CA2430475A1 - Methods and cells for detecting modulators of rgs proteins - Google Patents

Abstract

This application describes novel cells that respond to a pheromone comrising a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter. The cells may further comprises a heterologous nucleic acid encoding an RGS protein. Also described are methods involving the use of these cells for detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression.

Description

METHODS AND CELLS FOR DETECTING MODULATORS OF RGS PROTEINS
FIELD OF THE INVENTION
Tlus invention relates to novel cells that respond to a pheromone and express a reporter gene operably linked to a pheromone-responsive promoter. In certain embodiments, the reporter is Reuilla luciferase, Photi~us luciferase, green fluorescent protein, or derivates of green fluorescent protein. In other embodiments, the cells also express a heterologous regulator of G proteins ("RGS protein").
In another embodiment, the invention relates to methods of screening for compounds that modulate RGS proteins, wherein the methods employ the novel cells of the invention.
BACKGROUND OF THE INVENTION
The G protein signaling pathway is one of the most important signaling cascades for relaying extracellular signals, such as neurotransmitters, hormones, odorants, and Light. Such pathways have been identified in diverse organisms, including yeast and mammals.
Classically, the system is composed of three major components: G protein-coupled receptors (GPCRs), heterotrimeric G proteins having a, (3, and y subunits, and intracellular effectors (Gilman, 1987). Recently, the RGS family of proteins has been discovered. RGS
proteins provide a mechanism by which cells can fme tune both the duration and the magnitude of a signal generated through the G protein pathways (Kehrl et al., 1999). The present invention is directed to modified host systems that can be used to isolate and characterize novel factors that regulate RGS proteins. Such factors show great potential for controlling and treating diseases resulting from inappropriate activity of G protein signaling pathways.
The G protein signaling pathway commences upon activation of a GPCR, which is characterized by its seven transmembrane domains. When the GPCR is stimulated, its intracellular loops and C-terminal tail interact with an associated G protein (Wieland et al.
1999). The Ga subunit of the G protein then releases guanosine diphosphate (GDP) and binds guanosine triphosphate (GTP) in its place. The binding of the GTP alters the shape, or three-dimensional conformation, of the Ga subunit, resulting in the dissociation of the heterotrimer into a GTP-liganded Ga subunit and a G(3y dimer. The released subunits are then free to induce downstream signaling events, ultimately mediating biochemical responses, changes in cellular physiology, or other specific cellular responses. The signaling is terminated when the Ga subunits hydrolyze GTP, returning to the GDP-bound state, followed by reassembly with the G(3y subunits to form the inactive heterotrimers (Kehrl, IO 1998).
To elicit an appropriate cellular response, the strength of the intracellular signals must be tightly regulated. While there are a number of types of regulation of the system, such as phosphorylation of GPCRs, receptor binding proteins, and G[3y-trapping proteins, many investigators have focused on GTPase activating proteins (GAPS) (see Wieland et al., 1999).
GAPS accelerate the rate of the Ga-GTPase hydrolysis, thereby reducing the signal generated in the pathway and "desensitizing" the system. (DeVries et al., 1999).
RGS proteins represent a relatively new class of GAPs. The first member of the family was obtained from the yeast Saceha~omyces ce~evisiae (Dohlman et al., 1996;
Weiland et al., 1999). Hapliod mutants were identified that were hypersensitive to pheromone-induced cell cycle arrest, a response mediated by a GPCR pathway.
Studies revealed that a mutated gene product, Sst2; interacted with the G protein Ga-subunit as a GAP. Thus, Sst2 served as a negative regulator of the system, controlling the maturation of the yeast. Subsequently, many more members of the RGS family have been characterized in a number of species, including over 20 different members in mammals (Zheng et al. 1999). It _2_ is hypothesized that the repertoire of RGS proteins is greatly increased by alternative splicing (Panetta et al., 1999).
In addition to their role as GAPS for activated Ga subunits, RGS proteins have also been reported to stimulate G(3y-mediated pathways. Although RGS proteins have a siguficantly higher affinity for Goc-GTP, RGS proteins have a low affinity for Ga-GDP.
When RGS proteins bind to Ga,-GDP, G(3y proteins remain free to mediate downstream events (see Panetta et al., 1999). Thus, RGS proteins may be critical in regulating G protein signaling pathways in more than one way.
Because of the size of the RGS family and the crucial role of RGS proteins in regulating G protein signaling pathways, scientists have begun to study how individual RGS
proteins achieve their specificity. One level of specificity results from the expression pattern of different RGS proteins; some RGS proteins are expressed in particular tissues while some are expressed ubiquitously (Zheng et al., 1999; Panetta et al., 1999). It is also suspected that different RGS proteins may have differing specificity for individual Gcx-subunits (I~ehrl et al., 1998). This would enable certain RGS proteins to preferentially modulate certain G
protein signal pathways over others (Zheng et al., 1999), or bias a dual G
alpha response from a single GPCR.
Control of G protein signaling pathways may also be achieved through modulation of RGS protein concentration or activity. For example, transcription of RGS
protein-encoding ~0 genes may be altered through biochemical feedback mechanisms (see Panetta et al., 1999).
Platelet-activated factor has been shown to trigger RGS 1 expression in B
cells, while RGS 16 expression is induced by carbachol. Conversely, RGS4 expression is down-regulated in response to intracellular cAMP levels.

Many cell-based research platforms linl~ the desired effect of a gene or drug of interest to a change in cell phenotype through the use of reporter genes. In yeast systems, for example, reporter genes have commonly focused on auxotrophy genes for cell growth on selective media, or the LacZ gene for colorometric endpoint using assays that detect (3-galactosidase activity. The gene encoding luciferase, for example, from Renilla z~enifof~zzzis or Plzotizzus pyz"alis, is also useful as a reporter gene in yeast. Luciferase reporters provide increases in assay sensitivity, speed, ease, signal:noise ratios, and provide high quality quantitative data to yeast-based assays for a myriad of target identification and drug discovery applications. Use of the luciferase reporter gene in yeast provides substantial improvements to yeast-based assays such as assays for modulators of RGS
proteins.
In one embodiment, the instant invention is directed to methods for the identification of compounds capable of regulating RGS proteins, for example, compounds that directly or indirectly interact with the RGS proteins themselves. Clues to such factors can be found in the literature. For example, both RGS3 and RGS 12 have regions predicted to assume a coiled coil structure; such domains often mediate interactions with proteins of the cellular cytoslceleton (Kehrl et al., 1999). This may allow RGS proteins to fluctuate between membrane-associated and cytosolic pools, thus altering the availability of the RGS proteins at a given time and/or influencing the type of Ga-subunit the RGS protein modulates (DeVries et al., 1999).
The novel modified cells of the invention, and the novel methods incorporating these cells provide a significant advance for detecting substances that affect RGS
proteins. At this time, no one has developed an efficient and specific screening system to systematically detect compounds that are capable of regulating RGS activity. Such compounds axe of great therapeutic value, as they could potentially modulate one or more of hundreds of G protein pathways that mediate a vast array of biological processes and underlie several diseases. In addition, pharmacologists estimate that up to 60% of all medicines used today exert their effects through G protein signaling pathways (Roush, 1996). By uncovering new factors that regulate these systems, the phenomenon of drug tolerance associated with many of these medicines may be countered.
SUMMARY OF THE INVENTION
In one aspect, the invention is directed to a cell that responds to a pheromone comprising a heterologous nucleic acid encoding a suitable reporter operably linlced to a pheromone-responsive promoter, wherein the reporter is, for example, Revcilla luciferase, Photiuus luciferase, green fluorescent protein, or a derivate of green fluorescent protein. The cell may be a mammalian cell or a yeast cell. In particular embodiments, the yeast cell is Saccharomyces ce~evisiae, Schizosaccha~ofzzyces pombe, or Pichia pastof°is, preferably Saccha~~onzyces ce~evisiae.
The heterologous nucleic acid encoding the promoter may be contained on a vector, for example, a plasmid. In alternative embodiments, the heterologous nucleic acid is integrated into the cell's genome.
For certain embodiments, the pheromone-responsive promoter i's LUC1, FUS1, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FART, AGAl, AGA2, AGal, GPA1, STE2, STE3, STE6, MFA1, MFA2, MFal, MFa2, CIKl, or BART.
In another aspect, the cells of the invention may fi~ther comprise a heterologous nucleic acid encoding an RGS protein. The RGS protein may lack a G gamma-like ("GGL") or disheveled EGL-10 pleckstrin ("DEP") domain. In alternative embodiments, the cell will further comprise an endogenous nucleic acid encoding a native RGS protein corresponding to a heterologous RGS protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS protein. The mutation is either or each of a deletion, insertion, or substitution.
Any RGS protein is suitable for use in the invention, including RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3, RGS4, RGSS, RGS6, RGS7, RGSB, RGS9-1, RGS9-2, RGS10, RGS 11, RGS 12, RGS 13, RGS 14, RGS 16, RGS-PX1, GAIP, Axin, Conductin, egl-10, eat-16, p1 lSRhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain.
Where the protein contains an RGS-like (RGL) domain, that domain may be PLCB
or gamma subunit of cGMP PDE. Preferably, the RGS protein is RGS2, RGS4, RGS6, RGS11, or RGSZ. In some embodiments, the RGS protein lacks a GGL or DEP domain.
In some embodiments the cell will further comprise a heterologous nucleic acid encoding GbetaS. In a particular, embodiment, the GbetaS is human.
In certain embodiments, the RGS protein is a chimera. The chimera may comprise an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.
In particular embodiments, the N-terminus of RGS4 comprises amino acids 1-57 of RGS4, the C-terminus of RGS7 comprises amino acids 255-470 of RGS7 the N-terminus of RGS7 comprises amino acids 1-332 of RGS7, the C-terminus of RGS4 comprises amino acids 58-206 of RGS4, and the axin RGS domain comprises amino acids 199-345 of axm.
The invention includes cells comprising a heterologous nucleic acid encoding a chimeric RGS protein, such as those described above. The cell may be a mammalian cell or a yeast cell. In particular embodiments, the yeast cell is Saccha~~o~ayces cep°evisiae, Schizosacchar~omyces pombe, or Pichia pastof°is, preferably Saccharomyces cef°evisiae.
The heterologous nucleic acid encoding the chimeric RGS protein may be contained on a vector, for example, a plasmid. In alternative embodiments, the heterologous nucleic acid is integrated into the cell's genome.
Another aspect of the invention relates to an isolated nucleic acid encoding a chimeric RGS protein. The chimeric RGS protein may be any of those discussed above. The isolated nucleic acid may be inserted into a vector, such as a plasmid or a virus. The plasmid may be a low copy number plasmid.
In yet another aspect, the invention is a method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:
(a) providing at least one first cell that responds to a pheromone, wherein the first cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal;
(b) ,providing at least one second cell that responds to a pheromone, wherein the second cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS
protein;
(b) incubating a test sample with the first and second cells in the presence of a pheromone under conditions suitable to detect the measurable signal;
(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter; and _7 (d) comparing the level of expression in the first and second cells, wherein a difference in the level of expression indicates that the test sample alters RGS protein-mediated reporter gene expression.
To carry out the method of the invention, any suitable cell of the invention, such as those described above, may be used.
In one embodiment, the method may be performed using the test sample at a single concentration, or, alternatively, the test sample is used in a range of concentrations.
In performing the methods of the invention, detection of the level of expression of the reporter gene maybe accomplished using any suitable method known in the art.
In certain embodiments, detection of the reporter gene is accomplished using a halo assay. In alternative embodiments, the level of expression of the reporter is detected spectrophotometrically. Detection may be automated, thereby increasing the utility of the invention for screening test compounds on a large scale.
In a different aspect, the invention is a method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:
(a) providing at least two aliquots of a cell that responds to a pheromone, wherein the cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS
protein;
(b) incubating the aliquots of cells in the presence of a pheromone under conditions suitable to detect the measurable signal, wherein one of the aliquots contains a test sample;
(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter in the aliquots; and _g_ (d) comparing the level of expression of the reporter in the aliquots, wherein a difference in the level of expression between the aliquots indicates that the test sample alters RGS protein-mediated reporter gene expression.
To carry out the method of the invention, any suitable cell of the invention, such as those described above, may be used.
In one embodiment, the method may be performed using the test sample at a single concentration, or, alternatively, the test sample is used in a range of concentrations.
In performing the methods of the invention, detection of the level of expression of the reporter gene maybe accomplished using any suitable method lcnown in the art.
In certain embodiments, detection of the reporter gene is accomplished using a halo assay. In alternative embodiments, the level of expression of the reporter is detected spectrophotometrically. Detection may be automated, thereby increasing the utility of the invention for screening test compounds on a large scale.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 depicts halo assays for yeast with plasmids comprising RGS4 constructs.
Yeast derived from strains KY103 and KY113 are shown.
FIGURE 2A shows that yeast with the RGS4 and FUS 1-lacZ constructs exhibit a marked attenuation of pheromone-induced growth when compared to control strains lacking the RGS4 construct in a strain derived from KY103.
FIGURE 2B shows that yeast with the RGS4 and FUSl-lacZ constructs show a marked attenuation of pheromone-induced growth when compared to control strains lacking the RGS4 construct in a strain derived from KYl 13.

