EP1339740A2

EP1339740A2 - Methods and cells for detecting modulators of rgs proteins

Info

Publication number: EP1339740A2
Application number: EP01989139A
Authority: EP
Inventors: Kathleen H. Young; Jian Cao; David Sheuy
Original assignee: Wyeth LLC
Current assignee: Wyeth LLC
Priority date: 2000-12-01
Filing date: 2001-12-03
Publication date: 2003-09-03
Also published as: AU2002243255A1; WO2002050104A3; KR20030081337A; WO2002050104A2; WO2002050104A9; CA2430475A1; JP2004520824A; MXPA03004700A; IL156199A0; CN1478097A

Abstract

This application describes novel cells that respond to a pheromone comrising a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter. The cells may further comprises a heterologous nucleic acid encoding an RGS protein. Also described are methods involving the use of these cells for detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression.

Description

METHODS AND CELLS FOR DETECTING MODULATORS OF RGS PROTEINS

FIELD OF THE INVENTION

This invention relates to novel cells that respond to a pheromone and express a reporter gene operably linked to a pheromone-responsive promoter. In certain embodiments, the reporter is Renilla luciferase, Photinus luciferase, green fluorescent protein, or derivates of green fluorescent protein. In other embodiments, the cells also express a heterologous regulator of G proteins ("RGS protein").

In another embodiment, the invention relates to methods of screening for compounds that modulate RGS proteins, wherein the methods employ the novel cells of the invention.

BACKGROUND OF THE INVENTION

The G protein signaling pathway is one of the most important signaling cascades for relaying extracellular signals, such as neurotransmitters, hormones, odorants, and light. Such pathways have been identified in diverse organisms, including yeast and mammals.

Classically, the system is composed of three major components: G protein-coupled receptors

(GPCRs), heterotrimeric G proteins having , β, and γ subunits, and intracellular effectors

(Gilman, 1987). Recently, the RGS family of proteins has been discovered. RGS proteins provide a mechanism by which cells can fine tune both the duration and the magnitude of a signal generated through the G protein pathways (Kehrl et al., 1999). The present invention is directed to modified host systems that can be used to isolate and characterize novel factors that regulate RGS proteins. Such factors show great potential for controlling and treating diseases resulting from inappropriate activity of G protein signaling pathways.

The G protein signaling pathway commences upon activation of a GPCR, which is characterized by its seven transmembrane domains. When the GPCR is stimulated, its intracellular loops and C-terminal tail interact with an associated G protein (Wieland et al.

1999). The Gα subunit of the G protein then releases guanosine diphosphate (GDP) and

binds guanosine triphosphate (GTP) in its place. The binding of the GTP alters the shape, or

three-dimensional conformation, of the Gα subunit, resulting in the dissociation of the

heterotrimer into a GTP-liganded Gα subunit and a Gβγ dimer. The released subunits are

then free to induce downstream signaling events, ultimately mediating biochemical responses, changes in cellular physiology, or other specific cellular responses. The signaling

is terminated when the Gα subunits hydrolyze GTP, returning to the GDP-bound state,

followed by reassembly with the Gβγ subunits to form the inactive heterotrimers (Kehrl,

1998).

To elicit an appropriate cellular response, the strength of the intracellular signals must be tightly regulated. While there are a number of types of regulation of the system, such as

phosphorylation of GPCRs, receptor binding proteins, and Gβγ-trapping proteins, many

investigators have focused on GTPase activating proteins (GAPs) (see Wieland et al., 1999).

GAPs accelerate the rate of the Gα-GTPase hydrolysis, thereby reducing the signal generated

in the pathway and "desensitizing" the system. (DeVries et al., 1999).

RGS proteins represent a relatively new class of GAPs. The first member of the family was obtained from the yeast Saccharomyces cerevisiae (Dohlman et al., 1996; Weiland et al., 1999). Hapliod mutants were identified that were hypersensitive to pheromone-induced cell cycle aπest, a response mediated by a GPCR pathway. Studies

revealed that a mutated gene product, Sst2, interacted with the G protein Gα-subunit as a

GAP. Thus, Sst2 served as a negative regulator of the system, controlling the maturation of the yeast. Subsequently, many more members of the RGS family have been characterized in a number of species, including over 20 different members in mammals (Zheng et al. 1999). It is hypothesized that the repertoire of RGS proteins is greatly increased by alternative splicing

(Panetta et al., 1999).

In addition to their role as GAPs for activated Gα subunits, RGS proteins have also

been reported to stimulate Gβγ-mediated pathways. Although RGS proteins have a

significantly higher affinity for Gα-GTP, RGS proteins have a low affinity for Gα-GDP.

When RGS proteins bind to Gα-GDP, Gβγ proteins remain free to mediate downstream

events (see Panetta et al., 1999). Thus, RGS proteins may be critical in regulating G protein signaling pathways in more than one way.

Because of the size of the RGS family and the crucial role of RGS proteins in regulating G protein signaling pathways, scientists have begun to study how individual RGS proteins achieve their specificity. One level of specificity results from the expression pattern of different RGS proteins; some RGS proteins are expressed in particular tissues while some are expressed ubiquitously (Zheng et al., 1999; Panetta et al., 1999). It is also suspected that

different RGS proteins may have differing specificity for individual Gα-subunits (Kehrl et

al., 1998). This would enable certain RGS proteins to preferentially modulate certain G protein signal pathways over others (Zheng et al., 1999), or bias a dual G alpha response from a single GPCR.

Control of G protein signaling pathways may also be achieved through modulation of

RGS protein concentration or activity. For example, transcription of RGS protein-encoding genes may be altered through biochemical feedback mechanisms (see Panetta et al., 1999).

Platelet-activated factor has been shown to trigger RGS1 expression in B cells, while RGS 16 expression is induced by carbachol. Conversely, RGS4 expression is down-regulated in response to intracellular cAMP levels. Many cell-based research platforms link the desired effect of a gene or drag of interest to a change in cell phenotype through the use of reporter genes. In yeast systems, for example, reporter genes have commonly focused on auxotrophy genes for cell growth on selective media, or the LacZ gene for colorometric endpoint using assays that detect β-galactosidase activity. The gene encoding luciferase, for example, from Renilla reniformis or Photinus pyr alls, is also useful as a reporter gene in yeast. Luciferase reporters provide increases in assay sensitivity, speed, ease, signahnoise ratios, and provide high quality quantitative data to yeast-based assays for a myriad of target identification and drag discovery applications. Use of the luciferase reporter gene in yeast provides substantial improvements to yeast-based assays such as assays for modulators of RGS proteins.

In one embodiment, the instant invention is directed to methods for the identification of compounds capable of regulating RGS proteins, for example, compounds that directly or indirectly interact with the RGS proteins themselves. Clues to such factors can be found in the literature. For example, both RGS3 and RGS 12 have regions predicted to assume a coiled coil structure; such domains often mediate interactions with proteins of the cellular cytoskeleton (Kehrl et al., 1999). This may allow RGS proteins to fluctuate between membrane-associated and cytosolic pools, thus altering the availability of the RGS proteins at

a given time and/or influencing the type of Gα-subunit the RGS protein modulates (DeVries

et al, 1999). The novel modified cells of the invention, and the novel methods incorporating these cells provide a significant advance for detecting substances that affect RGS proteins. At this time, no one has developed an efficient and specific screening system to systematically detect compounds that are capable of regulating RGS activity. Such compounds are of great therapeutic value, as they could potentially modulate one or more of hundreds of G protein patiiways that mediate a vast aπay of biological processes and underlie several diseases. In addition, pharmacologists estimate that up to 60% of all medicines used today exert their effects through G protein signaling pathways (Roush, 1996). By uncovering new factors that regulate these systems, the phenomenon of drug tolerance associated with many of these medicines may be countered.

SUMMARY OF THE INVENTION In one aspect, the invention is directed to a cell that responds to a pheromone comprising a heterologous nucleic acid encoding a suitable reporter operably linked to a pheromone-responsive promoter, wherein the reporter is, for example, Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein. The cell may be a mammalian cell or a yeast cell. In particular embodiments, the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris, preferably Saccharomyces cerevisiae.

The heterologous nucleic acid encoding the promoter may be contained on a vector, for example, a plasmid. In alternative embodiments, the heterologous nucleic acid is integrated into the cell's genome.

For certain embodiments, the pheromone-responsive promoter is LUC1, FUS1, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FAR1, AGA1, AGA2, AGαl, GPA1, STE2, STE3, STE6, MFA1, MFA2, MFαl, MFα2, CIK1, or BAR1. In another aspect, the cells of the invention may further comprise a heterologous nucleic acid encoding an RGS protein. The RGS protein may lack a G gamma-like ("GGL") or disheveled EGL-10 pleckstrin ("DEP") domain. In alternative embodiments, the cell will further comprise an endogenous nucleic acid encoding a native RGS protein coπesponding to a heterologous RGS protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS protein. The mutation is either or each of a deletion, insertion, or substitution.

Any RGS protein is suitable for use in the invention, including RGSZ1, RGSZ2, Ret- RGS1, RGSl, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGSl 1, RGS12, RGS13, RGS14, RGS16, RGS-PXl, GAIP, Axin, Conductin, egl-10, eat-16, pi 15RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain. Where the protein contains an RGS-like (RGL) domain, that domain may be PLCB or gamma subunit of cGMP PDE. Preferably, the RGS protein is RGS2, RGS4, RGS6, RGSl 1, or RGSZ. In some embodiments, the RGS protein lacks a GGL or DEP domain. In some embodiments the cell will further comprise a heterologous nucleic acid encoding Gbeta5. In a particular, embodiment, the Gbeta5 is human.

In certain embodiments, the RGS protein is a chimera. The chimera may comprise an N-terminus of RGS4 and a C-terminus of RGS7, anN-terminus of RGS7 and a C-terminus of RGS4, anN-terminus of RGS4 and a complete RGS 10, anN-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N- terminus of RGS4 and a C-terminus of RGS 9 having a GGL domain, and anN-terminus of RGS4 and the RGS domain of axin, or portions thereof.

In particular embodiments, the N-terminus of RGS4 comprises amino acids 1-57 of RGS4, the C-terminus of RGS7 comprises amino acids 255-470 of RGS7 the N- terminus of RGS7 comprises amino acids 1-332 of RGS7, the C-terminus of RGS4 comprises amino acids 58-206 of RGS4, and the axin RGS domain comprises amino acids 199-345 of axin.

The invention includes cells comprising a heterologous nucleic acid encoding a chimeric RGS protein, such as those described above. The cell may be a mammalian cell or a yeast cell. In particular embodiments, the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyce pombe, or Pichia pastoris, preferably Saccharomyces cerevisiae.

