess PV1. Cells were washed and stained with mouse IgG3- specific, FITC-conjugated donkey anti-mouse IgG (H+L).
- Thin solid line represents cells stained with secondary antibodies only, thick solid line (dark blue) cells stained with PVl-IgG3 and secondary antibodies, and thin broken line (magenta) cells stained with PVl-IgG3 and excess PV1, and secondary antibodies.
- FIG. 20 Mouse splenic cells stained with PVl-IgG3 and 145.2C11. Cells were stained with mouse IgG3 isotype control (A) or PVl-IgG3 (B), counter-stained with R-PE-conjugated goat anti-mouse IgG3 and with FITC-conjugated 145.2C 11 , and analyzed by two-color flow cytometry as described in Materials and Methods . Only cells in the lymphocyte gate were analyzed. PVl-IgG3-positive cells are in the upper quadrants and CD3-positive cells are in the right side quadrants. The number in each quadrant represents percentage of the cells in that particular quadrant.
- the term "silenced anti-CD28 antibody” means any anti-CD28 antibody defective of mitogenic activity. More specifically, it is an antibody which binds specifically to the antigen CD28 receptor on the surface ofthe T cell and does not promote the growth or activation of T cells by combined stimulation with an anti-CD3 antibody.
- a silenced anti-CD28 antibody can be constructed on the basis of an anti-CD28 antibody or an anti- CD28 antibody-producing hybridoma by mutating or modifying an agonistic anti-CD28 antibody by a genetic engineering technique or by chemical modification. Taking the use of genetic engineering technology as an example, the binding affinity ofthe anti-CD28 antibody for the Fc receptors can be reduced or eliminated by introducing a mutation into the amino acid sequence ofthe Fc domain ofthe antibody.
- a silenced anti-CD28 antibody can be obtained by isolating cDNA from hybridoma cells capable of producing an anti- CD28 monoclonal antibody and introducing a mutation(s) into the region ofthe sequence corresponding to the Fc domain which plays an important role in the binding to the Fc receptor (WO 88/07089).
- the site of mutation is not particularly restricted inasmuch as the binding to the Fc receptors may be inhibited.
- the H-chain amino acid residues 234, 235, 236, 237, 318, 320 and 322 are preferred and a silenced anti-CD28 antibody can be constructed by replacing at least one of these amino acids with a different amino acid.
- the source of such a silenced anti-CD28 antibody can be judiciously selected according to the target animal in which the antibody is used.
- nonhuman monoclonal antibodies contain a ino acid sequences showing antigenicity in humans over a fairly broad range.
- Many studies have shown that the immune response of a patient to a foreign antibody following injection ofthe antibody is remarkably intense and the very administration of the antibody may bring the patient into a perilous condition or deprive the antibody of the therapeutic utility. Therefore, it is recommendable to replace the Fc region so as to make the antibody relatively more homologous to the therapeutic target animal, replace the framework potions ofthe variable regions, or use the antibody obtained from a trans genie animal into which the antibody gene ofthe target animal has been mtroduced.
- a chimeric antibody (EP125023) available on replacement ofthe Fc region, a humanized antibody with the framework portion replaced (EP0239400, EP045126) or a human antibody (EP546073, WO 97/07671) obtained from a transgenic animal mto which the human antibody gene has been mtroduced
- a human antibody obtained from a transgenic animal mto which the human antibody gene has been mtroduced
- the ant ⁇ -CD28 antibody hav g a silenced Fc region there can be mentioned not only the antibodies described hereinafter m the Examples section but also the antibodies synthetically prepared using the constant region gene of the therapeutic target animal and the variable region polynucleotides based on the ammo acid sequences of variable regions shown m SEQ ID NO:2 and NO-4 or SEQ ID NO:6 and
- polynucleotides examples are SEQ ID NOS 1, 3, 5, and 7
- nucleic acid sequencing encodmg a protem or peptide as disclosed herein may be modified slightly m sequence (e.g., substitution of a nucleotide m a triplet codon), and yet still encode its respective gene product ofthe same ammo acid sequence
- expression vector refers to an polynucleotide which encodes the peptide ofthe invention and provides the sequences necessary for its expression m the selected host cell.
- Expression vectors will generally include a transc ⁇ ptional promoter and terminator, or will provide for incorporation adjacent to an endogenous promoter.
- Expression vectors will usually be plasmids, further comp ⁇ smg an origin of replication and one or more selectable markers.
- expression vectors may alternatively be viral recombinants designed to infect the host, or integrating vectors designed to integrate at a preferred site within the host's genome Examples of expression vectors are disclosed m Molecular Cloning: A Laboratory Manual Second Edition, Sambrook, F ⁇ tsch, and Marnatis, Cold Spring Harbor Laboratory Press, 1989.
- Suitable host cells for expression ofthe silenced ant ⁇ -CD28 antibody clude prokaryotes, yeast, archae, and other eukaryotic cells
- Approp ⁇ ate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are well known m the art, e g , Pouwels et al Cloning Vectors A Laboratory Manual, Elsevier, New York (1985).
- the cells are mammalian cells.
- the vector may be a plasmid vector, a single or double-stranded phage vector, or a single or double-stranded RNA or DNA viral vector.
- Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
- the vectors in the case of phage and viral vectors also may be and preferably are introduced into cells as packaged or encapsulated virus by well known techniques for infection and transduction.
- Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
- Cell-free translation systems could also be employed to produce the proteins using RNAs derived from the present DNA constructs.
- the silenced anti-CD28 antibodys/proteins can be purified by isolation purification methods for proteins generally known in the field of protein chemistry.
- purified antibodies may be produced by the recombinant expression systems described above.
- the method comprises culturing a host cell transformed with an expression vector comprising a DNA sequence that encodes the protein under conditions sufficient to promote expression ofthe protein.
- the protein is then recovered from culture medium or cell extracts, depending upon the expression system employed.
- procedures for purifying a recombinant protein will vary according to such factors as the type of host cells employed and whether or not the recombinant protein is secreted into the culture medium.
- the silenced anti-CD28 antibody when formulated into a pharmaceutical composition can be used in (a) transplant rejections following the transplantation of organs or tissues, such as heart, kidney, liver, bone marrow, skin, cornea, lung, pancreas, small intestine, muscle, nerve, etc.; (b) graft-versus-host reactions in the transplantation of bone marrow; (c) autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, type I diabetes, etc.; and (d) immune diseases such as asthma, atopic dermatitis, etc.
- organs or tissues such as heart, kidney, liver, bone marrow, skin, cornea, lung, pancreas, small intestine, muscle, nerve, etc.
- graft-versus-host reactions in the transplantation of bone marrow graft-versus-host reactions in the transplantation of bone marrow
- autoimmune diseases such as rheuma
- the silenced anti-CD28 antibody by itself can be expected to suppress immune reactions and transplant rejections and induce immunotolerance, it can also be used in combination with other drags.
- other drugs which are useful for combining with the silence anti-CD28 antibody are various rmmunosuppressants such as rapamycrn, deoxyspergaulm, anti-CD40 antibody, ant ⁇ -CD40L antibody, prograf, cyclosporin A, anti-IL-2 antibody, anti-IL-2 receptor antibody, anti-IL-12 antibody, anti-IL12 receptor antibody and MMF.