FIGURE 3 shows that a yeast strain (KY117) with the RGS4 and FUS 1-luciferase constructs exhibits an attenuated level of luminescence in the presence of alpha factor when compared to a control strain Iaclcing the RGS4 construct (KYl 18).
FTGURE 4A depicts dose response curves of luminescence in response to alpha factor in cells containing RGS4 and FUSl-luciferase constructs and a control strain Iaclcing an RGS4 construct. Both strains are derived from KY103.
FIGURE 4B depicts dose response curves of luminescence in response to alpha factor in cells containing RGS4 and FUS1-luciferase constructs and control strain lacking an RGS4 construct. Both strains are derived from KYl 13.
FIGURE 5 depicts a schematic of the yeast pheromone-based assay for screening compounds as RGS bloclcers.
FIGURES 6A-C shows single dose assays for 96 compounds as a screen for compounds that interfere with RGS4-mediated attenuation of luminescence.
Figure 6A
shows the effect of the compounds in a yeast strain expressing RGS4. Figure 6B
shows the effect of the compounds in a yeast strain having a control vector lacking the RGS4 sequence.
Figure 6C shows the fold difference between the RGS4-expressing and control yeast strains.
FIGURES 7A-D shows dose response curves for test compounds SBQ7B1, SBQ8B1, CL485, and CL744, respectively. For each compound, figures showing the original counts per second, fold difference between strains, and fold difference within a strain are provided.
FIGURE 8 shows that yeast strains expressing RGSZ1 demonstrated smaller halos and decreased Luminescence than control yeast strains expressing an empty vector, indicating complementation of sst2 in yeast. Also shown axe the results of halo assays for yeast strains expressing RGS2, RGS7, and RGS9.

FIGURES 9A-D show dose response curves for test yeast strains expressing RGSZ1, RGS~, RGS7, and RGS9, respectively, compared to control yeast strains expressing an empty vector in response to varying concentrations of alpha factor.
FIGURE 10 shows the results of halo assays for yeast strains co-expressing and hGbetaS.
FIGURE 11 shows the results of halo assays for yeast strains co-expressing and hGbetaS.
FIGURE 12 shows the results of luciferase assays for chimeric RGS4/RGS10, RGS4, RGS 10, RGS7, RGS9, RGS6, and RGS 11.
FIGURE 13 shows the results of luciferase assays for RGS7, chimeric RGS7(ggl)/RGS4, chimeric RGS4/RGS7(ggl) 4/RGS10, RGS4, RGS10, RGS7, RGS9, RGS6, and RGS11.
DETAILED DESCRIPTION OF THE INVENTION
The modified cells of this invention employ a host cell. An effective host cell for use in the present invention simply requires that it is defined genetically in order to engineer the appropriate expression of a pheromone-responsive promoter linked to a reporter(s), optionally an exogenous RGS protein, and any other desired genetic manipulations. The host cell can be any cell, such as a eulcaryotic or prokaryotic cell, for example, a mammalian cell, capable of responding to a pheromone or other compound that serves as a ligand for a GPCR.
The cell may naturally respond to the pheromones or other compounds or may be genetically engineered to respond to them. Preferably, the host cell is a fungal cell, for example, a member of the genera Aspe~gillus or Neuropo~a. In more preferred embodiments, the host cell is a yeast cell. In alternative preferred embodiments the yeast cell is Sacclzaf omyces cep°evisiae, Schizosaccha~omyces pombe or Pichia pasto~is.