The heterologous nucleic acid encoding the chimeric RGS protein may be contained on a vector, for example, a plasmid. In alternative embodiments, the heterologous nucleic acid is integrated into the cell's genome.

Another aspect of the invention relates to an isolated nucleic acid encoding a chimeric RGS protein. The chimeric RGS protein may be any of those discussed above. The isolated nucleic acid may be inserted into a vector, such as a plasmid or a virus. The plasmid may be a low copy number plasmid. In yet another aspect, the invention is a method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:

(a) providing at least one first cell that responds to a pheromone, wherein the first cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal;

(b) , providing at least one second cell that responds to a pheromone, wherein the second cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS protein;

(b) incubating a test sample with the first and second cells in the presence of a pheromone under conditions suitable to detect the measurable signal;

(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter; and (d) comparing the level of expression in the first and second cells, wherein a difference in the level of expression indicates that the test sample alters RGS protein- mediated reporter gene expression.

To cany out the method of the invention, any suitable cell of the invention, such as those described above, may be used.

In one embodiment, the method may be performed using the test sample at a single concentration, or, alternatively, the test sample is used in a range of concentrations.

In performing the methods of the invention, detection of the level of expression of the reporter gene maybe accomplished using any suitable method known in the art. In certain embodiments, detection of the reporter gene is accomplished using a halo assay. In alternative embodiments, the level of expression of the reporter is detected spectrophotometrically. Detection may be automated, thereby increasing the utility of the invention for screening test compounds on a large scale.

In a different aspect, the invention is a method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:

(a) providing at least two aliquots of a cell that responds to a pheromone, wherein the cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS protein;

(b) incubating the aliquots of cells in the presence of a pheromone under conditions suitable to detect the measurable signal, wherein one of the aliquots contains a test sample;

(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter in the aliquots; and (d) comparing the level of expression of the reporter in the aliquots, wherein a difference in the level of expression between the aliquots indicates that the test sample alters RGS protein-mediated reporter gene expression.

To carry out the method of the invention, any suitable cell of the invention, such as those described above, may be used.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1 depicts halo assays for yeast with plasmids comprising RGS4 constructs. Yeast derived from strains KYI 03 and KYI 13 are shown.

FIGURE 2 A shows that yeast with the RGS4 and FUSl-lacZ constructs exhibit a marked attenuation of pheromone-induced growth when compared to control strains lacking the RGS4 construct in a strain derived from KYI 03.

FIGURE 2B shows that yeast with the RGS4 and FUSl-lacZ constructs show a marked attenuation of pheromone-induced growth when compared to control strains lacking the RGS4 construct in a strain derived from KYI 13. FIGURE 3 shows that a yeast strain (KYI 17) with the RGS4 and FUSl -luciferase constructs exhibits an attenuated level of luminescence in the presence of alpha factor when compared to a control strain lacking the RGS4 construct (KYI 18).

FIGURE 4A depicts dose response curves of luminescence in response to alpha factor in cells containing RGS4 and FUSl -luciferase constracts and a control strain lacking an RGS4 construct. Both strains are derived from KYI 03.

FIGURE 4B depicts dose response curves of luminescence in response to alpha factor in cells containing RGS4 and FUSl -luciferase constructs and control strain lacking an RGS4 construct. Both strains are derived from KYI 13. FIGURE 5 depicts a schematic of the yeast pheromone-based assay for screening compounds as RGS blockers.

FIGURES 6A-C shows single dose assays for 96 compounds as a screen for compounds that interfere with RGS4-mediated attenuation of luminescence. Figure 6A shows the effect of the compounds in a yeast strain expressing RGS4. Figure 6B shows the effect of the compounds in a yeast strain having a control vector lacking the RGS4 sequence. Figure 6C shows the fold difference between the RGS4-expressing and control yeast strains.

FIGURES 7A-D shows dose response curves for test compounds SBQ7/D1, SBQ8/B1, CL485, and CL744, respectively. For each compound, figures showing the original counts per second, fold difference between strains, and fold difference within a strain are provided.

FIGURE 8 shows that yeast strains expressing RGSZ1 demonstrated smaller halos and decreased luminescence than control yeast strains expressing an empty vector, indicating complementation of sst2 in yeast. Also shown are the results of halo assays for yeast strains expressing RGS2, RGS7, and RGS9. FIGURES 9 -D show dose response curves for test yeast strains expressing RGSZ1, RGS2, RGS7, and RGS9, respectively, compared to control yeast strains expressing an empty vector in response to varying concentrations of alpha factor.

FIGURE 10 shows the results of halo assays for yeast strains co-expressing RGS9 and hGbeta5.

FIGURE 11 shows the results of halo assays for yeast strains co-expressing RGS 7 and hGbeta5.

FIGURE 12 shows the results of luciferase assays for chimeric RGS4/RGS10, RGS4, RGS 10, RGS7, RGS9, RGS6, and RGSl 1. FIGURE 13 shows the results of luciferase assays for RGS7, chimeric

RGS7(ggl)/RGS4, chimeric RGS4/RGS7(ggl) 4/RGS10, RGS4, RGS 10, RGS7, RGS9, RGS6, and RGSl 1.

DETAILED DESCRIPTION OF THE INVENTION The modified cells of this invention employ a host cell. An effective host cell for use in the present invention simply requires that it is defined genetically in order to engineer the appropriate expression of a pheromone-responsive promoter linked to a reporter(s), optionally an exogenous RGS protein, and any other desired genetic manipulations. The host cell can be any cell, such as a eukaryotic or prokaryotic cell, for example, a mammalian cell, capable of responding to a pheromone or other compound that serves as a ligand for a GPCR. The cell may naturally respond to the pheromones or other compounds or may be genetically engineered to respond to them. Preferably, the host cell is a fungal cell, for example, a member of the genera Aspergillus or Neuropora. In more prefeπed embodiments, the host cell is a yeast cell. In alternative prefeπed embodiments the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe or Pichia pastor is. The cell of the invention employs at least one construct comprising a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal. Preferably, the heterologous nucleic acid is contained on a vector, such as a plasmid, although, alternatively, the nucleic acid may be integrated into the cell' s chromosome.

In certain embodiments the host cell further comprises an exogenous RGS protein. In prefeπed embodiments, the endogenous RGS protein in the host cell is mutated. Upon treatment with a pheromone, such as alpha factor, the pheromone sensitive-promoter is activated, resulting in expression of the reporter gene. Expression of a functional RGS protein inhibits activation of the pheromone-responsive promoter, resulting in a decrease in the expression of the reporter gene. The presence of a compound that inhibits RGS protein activity results in an increase in expression of the reporter gene.

Heterologous nucleic acid sequences are expressed in a cell by means of, for example, an expression vector or plasmid. An expression vector or plasmid is a replicable DNA construct in which a heterologous nucleic acid is operably linked to one or more suitable control sequences capable of affecting the expression of the reproter protein or protein subunit coded for by the heterologous nucleic acid sequence in the intended host cell. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation.

In addition to plasmids, vectors useful for practicing the invention include viruses, and integrable DNA fragments such as insertion sequences and transposons that integrate into the host genome by genetic recombination. Viral vectors suitable for use in the invention include adenoviras, adeno-associated virus, herpes simplex virus, rous sarcoma virus, lentivirus, and sindbis virus. The vector may replicate and function independently of the host genome, as in the case of a plasmid, or may integrate into the genome itself, as in the case of an integrable DNA fragment, such as, for example, an insertion sequence or transposon. Suitable vectors will contain replication and control sequences that are derived from species compatible with the intended host cell. For example, a promoter operable in a host cell is one that binds the RNA polymerase of that cell. Suitable replication and control sequences are well known to those of skill in the art.

Nucleic acids are operably associated with a control sequence when they are functionally related to each other. For example, a promoter is operably linked to a nucleic acid if it controls the transcription of the nucleic acid. A ribosome binding site is operably linked to a nucleic acid if it is positioned so as to permit translation.

The pheromone-responsive promoter and the ligand used can vary widely as long as their specific interaction are known or can be deduced by available scientific methods. Any of a variety of naturally occurring pheromone-responsive promoters, or synthetic pheromone- response element, or other pheromone-response-element-containing-gene could be used. Preferably, the pheromone-responsive promoter is from FUSl, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FAR1, AGA1, AGA2, AGαl, GPA1, STE2, STE3, STE6, MFA1, MFA2, MFαl, MFα2, CIK1, LUC1, BAR1, or an omega element.

Preferably, the pheromone used in the invention is alpha factor, a factor, or an M pheromone, although any pheromone or functional component that initiates changes in a yeast cell associated with the mating process (such as morphological changes, agglutiniation, morphogenesis, cell fusion, nuclear fusion, and so forth) is suitable for use in this invention.

As used herein, "heterologous" refers to nucleic acids, proteins, and other material originating from organisms other than the cell of the invention, or combinations thereof not naturally found in the cells of the invention. This term also refers to nucleic acid that originates from the same organism as the cell of the invention, but which has been modified in any way relative to the coπesponding endogenous sequence.

Any G protein-coupled receptor system may be employed in practicing this invention. Examples of such receptor systems include, but are not limited to, those related to adenosine receptors, somatostatin receptors, dopamine receptors, cholecystokinin receptors, muscarinic cholinergic receptors, α-adrenergic receptors, β-adrenergic receptors, opiate receptors, cannabinoid receptors, histamine receptors, growth hormone releasing factor receptors, glucagon receptors, serotonin receptors, vasopressin receptors, melanocortin receptors, and neurotensin receptors.

The reporter gene is generally selected in order that the interaction between binding of the ligand to its GPCR and the pheromone-responsive promoter can be monitored by well- known and straightforward techniques. Preferably, the reporter gene is selected based on its cost, ease of measuring its activity and low background. That is, the activity can be determined at relatively low levels of expression of the reporter gene because of a high signal to background ratio and/or a relatively low or no uninduced activity. The reporter can be any reporter for which its activity can be detected by any means available. Illustrative of reporters that can be used in the present invention are luciferase genes, green fluorescent protein genes, derivatives of green fluorescent protein genes, or CAT. Preferably, the activity of the reporter is indicated by colorimetric or fluorescent methods.

In a prefeπed embodiment, the reporter gene is a luciferase gene, for example, a luciferase gene from Renilla reniformis or Photinus pyralis. Luciferase genes from other organisms are also well known to those of skill in the art. A significant advantage confeπed by the use of the luciferase reporter gene is that it enables a liquid assay that is rapid, thereby permitting high through-put screening of test samples. Additionally, use of the luciferase reporter in yeast provides enhanced assay sensitivity, enables gathering of quantitative data, and allows assay automation, especially for higher through-put (384 well) assay formats. The short assay time adds utility in drug screening applications in avoiding compound toxicity effects due to long (48+ hours) incubation times presently needed for standard auxotrophic (HIS3, LYS2, URA3) reporters or counter selection (CAN1, URA3, CYH2) reporters, both of which require cell growth for endpoint determinations. Illustrative of RGS proteins which can be used in this invention are proteins containing an RGS domain such as RGSZl, RGSZ2, Ret-RGSl, RGSl, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14, RGS16, RGS-PXl, GAIP, Axin, Conductin, egl-10, eat-16, pl l5RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain, for example, PLCB, gamma subunit of cGMP PDE.