- Rapamycin in particular, inhibits transduction ofthe signal related to growth of T cells among signals from the IL2 receptor but does not inhibit transduction ofthe apoptosis-related signal, so that its use in combination with a specific inhibitor ofthe CD28 signal is expected to be useful.
- the silenced anti-CD28 antibody of this invention can be administered orally or parenterally, preferably by the intravenous, intramuscular or subcutaneous route.
- the silenced anti-CD28 antibody of this invention can be prepared m the form of a solution or a lyophilized powder and, where necessary, may be formulated with various pharmaceutically acceptable additives such as an excipient, diluent, stabilizer, isotonizing agent and buffer.
- the preferred additives include a sugar such as maltose, a surfactant such as polysorbate, an ammo acid such as glycine, a protein such as human serum albumin, and a salt such as sodium chloride.
- the dosage form such as in ectable preparations (solutions, suspensions, emulsions, solids to be dissolved when used, etc ), tablets, capsules, granules, powders, liquids, liposome inclusions, ointments, gels, external powders, sprays, rnhalating powders, eye drops, eye ointments, suppositories, pessaries, and the like can be selected appropriately depending on the administration method, and the peptide ofthe present invention can be accordingly formulated.
- Formulation m general is described in Chapter 25.2 of Comprehensive Medicmal Chemistry, Volume 5, Editor Hansch et al, Pergamon Press 1990.
- the dosage ofthe pharmaceutical composition of this invention is dependent on the specific composition, the type of disease as the target of therapy or prophylaxis, the method of admrnistration, the patient's age and condition and the duration of treatment, among other variables.
- 0.01-100 mg/kg, preferably 0.1-10 mg/kg, per day per adult can be administered.
- the composition can be administered in a dose of about 1 mg/kg/day immediately before transplantation, immediately after transplantation, and 3, 7, 12, 18, 25, 35, 45 and 60 days after transplantation, by intravenous, intramuscular or subcutaneous injection.
- the administration frequency and dosage may be judiciously increased or decreased while the course of rejection reaction after transplantation is monitored. While the administration interval depends on the method of administration used and the patient's condition, among other factors, not only continuous aclministrationbut also intermittent administration is feasible.
- the silenced anti-CD28 antibody of this invention is an antibody, it provides a sustained effect so that intermittent dosing may be rewarded with the expected efficacy.
- this tolerance can be maintained even if the use ofthe silenced anti-CD28 antibody is discontinued.
- this silenced anti-CD28 antibody is undoubtedly superior to other immunosuppressants the immunosuppressive effect of which declines after discontinuation.
- the hybridoma producing anti-human CD28 antibody (clone:TN228, mouse IgGl kappa) was generously provided by Dr. Yagita (Juntendo University School of Medicine, Japan). Approximately 0.2 mg of purified anti-human CD28 antibody (TN228) was reduced in 0.64 M guanidine-HCI, 0.28 M Tris-HCl, pH 8.5, 0.055 M DT7 for 90' at 60 C (under argon), carboxymethylated by addition of iodoacetic acid to 0.13 M for 45' at room temperature (in the dark), followed by addition of DTr to 0.32 M (to terminate the carboxymethylation reaction), and immediately buffer-exchanged in 0.1 M sodium phosphate, 0.002 M EDTA, pH 8.0 using a PD- 10 column (catalog #17-0851-01, Amersham Pharmacia Biotech, Uppsala, Sweden).
- the eluate was adjusted to 0.005 M DTT, 0.02 % glycerol, and one third ofthe solution (about 0.35 ml) was transferred to a separate tube for N-terminal deblocking ofthe heavy chain.
- the sample was digested with 1800 ⁇ U of pyroglutamate aminopeptidase (catalog # 7334, Takara Shuzo Co., Ltd., Tokyo, Japan) for 24 hours at 45 C.
- the N-teiminal sequences ofthe light and heavy chains from the deblocked sample were determined by 20 cycles of automated Edman degradation and PTH analysis on a Model 241 Protein Sequencer (Hewlett Packard, Palo Alto, CA).
- the PTH derivatives were analyzed on a Hypersil ODS C18 column.
- V region cDNAs for the light and heavy chains of TN228 were cloned from the hybridoma cells by an anchored polymerase chain reaction (PCR) method described by Co et al. (Co, M.S., N.M. Avadalovic, P.C. Caron, M.V. Avadalovic, D.A. Scheinberg, and C. Queen. 1992. Chimeric and humanized antibodies with specificity for the CD33 antigen. J. Immunol. 148: 1149-1154.). Amplification was performed on cDNA using 3' primers that anneal respectively to the mouse kappa and gamma chain C regions, and a 5' primer that anneals to the added G-tail ofthe cDNA. For VL PCR, the 3' primer has the sequence (SEQ ID NO:13):
- the 3' primers have the degenerate sequences (SEQ ID NOS: 14, 15 and 16):
- TN228 V L and V H were converted by PCR into mini-exon segments flanked by Xbal sites as described by He et al. (He, X.Y., Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V. Vexler, C. Klfngbeil, M.S. Co, and E.L. Berg. 1998. Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectin. J. Immunol. 160: 1029-1035) and were subcloned into the light chain and heavy chain expression plasmids (Fig. 1).
- Each mini-exon contains a signal peptide sequence, a mature variable region sequence and a splicing donor sequence derived from the most homologous mouse J chain gene. Such splicing donor sequences are used to splice the V region exon to the human antibody constant region.
- Each mini-exon was sequenced after it had been cloned into the expression vector to ensure the correct sequence was obtained and that no PCR errors were generated. The constant region exons ofthe light and heavy chain expression plasmids were also confirmed by sequencing.
- ChTN228 refers to a chimeric antibody containing the mouse TN228 VL and VH variable regions, a human IgG2M3 constant region for the heavy chain, and a human kappa constant region for the light chain.
- the heavy chain constant region was modified (Cole, M.S., C. Anasetti, and J.Y. Tso. 1997.
- Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells. J. Immunol. 159: 3613-3621) from the germline human 2 genomic fragment, and the light chain was derived from the germline human K genomic fra ment. Both the heavy and light chain genes are driven by the human cytomegalovirus major immediate early promoter and enhancer. The heavy chain gene is followed by the transcription terminator derived from the human complement gene C2 (Ashfield, R., P. Enriquez-Harris, andN.J. Proudfoot. 1991. Transcriptional termination between the closely linked human complement genes C2 and factor B: common terrnination factor for C2 and c-myc? EMBO J. 10: 4197-4207).
- the light chain selection marker gpt gene (Mulligan, R.C., and P. Berg. 1981. Selection for animal cells that express the Escherichia coli gene coding for xanthine-guanine phosphoribosyltransferase. Proc. Natl. Acad. Sci. USA 78: 2072-2076) and the heavy chain selection marker dhfr gene (Simonsen, C.C., and A,D. Levinson. 1983. Isolation and expression of an altered mouse dihydrofolate reductase cDNA. Proc. Natl. Acad. Sci. USA 80: 2495-2499) are both driven by the SV40 early promoter.
- transient transfection into COS-7 cells was done using lipofecta ine (catalog # 10964-013, GIBCO BRL).
- Spent media from transient transfectants were analyzed for human IgG2M3 antibody production by ELISA, using goat anti-human IgG gamma chain specific antibody as- capturing reagent and HRP-conjugated goat anti-human kappa chain antibody as developing reagent.