The cell of the invention employs at least one construct comprising a heterologous nucleic acid encoding a reporter operably linlced to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal.
Preferably, the heterologous nucleic acid is contained on a vector, such as a plasmid, although, alternatively, the nucleic acid may be integrated into the cell's chromosome.
In certain embodiments the host cell further comprises an exogenous RGS
protein. In preferred embodiments, the endogenous RGS protein in the host cell is mutated.
Upon treatment with a pheromone, such as alpha factor, the pheromone sensitive-promoter is activated, resulting in expression of the reporter gene. Expression of a functional RGS
protein inhibits activation of the pheromone-responsive promoter, resulting in a decrease in the expression of the reporter gene. The presence of a compound that inhibits RGS protein activity results in an increase in expression of the reporter gene.
Heterologous nucleic acid sequences are expressed in a cell by means of, for example, an expression vector or plasmid. An expression vector or plasmid is a replicable DNA
construct in which a heterologous nucleic acid is operably linked to one or more suitable control sequences capable of affecting the expression of the reproter protein or protein subunit coded for by the heterologous nucleic acid sequence in the intended host cell.
Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences that control the termination of transcription and translation.
In addition to plasmids, vectors useful for practicing the invention include viruses, and integrable DNA fragments such as insertion sequences and transposons that integrate into the host genome by genetic recombination. Viral vectors suitable for use in the invention include adenovirus, adeno-associated virus, herpes simplex virus, rous sarcoma virus, lentivirus, and sindbis virus. The vector may replicate and function independently of the host genome, as in the case of a plasmid, or may integrate into the genome itself, as in the case of an integrable DNA fragment, such as, for example, an insertion sequence or transposon.
Suitable vectors will contain replication and control sequences that are derived from species compatible with the intended host cell. For example, a promoter operable m a host cell is one that binds the RNA polymerase of that cell. Suitable replication and control sequences are well known to those of skill in the art.
Nucleic acids axe operably associated with a control sequence when they are functionally related to each other. For example, a promoter is operably linked to a nucleic acid if it controls the transcription of the nucleic acid. A ribosome binding site is operably linked to a nucleic acid if it is positioned so as to permit translation.
The pheromone-responsive promoter and the ligand used can vary widely as Iong as their specific interaction are lcrzown or can be deduced by available scientif c methods. Any of a variety of naturally occurring pheromone-responsive promoters, or synthetic pheromone-response element, or other pheromone-response-element-containing-gene could be used.
Preferably, the pheromone-responsive promoter is from FUS1, FUS2, KAR3, FUS3, STE3, STE13, STEI2, CHS1, FART, AGAl, AGA2, AGal, GPA1, STE2, STE3, STE6, MFAI, MFA2, MFal, MFa2, CIK1, LUCI, BAR1, or an omega element.
Preferably, the pheromone used in the invention is alpha factor, a factor, or an M
pheromone, although any pheromone or functional component that initiates changes in a yeast cell associated with the mating process (such as morphological changes, agglutiniation, morphogenesis, cell fusion, nuclear fusion, and so forth) is suitable fox use in this invention.
As used herein, "heterologous" refers to nucleic acids, proteins, and other material originating from organisms other than the cell of the invention, or combinations thereof not naturally found in the cells of the invention. This term also refers to nucleic acid that originates from the same orgazusm as the cell of the invention, but which has been modified in any way relative to the corresponding endogenous sequence.
Any G protein-coupled receptor system may be employed in practicing this invention.
Examples of such receptor systems include, but are not limited to, those related to adenosine receptors, somatostatin receptors, dopamine receptors, cholecystolcinin receptors, muscarinic cholinergic receptors, a-adrenergic receptors, (3-adrenergic receptors, opiate receptors, cannabinoid receptors, histamine receptors, growth hormone releasing factor receptors, glucagon receptors, serotonin receptors, vasopressin receptors, melanocortin receptors, and neurotensin receptors.
The reporter gene is generally selected in order that the interaction between binding of the ligand to its GPCR and the pheromone-responsive promoter can be monitored by well-known and straightforward techniques. Preferably, the reporter gene is selected based on its cost, ease of measuring its activity and low bacl~ground. That is, the activity can be determined at relatively low levels of expression of the reporter gene because of a high signal to bacl~ground ratio and/or a relatively low or no uninduced activity. The reporter can be any reporter for which its activity can be detected by any means available.
Illustrative of reporters that can be used in the present invention are luciferase genes, green fluorescent protein genes, derivatives of green fluorescent protein genes, or CAT.
Preferably, the activity of the reporter is indicated by colorimetric or fluorescent methods.
In a preferred embodiment, the reporter gene is a luciferase gene, for example, a luciferase gene from Reuilla f ehiformis or Photihus py~alis. Luciferase genes from other organisms are also well known to those of slcill in the art. A significant advantage conferred by the use of the luciferase reporter gene is that it enables a liquid assay that is rapid, thereby permitting high through-put screening of test samples. Additionally, use of the luciferase reporter in yeast provides enhanced assay sensitivity, enables gathering of quantitative data, and allows assay automation, especially for higher through-put (384 well) assay formats. The short assay time adds utility in drug screening applications in avoiding compound toxicity effects due to long (48+ hours) incubation times presently needed for standard auxotrophic (HIS3, LYS2, URA3) reporters or counter selection (CANT, URA3, CYH2) reporters, both of which require cell growth for endpoint determinations.
Illustrative of RGS proteins which can be used in this invention are proteins containing an RGS domain such as RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3, RGS4, RGSS, RGS6, RGS7, RGSB, RGS9-1, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14, RGS16, RGS-PX1, GAIP, Axin, Conductin, egl-10, eat-16, p115RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain, for example, PLCB, gamma subunit of cGMP PDE.
Both 2 micron and low copy number (CEN) versions of pheromone-responsive promoter-reporter gene constructs can be made to enable further control over reporter gene function or assay sensitivity by manipulation of the reporter gene copy number within a cell.
Molecular cloning techniques are carried out using standard methods, for example, those described by Ausubel et al., 1998. Restriction digests are performed as to manufacturers' specifications. Where appropriate to the cloning scheme, cDNA
fragments were end-filled to generate blunt ends using I~lenow according to standard techniques.
Dephosphorylation of cDNA fragments and/or vectors was conducted using Shrimp Alkaline Phosphatase (SAP) according to manufacturers' instructions (Boehringer Manheim or Amersham Life Science). Ligation reactions were conducted using standard techniques, and recombinant vectors were transformed into Esche~ichia coli DHSalpha cells and plated on LB-agar plates containing appropriate antibiotic(s). Colonies were recovered and plasmid DNA prepared using either DNA midi prep lcits, or automated DNA preparation (Qiagen).
Integrity of plasmids and cloning strategies were confirmed using reagents from Perlcin-Elmer, and automated sequencing equipment from ABI. Yeast strains were transformed using a Lithium Acetate procedure and plated on appropriate media (Rose et al., 1990). All yeast media and reagents were prepared using standard methods.
The novel modified cells of this invention are readily applied in various screening methods for determining the expression of the reporter gene in the presence of test compounds. The screening methods of this invention are designed to detect compounds that interact with the ability of the RGS protein to modify the G protein response pathway as determined by an alteration in the activity of the reporter gene. The test compound may be a peptide, which is preferably about two amino acids in length, or a non-peptide chemical compound. The non-peptide test compounds includes compounds, complexes and salts as well as natural product samples, such as plant extracts, tissue extracts, and materials obtained from fermentation broths.