Both 2 micron and low copy number (CEN) versions of pheromone-responsive promoter-reporter gene constracts can be made to enable further control over reporter gene function or assay sensitivity by manipulation of the reporter gene copy number within a cell. Molecular cloning techniques are caπied out using standard methods, for example, those described by Ausubel et al, 1998. Restriction digests are performed as to manufacturers' specifications. Where appropriate to the cloning scheme, cDNA fragments were end-filled to generate blunt ends using Klenow according to standard techniques. Dephosphorylation of cDNA fragments and/or vectors was conducted using Shrimp Alkaline Phosphatase (SAP) according to manufacturers' instructions (Boehringer Manheim or Amersham Life Science). Ligation reactions were conducted using standard techniques, and recombinant vectors were transformed into Escherichia coli DH5 alpha cells and plated on LB-agar plates containing appropriate antibiotic(s). Colonies were recovered and plasmid DNA prepared using either DNA midi prep kits, or automated DNA preparation (Qiagen). Integrity of plasmids and cloning strategies were confirmed using reagents from Perkin- Elmer, and automated sequencing equipment from ABI. Yeast strains were transformed using a Lithium Acetate procedure and plated on appropriate media (Rose et al., 1990). All yeast media and reagents were prepared using standard methods.

The novel modified cells of this invention are readily applied in various screening methods for determining the expression of the reporter gene in the presence of test compounds. The screening methods of this invention are designed to detect compounds that interact with the ability of the RGS protein to modify the G protein response pathway as determined by an alteration in the activity of the reporter gene. The test compound may be a peptide, which is preferably about two amino acids in length, or a non-peptide chemical compound. The non-peptide test compounds includes compounds, complexes and salts as well as natural product samples, such as plant extracts, tissue extracts, and materials obtained from fermentation broths.

In a prefeπed embodiment of the invention, cells were developed in which RGS activity can be monitored. In one example, the luciferase gene was linked to a pheromone- responsive promoter, FUSl. This FUSl -luciferase reporter gene was expressed in a yeast cell in which the endogenous RGS protein, Sst2, was deleted or expressed in a yeast strain wherein the endogenous sst2 gene contains a mutation rendering it functionally equivalent to a ssύ deleted strain. In the "test" cells, a plasmid was added expressing the mammalian RGS4 protein, while "control" cells were transfected with plasmids lacking the RGS4 gene. The test and control cells were treated with the alpha factor ligand, which binds to the receptor and stimulates the cellular cascade to drive the FUSl promoter and expression of the luciferase reporter gene. In the control strain, a high level of luciferase was expressed, resulting in strong luminescence in the presence of the substrate. Conversely, the yeast strain containing the RGS4, which negatively regulates the signal cascade, demonstrated a greatly diminished activity of the FUSl -luciferase reporter gene. These findings coπelated with previous findings using other reporters such as β-gal activity or auxotrophic markers. These yeast cells can be used in a number of ways to investigate or discover factors that interact with RGS proteins. For example, a test compound can be added to the test strain containing the vector expressing the RGS4 protein. If the factor interacts with the RGS4 protein, it will block or enhance the RGS4 protein function, thus affecting the RGS protein ability to negatively regulate the signal induced from alpha factor/receptor interaction. The alpha factor signal stimulation will then be available (prolonged in its ability) to reduce expression of the reporter gene, resulting in a high level of luminescence. Alternatively, a compound that enhances RGS function will reduce reporter gene expression. Compounds that demonstrate an increase in luciferase activity within the test (RGS4-expressing) strain in comparison to the control strain are considered to be potential drug candidates. Compounds that result in an increase in luciferase activity in the test strain of approximately 50% (or some other suitably determined percentage) over that seen for a vector control cell can be tested in a dose response assay.

These types of RGS assays show great potential in drug discovery. They are very sensitive, have a short testing period, and are ideal for high through-put systems used in large scale drag discovery. In addition, the luciferase-RGS assay may be used to identify ligands for orphan G-protein receptors, and could be used to study or screen other members in G-protein pathways, such as kinases.

The following Examples are provided to further illustrate various aspects of the present invention. They are not to be construed as limiting the invention.

Example 1. FUSl-LacZ reporter RGS assay:

Stimulation of the GPCR receptor by alpha factor in yeast is well characterized (see Dohlman et al., 1996). Stimulation of this pathway usually results in yeast cell cycle arrest. This signaling pathway is controlled by an endogenous RGS protein, Sst2, which functions as a negative regulator of GPCR signaling. The RGS protein acts to accelerate the endogenous

GTPase activity of the Gα-subunit. Deletion of the gene encoding Sst2 in yeast results in

yeast cells that are supersensitive to the ligand, since the ability to turn off the GPCR signal is impaired. A mammalian RGS protein, RGS4, can functionally complement for Sst2 in yeast. In the present experiment, reporter gene activity was measured in yeast strains deleted for sst2 in the presence or absence of the mammalian RGS4 protein. In this assay, we tested whether the RGS4 protein could modulate the alpha-factor-induced pheromone-response pathway leading to activation of pheromone-responsive genes. A lacZ gene was operably linked downstream to the pheromone-responsive promoter (FUSl-lacZ reporter gene) and expressed in a cell, such as a MATa cell, capable of responding to the pheromone alpha factor.

A plasmid (Kp27) comprising the FUS-1 promoter and the LacZ reporter gene was prepared. This plasmid was generated by digestion of pRS424 plasmid [Stratagene] with Xho and Eagl. The FUSl -promoter region (GenBank Ml 6717) was generated as a 1.095kb EcoRI-Sα/I fragment while the β-galactosidase gene (GenBank CVU89671) was generated as a 3.0kb SaR-Eagl fragment. A three-way, directional ligation was conducted between the prepared pRS424 vector, the FUSl fragment and the β-galactosidase fragment using standard methods to generate plasmid Kp27. Recombinant DNA was transformed into E. coli and DNA from selected transformants was prepared by standard methods. The Kp27 construct was confirmed by restriction digests and sequence analysis.

We also prepared plasmid constructs encoding the RGS4 protein. The cDNA encoding full-length rat RGS4 (Genbank AF117211) was obtained by PCR using plasmid pWΕ2RGS4 as a template (Shuey et al, 1997) with the following primers:

Kxl3(forward):

5'-GACGTCTCCCATGTGCAAAGGACTCG (SEQ ID NO: 1) which contains an embedded BsmBΪ site and part of a Nco sequence; and

Kx41 (reverse):

5'-CGGGATCCTTATTAGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 2) which contains an extra stop codon and the embedded R HI site. To construct a hemagglutinin-tagged ("HA") RGS4, a different 3 'primer was used which lacks the stop codon, but contains an embedded BamΑl site: Kx42(reverse): 5'-GAGGATCCGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 3)

The PCR products (approximately 650 bp) were digested with BsmBl and BamΑl and ligated to vectors Kp46 or Kp57 for untagged and HA-tagged RGS4 protein expression, respectively. The resultant plasmids Kpl 18 (RGS4-Kp46) and Kpl 19 (RGS4-Kp57) were transformed into bacterial cells. Recombinant DNA was prepared and confirmed by sequence analysis using the following primers:

Kx43 5^<-TTTTTACAGATCATCAAGGA (SEQ ID NO: 4) Kx44 5'-TGCGTCTTCAGAGCGCTTTT (SEQ ID NO: 5)

Kx39 5'-GAGCCAAGAAGAAGTCAAGAAAT (SEQ ID NO: 6)

Kx40 5'-TGGGCTTCATCAAAACAGG (SEQ ID NO: 7)

To generate a yeast strain in which the endogenous RGS protein, SST2, was deleted, a SST2::NEO construct was obtained from LEU marked plasmid pEK139/138 by digestion with-XTz I and Sacl. The resulting 4.0 kb fragment containing the -^,-s^,t2-NEO--s'-s't2 cassette was gel isolated and purified. _jThis cDNA fragment was co-transformed into yeast strain CY770 (MATa leu2-3,l 12 ura3-52 trpl-901 his-200 ade2-101 gal4 gal80 lys2::GALuas-HIS3 cyh^R; Young, et al, 1995) with URA marked pRS416 (Stratagene) to enhance integration. Following transformation, yeast cells were grown in YPD medium and plated on SC-ura media. Resultant URA⁺ yeast colonies were sequentially replica plated onto YPD media containing 50ug/ml, and then with 100 ug/ml G418 (Geneticin from BRL). The G418 resistant CY770 yeast colonies were confirmed by PCR analysis to verify the sst2-^~ EO-sst2 construct integration. The primers used for PCR verification were the following:

Kx24 5'-TATCGAGTCAATGGGGCAGGC (SEQ ID NO 8) Kx25 5'-CGAAACGTGGATTGGTGAAAG (SEQ ID NO 9) Kx26 5 '-ATTCGGCTATGACTGGGCACAAC (SEQ ID NO 10) Kx27 5 ' GTAAAGC ACGAGGAAGCGGTC AG (SEQ ID NO 11)

A 4.2 kb PCR fragment was expected from Kx24 and Kx25 primers for a confirmed knockout strain, while a 4.9 kb PCR product was expected for the wildtype (non-knockout) yeast strain. A 2.6 kb PCR product was expected from Kx24 and Kx27 primers for a confirmed knockout stain, while no PCR product was expected from the wildtype (non knock-out) strain. A 2.4 kb PCR product was expected from Kx25 and Kx26 primers for a confirmed knockout strain while no PCR product was expected from the wildtype (non knock-out) strain.