- the spent media was also tested for the ability of ChTN228 to bind to P815/CD28 + cells (stably transfected cell with CD28 into P815 (mouse mastcytoma)) by indirect immunofluorescent staining and analyzed by flow cytometry.
- the chimeric expression plasmids were transfected into murine myeloma cell line Sp2/0 by electroporation and the transfectants were selected for gpt expression.
- the spent media from stable transfectants were analyzed by ELISA as for the transient transfection.
- the cloned V L and V H genes were converted into mini-exons by PCR (Fig. 2 and 3) and subcloned into the light and heavy chain expression vectors as described above and shown in Fig. 1.
- Transient transfection of COS-7 cells The chimeric expression vectors were transiently transfected into monkey kidney cell line COS-7 to produce the chimeric TN228 + antibody. Spent medium from the transfected cells was tested by ELISA for the production of chimeric IgG2M3 antibodies and by flow cytometry for binding to P815/CD28 + cells. Spent medium was positive in both assays. The yield of cliimeric antibody from transient transfection was ⁇ 0.9 ⁇ g ml. The ChTN228 antibody from transient supernatant bound to P815/CD28 + cells in a concentration dependent manner (data not shown).
- Stable transfection of Sp2/0 cells The chimeric expression vectors were transfected into Sp2/0 cells for the production of a stable cell line. Spent media from several transfectants were tested for the production of chimeric TN228 antibody and for binding to P815/CD28 + cells as with the transient transfectants. Most transfectants were positive for both assays. One fransfectant was chosen for its liigher antibody productivity and expanded to grow in 5 L of serum free medium. ChTN228 was purified from 5 L of spent medium by affinity chromatography. The yield of purified antibody was ⁇ 25 mg.
- ChTN228 expressing transfectants from the stable transfection was grown in 5 L of GIBCO hybridoma serum-free medium (catalog # 12045-076, GIBCO BRL). Spent culture supernatant was harvested when cell viability reached 10 % or below, concentrated to 500 ml, and loaded onto a 5 ml protein-A Sepharose column using a Pharmacia PI pump (2-3 ml/min). The column was washed with PBS before the antibody was eluted with 0 M Glycine, 0.1 M NaCl, pH 2.7.
- the eluted protein was dialyzed against 3 changes of 2 L PBS and then desalted onto a PD- 10 column equilibrated with PBS containing an additional 0.1 M NaCl.
- the desalted protein solution was filtered through a 0.2 ⁇ m filter prior to storage at 4 C.
- Size exclusion HPLC was performed using a Perkin Elmer HPLC system consisting of a PE ISS 200 Advanced LC Sample Processor, a PE Series 410 Bio LC Pump, a PE 235C Diode Array Detector, and a PE Nelson 600 Series LINK.
- Perkin Elmer Turbochrom Navigator Version 4.1 software was used to control the autosampler, pump, and detector, and to acquire, store, and process the data. Separation was achieved using two TosoHaas TSK-GEL G3000SWXL size exclusion HPLC columns, 7.8 mm x 300 mm, 5 ⁇ m particle size, 250 A pore size (catalog # 08541, TosoHaas, Montgomeryville, MD) connected in series.
- the mobile phase was 200 mM potassium phosphate/150 mM potassium chloride at pH 6.9, and the flow rate was 1.00 mL/minute.
- the column eluate was monitored spectrophotometrically at both 220 mn and 280 nm.
- the injection volume was 50 ⁇ L (50 ⁇ g) ofthe ChTN228 sample.
- SDS-PAGE was performed according to standard procedures on a 4-20% gradient gel (catalog # EC6025, Novex, San Diego, CA).
- the purity ofthe isolated ChTN228 was analyzed by size exclusion HPLC and SDS-PAGE. Based on this analysis, the protein is 96.5 % monomer and has the mobility corresponding to a protein of molecular weight -160 kD.
- SDS-PAGE analysis of MuTN228, isotype control MuFd79 (mouse IgGl), ChTN228, and isotype control HuEP5C7 (human IgG2M3) under nonreducing conditions also indicated that all four antibodies have a molecular weight of about 150-160 kD. Analysis ofthe same four proteins under reducing conditions indicated all four antibodies were comprised of a heavy chain with a molecular weight of about 50 kD and a light chain with a molecular weight of about 25 kD.
- the bmdmg specificity ofthe MuTN228 and ChTN228 antibodies was compared in a flow cytometry competition experiment as described in the Methods Various amounts of unlabeled MuTN228 or ChTN228 were mixed with 25 ng of FITC-labeled MuTN228 antibody and mcubated with P815/CD28' cells. Both
- MuTN228 and ChTN228 competed with MuTN228-FITC m a concentration dependent manner, indicating that bmdmg of both antibodies is specific for the CD28 antigen (Fig. 4).
- the isotype control antibodies MuFd79 and HuEP5C7 did not compete with MuTN228-FITC, indicating that the MuTN228 and ChTN228 antibodies recognize the CD28 antigen through V-region specific interactions
- Example 7 Chimeric anti-human CD28 antibody which has reduced affinity to human F R inhibits primary mixed lymphocyte reaction.
- PBMC peripheral blood mononuclear cells
- Human peripheral blood mononuclear cells were prepared from normal healthy volunteers by density gradient centrifugation usmg FicoU-Paque plus (Amersham Pharmacia Biotech, Tokyo, Japan). Human blood were diluted with equal volume of RPMI1640 and overlaid on FicoU-Paque plus. After centrifugation for 30 min at room temperature, PBMCs were collected and washed with RPM11640 Thereafter, PBMCs were suspended with the med ⁇ um(RPMI1640 containing 2.5% human type AB serum, 2-merca ⁇ toethanol, and antibiotics) and applied to a nylon fiber column(Wako junyaku, Osaka, Japan). After 1 hr mcubation at 37 C in
- T cells 5 % C0 2 , T cells were eluted with warm medium.
- Human B cell lines (Raji and JY) were used as stimulator cells in the mixed lymphocyte reaction. These cells were X-ray irradiated (2000R) before use.
- TN228-IgG2m3 inhibited in a dose dependent manner. Therefore, conversion of Fc region of anti-human CD28 antibody to one with reduced affinity to human Fc R makes the antibody antagonistic to T cell proliferation. Chimeric anti-human CD28 antibody which has reduced affinity to human Fc R reduced T cell low responsiveness in secondary mixed lymphocyte reaction.
- Purified human T cells (1 x 10 5 cells/well) and irradiated Raji cells (1 x 10 5 cells/well) were plated in 96-well flat bottom micro plates. Antibodies were added to the culture medium and cells were incubated. After 5 days, cells were collected, washed with fresh medium. Cells were, suspended with fresh medium and cultured for 8 days. Cells were restimulated with irradiated Raji or JY cells. After additional 7 days culture, cells were incubated with 10 kBq/well [ 3 H]thy idine for 6 hours. Cells were harvested and radioactivity was measured by liquid scintillation counter.
- TN228-IgG2m3 inhibited primary MLR (Fig. 5 and 6).