In a prefeiTed embodiment of the invention, cells were developed in which RGS
activity can be monitored. In one example, the luciferase gene was linlced to a pheromone-responsive promoter, FUS 1. This FUS 1-luciferase reporter gene was expxessed in a yeast cell in which the endogenous RGS protein, Sst2, was deleted or expressed in a yeast strain wherein the endogenous sst2 gene contains a mutation rendering it functionally equivalent to a sst2 deleted strain. In the "test" cells, a plasmid was added expressing the mammalian RGS4 protein, while "control" cells were transfected with plasmids lacking the RGS4 gene.
The test and control cells were treated with the alpha factor ligand, which binds to the receptor and stimulates the cellular cascade to drive the FUS 1 promoter and expression of the luciferase reporter gene. In the control strain, a high level of luciferase was expressed, resulting in strong luminescence in the presence of the substrate. Conversely, the yeast strain containing the RGS4, which negatively regulates the signal cascade, demonstrated a greatly diminished activity of the FUS 1-luciferase reporter gene. These findings correlated with previous findings using other reporters such as ~i-gal activity or auxotrophic markers.

These yeast cells can be used in a number of ways to investigate or discover factors that interact with RGS proteins. For example, a test compound can be added to the test strain containing the vector expressing the RGS4 protein. If the factor interacts with the RGS4 protein, it will blocl~ or enhance the RGS4 protein function, thus affecting the RGS protein ability to negatively regulate the signal induced from alpha factor/receptor interaction. The alpha factor signal stimulation will then be available (prolonged in its ability) to reduce expression of the reporter gene, resulting in a high level of luminescence.
Alternatively, a compound that enhances RGS function will reduce reporter gene expression.
Compounds that demonstrate an increase in Iuciferase activity within the test (RGS4-expressing) strain in comparison to the control strain are considered to be potential drug candidates. Compounds that result in an increase in luciferase activity in the test strain of approximately 50% (or some other suitably determined percentage) over that seen for a vector control cell can be tested in a dose response assay.
These types of RGS assays show great potential in drug discovery. They are very sensitive, have a short testing period, and are ideal for high through-put systems used in large scale drug discovery. In addition, the luciferase-RGS assay may be used to identify ligands for orphan G-protein receptors, and could be used to study or screen other members in G-protein pathways, such as kinases.
The following Examples are provided to further illustrate various aspects of the present invention. They are not to be construed as limiting the invention.
Example 1. FUSl-LacZ reporter RGS assay:
Stimulation of the GPCR receptor by alpha factor in yeast is well characterized (see Dohlman et al., 1996). Stimulation of this pathway usually results in yeast cell cycle arrest.
This signaling pathway is controlled by an endogenous RGS protein, Sst2, which functions as a negative regulator of GPCR signaling. The RGS protein acts to accelerate the endogenous GTPase activity of the Ga,-subunit. Deletion of the gene encoding Sst2 in yeast results in yeast cells that are supersensitive to the ligand, since the ability to turn off the GPCR signal is impaired. A mammalian RGS protein, RGS4, can functionally complement for Sst2 in yeast.
In the present experiment, reporter gene activity was measured in yeast strains deleted for sst2 in the presence or absence of the mammalian RGS4 protein. In this assay, we tested whether the RGS4 protein could modulate the alpha-factor-induced pheromone-response pathway leading to activation of pheromone-responsive genes. A lacZ gene was operably linked downstream to the pheromone-responsive promoter (FUS1-lacZ reporter gene) and expressed in a cell, such as a MATa cell, capable of responding to the pheromone alpha factor.
A plasmid (Kp27) comprising the FUS-1 promoter and the LacZ reporter gene was prepared. This plasmid was generated by digestion of pRS424 plasmid [Stratagene] with .~YhoI and EagI. The FUS1-promoter region (GenBank M16717) was generated as a 1.095kb EcoRI-SaII fragment while the 13-galactosidase gene (GenBank CVU89671) was generated as a 3.Olcb SaII-EagI fragment. A three-way, directional ligation was conducted between the prepared pRS424 vector, the FUS 1 fragment and the 13-galactosidase fragment using standard methods to generate plasmid Kp27. Recombinant DNA was transformed into E. coli and DNA from selected transformants was prepared by standard methods. The Kp27 construct was confirmed by restriction digests and sequence analysis.
We also prepared plasmid constructs encoding the RGS4 protein. The cDNA
encoding full-length rat RGS4 (Genbank AF117211) was obtained by PCR using plasmid pWE2RGS4 as a template (Shuey et al., 1997) with the following primers:
Kx 13 (forward) 5'-GACGTCTCCCATGTGCAAAGGACTCG (SEQ ID NO: 1) which contains an embedded BsmBI site and part of a NcoI sequence; and Kx41 (reverse):
5'-CGGGATCCTTATTAGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 2) which contains an extra stop codon and the embedded BamHI site.
To construct a hemagglutinin-tagged ("HA") RGS4, a different 3'primer was used which lacks the stop codon, but contains an embedded BamHI site:
Kx42(reverse): 5'-GAGGATCCGGCACACTGAGGGACTAGGGAAG (SEQ ID NO: 3) The PCR products (approximately 650 bp) were digested with BsmBI and Baf~zHI
and ligated to vectors Kp46 or Kp57 for untagged and HA-tagged RGS4 protein expression, respectively. The resultant plasmids Kp118 (RGS4-Kp46) and Kpl 19 (RGS4-Kp57) were transformed into bacterial cells. Recombinant DNA was prepared and confirmed by sequence analysis using the following primers:
Kx43: 5'-TTTTTACAGATCATCAAGGA (SEQ ID NO: 4) Kx44: 5'-TGCGTCTTGAGAGCGCTTTT (SEQ ID NO: 5) Kx39: 5'-GAGCCAAGAAGAAGTCAAGAAAT (SEQ ID N0: 6) Kx40: 5'-TGGGCTTCATCAAAACAGG (SEQ ID N0: 7) To generate a yeast strain in which the endogenous RGS protein, SST2, was deleted, a SST2::NE0 construct was obtained from LEU marked plasmid pEKI39/I38 by digestion with NhoI and SacI. The resulting 4.0 kb fragment containing the sst2-NEO-sst2 cassette was gel isolated and purified. ,Tlus cDNA fragment was co-transformed into yeast strain CY770 (MATa leu2-3,112 ura3-52 trill-901 his-200 ade2-101 gal4 ga180 lys2::GALuas-HIS3 cyhR;
Young, et al., 1995) with URA marked pRS416 (Stratagene) to enhance integration.
Following transformation, yeast cells were grown in YPD medium and plated on SC-ura media., Resultant URA+ yeast colonies were sequentially replica plated onto YPD media containing SOug/ml, and then with 100 ug/ml 6418 (Geneticin from BRL). The resistant CY770 yeast colonies were confirmed by PCR analysis to verify the sst2 NEO-sst2 construct integration. The primers used for PCR verification were the following:
Kx24: 5'-TATCGAGTCAATGGGGCAGGC (SEQ ID NO: 8) Kx25: 5'-CGAAACGTGGATTGGTGAAAG (SEQ ID NO: 9) Kx26: 5'-ATTCGGCTATGACTGGGCACAAC (SEQ ID NO: I O) Kx27: 5' GTAAAGCACGAGGAAGCGGTCAG (SEQ ID NO: 11 A 4.2 lcb PCR fragment was expected from Kx24 and Kx25 primers for a confirmed Icnoclcout strain, while a 4.9 lcb PCR product was expected for the wildtype (non-lcnockout) yeast strain. A 2.6 kb PCR product was expected from Kx24 and Kx27 primers for a confirmed knockout stain, while no PCR product was expected from the wildtype (non lcnoclc-out) strain. A 2.4 lcb PCR product was expected from Kx25 and Kx26 primers for a confirmed lcnoclcout strain while no PCR product was expected from the wildtype (non knock-out) strain.
Following PCR verification, candidate yeast colonies were plated on SC-ura plates to confirm the loss of the pRS416 plasmid used to facilitate integration. To test the ability of the RGS4 protein to complement the loss of the Sst2 protein, 6418 resistant, ura-minus colonies were tested for response to alpha factor stimulation using pheromone-response halo assays (Dohlman et al., 1996). Results are depicted in Figures 1, 2A and 2B, which show halo assays and dose curves, respectively, in two yeast backgrounds. One of the tested and confirmed CY7700sst (knockout) yeast colonies was designated KY103 (MATa leu2-3,112 ura3-52 trill-901 his-200 ade2-101 gal4 ga180 Lys2::GALuas-HIS3 cyhR , sst2, G418R).
Similarly, yeast strain YPH499 (American Type Culture Collection, Manassas, VA) was deleted for the sst2 gene and designated KY113 (MATa ura3-52 lys2-801a ade2-lOlo trpl-D63 his3-D200 Ieu2-Dl, sst2).
Pheromone-responsive yeast test strains were generated using a Li-acetate method (Rose et al., 1990) and plated on plasmid retention media. Plasmids Kp118 (RGS
expression plasmid) and Kp27 (FUS I-lacZ reporter plasmid) were transformed into KY103.