Following PCR verification, candidate yeast colonies were plated on SC-ura plates to confirm the loss of the pRS416 plasmid used to facilitate integration. To test the ability of the RGS4 protein to complement the loss of the Sst2 protein, G418 resistant, ura-minus colonies were tested for response to alpha factor stimulation using pheromone-response halo assays (Dohlman et al., 1996). Results are depicted in Figures 1, 2A and 2B, which show halo assays and dose curves, respectively, in two yeast backgrounds. One of the tested and

confirmed CY770Δsst (knockout) yeast colonies was designated KY103 (MATa leu2-3,l 12

ura3-52 trρl-901 his-200 ade2-101 gal4 gal80 Lys2::GALuas-HIS3 cyh^R , sst2, G418R). Similarly, yeast strain YPH499 (American Type Culture Collection, Manassas, VA) was deleted for the sst2 gene and designated KYI 13 (MATa ura3-52 lys2-801a ade2-101o trpl- D63 his3-D200 Ieu2-Dl, sst2). Pheromone-responsive yeast test strains were generated using a Li-acetate method

(Rose et al, 1990) and plated on plasmid retention media. Plasmids Kpl 18 (RGS expression plasmid) and Kp27 (FUSl-lacZ reporter plasmid) were transformed into KYI 03. Control yeast strains were prepared by co-transforming empty expression plasmid Kp46, which lacks an RGS-encoding sequence, and reporter plasmid Kpl31 into strain KY103 to generate yeast strain Kyi 16, and into strain KYI 13 to generate strain KYI 18.

To see if the RGS4 protein interfered with pheromone-induced transcription of the β- galactosidase gene, yeast having the RGS4 construct and control yeast having an empty vector were treated with alpha factor (25 nM). Expression of RGS4 in strain KYI 17 desensitized the pheromone-induced LacZ signal (data not shown). Expression of RGS4 also rescued pheromone-induced growth arrest.

Example 2. FUSl-Iuciferase reporter RGS assay:

Example 1 confirmed that a plasmid generated with the desired backbone and pheromone-responsive FUSl promoter operably linked upstream of the LacZ gene could be used to study the activity of an RGS protein. In this experiment, a luciferase gene was linked downstream to the FUSl promoter instead of the lacZ gene. This luciferase system provides certain advantages over the system with the lacZ reporter gene, most notably increased speed and ease of monitoring gene expression.

A FUS-1 reporter plasmid (Kpl 20) comprising a luciferase gene was constructed. The FUS 1-luciferase reporter cassette was constructed by an Ncol-Xba I digestion of plasmid pGL (Promega) to isolate a 1.7 kb fragment containing the firefly luciferase gene. This fragment was blunt ended and purified. The Kp27 vector served as the base vector and was prepared by digestion with BamHl-Notl (to remove the LacZ gene), dephosphorylated, blunt-ended, and purified. The prepared vector and luciferase fragment were ligated to generate plasmid Kpl 20. This cloning scheme resulted in an expected four extra amino acid residues (methionine, alanine, glycine, serine) from the original Kp27 vector that were fused in frame to the N-terminus of the luciferase ORF. The BamHl and Ncol restriction sites were retained. The plasmid Kpl 20 construct was confirmed by DΝA sequencing using primers:

Kx45: 5'-ATATAAGCCATCAAGTTTCTG; and (SEQ ID NO: 12)

Kx46: 5'-CTCACTAAAGGGAACAAAAG (SEQ ID NO: 13)

Plasmid constracts encoding the RGS4 protein and yeast strains in which the endogenous RGS protein (SST2) was deleted were prepared as described in Example 1.

Pheromone-responsive yeast test strains were generated using the Li-acetate method

(Rose et al., 1990) and plated on plasmid retention media. Transformation of plasmids Kp 118 (RGS expression plasmid) and Kp 131 (FUS 1 -luc reporter plasmid) into yeast strain KY103 generated yeast strain KYI 15. Kpl31 was derived from Kpl20. Briefly, the FUS1- luciferase reporter cassette was excised from Kpl 20 using Kpnl and S cl restriction enzymes. The 2.8 kb fragment was gel purified, blunt ended and ligated into pRS416 to generate Kp 131. Kp 118 and Kp 131 were also co-transformed into KY 113 to generate yeast strain KYI 17.

Control yeast strains were prepared by co-transforming empty expression plasmid Kp46 and reporter plasmid Kpl 31 into KYI 03 to generate yeast strain Kyi 16, and into strain KYI 13 to generate strain KYI 18.

To determine if the RGS4 protein interferes with pheromone-induced transcription of the luciferase protein, yeast having the RGS4 constract and control yeast having an empty vector were treated with alpha factor (25 nM). Results using the KYI 13 -based strains KYI 17 (RGS4) and KYI 18 (control) are shown in Figure 3. This figure shows that the RGS4 protein likely interacts with the yeast Gα subunit (Gpalp), causing the alpha factor- induced luciferase signal to decrease. Strong luminescence was seen with the control strains lacking the RGS4 protein. In contrast, weak luminescence was seen in the yeast strain expressing the RGS4 protein. Pheromone-responsive luciferase activity was observed in yeast strains generated from both base yeast strains KYI 03 and KYI 13. However, the response of KYI 13 -based yeast strains was slightly stronger (data not shown) and therefore these strains are more sensitive.

These findings coπelated with the findings set forth in Example 1 , in which we monitored β-gal activity. Dose response curves for the luciferase system, shown in Figures 4A and 4B, reveal that luciferase works as well as lacZ as a reporter gene. Additionally, the luciferase reporter is more sensitive than beta-galactosidase since the fold-increase is higher (data not shown).

Example 3. Low copy version of the FUSl-luciferase reporter.:

As an alternative to the 2um version of the FUSl-luciferase reporter constructs discussed previously, a low copy number (CEN) version of the luciferase construct of Example 2 was made. The CEN version of the pheromone pathway responsive FUSl- luciferase reporter was generated by digestion of plasmid Kpl 20 with Kpnl and Sαcl to isolate a 2.8 kb fragment containing the FUSl promoter and the luciferase gene reporter cassette. Plasmids pRS414 and pRS416 (Stratagene) were each digested with Kpnl and Sαcl and gel purified. Standard ligations were performed to generate two additional FUSl- luciferase recombinant plasmids; Kpl 33 (TRP1 marked) and Kpl35/Kpl31* (URA3 marked). Bacterial transformation and generation of plasmid DNAs were performed by standard methods. Plasmids were confirmed by DNA sequencing. Plasmid Kpl31* represents a similar constract to Kpl 35, but was generated independently using a different cloning scheme.

The CEN versions of the reporter gene were tested in a pheromone response assay. These versions were found to function in the pheromone response assay and to provide a suitable signal-to-noise ratio (data not shown). Example 4. Incorporating alternative reporter genes:

A variety of reporter genes can be used in the system. Illustrative of reporters that can be used in the present invention are reporter genes such as luciferase genes from species other than firefly, green fluorescent protein gene, or CAT. For example, a Renilla luciferase gene reporter can be used as an alternative to a firefly luciferase reporter. To construct these, the open reading frame encoding for Renilla luciferase was cloned into the pheromone- responsive reporter plasmids described in Examples 1 or 2 to generate FUSl-RenLuc. High (2 micron) and low (CEN) copy number plasmids were generated in an analogous manner to that described for firefly luciferase reporter genes.

Example 5. RGS-assay-single point drug screen:

The validated strains described above were used for the identification of small molecules that modulate the activity of the co-expressed mammalian RGS protein. A schematic of the screen is shown in Figure 5. Yeast strains with the RGS expression plasmid and a control strain were used to test for small molecules that modulate the function of RGS4, resulting in an increase in luciferase activity. On the basis of molecular modeling, a subset of molecules in a library of test chemicals was tested in single point assays. Compounds that demonstrated an increase in luciferase activity in the test (RGS4) strain in comparison to the control strain were "positive" and were considered interesting candidates for further study. Specifically, yeast strains containing either the RGS expression plasmid (KYI 17), or the control backbone vector (stain KYI 18) were inoculated into appropriate media (SC-leu- trp) and incubated overnight at 30°C. The cell density of these fresh yeast cultures was determined by OD₆oo and cells were diluted to OD₆₀o of 0.05 in appropriate growth media (SC-leu-trp). 150 μl of cell suspension was seeded into the wells of a 96 well microtitre plate, and approximately 1 μl of stock test compound (lOmg/ml) was transfeπed to individual wells using a replicator.

Test compounds were incubated with the cells for 3 hours at 30°C. The cells were then stimulated with ligand (10 μl alpha factor (200 nM stock in 10X solution) to a final concentration of 20 nM). The plate was shaken briefly and incubated for 2 hours at 30°C. 100 μl LucLite substrate (Packard) was added to each well, and the plate was sealed and shaken at room temperature in the dark for 1 hour. Luminescence was determined using a Top Count (Packard) for 2 seconds.

Results of single dose assays of 96 compounds is shown in Figure 6. Each compound was added to two yeast strains: an RGS4 strain (Fig. 6A) and a control vector strain (Fig. 6B). The difference in luminescence (fold) is calculated as counts per second(RGS)/counts per second(vector) (Fig. 6C). A compound with a fold increase in luminescence higher than the average is considered a candidate as a RGS blocker.

Example 6. RGS-assay-Dose response assay of potential drugs:

Compounds causing an increase in luciferase activity in the test strain of approximately 50% over that seen in the control strain in the single point assay (Example 5) were then tested in a dose response assay.

A yeast strain containing the RGS expression plasmid (KYI 17), and a control yeast stain containing the backbone vector (KYI 18) were inoculated in appropriate media (SC-leu- trp) and incubated overnight at 30°C. The cell density of fresh yeast cultures was determined by OD₆oo and cells were diluted to an OD₆₀o of 0.05 in appropriate growth media (SC-LT). Aliquots of 150 μl of suspended cells were dispensed into Row A of a 96 well microtiter plate. DMSO was added to the remaining yeast cells to a final concentration of 3% and 100 μl of cells was seeded into the remaining wells of the 96 well plate. Test compound (4.5 μl) was added to the cells in Row A, resulting in a final concentration of 900 μM, mixed, and 50 μl was transfeπed from Row A into Row B, and mixed well. Subsequently 50 μl was transfeπed from Row B into Row C, and so forth through Row G to create a serial dilution within a column of the 96 well plate. This established an 8 point dose response curve with all wells containing 3% DMSO.

Cells and test compound were incubated at 30°C for 4 hours, then 10 μl of ligand (alpha factor in 200 nM stock lOx solution) was added to a final concentration of 20 nM. The plate was shaken briefly and incubated for 2 hours at 30°C. 100 μl of LucLite substrate was added to each well, and the plate was sealed and shaken at room temperature in the dark for 1 hour. Luminescence was determined using a Top Count (Packard) for 2 seconds. Results for four test compounds are shown in Figures 7A-D. Compound SBQ8/B1 demonstrated the ability to greatly affect RGS4 function.

Example 7. Functional complementation by additional mammalian RGS proteins. Previously, it had been demonstrated that mammalian RGS4 is able to complement

SST2p to enable S. cerevisiae to recover from alpha factor stimulation that did not result in productive mating. The RGS protein accelerates the endogenous GTPase activity of the yeast G-alpha protein, Gpal. Previous data support only RGS4 as capable of functionally replacing SST2. To investigate the overall utility in using the pheromone-response pathway to investigate the function of mammalian RGS proteins, RGSZl and RGS2 were also expressed in the sst2 knockout strain containing the pheromone-responsive luciferase reporter gene (FUSl -luc) previously described.