- the antibody was applied to primary MLR culture, then antibody was removed from culture supernatant. After culturing in the medium without antibodies, cells were re-stimulated with the same stimulator cells(Raji) or third party stimulator(JY). The proliferation of cells treated with TN228-IgG2m3 through primary MLR was reduced compared to that of none-treated cells. However, both cells proliferated to almost the same extent with third party stimulator (JY) (Fig. 7). This result indicates that anti-human CD28 antibody with reduced affinity to human Fc R may induce T-cell energy through alo-antigen stimulation.
- Example 8 indicates that anti-human CD28 antibody with reduced affinity to human Fc R may induce T-cell energy through alo-antigen stimulation.
- the humanized TN228 heavy chain variable domain has 65 residues out of 85 framework residues that are identical to those ofthe mouse TN228 heavy chain framework, or 76% sequence identity.
- the humanized TN228 tight chain variable domain has 56 residues out of 80 framework residues that are identical to those of the mouse TN228 light chain framework, or 70% sequence identity.
- the computer programs ABMOD and ENCAD (Levitt, M. 1983. Molecular dynamics of native protein. I. Computer simulations of trajectories. J. Mol. Biol. 168: 595-620) were used to construct a molecular model ofthe TN228 variable domain, which was used to locate the amino acids in the mouse TN228 framework that are close enough to the CDRs to potentially interact with them.
- ABMOD and ENCAD Levitt, M. 1983. Molecular dynamics of native protein. I. Computer simulations of trajectories. J. Mol. Biol. 168: 595-620
- To design the humanized TN228 heavy and light chain variable regions the CDRs from the mouse TN228 heavy chain were grafted into the framework regions ofthe human IC4 heavy chain and the CDRs from the mouse TN228 light chain were grafted into the framework regions ofthe human IC4 light chain.
- MuTN228 CDRs into the IC4 framework region was done). Furthermore, framework residues that occurred only rarely at their positions in the database of human antibodies were replaced by human consensus amino acids at those positions. For humanized TN228 this was done at residues 23, 40, 73, 83 and 85 ofthe heavy chain and at residues 69 and 77 ofthe light chain.
- the amino acid sequences of the humanized TN228 antibody heavy and light chain variable regions are shown Figure 9 and 10.
- variable region amino acid sequences were constructed to encode them, including signal peptides, splice donor signals and appropriate restriction enzyme sites (Figure 8).
- the heavy and light chain variable region genes were constracted and amplified using eight overlapping synthetic oligonucleotides ranging in length from approximately 65 to 80 bases (He, X.Y, Z. Xu, J. Melrose, A. Mullowney, M. Vasquez, C. Queen, V. Vexler, C. Klingbeil, M.S. Co, and E.L. Berg. 1998. Humanization and pharmacokinetics of a monoclonal antibody with specificity for both E- and P-selectfn. J. Immunol. 160: 1029-1035).
- the oligonucleotides were annealed pairwise and extended with the Klenow fragment of DNA polymerase I, yielding four double-stranded fragments.
- the resulting fragments were denatured, annealed pairwise, and extended with Klenow, yielding two fragments. These fragments were denatured, annealed pairwise, and extended once again, yielding a full-length gene.
- the resulting product was amplified by polymerase chain reaction (PCR) using Taq polymerase, gel-purified, digested with Xbal, gel- purified again, and subcloned into the Xbal site of pVg2M3 for the expression of heavy chain, and pVk for the expression of light chain.
- the pVg2M3 vector for human gamma 2 heavy chain expression (Cole, M.S., C. Anasetti, and J.Y. Tso. 1997. Human ' IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells. J. Immunol. 159: 3613-3621), and the pVk vector for human kappa light chain expression (CO, M.S., N.M. Avadalovic, P.C. Caron, M.V. Avadalovic, D.A. Scheinberg, and C. Queen. 1992. Chimeric and humanized antibodies with specificity for the CD33 antigen. J. Immunol. 148:1149-1154) have been previously described.
- the sequences ofthe V-regions and constant region exons ofthe heavy and light chain final plasmids were verified by nucleotide sequencing.
- the gross structures ofthe final plasmids were verified by restriction mapping. All DNA manipulations were performed by standard methods.
- HuTN228 refers to a humanized antibody containing the humanized TN228 V H and V L variable regions, a human IgG2M3 constant region for the heavy chain, and a human kappa constant region for the light chain.
- the heavy chain constant region was modified (Cole, M.S., C. Anasetti, and J.Y. Tso. 1997. Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells. J. Immunol. 159: 3613-3621) from the germline human 2 genomic fragment, and the light chain was derived from the germline human K genomic fragment.
- the human cytomegalovirus major immediate early promoter and enhancer drive both the heavy and light chain genes.
- the heavy chain gene is followed by the transcription terminator derived from the human complement gene C2 (Ashfield, R., P. Enriquez-Harris, and J. Proudfoot. 1991. Transcriptional te ⁇ nination between the closely linked human complement genes C2 and factor B: common termination factor for C2 and c-myc? EMBO J. 10: 4197-4207).
- the light chain selection marker gpt gene (Mulligan, R.C., and P. Berg. 1981. Selection for animal cells that express the Escherichia coli gene coding for xanthme-guanine phosphoribosyltransferase. Proc. Natl. Acad. Sci.
- HuTN2208 transient transfection into COS-7 cells (monkey kidney cell line) was done using Lipofectamfne 2000 (catalog # 11668-027, Life Technologies). Spent media from transient transfectants were analyzed for human IgG2M3 antibody production by ELISA, using goat anti-human IgG gamma chain specific antibody as capturing reagent and HRP-conjugated goat anti-human kappa chain antibody as developing reagent. The spent media were also tested for the ability of HuTN228 to bind to P815/CD28 + cells by indirect immunofluorescent staining and analyzed by flow cytometry (data not shown).
- the humanized expression plasmids were transfected into murine myeloma cell line S ⁇ 2/0 by electroporation and the transfectants were selected for gpt expression.
- the spent media from stable transfectants were analyzed by ELISA as for the transient transfection.
- Transient transfection of COS-7 cells The expression vectors were transiently transfected into monkey kidney cell line COS-7 to produce the HuTN228 antibody. Spent medium from the transfected cells was tested by ELISA for the production of humanized gG2M3 antibodies and by flow cytometry for binding to P815 /CD28 + cells (data not shown). Spent medium was positive in both assays. The yield of humanized antibody from transient transfection was -3.7 g/ml. The HuTN228 antibody from transient supernatant bound to P815/CD28 " cells in a concentration dependent manner (data not shown). Stable transfection of Sp2/0 cells: The humanized expression vectors were transfected into Sp2/0 cells for the production of a stable cell line.
- HuTN228 antibody Spent media from several transfectants were tested for the production of HuTN228 antibody as with the transient transfectants.
- One transfectant (clone 4) was chosen for its higher antibody productivity and expanded in GIBCO hybridoma serum free medium.
- HuTN228 antibody was purified from 570 ml of spent medium by affinity chromatography. The yield of purified antibody was ⁇ 7 mg.
- Sepharose column The column was washed with PBS before the antibody was eluted with 0.1 M Glycine, 0.1
- the eluted protein was dialyzed against 3 changes of 2 L PBS and then desalted onto a PD-10 column equilibrated with PBS containing an additional 0.1 M NaCl.
- the desalted protein solution was filtered through a 0.2 m filter prior to storage at 40C.