Control yeast strains were prepared by co-transforming empty expression plasmid Kp46, which lacks an RGS-encoding sequence, and reporter plasmid Kp131 into strain KY103 to generate yeast strain Ky116, and into strain KY113 to generate strain KY118.
To see if the RGS4 protein interfered with pheromone-induced transcription of the 13-galactosidase gene, yeast having the RGS4 construct and control yeast having an empty vector were treated with alpha factor (25 nM). Expression of RGS4 in strain KYl 17 desensitized the pheromone-induced LacZ signal (data not shown). Expression of RGS4 also rescued pheromone-induced growth arrest.
Example 2. FUS1-luciferase reporter RGS assay:
Example 1 confirmed that a plasmid generated with the desired baclcbone and pheromone-responsive FUS 1 promoter operably liuced upstream of the LacZ gene could be used to study the activity of an RGS protein. In this experiment, a luciferase gene was linked downstream to the FUS 1 promoter instead of the lacZ gene. This luciferase system provides certain advantages over the system with the lacZ reporter gene, most notably increased speed and ease of monitoring gene expression.
A FUS-1 reporter plasmid (Kp120) comprising a luciferase gene was constructed.
The FUS 1-luciferase reporter cassette was constructed by an NcoI Xba I
digestion of plasmid pGL (Promega) to isolate a 1.7 kb fragment containing the firefly luciferase gene.
This fragment was blunt ended and purified. The Kp27 vector served as the base vector and was prepared by digestion with BamHI-NotI (to remove the LacZ gene), dephosphorylated, blunt-ended, and purified. The prepared vector and luciferase fragment were ligated to generate plasmid Kp 120. This cloning scheme resulted in an expected four extra amino acid residues (methionine, alanine, glycine, serine) fiom the original Kp27 vector that were fused in frame to the N-terminus of the luciferase ORF. The BaynHI and NcoI
restriction sites were retained. The plasmid Kp120 construct was confirmed by DNA sequencing using primers:
Kx45: 5'-ATATAAGCCATCAAGTTTCTG; and (SEQ ID NO: 12) Kx46: 5'-CTCACTAAAGGGAACAAAAG (SEQ ID NO: 13) Plasmid constructs encoding the RGS4 protein and yeast strains in which the endogenous RGS protein (SST2) was deleted were prepared as described in Example 1.
Pheromone-responsive yeast test strains were generated using the Li-acetate method (Rose et al., 1990) and plated on plasmid retention media. Transformation of plasmids Kpl 18 (RGS expression plasmid) and Kp131 (FUS1-luc reporter plasmid) into yeast strain KY103 generated yeast strain KYl 15. Kp131 was derived from Kp120. Briefly, the FUSl-luciferase reporter cassette was excised from Kp120 using KpnI and SacI
restriction enzymes.
The 2.8 kb fragment was gel purified, blunt ended and ligated into pRS416 to generate Kp 131. Kp 118 and Kp 131 were also co-transformed into KY 113 to generate yeast strain KY117.
Control yeast strains were prepared by co-transforming empty expression plasmid Kp46 and reporter plasmid Kp131 into KY103 to generate yeast strain Ky116, and into strain KY113 to generate strain KY118.
To determine if the RGS4 protein interferes with pheromone-induced transcription of the luciferase protein, yeast having the RGS4 construct and control yeast having an empty vector were treated with alpha factor (25 nM). Results using the KYl 13-based strains KY117 (RGS4) and KY118 (control) are shown in Figure 3. This figure shows that the RGS4 protein likely interacts with the yeast Ga subunit (Gpalp), causing the alpha factor-induced luciferase signal to decrease. Strong luminescence was seen with the control strains lacl~ing the RGS4 protein. In contrast, weak luminescence was seen in the yeast strain expressing the RGS4 protein. Pheromone-responsive luciferase activity was observed in yeast strains generated from both base yeast strains KY103 and KYl 13.
However, the response of KY113-based yeast strains was slightly stronger (data not shown) and therefore these strains are more sensitive.
These findings correlated with the findings set forth in Example 1, in which we monitored 13-gal activity. Dose response curves for the luciferase system, shown in Figures 4A and 4B, reveal that luciferase works as well as lacZ as a reporter gene.
Additionally, the luciferase reporter is more sensitive than beta-galactosidase since the fold-increase is higher (data not shown).
Example 3. Low copy version of the FUS1-luciferase reporter.:
As an alternative to the 2um version of the FUS 1-luciferase reporter constructs discussed previously, a low copy number (CEN) version of the luciferase construct of Example 2 was made. The CEN version of the pheromone pathway responsive FUS 1-luciferase reporter was generated by digestion of plasmid Kp120 with KphI and SacI to isolate a 2.8 kb fragment containing the FUS 1 promoter and the luciferase gene reporter cassette. Plasmids pRS414 and pRS416 (Stratagene) were each digested with KpnI
and SacI
and gel purified. Standard ligations were performed to generate two additional luciferase recombinant plasmids; Kp133 (TRPl marked) and Kp135/Kp131 * (URA3 marked). Bacterial transformation and generation of plasmid DNAs were performed by standard methods. Plasmids were confirmed by DNA sequencing. Plasmid Kp131 represents a similar construct to Kp135, but was generated independently using a different cloning scheme.
The CEN versions of the reporter gene were tested in a pheromone response assay.
These versions were found to function in the pheromone response assay and to provide a suitable signal-to-noise ratio (data not shown), Example 4. Incorporating alternative reporter genes:
A variety of reporter genes can be used in the system. Illustrative of reporters that can be used in the present invention are reporter genes such as luciferase genes from species other than firefly, green fluorescent protein gene, or CAT. For example, a Renilla Iuciferase gene reporter can be used as an alternative to a firefly luciferase reporter. To construct these, the open reading frame encoding for Renilla luciferase was cloned into the pheromone-responsive reporter plasmids described in Examples 1 or 2 to generate FUS 1-RenLuc. High (2 micron) and low (CEN) copy number plasmids were generated in an analogous manner to that described for firefly luciferase reporter genes.
Example 5. RGS-assay-single point drug screen:
The validated strains described above were used for the identification of small molecules that modulate the activity of the co-expressed mammalian RGS
protein. A
schematic of the screen is shown in Figure 5. Yeast strains with the RGS
expression plasmid and a control strain were used to test for small molecules that modulate the function of RGS4, resulting in an increase in luciferase activity. On the basis of molecular modeling, a subset of molecules in a library of test chemicals was tested in single point assays.
Compounds that demonstrated an increase in Iuciferase activity in the test (RGS4) strain in comparison to the control strain were "positive" and were considered interesting candidates for further study.
Specifically, yeast strains containing either the RGS expression plasmid (KYl 17), or the control baclcbone vector (stain KY118) were inoculated into appropriate media (SC-leu-trp) and incubated overnight at 30°C. The cell density of these fresh yeast cultures was determined by OD6oo and cells were diluted to OD6oo of 0.05 in appropriate growth media (SC-leu-trp). 150 ~,1 of cell suspension was seeded into the wells of a 96 well microtitre plate, and approximately 1 ~.1 of stock test compound (1 Omg/ml) was transferred to individual wells using a replicator.
Test compounds were incubated with the cells for 3 hours at 30°C. The cells were then stimulated with ligand (10 ~,1 alpha factor (200 nM stock in l OX
solution) to a final concentration of 20 nM). The plate was shaken briefly and incubated for 2 hours at 30°C.
100 ~d LucLite substrate (Paclcard) was added to each well, and the plate was sealed and shaken at room temperature in the dark for 1 hour. Luminescence was determined using a Top Count (Paclcard) for 2 seconds.
Results of single dose assays of 96 compounds is shown in Figure 6. Each compound was added to two yeast strains: an RGS4 strain (Fig. 6A) and a control vector strain (Fig. 6B).
The difference in luminescence (fold) is calculated as counts per second(RGS)/counts per second(vector) (Fig. 6C). A compound with a fold increase in luminescence higher than the average is considered a candidate as a RGS bloclcer.
Example 6. RGS-assay-Dose response assay of potential drugs:
Compounds causing an increase in luciferase activity in the test strain of approximately 50% over that seen in the control strain in the single point assay (Example 5) were then tested in a dose response assay.
A yeast strain containing the RGS expression plasmid (I~Y117), and a control yeast stain containing the baclcbone vector (I~Y11 ~) were inoculated in appropriate media (SC-leu-trp) and incubated overnight at 30°C. The cell density of fresh yeast cultures was determined by OD6oo and cells were diluted to an OD6oo of 0.05 in appropriate growth media (SC-LT).
Aliquots of 150 p1 of suspended cells were dispensed into Row A of a 96 well micxotiter plate. DMSO was added to the remaining yeast cells to a final concentration of 3% and 100 ~.1 of cells was seeded into the remaining wells of the 96 well plate. Test compound (4.5 ~1) was added to the cells in Row A, resulting in a final concentration of 900 ~,M, mixed, and 50 ~,1 was transferred from Row A into Row B, and mixed well. Subsequently 50 ~,1 was transferred from Row B into Row C, and so forth through Row G to create a serial dilution within a column of the 96 well plate. This established an 8 point dose response curve with all wells containing 3% DMSO.
Cells and test compound were incubated at 30°C for 4 hours, then 10 ~.1 of ligand (alpha factor in 200 nM stock l Ox solution) was added to a final concentration of 20 nM.
The plate was shaken briefly and incubated for 2 hours at 30°C. 100 ~,l of LucLite substrate was added to each well, and the plate was sealed and shaken at room temperature in the dark for 1 hour. Luminescence was determined using a Top Count (Paclcard) for 2 seconds.
Results for four test compounds are shown in Figures 7A-D. Compound SBQBB 1 demonstrated the ability to greatly affect RGS4 function.
Example 7. Functional complementation by additional mammalian RGS proteins.
Previously, it had been demonstrated that mammalian RGS4 is able to complement SST2p to enable S. ce~evisiae to recover from alpha factor stimulation that did not result in productive mating. The RGS protein accelerates the endogenous GTPase activity of the yeast G-alpha protein, Gpal . Previous data support only RGS4 as capable of functionally replacing SST2. To investigate the overall utility in using the pheromone-response pathway to investigate the function of mammalian RGS proteins, RGSZI and RGS2 were also expressed in the sst2 lmockout strain containing the pheromone-responsive luciferase reporter gene (FUS1-luc) previously described.
General cloning: cDNA encoding the various mammalian RGSZl and RGSZ2 proteins were subcloned into vector p426-TEF (ATCC #87669). This vector [6359 bp, URA3, 2mu-ori, TEFp-CYClt, REP3, AmpR] contains an elongation factor 1-alpha promoter from S
cerevisiae (see Genbank YSCEF1AB for sequence) and is suggested to be 5-fold stronger than the ADH promoter (Mumberg et al., Gene, 156:119). Designated cDNA inserts were generated using standard methods for polymerase chain reaction, restriction digests, ligations, and transformation into DHS-alpha E.coli cells. DNA was prepare using Qiagen preps, confirmed by restriction digest, and DNA sequence analysis. The resulting constructs were sequenced at 5'-end junction site. The sequencing primer is Kx65:
5'-TCAGTTTCATTTTTCTTGTTCTAT (SEQ. ID. NO: 14) This primer hybridizes to the TEF promoter region.
Human RGSZl:
RGSZ1 cDNA was prepared using a 26 by 5' forward oligonucleotide primer containing an embedded SAM HI restriction site:
5'-GC ggatccATGGGATCAGAGCGGATG (SEQ. ID. NO: 15) and 27 by 3' reverse oligonucleotide primer containing an embedded CIaI
restriction site and a stop codon:
5'-CG atcgattaCTATGCTTCAATAGATT (SEQ. ID. NO: 16).
These primers were used in a standard PCR reaction, using a previously described RGSZ1-pACT recombinant vector as template. A 650 by fragment is obtained that encodes the full-length RGSZ1 (Genbank AF079479) and contains the endogenous start and stop codons.
The PCR product was gel purified, digested with BamHI and ClaI restriction enzymes, and ligated into the prepared BamHI and CZaI sites of p426TEF. Restriction digest analysis using HincII alone, SphI alone, or SalI+SphI, confirms the direction of the cDNA
insert. The resulting plasmid, pTEF426-RGSZ1, is designated Kp140 (also known as pKHY55) and Kp 141 (also known as pKHY56).
_27_ Human RGS2:
Human RGS2 cDNA (Genbank NM 002923) was obtained by PCR amplification from a human whole brain library using a 21 by forward 5' oligonucleotide primer with an embedded NotI site:
5'-CCAGCGGGAGAACGATAATGC (SEQ. ID. NO: 17) and a 19 by 3' reverse oligonucleotide primer with an embedded BamHI site:
5'-CCCCTCAGGAAAAGAATG (SEQ. ID. NO: 1 &) The 705 by PCR product was ligated in the pCRII vector (Invitrogen), to generate pKHY146 (hRGS2-pCRII). pKHY146 was transformed into bacterial cells following vendor instructions, plasmid DNA prepared and sequence confirmed. The hRGS2 cDNA was excised from pKHY146 using NotI and BamHI and subcloned into the prepared NotI
and BamHI sites of pcDNA3.I (Invitrogen). The resulting recombinant plasmid (hRGS2-pcDNA3. I) is designated pKHY150. The pKHYI50 was digested with PmeI and a 650 by fragment was isolated, gel purified, and used in a blunt end ligation into the prepared SmaI
site of p426TEF, to generate the recombinant plasmid hRGS2-pTEF426 and two resulting (sibling) recombinant plasmids designated Kpl3~ (also known as pKHY53) and Kp139 (also lazown as pKHY54). Orientation of the hRGS2 cDNA insert was determined by restriction digest analysis using PstI or HindIII.
Generation of strains: These RGS constructs were transformed into yeast KY113;
the FUS1-Iuciferase reporter (Kp120) was also co-transformed into KY113. The resulting yeast strains are designated as follows:
_2g_ Table 1 Strain plamid nso ltnownRGS
as KY199 Kp138 .pKHY53 RGS2 KY200 Kp139 .pKHY54 RGS2 KY201 Kp140 .pKHY55 RGSZ1 KY202 Kp141 .pKHY56 RGSZ1 KY21I p426TEF