General cloning: cDNA encoding the various mammalian RGSZl and RGSZ2 proteins were subcloned into vector p426-TEF (ATCC #87669). This vector [6359 bp, URA3, 2mu- ori, TEFp-CYClt, REP3, AmpR] contains an elongation factor 1 -alpha promoter from S. cerevisiae (see Genbank YSCEF1AB for sequence) and is suggested to be 5 -fold stronger than the ADH promoter (Mumberg et al., Gene, 156:119). Designated cDNA inserts were generated using standard methods for polymerase chain reaction, restriction digests, ligations, and transformation into DH5-alpha E.coli cells. DNA was prepare using Qiagen preps, confirmed by restriction digest, and DNA sequence analysis. The resulting constracts were sequenced at 5'-end junction site. The sequencing primer is Kx65:

5'-TCAGTTTCATTTTTCTTGTTCTAT (SEQ. ID. NO: 14)

This primer hybridizes to the TEF promoter region. Human RGSZl:

RGSZl cDNA was prepared using a 26 bp 5' forward ohgonucleotide primer containing an embedded BAM HI restriction site:

5'-GC ggatocATGGGATCAGAGCGGATG (SEQ. ID. NO: 15) and 27 bp 3' reverse ohgonucleotide primer containing an embedded Clal restriction site and a stop codon:

5'-CG atogattaCTATGCTTCAATAGATT (SEQ. ID. NO: 16).

These primers were used in a standard PCR reaction, using a previously described RGSZl - pACT recombinant vector as template. A 650 bp fragment is obtained that encodes the full- length RGSZl (Genbank AF079479) and contains the endogenous start and stop codons. The PCR product was gel purified, digested with BamHl and Clal restriction enzymes, and ligated into the prepared BamHl and Clal sites of p426TEF. Restriction digest analysis using H cII alone, Sphl alone, or SaR+Sphl, confirms the direction of the cDNA insert. The resulting plasmid, pTEF426-RGSZl, is designated Kpl 40 (also known as pKΗY55) and Kρl41 (also known as pKHY56). Human RGS2:

Human RGS2 cDNA (Genbank NM 002923) was obtained by PCR amplification from a human whole brain library using a 21 bp forward 5' ohgonucleotide primer with an embedded Notl site:

5'-CCAGCGGGAGAACGATAATGC (SEQ. ID. NO: 17) and a 19 bp 3' reverse ohgonucleotide primer with an embedded BamHl site:

5'-CCCCTCAGGAAAAGAATG (SEQ. ID. NO: 18)

The 705 bp PCR product was ligated in the pCRII vector (Invitrogen), to generate pKHY146 (hRGS2-pCRII). pKHY146 was transformed into bacterial cells following vendor instructions, plasmid DNA prepared and sequence confirmed. The hRGS2 cDNA was excised from pKHY146 using Notl and BamHl and subcloned into the prepared Notl and BamHl sites of pcDΝA3.1 (Invitrogen). The resulting recombinant plasmid (hRGS2- pcDNA3.1) is designated pKHY150. The pKHY150 was digested with Pmel and a 650 bp fragment was isolated, gel purified, and used in a blunt end ligation into the prepared Smαl site of p426TEF, to generate the recombinant plasmid hRGS2-pTEF426 and two resulting (sibling) recombinant plasmids designated Kpl 38 (also known as pKHY53) and Kpl 39 (also known as pKHY54). Orientation of the hRGS2 cDNA insert was determined by restriction digest analysis using Pstl or Hindlϊl. Generation of strains: These RGS constructs were transformed into yeast KYI 13 ; the

FUSl-luciferase reporter (Kpl20) was also co-transformed into KYI 13. The resulting yeast strains are designated as follows: Table 1

Three colonies from each yeast transformation were picked and streaked onto SC- Ura-Trp plates. Two of the three colonies were tested in the pheromone-response assay (as

previously described) to measure luciferase reporter gene activity. Briefly, 100 μl of 0.1

OD₆₀₀ overnight culture was stimulated by alpha factor in concentrations of 25 or 225 ng for 2 hours at 30C. The same culture was also subjected to pheromone-response halo assay (as previously described) . Cell lawn (made from 0.3 OD₆₀₀ culture) on SC-Ura-Trp agar plates was stimulated with alpha factor in concentrations of 50 or 250 ng per each spot. The plates were incubated at 30°C for about 40 hours, and then observed for halo formation.

Results:

Results of the halo assay are depicted in Figure 8 and results for the luciferase reporter assay are depicted in Figures 9A and 9B. Yeast strains expressing RGSZl demonstrated smaller halos and decreased luminescence compared to yeast strains expressing the empty vector, thus indicating complementation of -s*-?t2 in yeast. Additional dose response curves and more detailed halo assays (alpha factor at 431, 48, 5.3, or 0.6 ng per spot, or 431, 144, 48, or 16 ng per spot) were done for these strains. Responses from RGSZl -expressing strains were not as robust as that observed previously from strains expressing RGS4. This suggests that RGSZ 1 displays 33 % of the response observed with RGS4 ( 1 /8 vs. 1 /27 fold when compared to its control vector).

The yeast strain expressing RGS2 demonstrates halos that are slightly smaller than the halos observed for stains expressing the vector only. Strains expressing RGS2, however, demonstrate decreased luminescence in comparison to control strains (especially at 62 nM), which is suggestive of functional complementation of sst2. Human RGS7: Full length human RGS7 (Genbank AF090116) was obtained from a human brain cDNA library (Clontech) by PCR amplification using a 20 base forward ohgonucleotide primer with an embedded Notl site:

5*-CTTGGCGGAGGAGGGCACAC (SEQ ID NO: 19) and a reverse 22 base ohgonucleotide primer having an embedded BamHl site: 5'-TGGAGGCATTGAGACGGAAGA (SEQ ID NO: 20)

The resulting 1698 bp PCR product was restriction digested with appropriate enzymes and ligated into the Notl and BamHl sites of pcDΝA3.1. The resulting recombinant vector (hRGS7-pcDNA3.1) is designated pKHY126, and was confirmed by restriction digests and sequence analysis. pKHY126 was digested with Pmel, a 1.5 kb fragment was isolated, gel purified, and blunt ligated into the Smal site of p426TEF. The orientation of the hRGS7 cDNA insert was determined by restriction digest analysis using Xbal, Hindlll, or Clal and Sαcl. Two sibling isolates of the confirmed hRGS7-pTEF426 plasmid were designated Kpl44 (also known as pKHY59) and Kpl45 (also known as pKHY60).

A second hRGS7 clone was generated that encodes from the G-gamma like ("GGL") domain to the end of the protein. This GGL-hRGS7 cDNA was generated by PCR using a 27 base forward oligonucleotide primer containing an embedded -δα HI site and a start codon:

5'-GCGGATCCATGAAACCTCCAACAGAAG (SEQ ID NO: 21) and a 26 base reverse oligonucleotide primer containing an embedded Clal site and exogenous stop codon:

5'-CGATCGATTATTAGTAAGACTGAGCA (SEQ ID NO: 22) with pKHY126 as template. The resultant PCR product is 660 bp and encodes from amino acid sequence KPPT to the terminal amino acid. The 650 bp PCR product was digested with the appropriate enzymes, isolated, gel purified, and directionally ligated into the RαmHI and Clal site of prepared p426TEF vector (ATCC). Recombinant plasmids were confirmed by restriction digests using Ncol and Xhol, Xbal alone, or Clal and Ncol. Two sibling isolates of the recombinant plasmid (GGL-hRGS7-p426TEF) were designated Kpl 42 (also known as pKHY57) or Kpl43 (also known as pKHY58). Human RGS9:

Full length human RGS9 (Genbank AF071476) was obtained from a human brain cDΝA library (Clontech) by PCR amplification using a 40 base forward oligonucleotide primer with an embedded Hindu! site:

5'-GCAAGCTTCCACCATGACAATCCGACACCAAGGCCAGCAG (SEQ ID NO: 23) and a 39 base reverse oligonucleotide primer with an embedded -Zbαl site:

5'-GCTCTAGATTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 24) The resulting 2.0 kb PCR product was restriction digested with appropriate enzymes, and ligated into the Hindlll and Xbal sites of pWE3 to generate recombinant vector hRGS9- pWE3. The constract was confirmed by restriction digests and sequence analysis. hRGS9- pWE3 was used as template with a forward oligonucleotide primer containing an embedded RαmHI site: 5'-CCGGATCCAGATGACAATCCGACACCAAGGCCAGC (SEQ ID NO: 25) and a reverse oligonucleotide primer containing an embedded Xhol site:

5'-CGCTCGAGTTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 26) were used to generate a 2.0 kb fragment using standard PCR methods. The hRGS9 PCR product was digested with the BamHl and Xhol, purified and directionally ligated into the prepared BamHl and Xhol sites of pACT2 to generate the plasmid pACT-hRGS9, which was confirmed by sequence analysis. The cDNA encoding full length hRGS9, containing endogenous start and stop codons, was excised from pACT-hRGS9 using BamHl and Xhol restriction enzymes to obtain a 2.0 kb fragment. The 2.0 kb fragment was isolated, gel purified, and directionally ligated into the prepared BαmHl and-Z/zσl sites of vector p426TEF. The resulting recombinant plasmids (hRGS9-TEF426) were confirmed by restriction digest with BαmHl and Sphl and designated Kpl48 (also known as pKHY63) and Kpl49 (also known as pKHY62).

A second hRGS9 clone was generated that encodes from the G-gamma like (GGL) domain to the end of the protein. This GGL-hRGS9 cDNA was generated by PCR using a 28 base forward oligonucleotide primer containing an embedded BαmHl site and a start codon:

5'-GCGGATCCATGAAGAAACAAACAGTCGT (SEQ ID NO: 27) and a 26 base reverse oligonucleotide primer containing an embedded Clαl site and exogenous stop codon:

5'-CGATCGAATTATTACAGGCTCTCCCAG (SEQ ID NO: 28) with Kp 148 as template.