- Size exclusion HPLC was performed using a Perkin Elmer HPLC system consisting of a PE ISS 200
- TosoHaas TSK-GEL G3000SWXL size exclusion HPLC columns (7.8 mm x 300 mm, 5 m particle size, 250 pore size; catalog # 08541, TosoHaas, Montgomeryville, MD) connected in series.
- the mobile phase was 200 mM potassium ⁇ hosphate/150 mM potassium chloride at pH 6.9, and the flow rate was 1.00 mL/minute.
- the column eluate was monitored spectrophotometrically at both 220 nm and 280 mn.
- the injection volume was 60
- the isotype ofthe purified antibody was confirmed using the Human IgG Subclass Profile ELISA Kit (catalog # 99-1000, Zymed Laboratories, South San Francisco, CA) following the manufacturer's recommendations.
- the purity ofthe isolated HuTN228 antibody was analyzed by size exclusion HPLC and SDS-PAGE. The HPLC elution profile of HuTN228 is not shown. Based on this analysis, the protein is -98% monomer and has the mobility corresponding to a protein of molecular weight -160 kD.
- the isotype test indicated that the isotype ofthe HuTN228 antibody was consistent with the expected IgG2 isotype (data not shown).
- MuTN228-FITC 50 ng/test in 25 1 of FSB was combined with three-fold serial dilutions of competing HuTN228 or MuTN228 antibodies (beginning at 200 g/ml) in 25 1 of FSB, and added to P815/CD28 "1" cells (3x10 s cells/test) in 50 1 of FSB.
- P815/CD28 + cells were mcubated with MuTN228-FITC alone (50 ng/test in 50 1 of FSB).
- HuEP5C7 human IgG2M3
- MuFd79 mouse IgGl isotype control antibodies (200 g/ml) in 25 1 of FSB were also tested as nonspecific competitors.
- Cells were incubated with the antibody mixture in a final volume of 100 1 for one hour on ice (in the dark), then washed with 2 ml of FSB, and analyzed by flow cytometry. This experiment was repeated three times.
- sCD28-Fc means the fused protein, in which the extracellular domains of CD28 were combined with the CH2 and CH3 domains of IgGl.
- Amixture of MuTN228-biotin (0.5 g/ml) in 100 1 of ELISA Buffer (EB PBS, 1% BSA, 0.1% Tween-20) and three-fold serially diluted HuTN228 or MuTN228 competitor antibodies (starting at 100 g/ml) in 100 1 of EB was added in triplicate in a final volume of 200 1well. Isotype control antibodies HuEP5C7 and MuFd79 (100 g/ml) in 100 1 of EB were also tested as non-specific competitors. As a 'no competitor' control, 100 1 of EB was added to 100 1 of MuTN228-biotin (0.5 g/ml).
- MuTN228 and HuTN228 competed with MuTN228-biotin in a concentration dependent manner.
- the isotype control antibodies MuFd79 and HuEP5C7 did not compete with MuTN228-biotin, indicating that the MuTN228 and HuTN228 antibodies recognize the CD28 antigen through V-region specific interactions.
- the IC 50 values of MuTN228 and HuTN228 for all three experiments are shown in Table 2. The relative binding of HuTN228 was on average 2.6 fold less than that of MuTN228. Table 2. ELISA competition summary
- the relative binding affinities ofthe MuTN228 and HuTN228 antibodies were determined following the method of Queen et al. (Queen, C, W.P. Schneider, H.E. Selick, P.W. Payne, N.F. Landolfi, J.F. Duncan, N.M. Avdalovic, M. Levitt, R.P. Junghans, T.A. Waldmann. 1989. A humanized antibody that binds to the interleukin 2 receptor. Proc. Natl. Acad. Sci. 86:10029-10033).
- BB PBS, 2% FBS, 1 g/ml mouse IgG, 0.1% NaN 3 ) was combined in triplicate with threefold serial dilutions of MuTN228 or HuTN228 competitor antibodies (beginning at 400 g /ml) in 50 1 of BB, added to 100 1 of P815/CD28 "1" cells (2.5 x 10 5 cells/test) in incubation tubes (Skatron Macrowell Tube Strips, catalog # 15773, Molecular Devices, Sunnyvale, CA), and incubated for 90 minutes at 4 C with gentle shaking. Isotype control antibodies HuEP5C7 and MuFd79 (400 g /ml) in 50 1 of BB were also tested as nonspecific competitors. Following the incubation, the cell-antibody mixture was transferred to centrifuge tubes (Sarstedt
- ATCC ATCC HB-12352
- Purified PV1, R-phycoerythrin (R-PE)-conjugated PV1 were purchased from Southern Biotechnology (Birmingham, AL).
- the Syrian hamster anti-CD28 antibody 37.51 was from PharMingen (San Diego, CA).
- FITC-conjugated goat anti-mouse kappa, R-PE-conjugated goat anti-mouse IgG3, and horse radish peroxidase (HRP)-conjugated goat anti-mouse kappa were from Southern Biotechnology.
- Goat anti- mouse IgG3, and mouse IgG3 isotype control FLOPC 22 were from Sigma Chemicals (St. Louis, MO).
- the Armenian hamster anti-murine CD3 antibody 145.2C11 and its hamster/mouse chimeric version 145.2C1 l-IgG3 were generated in our laboratory.
- FITC-conjugated 145.2C11 was from Boehringer Mannheim (Indianapolis,
- V region cDNAs for the light and heavy chains of PV1 were cloned from the hybridoma cells by an anchored polymerase chain reaction (PCR) method described by Co et al. (Co, M.S., N.M. Avadalovic, P.C. Caron, MN. Avadalovic, D.A. Scheinberg, and C. Queen. 1992. /. Immunol.
- PCR polymerase chain reaction
- Amplification was performed on cD A using 3' primers that anneal respectively to the hamster kappa and gamma chain C regions, and a 5' primer that anneals to the added G-tail ofthe cD ⁇ A.
- the 3' primer has the sequence of 5 ' ATAGAGCTCCACTTCCAGTGCCC (SEQ ID N0 : 20) , with residues 11- 24 hybridizing to the hamster C ⁇ region.
- VH PCR the 3' primers has the degenerated sequences of (SEQ ID NOS:17, 18 and 19):
- V and VH cDNAs were subcloned into a pUC19 vector for sequence determination. To avoid PCR-generated errors, five independent clones for each cDNA were sequenced, and only the clones whose sequence agreed with the consensus sequence were chosen to express the chimeric PV1.
- PV1 V region cDNAs Cloning of PV1 V region cDNAs.
- the PV1 light and heavy chain V region cDNAs were cloned from the hybridoma cells as described in Methods. For the VL PCR, only 3' primer corresponding to the hamster C ⁇ region could yield VL CDNA product from PV1. A 3' primer from the hamster C ⁇ region, on the other hand, did not yield any PCR product.
- Several light and heavy chain clones were sequenced and were found to contain the same V and VH, respectively. Limited CHI and C ⁇ sequence data indicated that the cloned heavy and light chains are not murine in origin.
- PV1 V and V H were made by PCR into mini-exon segments flanked by Xbal sites as described (He, X. Y., Z.