~KY212 ~p426TEF

Three colonies from each yeast transformation were picked and streaked onto SC-Ura-Trp plates. Two of the three colonies were tested in the pheromone-response assay (as previously described) to measure luciferase reporter gene activity. Briefly, 100 ~.I of 0.1 OD6oo overnight culture was stimulated by alpha factor in concentrations of 25 or 225 ng for 2 hours at 30C. The same culture was also subjected to pheromone-response halo assay (as previously described) . CeII lawn (made from 0.3 OD6oo culture) on SC-Ura-Trp agax plates was stimulated with alpha factor in concentrations of 50 or 250 ng per each spot. The plates were incubated at 30°C for about 40 hours, and then observed for halo formation.
Results:
Results of the halo assay are depicted in Figure 8 and results for the luciferase reporter assay are depicted in Figures 9A and 9B. Yeast strains expressing demonstrated smaller halos and decreased luminescence compared to yeast strains expressing the empty vector, thus indicating complementation of sst2 in yeast. Additional dose response curves and more detailed halo assays (alpha factor at 431, 48, 5.3, or 0.6 ng per spot, or 431, 144, 48, or 16 ng per spot) were done for these strains. Responses from RGSZ1-expressing strains were not as robust as that observed previously from strains expressing RGS4. This suggests that RGSZ1 displays 33% of the response observed with RGS4 (1/8 vs.
1/27 fold when compared to its control vector).
The yeast strain expressing RGS2 demonstrates halos that are slightly smaller than the halos observed for stains expressing the vector only. Strains expressing RGS2, however, demonstrate decreased luminescence in comparison to control strains (especially at 62 nlVn, which is suggestive of functional complementation of sst2.
Human RGS7:
Full length human RGS7 (Genbanlc AF090116) was obtained from a human brain cDNA library (Clontech) by PCR amplification using a 20 base forward oligonucleotide primer with an embedded NotI site:
5'-CTTGGCGGAGGAGGGCACAC
(SEQ ID NO: 19) and a reverse 22 base oligonucleotide primer having an embedded BamHI site:
5'-TGGAGGCATTGAGACGGAAGA (SEQ ID NO: 20) The resulting 1698 by PCR product was restriction digested with appropriate enzymes and ligated into the NotI and BamHI sites of pcDNA3.1. The resulting recombinant vector (hRGS7-pcDNA3.1) is designated pI~HY126, and was confirmed by restriction digests and sequence analysis. pI~HY126 was digested with PmeI, a 1.5 kb fragment was isolated, gel purified, and blunt ligated into the SmaI site of p426TEF. The orientation of the hRGS7 cDNA insert was determined by restriction digest analysis using XbaI, Fli~cdIII, or ClaI and SacI. Two sibling isolates of the confirmed hRGS7-pTEF426 plasmid were designated I~p144 (also known as pI~HY59) and I~p145 (also known as pKHY60).
A second hRGS7 clone was generated that encodes from the G-gamma like ("GGL") domain to the end of the protein. This GGL-hRGS7 cDNA was generated by PCR
using a 27 base forward oligonucleotide primer containing an embedded BamHI site and a start codon:
5'-GCGGATCCATGAAACCTCCAACAGAAG (SEQ ID NO: 21) and a 26 base reverse oligonucleotide primer containing an embedded CIaI site and exogenous stop codon:
5'-CGATCGATTATTAGTAAGACTGAGCA
(SEQ ID NO: 22) with pKHYl26 as template. The resultant PCR product is 660 by and encodes from amino acid sequence KPPT to the terminal amino acid. The 650 by PCR product was digested with the appropriate enzymes, isolated, gel purified, and directionally ligated into the BamHI and CZaI site of prepared p426TEF vector (ATCC). Recombinant plasmids were confirmed by restriction digests using NcoI and 6Yhh~I, XbaI alone, or CIaI and Ncol. Two sibling isolates of the recombinant plasmid (GGL-hRGS7-p426TEF) were designated I~p142 (also known as pKHY57) or I~p143 (also known as pI~HHY58).
Human RGS9:
Full length human RGS9 (Genbank AF071476) was obtained from a human brain cDNA library (Clontech) by PCR amplification using a 40 base forward oligonucleotide primer with an embedded HindIII site:
5'-GCAAGCTTCCACCATGACAATCCGACACCAAGGCCAGCAG (SEQ ID NO: 23) and a 39 base reverse oligonucleotide primer with an embedded ~'baI site:
5'-GCTCTAGATTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 24) The resulting 2.0 kb PCR product was restriction digested with appropriate enzymes, and ligated into the Hi~dIII and XbaI sites of pWE3 to generate recombinant vector hRGS9-pWE3. The construct was confirmed by restriction digests and sequence analysis. hRGS9-pWE3 was used as template with a forward oligonucleotide primer containing an embedded BanZHI site:
5'-CCGGATCCAGATGACAATCCGACACCAAGGCCAGC (SEQ ID NO: 25) and a reverse oligonucleotide primer containing an embedded ~'hoI site:
5'-CGCTCGAGTTACAGGCTCTCCCAGGGGCAGATGACC (SEQ ID NO: 26) were used to generate a 2.0 kb fragment using standard PCR methods. The hRGS9 PCR
product was digested with the BarnHI and.XhoI, purified and directionally ligated into the prepared BamHI and XhoI sites of pACT2 to generate the plasmid PACT-hRGS9, which was confirmed by sequence analysis. The cDNA encoding full length hRGS9, containing endogenous start and stop codons, was excised from pACT-hRGS9 using BamHI and lihoI
restriction enzymes to obtain a 2.0 lcb fragment. The 2.0 lcb fragment was isolated, gel purified, and directionally ligated into the prepared BamHI and ~'hoI sites of vector p426TEF.
The resulting recombinant plasmids (hRGS9-TEF426) were confirmed by restriction digest with BamHI and SpYcI and designated Kp148 (also known as pKHY63) and Kp149 (also known as pKHY62).
A second hRGS9 clone was generated that encodes from the G-gamma lilce (GGL) domain to the end of the protein. This GGL-hRGS9 cDNA was generated by PCR
using a 28 base forward oligonucleotide primer containing an embedded BamHI site and a start codon:
5'-GCGGATCCATGAAGAAACAAACAGTCGT (SEQ ID NO: 27) a~zd a 26 base reverse oligonucleotide primer containing an embedded CIaI site and exogenous stop codon:
5'-CGATCGAATTATTACAGGCTCTCCCAG (SEQ ID NO: 28) with Kp148 as template.
The resulting PCR product is a 1.4 lcb fragment. The cloning strategy is similar to that described for GGL-RGS7, such that the 1400 by PCR product was digested with appropriate enzymes, isolated, gel purified, and directionally ligated into the BamHI and ClaI
sites of prepared p426TEF vector (ATCC). Recombinant plasmids were confirmed by restriction digests with SacI alone, EcoRI alone, SaII alone, or BamHI and SphI to confirm direction. Two sibling isolates of the recombinant plasmid (GGL-RGS9-p426TEF) were designated Kp146 (also known as pKHY61) and Kp147 (also known as pKHY62).

Generatation of strains: The above RGS constructs were transformed into yeast KYl 13.
The FUS1-luciferase reporter (Kp120) was also co-transformed into this yeast strain. The resulting yeast strains axe designated as follows:
Table 2 Strain plamid also knownRGS
as KY199 Kp138 .pKHY53 RGS2 KY200 Kp139 .pKHY54 RGS2 KY201 Kp140 .pKHY55 RGSZ1 KY202 Kp141 .pKHY56 RGSZl KY203 Kp142 .pKHY57 RGS7(GGL) KY204 Kp143 .pKHY58 RGS7(GGL) KY205 Kp144 .pKHY59 RGS7(full)) KY206 Kp145 .pKHY60 RGS7(full) KY207 Kp146 .pKHY61 RGS9(GGL) KY208 Kp147 .pKHY62 RGS9(GGL) KY209 Kp148 .pKHY63 RGS9(full) KY210 Kp149 .pKHY64 RGS9(full) KY211 p426TEF

KY212 p426TEF

Three colonies from each yeast transformation were picked and streaked onto SC-Ura-Trp plates. Two of the three colonies were subjected to pheromone response assay (as previously described) to measure luciferase xeporter gene activity. Briefly, 100 ~.1 of 0.1 OD6oo overnight culture was stimulated by alpha factor in concentrations of 25 or 225 ng for 2 hours at 30C. The same culture was also subjected to pheromone response halo assay (as previously described). Cell lawn (made from 0.3 ODdoO culture) on SC-Ura-Trp agar plates was stimulated with alpha factor in concentrations of SO or 250 ng per spot.
The plates were incubated at 30C fox about 40 hours, and observed for halo formation.
Results:
Results for the luciferase reporter assay are depicted in Figures 9A-D and results of the halo assays are depicted in Figure 8. Yeast strains expressing RGSZl demonstrated smaller halos and decreased luminescence than yeast strains expressing the empty vector, indicating complementation of sst2 in yeast. Additional dose response curves and more detailed halo assays (alpha factor at 431, 48, 5.3, and 0.6 ng per spot, or 431, 144, 48 orl6 ng per spot) were done for these strains. Responses from RGSZ1 expressing strains were not as robust as that observed previously from strains expressing RGS4, suggesting that RGSZ1 displays 33% of the response observed with RGS4 (1/8 vs.l/27 fold when compared to its control vector).
The yeast strain expressing RGS2 demonstrates halos that are slightly smaller that the halos observed for stains expressing the vector only. Strains expressing RGS2, however, demonstrate decreased luminescence in comparison to control strains (especially at 62 nM), and is suggestive of functional complementation of sst2. The yeast strain expressing either the full length or the GGL+RGS C-terminal of RGS7 demonstrated halos and luminescence that were similar to negative control strains, suggesting that this form of RGS does not easily provide functional complementation of sst2. The yeast strains expressing either the full length or the GGL+RGS C-terminal of RGS9 demonstrate halos that are similar to negative control strains. There is some indication, however, of decreased luminescence in strains expressing full length RGS9 in comparison to negative control strain.
Example 8: co-expression of human GbetaS
RGS7 and RGS9 are longer RGS proteins being 469 and 673 amino acids, respectively, and are within a subclass of the RGS protein family, together with RGS6 and RGS 1 l, that contain a DEP domain, and the highly conserved GGL domain that binds GbetaS
(Snow et al., 1999). RGS7 and RGS9 demonstrate a high level of homology within the GGL
domains. RGS6 and RGS7 have 80% homology in the DEP domain, but RGS7 and RGS9 have only 50%. Present worlc in the RGS field suggests that this subclass of GGL-domain-containing RGS proteins would function similarly. Our findings, however, suggest that these, and potentially members of other subclasses of RGS proteins may not display identical functionality. The GGL domain has been demonstrated to bind the heterotrimeric G-protein GbetaS, with suggestions that the GGL-RGS/GbetaS interaction may be impot-tant for proper folding of both proteins, and functionally relevant. GbetaS is the most distinct isoform of the Gbeta proteins, and is highly expressed in the brain. The homology between GbetaS and the yeast Gbeta (STE4) is <40%. Therefore, we co-expressed human GbetaS with RGS7 or RGS9 (or RGS4 as a control) in yeast to determine whether human GbetaS would enable the GGL-domain-containing RGS proteins to functionally complement sst2.
The cDNA encoding human GbetaS was obtained by PCR using a 39 base forwaxd oligonucleotide primer containing an embedded Hi~dIII site:
5'-GCCCAAGCTTCCGCCAGCCATGGCAACCGAGGGGCTGCA (SEQ ID NO: 29) and a 24 base reverse oligonucleotide primer containing an embedded XhoI site:
5'-CCGCTCGAGTTAGGCCCAGACTCT (SEQ ID NO: 30) and hGBetaS recombinant vector as template (Liang et al., 2000). The hGbetaS
PCR product was digested with Hi~cdIII and XhoI, gel purified, and ligated into Hi~dIII
and ~'hoI digested p425TEF. The resulting recombinant vector was confirmed by sequence analysis and designated hGbetaS-p425TEF. This vector was co-transformed with the FUS1-luciferase reporter plasmid (Kp 120), and previously described recombinant plasmids encoding RGS2, RGS4, RGS7, RGS9, and RGSZ1, or empty plasmid control vectors) into yeast strain KY113. The resulting yeast strains containing the combination of plasmid are surmnarized in the following table.
Table 3 Strain RGS plasmid GbetaS plasmidReporter plasmid #

ySAl P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase ySA2 P426TEF RGS P425TEF hGBetaSKp 120 Firefly 4 luciferase ySA3 P426TEF RGS P425TEF hGBetaSKp120 Firefly Iuciferase Z

ySA4 P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase ySAS P426TEF RGS P425TEF hGBetaSKp120 Firefly luciferase ySA6 P426TEF RGS P425TEF Kp120 Firefly luciferase ySA7 P426TEF RGS P425TEF Kp120 Firefly luciferase ySA8 P426TEF RGS P425TEF Kp120 Firefly luciferase Z