The resulting PCR product is a 1.4 kb fragment. The cloning strategy is similar to that described for GGL-RGS7, such that the 1400 bp PCR product was digested with appropriate enzymes, isolated, gel purified, and directionally ligated into the BαmHl and Clαl sites of prepared p426TEF vector (ATCC). Recombinant plasmids were confirmed by restriction digests with Sαcl alone, EcoRI alone, Sail alone, or BamHl and Sphl to confirm direction. Two sibling isolates of the recombinant plasmid (GGL-RGS9-p426TΕF) were designated Kpl46 (also known as pKHY61) and Kpl47 (also known as pKHY62). Generatation of strains: The above RGS constracts were transformed into yeast KYI 13. The FUSl-luciferase reporter (Kpl 20) was also co-transformed into this yeast strain. The resulting yeast strains are designated as follows: Table 2

Three colonies from each yeast transformation were picked and streaked onto SC- Ura-Trp plates. Two of the three colonies were subjected to pheromone response assay (as previously described) to measure luciferase reporter gene activity. Briefly, 100 μl of 0.1 OD₆oo overnight culture was stimulated by alpha factor in concentrations of 25 or 225 ng for 2 hours at 30C. The same culture was also subjected to pheromone response halo assay (as previously described). Cell lawn (made from 0.3 OD₆₀o culture) on SC-Ura-Trp agar plates was stimulated with alpha factor in concentrations of 50 or 250 ng per spot. The plates were incubated at 30C for about 40 hours, and observed for halo formation. Results:

Results for the luciferase reporter assay are depicted in Figures 9A-D and results of the halo assays are depicted in Figure 8. Yeast strains expressing RGSZl demonstrated smaller halos and decreased luminescence than yeast strains expressing the empty vector, indicating complementation ofsst2 in yeast. Additional dose response curves and more detailed halo assays (alpha factor at 431, 48, 5.3, and 0.6 ng per spot, or 431, 144, 48 orl6 ng per spot) were done for these strains. Responses from RGSZl expressing strains were not as robust as that observed previously from strains expressing RGS4, suggesting that RGSZl displays 33% of the response observed with RGS4 (1/8 vs.1/27 fold when compared to its control vector).

The yeast strain expressing RGS2 demonstrates halos that are slightly smaller that the halos observed for stains expressing the vector only. Strains expressing RGS2, however, demonstrate decreased luminescence in comparison to control strains (especially at 62 nM), and is suggestive of functional complementation of sstl. The yeast strain expressing either the full length or the GGL+RGS C-terminal of RGS7 demonstrated halos and luminescence that were similar to negative control strains, suggesting that this form of RGS does not easily provide functional complementation of ssf2. The yeast strains expressing either the full length or the GGL+RGS C-terminal of RGS9 demonstrate halos that are similar to negative control strains. There is some indication, however, of decreased luminescence in strains expressing full length RGS9 in comparison to negative control strain. Example 8: co-expression of human Gbeta5

RGS7 and RGS9 are longer RGS proteins being 469 and 673 amino acids, respectively, and are within a subclass of the RGS protein family, together with RGS6 and RGS 11 , that contain a DEP domain, and the higlily conserved GGL domain that binds Gbeta5 (Snow et al., 1999). RGS7 and RGS9 demonstrate a high level of homology within the GGL domains. RGS6 and RGS7 have 80% homology in the DEP domain, but RGS7 and RGS9 have only 50%. Present work in the RGS field suggests that this subclass of GGL-domain- containing RGS proteins would function similarly. Our findings, however, suggest that these, and potentially members of other subclasses of RGS proteins may not display identical functionality. The GGL domain has been demonstrated to bind the heterotrimeric G-protein Gbeta5, with suggestions that the GGL-RGS/Gbeta5 interaction may be important for proper folding of both proteins, and functionally relevant. Gbeta5 is the most distinct isoform of the Gbeta proteins, and is highly expressed in the brain. The homology between Gbeta5 and the yeast Gbeta (STE4) is <40%. Therefore, we co-expressed human Gbeta5 with RGS7 or

RGS9 (or RGS4 as a control) in yeast to determine whether human Gbeta5 would enable the GGL-domain-containing RGS proteins to functionally complement sst2.

The cDNA encoding human Gbeta5 was obtained by PCR using a 39 base forward oligonucleotide primer containing an embedded Hindlll site: 5'-GCCCAAGCTTCCGCCAGCCATGGCAACCGAGGGGCTGCA (SEQ ID NO: 29) and a 24 base reverse oligonucleotide primer containing an embedded Xhol site:

5'-CCGCTCGAGTTAGGCCCAGACTCT (SEQ ID NO: 30) and hGBeta5 recombinant vector as template (Liang et al, 2000). The hGbeta5 PCR product was digested with Hindlll and-X7zoI, gel purified, and ligated into Hindlll and Xhol digested p425TEF. The resulting recombinant vector was confirmed by sequence analysis and designated hGbeta5-p425TEF. This vector was co-transformed with the FUSl-luciferase reporter plasmid (Kpl 20), and previously described recombinant plasmids encoding RGS2, RGS4, RGS7, RGS9, and RGSZl, or empty plasmid control vector(s) into yeast strain KYI 13. The resulting yeast strains containing the combination of plasmid are summarized in the following table.

Table 3

The strains were tested for activity in pheromone-responsive halo assays and luciferase reporter assays, as previously described. The results from the halo assays are depicted in Figure 10 for RGS7 and Figure 11 for RGS9. As a control, we tested the effect of hGbeta5 on the ability of RGS4 to complement sst2. RGS4 is a short RGS protein of 206 amino acids and does not contain a GGL domain. Halo assays and luminescence of strains co-expressing hGbeta5 and RGS4 were similar to strains expressing RGS4 and an empty control vector (data not shown). Since RGS7 and RGS9 both contain a GGL domain, one would anticipate that these RGS proteins would be similarly affected by co-expression of Gbeta5. Co-expression of hGbeta5 with RGS9, however, had no effect on RGS7 as halos were similar to the vector control strain. Co-expression of hGbeta5, however, resulted in an increase in halo size (rather than a decrease as occurs by RGS4 expression) in comparison to vector control strains. Expression of hGbeta5 alone had no effect, similar to the vector-only control. This is an unanticipated result and suggests that despite the similarity in domain stracture of RGS 7 and RGS 9, these two RGS proteins may in fact be functionally dissimilar.

Example 9: Chimeric RGS Proteins

To further investigate the utility of the assay, several chimeric RGS proteins were tested. Specific RGS chimeric proteins are described below, but in general we investigated the effect of N-terminal and C-terminal RGS protein combinations, or the addition of a the N- terminal region of an RGS protein that has been demonstrated to complement (for example RGS4) for an sst2 knockout, to a different, but full length, RGS protein.

Cloning strategies used in chimeric gene construction 1. RGS4N/RGS7C: The RGS4 N-terminal region of 171 bp, which encodes amino acids 1-57 of RGS4, was obtained by PCR using rat RGS4 cDNA as template. The forward primer contained an embedded BamHl site: chiRgs4 Nterm 5'-CGCGGATCCATGTGCAAAGGGCTTGCA (SEQ ID NO: 31) while the reverse primer contained an embedded Smαl site: chiRgs4r Nterm 5'-TCCCCCGGGCTTGACTTCCTCTTGGCT (SEQ ID NO: 32) The RGS 7 C-terminal region, which begins with the GGL domain of full length human RGS7 through the last amino acid, was amplified to produce a 645 bp product encoding amino acids 255-470 of RGS7. The forward primer contained an embedded Smαl site: chiRgs7 Cterrn 5'-TCCCCCGGGGATGAGTTACAACAACAG (SEQ ID NO: 33) The reverse primer contains an embedded Clal site: chiRgs7r Cterm 5'-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 34) The two PCR products were gel purified, cut with Smαl and ligated. The ligation mixture was then used as template to produce the full length chimeric PCR product of 816 bp. The forward primer used in this PCR reaction was chiRgs4 Nterm (SEQ ID NO: 31) and the reverse primer was chiRgs7r Cterm (SEQ ID NO: 34). The resulting chimeric gene was gel purified, re-amplified, cut with the appropriate restriction enzymes, and cloned into the RαmHl and Clal site of vector p426TEF, which encodes an N-teπninal HA tag. 2. RGS7N/RGS4C:

The RGS7 N-terminal region includes the GGL domain of RGS7 and was amplified using human RGS7 cDNA as template to produce a 996 bp PCR product encoding amino acids 1-332. The forward primer contains an embedded BamHl site:

chiRgs7 Nterm 5'-CGCGGATCCATGGCCCAGGGGAAT (SEQ ID NO: 35)

The reverse primer contains an embedded Smαl site:

chiRgs7r Nterm 5'-TCCCCCGGGAAAACCCCATCGTTT (SEQ ID NO: 36)

The RGS4C region contains only the RGS4 core domain and was amplified using RGS4 cDNA as a template to produce a 447 bp PCR product encoding amino acids 58-206. The forward primer contains an embedded Smαl site: chiRgs4 Cterm 5*-TCCCCCGGGAAATGGGCTGAATCACTG (SEQ ID No: 37) The reverse primer contains an embedded Clal site: chiRgs4r Cterm 5'-CCCATCGATTTAGGCACACTGAGGGAC (SEQ ID NO: 38)

The two PCR products were gel purified, cut with Smαl and ligated. The ligation mixture was used as template for PCR amplification of the chimeric gene product of 1443 bp. The primers used were as described above. The forward primer was chiRgs7 Nterm (SEQ ID NO: 35), while the reverse primer was chiRgs4r Cterm (SEQ ID NO: 38). The resulting chimeric gene was gel purified, re-amplified, cut with appropriate restriction enzymes and cloned into the BamHl and Clαl site of vector p426TEF, which encodes an N-terminal HA tag.

3. RGS4N/RGS10 (full length):

The RGS4N region is identical to that described for the RGS4N/RGS7C chimera described above.

The RGS 10 (full length) for this chimera was obtained from p426-RGS10 by restriction digest using Smαl and Xho 1. The plasmid p426-RGS 10 was constracted by PCR amplification using human RGS 10 cDNA (Genbank no. XM_049797) as template. The forward primer contains an embedded Hindlll site:

RGS 10 fwd 5'-CCCAAGCTTATGGAACACATCCACGACAGC (SEQ ID NO: 39) The reverse primer contains an embedded Xhol site: RGS 10 rev 5'- CCGCTCGAGTCATGTGTTATAAATTCTGGA (SEQ ID NO: 40)

The PCR product of 504 bp, which encodes the full length RGS 10, was gel purified and cloned into the Hindlll and Xhol sites of vector p426TEF.

The RGS4 N-terminal region PCR product described above was cut with Smαl and ligated with the gel purified Smαl and Xliol restriction fragment of RGS 10. The ligation mixture was used as template for PCR to obtain the chimeric RGS4/RGS10. The forward primer used was chiRgs4 Nterm (SEQ ID NO: 32), while the reverse primer was RGS 10 rev (SEQ ID NO: 40), both described above. The resulting chimeric gene was gel purified, re- amplified and cloned into the BamHl and Xhol site of vector p426TEF, which encodes an N- terminal HA tag.