- Each mini-exon contains a signal peptide sequence, a mature variable region sequence and a 5' splicing donor sequence derived from the most homologous mouse J chain gene. Such splicing donor is used to splice the V region exon to the mouse antibody constant region. Each mini-exon was sequenced again after it had been cloned into the expression vector to ensure the correct splicing signal was introduced, and no PCR errors were generated.
- PVl-IgG3 refers to a chimeric antibody containing the hamster PV1 V and V H variable regions, a mouse IgG3 constant region for the heavy chain, and a mouse kappa constant region for the light chain.
- the expression vector pVl.g3.rg.dE (Fig. 14) was obtained by a two-step cloning process similar to that described by Cole et. al. (Cole, M.S., C. Anasetti, and J.Y. Tso. 1997. J. Immunol. 159:3613- 3621.).
- the heavy chain constant region was derived from the mouse ⁇ 3 genomic fragment, and the light chain from the K fragment. Both the heavy and light chain genes are driven by the human cytomegalo virus major immediate early promoter and enhancer, and they are separated by the transcription terminator derived from the human complement gene C2 (Ashfield, R., P. Enriquez-Harris, andN.J. Proudfoot. 1991. EMBO J. 10:4197- 4207.).
- the selection marker gpt gene (Mulligan, R.C., and P. Berg. 1981. Proc. Natl. Acad. Sci. USA 78:2072- 2076) is driven by a modified SV40 early promoter.
- the single plasmid vector was transfected into the murine myeloma cell line NS0, and the transfectants were selected for gpt expression.
- Spent media from transfectants were analyzed for mouse IgG3 antibody production by ELISA, using goat anti-mouse IgG3 as capturing reagent and HRP-conjugated goat anti-mouse kappa chain as developing reagent.
- the assay is specific for mouse IgG3; other mouse IgG isotypes are negative in this analysis.
- the desalted protein solution was filtered through a 0.2 ⁇ m filter prior to storage at 4 °C.
- PVl-IgG3 at high concentrations >1 mg/mL precipitates in the cold but returns to solution by warming at 37° C.
- the antibody stays in solution at room temperature. ⁇ Repeated cycles of cold precipitation do not seem to affect the antigen binding activity ofthe antibody.
- Size exclusion HPLC was performed using a
- Perkin Elmer HPLC system consisting of a PE ISS 200 Advanced LC Sample Processor, a PE Series 410 Bio LC Pump, a PE 235C Diode Array Detector, and a PE Nelson 600 Series LINK.
- Perkin Elmer Turbochrom Navigator Version 4.1 software was used to control the autosampler, pump, and detector, and to acquire, store, and process the data. Separation was achieved using two TosoHaas TSK-GEL G3000SWXL size exclusion HPLC columns (TosoHaas, catalog # 08541, 7.8 mmx 300 mm, 5 ⁇ m particle size, 250 A pore size) connected in series.
- the mobile phase was 200 mM potassium phosphate/150 mM potassium chloride at pH 6.9, and the flow rate was 1.00 mL/minute.
- the column eluate was monitored spectrophotometrically at both 220 nm and 280 nm.
- the injection volume was 50 ⁇ L (63.5 ⁇ g) ofthe undiluted PVl-IgG3 sample. SDS-PAGE was performed according to standard procedures.
- the purity ofthe isolated PVl-IgG3 was analyzed by size exclusion HPLC and SDS-PAGE.
- the HPLC elution profile of PVl-IgG3 is shown in Fig. 16. Based on this analysis, the protein is 99%) monomer and has the mobility corresponding to the molecular weight of 150 kD.
- IgG3 and 25 ⁇ g/ml of PV1 at 4° C for 30 mm washed 2 times with PBS, stamed with FITC-conjugated donkey anti-mouse IgG (H+L), washed, and analyzed by FACScan To control for nonspecific bmdmg o the secondary antibodies to PV1, EL4 cells were stamed with excess PV1 without PVl-IgG3 and analyzed
- mice T cell staining For mouse T cell staining, BALB/c mouse splenic cells (2 5 x 10 cells/0 2 ml) were stamed with 1 ⁇ g/ml of
- mouse IgG3 isotype control (FLOPC 21) or PVI-IgG3 at 4° C for 30 mm washed with 2 ml of cold PBS, and stamed with 20 ⁇ l of FITC-conjugated 145 2C11 (10 ⁇ g/ml) and 20 ⁇ l of R-PE-conjugated goat anti-mouse IgG3 (10 ⁇ g/ml). After 20 min of incubation at 4° C in the dark, the cells were washed with PBS and analyzed by FACScan.
- PVl Characterization of PVl and PVl-IgG3 by flow cytometry.
- PVl was used to stain CD28-positive T cell line EL4 and analyzed by FACScan. The pattern of staining mdicated that PVl binds EL4 cells at two different sites (Fig. 17A).
- PVl as well as several Armenian hamster anti-murine T cell antibodies (145.2C11, anti-CD3; H57-597, anti-TCR; and UC10-4F10-11, anti-CTLA4) also bind nonspecifically to CD28-negative myeloma cell line NSO (data not shown).
- the Syrian hamster anti-CD28 antibody 37.51 on the other hand, binds specifically to only one site on EL4 cells (Fig.
- PVl in addition to CD28 binding, PVl also binds nonspecifically to other sites, possibly through the carbohydrate/lectin type of interaction. As shown in Fig. 1 C, the chimeric PVl-IgG3 does not contain this nonspecific binding activity.
- the antibody binds EL4 cells in a pattern similar to that of 37.51, and it does not bind to CD28-negative NSO cells (data not shown).
- the nonspecific binding property of PVl lies in the heavy chain constant region of this particular antibody and it is eliminated upon chimerization.
- the inhibition by PVl-IgG3 was less than that by PVl, and we interpreted these data as PVl-IgG3 competed with R-PE- conjugated PVl for the CD28 sites but not for the nonspecific sites.
- both 145.2C1 l(Armenian hamster anti-murine CD3) and the chimeric 145.2C1 l-IgG3 prevented R-PE-conjugated 145.2C11 from binding to EL4 cells (Fig. 18B), but the chimeric antibody is less efficient due to its inability to eliminate R-PE-
- PVl-IgG3 was used to stain mouse splenic cells.
- PVl-IgG3-coated splenic cells were specifically recognized by the secondary antibodies R-PE-conjugated goat anti-mouse IgG3.
- FITC- conjugated 145.2C11 was also added to splenic cells to label CD3-positive cells.
- PVl-IgG3 specifically stained CD3-positive cells, but not CD3-negative cells (Fig. 19B).
- Mouse IgG3 isotype control did not stain the CD3-positive cells (Fig. 19A).
- the chimeric PVl-IgG3 reco nizes an antigen that is expressed on murine T cells, an antigen binding activity that is consistent with an anti-CD28 antibody.
- mice were immunized intradermally at the base ofthe tail with 125 ⁇ g of bovine CII (Collagen Gijutsu).
- Kenkyukai, Japan emulsified with an equal volume of CFA (Wako, Japan).
- Mice were boosted by intradermal injection with 125 ⁇ g of bovine CII in CFA on day 21.
- Mice were treated anti-CD28 antibody (PVl-IgG3) at the dose of lmg/kg/day continuous infusion via osmotic pump for 7days after the initial immunization.
- Arthritis development was checked by inspection of four paws on day 11 after the second immunization, and the inflammation of four paws was graded from 0 to 3 as described previously (Tada, Y., A. Ho, D.-R. Koh, T. W.