ySA9 P426TEF RGS P425TEF Kp120 Firefly luciferase ySAlO P426TEF RGS P425TEF Kp120 Firefly luciferase ySA21 P426TEF P425TEF Kp120 Firefly luciferase ySA38 P426TEF P425TEF hGBetaSKp120 Firefly luciferase The strains were tested for activity in pheromone-responsive halo assays and luciferase reporter assays, as previously described. The results from the halo assays are depicted in Figure 10 for RGS7 and Figure 11 for RGS9. As a control, we tested the effect of hGbetaS on the ability of RGS4 to complement sst2. RGS4 is a short RGS protein of 206 amino acids and does not contain a GGL domain. Halo assays and luminescence of strains co-expressing hGbetaS and RGS4 were similar to strains expressing RGS4 and an empty control vector (data not shown). Since RGS7 and RGS9 both contain a GGL
domain, one would anticipate that these RGS proteins would be similarly affected by co-expression of GbetaS. Co-expression of hGbetaS with RGS9, however, had no effect on RGS7 as halos were similar to the vector control strain. Co-expression of hGbetaS, however, resulted in an increase in halo size (rather than a decrease as occurs by RGS4 expression) in comparison to vector control strains. Expression of hGbetaS alone had no effect, similar to the vector-only control. This is an unanticipated result and suggests that despite the similarity in domain stmcture of RGS7 and RGS9, these two RGS proteins may in fact be functionally dissimilar.
Example 9: Chimeric RGS Proteins To fiu-ther investigate the utility of the assay, several chimeric RGS
proteins were tested. Specific RGS chimeric proteins are described below, but in general we investigated the effect of N-terminal and C-terminal RGS protein combinations, or the addition of a the N-terminal region of an RGS protein that has been demonstrated to complement (for example RGS4) for an sst2 lcnoclcout, to a different, but full length, RGS protein.
Cloning strategies used in chimeric gene construction 1. RGS4N/RGS7C:
The RGS4 N-terminal region of 171 bp, which encodes amino acids 1-57 of RGS4, was obtained by PCR using rat RGS4 cDNA as template. The forward primer contained an embedded BamHl site:
chiRgs4 Nterm 5'-CGCGGATCCATGTGCAAAGGGCTTGCA (SEQ ID NO: 31) while the reverse primer contained an embedded SmaI site:

chiRgs4r Nterm 5'-TCCCCCGGGCTTGACTTCCTCTTGGCT (SEQ ID NO: 32) The RGS7 C-terminal region, which begins with the GGL domain of full length human RGS7 through the last amino acid, was amplified to produce a 645 by product encoding amino acids 255-470 of RGS7. The forward primer contained an embedded S~aal site:
chiRgs7 Cterm 5'-TCCCCCGGGGATGAGTTACAACAACAG (SEQ ID NO: 33) The reverse primer contains an embedded Clal site:
chiRgs7r Cterm 5'-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 34) The two PCR products were gel purified, cut with SmaI and ligated. The ligation mixture was then used as template to produce the full length chimeric PCR
product of 816 bp. The forward primer used in this PCR reaction was chiRgs4 Nterm (SEQ ID NO:
31 ) and the reverse primer was chiRgs7r Cterm (SEQ ID NO: 34). The resulting chimeric gene was gel purified, re-amplified, cut with the appropriate restriction enzymes, and cloned into the BarraHl and Clal site of vector p426TEF, which encodes an N-terminal HA tag.
2. RGS7N/RGS4C:
The RGS7 N-terminal region includes the GGL domain of RGS7 and was amplified using human RGS7 cDNA as template to produce a 996 by PCR product encoding amino acids 1-332. The forward primer contains an embedded BamHI site:
chiRgs7 Nterm 5'-CGCGGATCCATGGCCCAGGGGAAT (SEQ ID NO: 35) The reverse primer contains an embedded Smal site:
chiRgs7r Nterm 5'-TCCCCCGGGAAAACCCCATCGTTT (SEQ ID NO: 36) The RGS4C region contains only the RGS4 core domain and was amplified using RGS4 cDNA as a template to produce a 447 by PCR product encoding amino acids 58-206.
The forward primer contains an embedded Smal site:

chiRgs4 Cterm 5'-TCCCCCGGGAAATGGGCTGAATCACTG (SEQ ID No: 37) The reverse primer contains an embedded Clal site:
chiRgs4r Cterm 5'-CCCATCGATTTAGGCACACTGAGGGAC (SEQ ID NO: 38) The two PCR products were gel purified, cut with Smal and ligated. The ligation mixture. was used as template for PCR amplification of the chimeric gene product of 1443 bp.
The primers used were as described above. The forward primer was chiRgs7 Nterm (SEQ ID
NO: 35), while the reverse primer was chiRgs4r Cterm (SEQ ID NO: 38). The resulting chimeric gene was gel purified, re-amplified, cut with appropriate restriction enzymes and cloned into the BamHl and Clal site of vector p426TEF, which encodes an N-terminal HA
tag.

3. RGS4N/RGS10 (full length):
The RGS4N region is identical to that described for the RGS4N/RGS7C chimera described above.
The RGS 10 (full length) for this chimera was obtained from p426-RGS 10 by restriction digest using Smal and Xhol. The plasmid p426-RGS10 was constructed by PCR
amplification using human RGS 10 cDNA (Genbanlc no. XM 049797) as template.
The forward primer contains an embedded HindIII site:
RGS10 fwd 5'-CCCAAGCTTATGGAACACATCCACGACAGC (SEQ ID NO: 39) The reverse primer contains an embedded XhoI site:
RGS10 rev 5'- CCGCTCGAGTCATGTGTTATAAATTCTGGA (SEQ ID NO: 40) The PCR product of 504 bp, which encodes the full length RGS10, was gel purified and cloned into the IlihilIII and XhoI sites of vector p426TEF.
The RGS4 N-terminal region PCR product described above was cut with Smal and ligated with the gel purif ed S~aal and XhoI restriction fragment of RGS 10.
The ligation mixture was used as template for PCR to obtain the chimeric RGS4/RGS 10. The forwaxd primer used was chiRgs4 Nterm (SEQ ID NO: 32), while the reverse primer was RGS 10 rev (SEQ ID NO: 40), both described above. The resulting chimeric gene was gel purified, re-amplified and cloned into the BamHl and Xho 1 site of vector p426TEF, which encodes an N-terminal HA tag.
4. RGS4N/RGS7 full length:
The RGS4 N-terminal region was obtained as described above. The full length cDNA was amplified using cloned human RGS7 as a template to produce a 1410 by PCR
product encoding amino acids 1-470. The forward primer contains an embedded SnZaI site:
RGS7N fwd 5'-TCCCCCGGGATGGCCCAGGGGAAT (SEQ ID NO: 41) The reverse primer contained an embedded CIaI site:
Rgs7r Cterm 5'-CCCATCGATTTAGTAAGACTGAGC (SEQ ID NO: 42) The two PCR products were gel purified, cut with Sn2aI and ligated. The ligation mixture was then used as template for PCR to obtain the RGS4N/RGS7 full length chimeric gene. The forward primer was chiRgs4 Nterm (SEQ ID NO: 31) and the reverse primer was Rgs7r Cterm (SEQ ID NO: 42). The resulting chimeric gene was gel purified, re-amplified and cloned into the BamHl and Clal site of vector p426TEF, which encodes an N-terminal HA tag.

5. RGS4N/RGS9C:
Two different chimeras for RGS4N/RGS9C where constructed, wherein one contains the GGL domain in the RGS9 C-terminal region, while the other does not contain the GGL
domain within the RGS9 C-terminal region.
5a. RGS4N/RGS9C (minus GGL domain):
The RGS4 N-terminal region was amplified by PCR as described previously, digested with BamHI and HindIII and gel purified.

The RGS9 C-terminal region (minus the GGL domain) was amplified using the human RGS9 cDNA as template to obtain a 1125 by product encoding amino acids 302-675.
The forward primer contains an embedded HindIII site: RGS9RGS fwd (minus GGL
domain) 5'-CCCAAGCTTATGAACTTCAGCGAA (SEQ ID NO: 43) The reverse primer contains an embedded XhoI site:
RGS9RGS rev 5'- CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 44) The RGS9C (minus GGL domain) PCR product was purified, cut with HindIII and XhoI, and cloned into HihdIII and.XhoI sites of vector p426TEF. The resulting plasmid was then digested with BamHI and HihdIII, and Iigated with the BamHI and Hi~dIII

terminal fragment to generate the RGS4N/RGS9c minus GGL domain chimeric plasmid.
5b. RGS4N/RGS9C (plus GGL domain):
The RGS9 C-terminal region including the GGL domain fragment was amplified using RGS9 cDNA as template to produce an 1356 by PCR produce encoding amino acids 223-675 of human RGS9. The forward primer, RGS9chi Cterm HihdIII fwd (plus GGL
domain), contains an embedded HindIII site:
5'-CCCAAGCTTGCTGTCAAAAAAGAGATC (SEQ ID NO: 45) The reverse primer contains an embedded ~YhoI site:
RGS9RGS rev 5'-CCGCTCGAGTTACAGGCTCTCCCA (SEQ ID NO: 46) The RGS4NlRGS9C (minus GGL domain) chimeric plasmid (described above) was cut with Hi~dIII and XhoI and the cDNA band containing the vector with RGS4N
was gel purified. The vector-RGS4N cDNA was then Iigated to the HihdIII andXh.ol RGS9C
(plus GGL) prepared PCR product to generate the RGS4N/RGS9 plus GGL domain chimeric plasmid.

6. RGS4N/axin:
The RGS domain present in human axin was PCR amplified to produce a 441 by fragment encoding amino acids 199-345. The forward primer, AxinSmal fwd, contains an embedded SzzzaI site:
5'-TCCCCCGGGGGCAGTGCCTCCCCCACCCCACCAT (SEQ ID NO: 47) The reverse primer, AxinXho 1 rev, contains an embedded XhoI site 5'-CCGCTCGAGTTAGACTTTGGGGCTCTCCGA (SEQ ID NO: 48) The p426TEF plasmid containing the RGS4N/RGS7C chimera was cut with SmaI and XhoI to remove the RGS7C fragment, and then gel purified. The vector-RGS4 DNA
was then ligated with the SmaI and Xhol fragment encoding the RGS domain of the axin gene to produce the RGS4N/Axin chimeric plasmid.

7. RGSll:
Human RGS11 was amplified using cDNA (GenBank no. NM 003834) as template to produce a 1341 by PCR product encoding amino acids 1-447. The forward primer contains an embedded EcoRI site:
RGS 11 fwd 5'-CCGGAATTCATGGCCGCCGGCCCCGCGCCG (SEQ ID NO: 49) The reverse primer contains an embedded HindIII site:
RGS11 rev 5'-CCCAAGCTTCTAGGCCACCCCATCTCCACC (SEQ ID NO: 50) The resulting PCR product was digested with EcoRl and HihdIII, and subcloned into similar sites of the p426TEF vector.