4. RGS4N/RGS7 full length:

The RGS4 N-terminal region was obtained as described above. The full length RGS7 cDNA was amplified using cloned human RGS7 as a template to produce a 1410 bp PCR product encoding amino acids 1-470. The forward primer contains an embedded Smαl site: RGS7N fwd 5'-TCCCCCGGGATGGCCCAGGGGAAT (SEQ ID NO: 41)

The reverse primer contained an embedded Clαl site:

Rgs7r Cterm 5*-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 42) The two PCR products were gel purified, cut with Smαl and ligated. The ligation mixture was then used as template for PCR to obtain the RGS4N/RGS7 full length chimeric gene. The forward primer was chiRgs4 Nterm (SEQ ID NO: 31) and the reverse primer was Rgs7r Cterm (SEQ ID NO: 42). The resulting chimeric gene was gel purified, re-amplified and cloned into the BαmHl and Clαl site of vector p426TEF, which encodes an N-terminal HA tag.

5. RGS4N/RGS9C: Two different chimeras for RGS4N/RGS9C where constracted, wherein one contains the GGL domain in the RGS9 C-terminal region, while the other does not contain the GGL domain within the RGS 9 C-tenninal region. 5a. RGS4N/RGS9C (minus GGL domain):

The RGS4 N-terminal region was amplified by PCR as described previously, digested with -δαrnHI and Hindlll and gel purified. The RGS 9 C-terminal region (minus the GGL domain) was amplified using the human RGS9 cDNA as template to obtain a 1125 bp product encoding amino acids 302-675. The forward primer contains an embedded Hindlll site: RGS9RGS fwd (minus GGL domain) 5'-CCCAAGCTTATGAACTTCAGCGAA (SEQ ID NO: 43) The reverse primer contains an embedded Xhol site:

RGS9RGS rev 5'- CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 44) The RGS9C (minus GGL domain) PCR product was purified, cut with Hindlll and J-.7- I, and cloned into Hindlll and J-Tzol sites of vector p426TEF. The resulting plasmid was then digested with BamHl and Hindlll, and ligated with the BαmHl and Hindlll RGS4 N- terminal fragment to generate the RGS4N/RGS9c minus GGL domain chimeric plasmid. 5b. RGS4N/RGS9C (plus GGL domain):

The RGS 9 C-terminal region including the GGL domain fragment was amplified using RGS9 cDNA as template to produce an 1356 bp PCR produce encoding amino acids 223-675 of human RGS9. The forward primer, RGS9chi Cterm Hindlll fwd (plus GGL domain), contains an embedded Hindlll site:

5'-CCCAAGCTTGCTGTCAAAAAAGAGATC (SEQ ID NO: 45) The reverse primer contains an embedded Xhol site:

RGS9RGS rev 5'-CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 46) The RGS4N/RGS9C (minus GGL domain) chimeric plasmid (described above) was cut with Hindlll and Xhol and the cDNA band containing the vector with RGS4N was gel purified. The vector-RGS4N cDNA was then ligated to the Hindlll and Xhol RGS9C (plus GGL) prepared PCR product to generate the RGS4N/RGS9 plus GGL domain chimeric plasmid.

6. RGS4N/axin: The RGS domain present in human axin was PCR amplified to produce a 441 bp fragment encoding amino acids 199-345. The forward primer, AxinSmαl fwd, contains an embedded Smαl site:

5'-TCCCCCGGGGGCAGTGCCTCCCCCACCCCACCAT (SEQ ID NO: 47) The reverse primer, AxinXhol rev, contains an embedded Xhol site 5'-CCGCTCGAGTTAGACTTTGGGGCTCTCCGA (SEQ ID NO: 48)

The p426TEF plasmid containing the RGS4N/RGS7C chimera was cut with Smαl and Xhol to remove the RGS7C fragment, and then gel purified. The vector-RGS4 DNA was then ligated with the Smαl and Xhol fragment encoding the RGS domain of the axin gene to produce the RGS4N/Axin chimeric plasmid. 7. RGS11:

Human RGSl 1 was amplified using cDNA (GenBank no. NM_003834) as template to produce a 1341 bp PCR product encoding amino acids 1-447. The forward primer contains an embedded EcoRI site:

RGSl 1 fwd 5'-CCGGAATTCATGGCCGCCGGCCCCGCGCCG (SΕQ ID NO: 49) The reverse primer contains an embedded Hindlll site:

RGS 11 rev 5'-CCCAAGCTTCTAGGCCACCCCATCTCCACC (SΕQ ID NO: 50) The resulting PCR product was digested with EcoRI and Hindlll, and subcloned into similar sites of the p426TΕF vector. 8. RGS6: Human RGS6 was amplified from cDNA (GenBank no. AF156932) to obtain a 1419 bp PCR product encoding the full length protein of amino acids 1-473. The forward primer contains an embedded Hindlll site:

RGS6 wd 5'-CCCAAGCTTATGGCTCAAGGATCCGGGGAT (SEQ ID NO: 51) The reverse primer contains an embedded Xhol site: RGS6 rev 5'-CCGCTCGAGTCAGGAGGACTGCATCAG (SEQ ID NO: 52) The PCR product was digested with Hindlll and Xhol and cloned into similar sites of the p426TEF vector. Strain generation:

Yeast strains were produced to evaluate the ability of the various RGS chimeric proteins to complement an sst2 knock-out. The RGS chimeric plasmids were transformed into the base strain KYI 13, in the presence or absence of human Gbeta5. All strains contained either control or expression plasmid and firefly luciferase reporter gene to enable investigation under similar media conditions. Strains are summarized in the following table:

Table 4

RESULTS:

These strains were tested for functional complementation in the pheromone response assay, using a pheromone-responsive reporter gene. For example, the luciferase reporter gene was employed in the quantitative assay. Strains were also tested in a 'halo assay' in response to 2 day exposure to alpha factor in a qualitative assay for pheromone response.

All strains were tested in dose response assays. For luciferase based assays, the alpha

factor doses tested were 0, 100 pmol, 1 nmol, 10 nmol, 100 nmol, 1 μmol, 10 μmol, and 100 μmol.

The halo assays were conducted as previously mentioned. For comparison of the numerous dose response curves, response was determined for a single dose of alpha factor within the curve. Response was then determined as a percent response to the negative control strain containing no RGS and no Gbeta5. For example, a constract having no effect would be ranked at 100, similar to the sst2 knockout strain containing empty vectors, while a highly functional complementing RGS protein, such as RGS4, would be ranked at 0.

We tested several short, that is, relatively low molecular weight, RGS proteins. RGS2 and RGSz were previously tested and demonstrated some ability to complement the sst2 knockout phenotype, although not as effectively as RGS4. RGS 10 is also a short RGS protein, however when expressed as a wild-type protein, it did not demonstrate complemenation in either the luciferase or the halo assay. The RGS4/RGS10 chimera, however, restored the RGS function to values very close to those observed for expression of RGS4 alone. These results are shown in Figure 12. From these data, RGS4 is the most effective RGS protein in the complementation of the sst2 knockout phenotype. RGS7 is non-functional, and is not much improved by deleting the N-terminal region. These data are shown in Figure 14. Addition of the RGS4 N-terminal region to either the RGS 7 C-terminal region or addition of the RGS4 N-terminal region to the full length RGS7 protein, however, enables some level of functional complementation. Moreover, improvements are also noted in the halo assay.

RGS9 in its native state demonstrated an intermediate ability to complement the sst2 knockout phenotype. This complementation is negated in the absence of the RGS9 N- terminal region. Addition of the RGS4 N-terminal to the non-functional C-terminal RGS9- ggl, however, improves complementation, which is further improved by removal of the ggl domain of RGS9. In addition, we observed some intemiediate complementation by RGS6 (value of 25) and RGSl 1 (value of 50), which was not affected by co-expression of G-beta5.

We observed a difference in the response of strain expressing RGS9, where the wild- type protein had some effect; however co-expressed with Gbeta5 often an enhanced pheromone response was observed. A similar effect was not observed by co-expression of Gbeta5 with other GGL-containing RGS proteins, that is, RGS6, RGS7, and RGAl 1. This finding suggests an alternate function of RGS 9.

References

Ausubel, F. et al, (Ed), Current Protocols in Molecular Biology, John Wiley & Sons, Inc., USA, (1998).

De Vries, L., et al., RGS proteins: more than just GAPs for heterotrimeric G proteins, Trends in Cell Biology, Elsevier Science, Vol. 9, pp. 138-143 (April 1999).

Dohlman et al, Sst2, a negative regulator of pheromone signaling in the yeast Saccharomyces cerevisiae: expression, localization and genetic interaction and physical association with Gpal (the G alpha subunit), Mol. Cell. Biol., Vol. 16, No. 9, pp. 5194-5209 (1996).

Kehrl, J.H., Heterotrimeric G protein Signaling: Roles in Immune Function and

Fine-Tuning by RGS Proteins, Immunity, Vol. 8, pp. 1-10 (1998).

Panetta, R., et al., Regulators ofG Protein Signaling (RGS) 2 and 16 Are Induced in Response to Bacterial Lipopolysaccharide and Stimulate c-fos Promoter Expression, Biochemical and Biophysical Research Communications, Vol. 259, No. 3, pp. 550-556 (June 1999).

Rousch, Wade, Regulating G Protein Signaling, Science (Cell Biology), Vol. 271, pp. 1056-1058 (Feb. 1996).

Shuey D.J., et al., RGS7 attenuates signal transduction through the Galpha q family of heterotrimeric G-proteins in mammalian cells, J. Neurochem., Vol. 70, pp. 1964-1972 (1997).

Wieland, T., et al., Regulators of G-protein signalling: a novel protein family involved in timely deactivation and desensitization of signalling via heterotrimeric G proteins, Naunyn-Schmiedeberg's Arch Pharmacol, Vol. 360, pp. 14-26 (1999). Young, K., et al., Identification of compounds affecting specific interaction of peptide binding pairs, US 5,989,808 (1995).

Zhen, B., et al., Divergence of RGS proteins: evidence for the existence of six mammalian RGS subfamilies, Dept. of Cellular and Molecular Medicine, and Phatology, University of California, San Diego, La Jolla, California, Elsevier Science Ltd., Vol. 4, pp. 411-414 (1999).

All cited publications, patents, and patent applications are hereby incorporated by reference in their entirety.

While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be appreciated by one skilled in the art from reading this disclosure that various changes in form and detail can be made without departing from the true scope of the invention.

Claims

We Claim:

1. A cell that responds to a pheromone comprising a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein the reporter is Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

2. The cell of claim 1, wherein the cell is a mammalian cell or a yeast cell.

3. The cell of claim 2, wherein the cell is a yeast cell.

4. The cell of claim 1, wherein the heterologous nucleic acid is on a plasmid. 5. The cell of claim 1 , wherein the heterologous nucleic acid is integrated into the cell's genome.