- mice were immunized with bovine CII, and observed for development of arthritis. At day 11 after the second immunization, arthritis index was significantly reduced in mice treated with anti-CD28 antibody (0.63 ⁇ 0.50) (PO.01) versus control (7.50 ⁇ 0.66).
- mice Female BALB/c and C3H mice were obtained from Charles River Japan, Inc. (Yokohama, Japan). Animals were all housed in a specific pathogen-free facility in microisolator cages with filtered air and free access to food and water. All mice were 6-8 wk of age when experiments were initiated.
- Antibodies Anti-mouse silent CD28 (PVl-IgG3) has identical specificity to that of PV-1 clone but it does not have strong agonistic activity in vitro (Fc ⁇ IgG3).
- Anti-mouse CD154 (TRAPl, IgGl) was purchased fromBD PharMingen (San Diego, CA).
- CTLA4-Ig (CTLA-4 Fc Chimera) was purchased from Genzyme (Cambridge, MA).
- Tail-Skin transplantation Full thickness skin grafts (0.5 cm2) from tail of donor mice(BALB/c:H-2d) were transplanted on the dorsal thorax of recipient mice(C3H:H-2b) and secured with a band-aid for 7 days. Graft survival was then followed by daily visual inspection. Rejection was defined as the >80% loss of viable epidermal graft tissue. Statistical analyses were performed using a Dunnett's Multiple Comparison test. Values of p ⁇ 0.05 were considered significant.
- Anti-human CD28 antibody was prepared with the same method as that of Fab fragment except for the concentration of cysteine (1.15mM) and the period of incubation (one over night).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Surgery (AREA)
- Transplantation (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US25515500P | 2000-12-14 | 2000-12-14 | |
| US255155P | 2000-12-14 | ||
| PCT/US2001/047955 WO2002047721A1 (en) | 2000-12-14 | 2001-12-14 | Silensed anti-cd28 antibodies and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1341553A1 true EP1341553A1 (en) | 2003-09-10 |
| EP1341553A4 EP1341553A4 (en) | 2004-07-28 |
Family
ID=22967074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01995504A Withdrawn EP1341553A4 (en) | 2000-12-14 | 2001-12-14 | Silensed anti-cd28 antibodies and use thereof |
Country Status (18)
| Country | Link |
|---|---|
| EP (1) | EP1341553A4 (en) |
| JP (1) | JP2004515243A (en) |
| KR (1) | KR20040020866A (en) |
| CN (1) | CN1272345C (en) |
| AR (1) | AR031924A1 (en) |
| AU (2) | AU2002226086C1 (en) |
| BR (1) | BR0116686A (en) |
| CA (1) | CA2432736A1 (en) |
| CZ (1) | CZ20031909A3 (en) |
| HU (1) | HUP0400697A3 (en) |
| IL (1) | IL156262A0 (en) |
| MX (1) | MXPA03005327A (en) |
| NO (1) | NO20032542L (en) |
| NZ (1) | NZ526569A (en) |
| PL (1) | PL363239A1 (en) |
| RU (1) | RU2261723C2 (en) |
| WO (1) | WO2002047721A1 (en) |
| ZA (1) | ZA200305384B (en) |
Families Citing this family (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080095774A1 (en) * | 2001-02-16 | 2008-04-24 | Wyeth | Agents and Methods for Specifically Blocking CD28-Mediated Signaling |
| WO2002066059A2 (en) | 2001-02-16 | 2002-08-29 | Genetics Institute, Llc | Agents that specifically block cd28-mediated signaling and uses therefor |
| BRPI0611901A2 (en) | 2005-06-14 | 2012-08-28 | Amgen, Inc | composition, lyophilized kit and process for preparing a composition |
| FR2951176A1 (en) | 2009-10-09 | 2011-04-15 | Tcl Pharma | MONOVALENT LIGANDS OF THE HUMAN CD28 RECEPTOR |
| LT2536764T (en) * | 2010-02-18 | 2018-10-25 | Ose Immunotherapeutics | Anti-cd28 humanized antibodies |
| PT3528787T (en) | 2016-10-21 | 2026-03-11 | Amgen Inc | Pharmaceutical formulations and methods for producing them. |
| KR20210035805A (en) | 2018-06-15 | 2021-04-01 | 플래그쉽 파이어니어링 이노베이션스 브이, 인크. | Increased immune activity through regulation of postcellular signaling factors |
| CA3130348A1 (en) * | 2019-03-14 | 2020-09-17 | Motti HAKIM | A method for immunosuppression |
| WO2020227159A2 (en) | 2019-05-03 | 2020-11-12 | Flagship Pioneering Innovations V, Inc. | Methods of modulating immune activity |
| JP2023509803A (en) | 2019-12-02 | 2023-03-09 | ビオンド バイオロジクス リミテッド | Use of MMP Suppression |
| US20230114107A1 (en) | 2019-12-17 | 2023-04-13 | Flagship Pioneering Innovations V, Inc. | Combination anti-cancer therapies with inducers of iron-dependent cellular disassembly |
| US20230355804A1 (en) | 2020-06-29 | 2023-11-09 | Flagship Pioneering Innovations V, Inc. | Viruses engineered to promote thanotransmission and their use in treating cancer |
| CA3192204A1 (en) | 2020-08-19 | 2022-02-24 | Xencor, Inc. | Anti-cd28 and/or anti-b7h3 compositions |
| EP4313109A1 (en) | 2021-03-31 | 2024-02-07 | Flagship Pioneering Innovations V, Inc. | Thanotransmission polypeptides and their use in treating cancer |
| AU2022303363A1 (en) | 2021-06-29 | 2024-01-18 | Flagship Pioneering Innovations V, Inc. | Immune cells engineered to promote thanotransmission and uses thereof |
| US12365743B2 (en) | 2022-02-23 | 2025-07-22 | Xencor, Inc. | Anti-CD28 x anti-PSMA antibodies |
| WO2024040194A1 (en) | 2022-08-17 | 2024-02-22 | Capstan Therapeutics, Inc. | Conditioning for in vivo immune cell engineering |
| US20240174732A1 (en) | 2022-10-05 | 2024-05-30 | Flagship Pioneering Innovations V, Inc. | Nucleic acid molecules encoding trif and additional polypeptides and their use in treating cancer |
| WO2024148336A1 (en) * | 2023-01-06 | 2024-07-11 | Igm Biosciences, Inc. | T cell costimulatory multimeric binding molecules and uses thereof |
| WO2024151687A1 (en) | 2023-01-09 | 2024-07-18 | Flagship Pioneering Innovations V, Inc. | Genetic switches and their use in treating cancer |
| AU2024279278A1 (en) | 2023-05-31 | 2025-12-18 | Capstan Therapeutics, Inc. | Lipid nanoparticle formulations and compositions |
| US20250127728A1 (en) | 2023-10-05 | 2025-04-24 | Capstan Therapeutics, Inc. | Constrained Ionizable Cationic Lipids and Lipid Nanoparticles |
| WO2025076113A1 (en) | 2023-10-05 | 2025-04-10 | Capstan Therapeutics, Inc. | Ionizable cationic lipids with conserved spacing and lipid nanoparticles |
| US20250302763A1 (en) | 2024-02-22 | 2025-10-02 | Capstan Therapeutics, Inc. | Immune engineering amplification |
| WO2025217452A1 (en) | 2024-04-11 | 2025-10-16 | Capstan Therapeutics, Inc. | Constrained ionizable cationic lipids and lipid nanoparticles |