6. The cell of claim 1, wherein the pheromone-responsive promoter is LUC1, FUSl,

FUS2, KAR3, FUS3, STE3, STE13, STE12, CHSl, FARl, AGAl, AGA2, AGαl, GPAl,

STE2, STE3, STE6, MFA1, MFA2, MFαl, MFα2, CIK1, or BAR1. 7. The yeast cell of claim 3, wherein the yeast cell is Saccharomyces cerevisiae,

Schizosaccharomyces pombe, or Pichiapastoris.

8. The yeast cell of claim 7, wherein the yeast cell is Saccharomyces cerevisiae.

9. The cell of claim 1, fiirther comprising a heterologous nucleic acid encoding an RGS protein. 10. The cell of claim 9, wherein the RGS protein lacks a GGL or DEP domain.

11. The cell of claim 9 further comprising an endogenous nucleic acid encoding a native RGS protein coπesponding to a heterologous RGS protem, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS protein.

12. The cell of claim 11, wherein the mutation is either or each of a deletion, insertion, or substitution.

13. The cell of claim 9, wherein the RGS protein is RGSZl, RGSZ2, Ret-RGSl, RGSl, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGSl l, RGS12, RGS13, RGS14, RGS16, RGS-PXl, GAIP, Axin, Conductin, egl-10, eat-16, pi 15RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain. 14. The cell of claim 13, wherein the RGS-like (RGL) domain is PLCB or gamma subunit of cGMP PDE.

15. The cell of claim 13, wherein the RGS protein is RGS2, RGS4, RGS6, RGSl 1, or RGSZ.

16. The cell of claim 9, wherein the RGS protein is a chimera. 17. The cell of claim 16, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, anN-terminus of RGS 7 and a C-terminus of RGS4, anN-terminus of RGS4 and a complete RGS 10, anN-terminus RGS4 and a complete RGS7, anN-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, anN-terminus of RGS4 and a C- terminus of RGS 9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

18. The cell of claim 17, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

19. The cell of claim 17, wherein the C-terminus of RGS 7 comprises amino acids 255-470 of RGS7. 20. The cell of claim 17, wherein the N-terminus of RGS7 comprises amino acids

1-332 of RGS7.

22. The cell of claim 17, wherein the C-terminus of RGS4 comprises amino acids 58- 206 of RGS4.

23. The cell of claim 17, wherein the axin RGS domain comprises amino acids 199- 345 of axin.

24. A cell comprising a heterologous nucleic acid encoding a chimeric RGS protein.

25. The cell of claim 24, wherein the cell is a mammalian cell or a yeast cell.

26. The cell of claim 5, wherein the cell is a yeast cell.

27. The cell of claim 24, wherein the heterologous nucleic acid is on a plasmid. 28. The cell of claim 24, wherein the heterologous nucleic acid is integrated into the cell's genome.

29. The cell of claim 24, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, anN-terminus of RGS7 and a C-terminus of RGS4, anN-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS 9 lacking a GGL domain, an N-terminus of RGS4 and a C- terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin.

30. The cell of claim 29, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4. 31. The cell of claim 29, wherein the C-terminus of RGS7 comprises amino acids

255-470 of RGS7.

32. The cell of claim 29, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

33. The cell of claim 29, wherein the C-terminus of RGS4 comprises amino acids 58- 206 of RGS4.

34. The cell of claim 29, wherein the axin RGS domain comprises amino acids 199- 345 of axin.

35. An isolated nucleic acid encoding a chimeric RGS protein.

36. The isolated nucleic acid of claim 35, wherein the chimera comprises anN- terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, anN-terminus of RGS4 and a C-terminus of RGS 9 lacking a GGL domain, anN- terminus of RGS4 and a C-terminus of RGS 9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof. 37. The isolated nucleic acid of claim 36, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

38. The isolated nucleic acid of claim 36, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

39. The isolated nucleic acid of claim 36, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

40. The isolated nucleic acid of claim 36, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

41. The isolated nucleic acid of claim 36, wherein the axin RGS domain comprises amino acids 199-345 of axin. 42. A vector comprising the isolated nucleic acid of claim 35.

43. The vector of claim 42, wherein the vector is a plasmid or a virus.

44. The vector of claim 43, wherein the vector is a plasmid.

45. The vector of claim 44, wherein the plasmid is a low copy number plasmid.

46. A cell comprising the vector of claim 42. 47. The cell of claim 9, further comprising a heterologous nucleic acid encoding

Gbeta5.

48. The cell of claim 47, wherein the Gbeta5 is human Gbeta5.

49. A method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising: (a) providing at least one first cell that responds to a pheromone, wherein the first cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal; (b) providing at least one second cell that responds to a pheromone, wherein the second cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS protein; (b) incubating a test sample with the first and second cells in the presence of a pheromone under conditions suitable to detect the measurable signal;

(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter; and

(d) comparing the level of expression in the first and second cells, wherein a difference in the level of expression indicates that the test sample alters RGS protein- mediated reporter gene expression.

50. The method of claim 49, wherein the test sample is used at a single concentration.

51. The method of claim 49, wherein the test sample is used in a range of concentrations. 52. The method of claim 49, wherein the level of expression of the reporter is detected in a halo assay.

53. The method of claim 49, wherein the level of expression of the reporter is detected spectrophotometrically.

54. The method of claim 53, wherein the detection is automated.

55. The method of claim 49, wherein the heterologous nucleic acid encodes a Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

56. The method according to claim 49, wherein the first and second cell is either a mammalian cell or a yeast cell.

57. The method according to claim 56, wherein the first and second cells are yeast cells.

58. The method according to claim 49, wherein the heterologous nucleic acid encoding the reporter gene is on a plasmid. 59. The method according to claim 49, wherein the heterologous nucleic acid encoding the reporter gene is integrated into the cell's genome.

60. The method according to claim 49, wherein the second heterologous nucleic acid encoding the RGS protein is on a plasmid.

61. The method according to claim 49, wherein the second heterologous nucleic acid encoding the RGS protein is integrated into the cell's genome.

62. The method according to claim 49, wherein the pheromone-responsive promoter is LUCl, FUSl, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHSl, FARl, AGAl, AGA2, AGαl, GPAl, STE2, STE3, STE6, MFA1, MFA2, MFαl, MFα2, CIK1, or BAR1.

63. The method according to claim 57, wherein the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastor is.

64. The method according to claim 63, wherein the yeast cell is Saccharomyces cerevisiae.

65. The method according to claim 49, wherein the RGS protein lacks a GGL or DEP domain.

66. The method according to claim 49, further comprising an endogenous nucleic acid encoding a native RGS protein coπesponding to a heterologous RGS protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS protein. 67. The method according to claim 66, wherein the mutation is either or each of a deletion, insertion, or substitution.

68. The method according to claim 49, wherein the RGS protein is RGSZl, RGSZ2, Ret-RGSl, RGSl, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGSl l, RGS12, RGS13, RGS14, RGS16, RGS-PXl, GAIP, Axin, Conductin, egl- 10, eat- 16, p 115RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain.

69. The method according to claim 68, wherein the RGS-like (RGL) domain is PLCB or gamma subunit of cGMP PDE.

70. The method according to claim 68, wherein the RGS protein is RGS2, RGS4, RGS6, RGSl l, or RGSZ.

71. The method according to claim 49, wherein the RGS protein is a chimera.

72. The method according to claim 71, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, anN-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of

RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

73. The method according to claim 72, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

74. The method according to claim 72, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

75. The method according to claim 72, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7. 76. The method according to claim 72, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

77. The method according to claim 72, wherein the axin RGS domain comprises amino acids 199-345 of axin.

78. A method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:

79. The method of claim 78, wherein the test sample is used at a single concentration.

80. The method of claim 78, wherein the test sample is used in a range of concentrations.

81. The method of claim 78, wherein the level of expression of the reporter is detected in a halo assay.

82. The method of claim 78, wherein the level of expression of the reporter is detected spectrophotometrically. 83. The method of claim 82, wherein the detection is automated.

84. The method of claim 78, wherein the heterologous nucleic acid encodes a Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

85. The method according to claim 78, wherein the cell is a mammalian cell or a yeast cell.

86. The method according to claim 85, wherein the cell is a yeast cell.

87. The method according to claim 78, wherein the heterologous nucleic acid encoding the reporter gene is on a plasmid.

88. The method according to claim 78, wherein the heterologous nucleic acid encoding the reporter gene is integrated into the cell's genome.

89. The method according to claim 78, wherein the second heterologous nucleic acid encoding the RGS protein is on a plasmid.

90. The method according to claim 78, wherein the second heterologous nucleic acid encoding the RGS protein is integrated into the cell's genome. 91. The method according to claim 78, wherein the pheromone-responsive promoter is LUCl, FUSl, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHSl, FARl, AGAl, AGA2, AGαl, GPAl, STE2, STE3, STE6, MFA1, MFA2, MFαl, MFα2, CIK1, or BAR1.

92. The method according to claim 86, wherein the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris.

93. The method according to claim 92, wherein the yeast cell is Saccharomyces cerevisiae.

94. The method according to claim 78, wherein the RGS protein lacks a GGL or DEP domain. 95. The method according to claim 78, further comprising an endogenous nucleic acid encoding a native RGS protein coπesponding to a heterologous RGS protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS protein.

96. The method according to claim 95, wherein the mutation is either or each of a deletion, insertion, or substitution.

' 97. The method according to claim 78, wherein the RGS protein is RGSZl , RGSZ2, Ret-RGSl, RGSl, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGSl l, RGS12, RGS13, RGS14, RGS16, RGS-PXl, GAIP, Axin, Conductin, egl- 10, eat-16, pi 15RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain.

98. The method according to claim 97, wherein the RGS-like (RGL) domain is PLCB or gamma subunit of cGMP PDE.

99. The method according to claim 97, wherein the RGS protein is RGS2, RGS4, RGS6, RGSll, or RGSZ. 100. The method according to claim 78, wherein the RGS protein is a chimera.

101. The method according to claim 100, wherein the chimera comprises an N- terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, anN-terminus of RGS4 and a complete RGS 10, anN-terminus RGS4 and a complete RGS7, anN-terminus of RGS4 and a C-teπninus of RGS9 lacking a GGL domain, anN- terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

102. The method according to claim 101, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4. 103. The method according to claim 101, wherein the C-terminus of RGS 7 comprises amino acids 255-470 of RGS7.

104. The method according to claim 101, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

105. The method according to claim 101, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

106. The method according to claim 101, wherein the axin RGS domain comprises amino acids 199-345 of axin.