| WO2025217454A2 (en) | 2024-04-11 | 2025-10-16 | Capstan Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6641809B1 (en) * | 1990-03-26 | 2003-11-04 | Bristol-Myers Squibb Company | Method of regulating cellular processes mediated by B7 and CD28 |
-
2001
- 2001-12-14 KR KR10-2003-7007798A patent/KR20040020866A/en not_active Ceased
- 2001-12-14 AR ARP010105828A patent/AR031924A1/en unknown
- 2001-12-14 EP EP01995504A patent/EP1341553A4/en not_active Withdrawn
- 2001-12-14 NZ NZ526569A patent/NZ526569A/en unknown
- 2001-12-14 RU RU2003121231/15A patent/RU2261723C2/en not_active IP Right Cessation
- 2001-12-14 CZ CZ20031909A patent/CZ20031909A3/en unknown
- 2001-12-14 AU AU2002226086A patent/AU2002226086C1/en not_active Ceased
- 2001-12-14 HU HU0400697A patent/HUP0400697A3/en unknown
- 2001-12-14 MX MXPA03005327A patent/MXPA03005327A/en unknown
- 2001-12-14 AU AU2608602A patent/AU2608602A/en active Pending
- 2001-12-14 PL PL01363239A patent/PL363239A1/en not_active Application Discontinuation
- 2001-12-14 WO PCT/US2001/047955 patent/WO2002047721A1/en not_active Ceased
- 2001-12-14 IL IL15626201A patent/IL156262A0/en unknown
- 2001-12-14 CN CNB018226361A patent/CN1272345C/en not_active Expired - Fee Related
- 2001-12-14 CA CA002432736A patent/CA2432736A1/en not_active Abandoned
- 2001-12-14 JP JP2002549291A patent/JP2004515243A/en not_active Withdrawn
- 2001-12-14 BR BR0116686-7A patent/BR0116686A/en not_active IP Right Cessation
-
2003
- 2003-06-05 NO NO20032542A patent/NO20032542L/en not_active Application Discontinuation
- 2003-07-11 ZA ZA200305384A patent/ZA200305384B/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| CA2432736A1 (en) | 2002-06-20 |
| ZA200305384B (en) | 2004-10-11 |
| HUP0400697A2 (en) | 2004-06-28 |
| AR031924A1 (en) | 2003-10-08 |
| CN1272345C (en) | 2006-08-30 |
| WO2002047721A1 (en) | 2002-06-20 |
| RU2003121231A (en) | 2005-02-10 |
| AU2002226086C1 (en) | 2006-03-09 |
| CN1489473A (en) | 2004-04-14 |
| EP1341553A4 (en) | 2004-07-28 |
| RU2261723C2 (en) | 2005-10-10 |
| CZ20031909A3 (en) | 2003-11-12 |
| AU2002226086B2 (en) | 2005-08-25 |
| NO20032542L (en) | 2003-08-07 |
| PL363239A1 (en) | 2004-11-15 |
| NZ526569A (en) | 2005-07-29 |
| AU2608602A (en) | 2002-06-24 |
| IL156262A0 (en) | 2004-01-04 |
| KR20040020866A (en) | 2004-03-09 |
| HUP0400697A3 (en) | 2007-05-02 |
| JP2004515243A (en) | 2004-05-27 |
| NO20032542D0 (en) | 2003-06-05 |
| MXPA03005327A (en) | 2004-12-03 |
| BR0116686A (en) | 2003-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2002226086C1 (en) | Silensed anti-CD28 antibodies and use thereof | |
| AU2002226086A1 (en) | Silensed anti-CD28 antibodies and use thereof | |
| EP0966485B1 (en) | MUTATED NONACTIVATING IgG2 DOMAINS AND ANTI-CD3 ANTIBODIES INCORPORATING THE SAME | |
| RU2244720C2 (en) | Antibody igg with affinity binding with respect to antigenic complex cd3, recombinant nucleic acids encoding antibody light and heavy chain, method for preparing system, method for preparing antibody, method for treatment of patient | |
| JP4066166B2 (en) | Anti-CD28 antibody | |
| RU2630656C2 (en) | ANTIBODIES AGAINST αβTCR | |
| KR100191152B1 (en) | Cd4 specific recombinant antibody | |
| RU2710354C2 (en) | Combined therapy based on tumour-targeted immunocytokines containing variant il-2, and antibodies to human pd-l1 | |
| RU2375375C2 (en) | Humanised ahth-cd4 antibody with immunosuppressive properties | |
| JP6928971B2 (en) | Monoclonal antibody that antagonizes and inhibits the binding of human PD-1 antigen and its ligand, and its production method and use | |
| JP4448906B2 (en) | CD4-specific antibody TRX1 and uses thereof | |
| JP2006137777A (en) | Bispecific antibody effective to treat b-cell lymphoma and cell line | |
| CZ287347B6 (en) | Humanized antibody, process of its preparation, its use and pharmaceutical preparations based thereon | |
| AU754185B2 (en) | LO-CD2a antibody and uses thereof for inhibiting T cell activation and proliferation | |
| EP3851455B1 (en) | Monoclonal antibody specifically binding human and monkey cd38 antigens, preparation method and use thereof | |
| JP2006519228A (en) | Compositions and methods for tolerizing primates against antigens | |
| MXPA01008098A (en) | Humanized immunoglobulin reactive with b7 molecules and methods of treatment therewith. | |
| US20260042857A1 (en) | Selective targeting of host cd70+ alloreactive cells to prolong allogeneic car t cell persistence | |
| KR20070036138A (en) | Optimal Dose Determination Using Anti-Cd4 Antibodies for Toleration in Primates | |
| US20040116675A1 (en) | Silenced anti-cd28 antibodies and use thereof | |
| JP7278623B2 (en) | ANTI-CD27 ANTIBODY AND USES THEREOF | |
| HK1064943A (en) | Silensed anti-cd28 antibodies and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030610 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| DIN1 | Information on inventor provided before grant (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: FUJISAWA PHARMACEUTICAL CO., LTD. |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: SEKI, NOBU,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: HIGASHI, YASUYUKI,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: TAMURA, KOUICHI,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: VASQUEZ, MAXIMILIANO Inventor name: HINTON, PAUL Inventor name: TSO, J. YUN |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: UEDA, HIROTSUGU,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: SEKI, NOBU,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: HIGASHI, YASUYUKI,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: TAMURA, KOUICHI,C/O FUJISAWA PHARMACEUT.CO.,LTD Inventor name: VASQUEZ, MAXIMILIANO Inventor name: HINTON, PAUL Inventor name: TSO, J. YUN |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/00 B Ipc: 7C 12N 5/10 B Ipc: 7C 12N 15/12 B Ipc: 7C 12N 15/13 B Ipc: 7C 07K 16/28 B Ipc: 7A 61K 39/395 A |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20040614 |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: ASTELLAS PHARMA INC. |
|
| 17Q | First examination report despatched |
Effective date: 20060215 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070623 |