8. RGS6:
Human RGS6 was amplified from cDNA (GenBanl~ no. AF156932) to obtain a 1419 by PCR product encoding the full length protein of amino acids 1-473. The forward primer contains an embedded HindIII site:
RGS6 fwd 5'-CCCAAGCTTATGGCTCAAGGATCCGGGGAT (SEQ ID NO: S 1) The reverse primer contains an embedded XhoI site:
RGS6 rev 5'-CCGCTCGAGTCAGGAGGACTGCATCAG (SEQ ID NO: 52) The PCR product was digested with Hi~dIII and XhoI and cloned into similar sites of the p426TEF vector.
Strain generation:
Yeast strains were produced to evaluate the ability of the various RGS
chimeric proteins to complement an sst2 knoclc-out. The RGS chimeric plasmids were transformed into the base strain KY113, in the presence or absence of human GbetaS. All strains contained either control or expression plasmid and firefly luciferase reporter gene to enable investigation under similar media conditions. Strains are summarized in the following table:
Table 4 Strain nameP426 TEF plsamid P425 TEF plasmid Ysa21 vector vector Ysa38 vector Hgbeta5 Ysa4 RGS7 Hgbeta5 Ysa7 RGS7 Vector Ysa42 RGS7(minus N terminus, plus Hgbeta5 GGL) Ysa46 RGS7(minus N terminus, plus Vector GGL) Ysa44 RGS7N/RGS4C clumera Hgbeta5 Ysa48 RGS7N/RGS4C chimera Vector Ysa93 RGS4N/RGS7C chimera Hgbeta5 Ysa94 RGS4N/RGS7C chimera Vector Ysa152 RGS4N/RGS7 full length chimeraHgbeta5 Ysal53 RGS4N/RGS7 full length chimeraVector YsaS RGS9 Hgbeta5 YsalO RGS9 Vector Ysa43 RGS9(minus N terminus, plus Hgbeta5 GGL) Ysa47 RGS9(minus N terminus, plus vector GGL) Ysa125 RGS4N/RGS9C (minus GGL) Hgbeta5 Ysa126 RGS4N/RGS9C (minus GGL) vector Ysa127 RGS4N/RGS9C (plus GGL) Hgbeta5 Ysa128 RGS4N/RGS9C (plus GGL) vector Ysa89 RGS 10 Hgbeta5 Ysa90 RGS 10 vector Ysa155 RGS4N/RGS10 full length chimeraHgbeta5 Ysa156 RGS4N/RGS 10 full length chimeravector Ysa91 RGS 11 Hgbeta5 Ysa92 RGS 11 vector Ysa45 RGS6 Hgbeta5 Ysa49 RGS6 vector Ysa105 RGS4N/RGSdomain of axin chimeravector Ysa106 RGS4N/RGSdomain of axin chimeraHgbeta5 RESULTS:
These strains were tested for functional complementation in the pheromone response assay, using a pheromone-responsive reporter gene. For example, the luciferase reporter gene was employed in the quantitative assay. Strains were also tested in a 'halo assay' in response to 2 day exposure to alpha factor in a qualitative assay for pheromone response.
All strains were tested in dose response assays. For luciferase based assays, the alpha factor doses tested were 0, 100 pmol, 1 nmol, 10 nmol, 100 nmol, 1 ~,mol, 10 ~mol, and 100 ~,mol.
The halo assays were conducted as previously mentioned. For comparison of the numerous dose response curves, response was determined for a single dose of alpha factor within the curve. Response was then determined as a percent response to the negative control strain containing no RGS and no GbetaS. For example, a construct having no effect would be ranlced at 100, similar to the sst2 knoclcout strain containing empty vectors, while a highly functional complementing RGS protein, such as RGS4, would be ranked at 0.
We tested several short, that is, relatively low molecular weight, RGS
proteins. RGS2 and RGSz were previously tested and demonstrated some ability to complement the sst2 knockout phenotype, although not as effectively as RGS4. RGS 10 is also a short RGS
protein, however when expressed as a wild-type protein, it did not demonstrate complemenation in either the luciferase or the halo assay. The RGS4/RGS 10 chimera, however, restored the RGS function to values very close to those observed for expression of RGS4 alone. These results are shown in Figure 12.
From these data, RGS4 is the most effective RGS protein in the complementation of the sst2 knockout phenotype. RGS7 is non-functional, and is not much improved by deleting the N-terminal xegion. These data are shown in Figure 14. Addition of the RGS4 N-terminal region to either the RGS7 C-terminal region or addition of the RGS4 N-terminal region to the full length RGS7 protein, however, enables some level of functional complementation.
Moreover, improvements are also noted in the halo assay.
RGS9 in its native state demonstrated an intermediate ability to complement the sst2 knockout phenotype. This complementation is negated in the absence of the RGS9 N-terminal region. Addition of the RGS4 N-terminal to the non-functional C-terminal RGS9-ggl, however, improves complementation, which is further improved by removal of the ggl domain of RGS9.

In addition, we observed some intermediate complementation by RGS6 (value of 25) and RGS 11 (value of 50), which was not affected by co-expression of G-betas.
We observed a difference in the response of strain expressing RGS9, where the wild-type protein had some effect; however co-expressed with GbetaS often an enhanced pheromone response was observed. A similar effect was not observed by co-expression of GbetaS with other GGL-containing RGS proteins, that is, RGS6, RGS7, and RGA11.
This finding suggests an alternate function of RGS9.

References Ausubel, F. et al., (Ed), Current Protocols in Molecular Biology, John Wiley &
Sons, Inc., USA, (1998).
De Vries, L., et al., RGS p~°oteius: mop°e than just GAPS for heterotrimet°ic G
p~oteius, Trends in Cell Biology, Elsevier Science, Vol. 9, pp. 138-143 (April 1999).
Dohlman et al., Sst2, a negative f°egulator ofphe~omone signaling in the yeast Saceha~omyces ce~evisiae: expression, localization and genetic interaction and physical association with Gpal (the G alpha subunit), Mol. Cell. Biol., Vol. 16, No. 9, pp. 5194-5209 (1996).
Kehrl, J.H., Fleterot~imeric G pf otein Signaling: Roles in Immune Function and Fine-Tuning by RGS P~oteihs, Immunity, Vol. 8, pp. 1-10 (1998).
Panetta, R., et al., Regulators of G Protein Signaling (RGS) 2 and l6A~e Induced in Response to Bacterial Lipopolysaccharide and Stimulate c fos P~omote~
Expression, Biochemical and Biophysical Reseaxch Communications, Vol. 259, No. 3, pp. 550-556 (June 1999).
Rousch, Wade, Regulating G Protein Signaling, Science (Cell Biology), Vol.
271, pp. 1056-1058 (Feb. 1996) Shuey D.J., et al., RGS7 attenuates signal transduction thi°ough the Galpha q family of hete~otf~ime~ic G proteins in manamalian cells, J. Neurochem., Vol. 70, pp.

(1997).
Wieland, T., et al., Regulators of G protein signalling.' a novel protein family involved in timely deactivation and desensitization of signalling via heterot~ime~ic G
p~°oteins, Naunyn-Schmiedeberg's Arch Pharmacol, Vol. 360, pp. 14-26 (1999).

Young, K., et al., Identification of compounds affecting specific interaction ofpeptide bindingpai~s, US 5,989,808 (1995).
Zhen, B., et al., Dives°gence of RCS proteins: evidence foy~ the existence of six mammalian RCS subfamilies, Dept. of Cellular and Molecular Medicine, and Phatology, University of California, San Diego, La Jolla, California, Elsevier Science Ltd., Vol. 4, pp.
411-414 (1999).
All cited publications, patents, and patent applications are hereby incorporated by reference in their entirety.
While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be appreciated by one skilled in the art from reading this disclosure that various changes in form and detail can be made without departing from the true scope of the invention.

SEQUENCE ZISTING
<110> American Home Products Corp.
Young, Kathleen Cao, Jian Shuey, David <120> Methods and Cells for Detecting Modulators of RGS
Proteins <130> 1142.219-304 <150> US 60/250,147 <151> 2000-12-01 <160> 52 <170> PatentIn version 3.0 <210> 1 <211> 26 <212> DNA
<213> Rattus rattus <400> 1 gacgtctccc atgtgcaaag gactcg <210> 2 <211> 37 <212> DNA
<213> Rattus rattus <400> 2 cgggatcctt attaggcaca ctgagggact agggaag <210> 3 <211> 31 <212> DNA
<213> Rattus rattus <400> 3 gaggatccgg cacactgagg gactagggaa g <210> 4 <211> 20 <212> DNA

<213> Rattus rattus <400> 4 tttttacaga tcatcaagga <210> 5 <211> 20 <212> DNA
<213> Rattus rattus <400> 5 tgcgtcttca gagcgctttt <210> 6 <211> 23 <212> DNA
<213> Rattus rattus <400> 6 gagccaagaa gaagtcaaga aat <210> 7 <211> 19 <212> DNA
<213> Rattus rattus <400> 7 tgggcttcat caaaacagg <210> 8 <211> 21 <212> DNA

<213> Saccharomyces cerevisiae <400> 8 tatcgagtca atggggcagg c <210> 9 <211> 21 <212> DNA
<213> Saccharomyces cerevisiae <400> 9 cgaaacgtgg attggtgaaa g <210> 10 <211> 23 <212> DNA

<213> Saccharomyces cerevisiae <400> 10 attcggctat gactgggcac aac <210> 11 <211> 23 <212> DNA

<213> Saccharomyces cerevisiae <400> 11 gtaaagcacg aggaagcggt cag <210> 12 <211> 21 <212> DNA
<213> Photinus pyralis <400> 12 atataagcca tcaagtttct g <210> 13 <211> 20 <212> DNA
<213> Photinus pyralis <400> 13 ctcactaaag ggaacaaaag <210> 14 <211> 24 <212> DNA
<213> Saccharomyces cerevisiae <400> 14 tcagtttcat ttttcttgtt ctat <210>15 <211>24 <212>DNA

<213>.Homo Sapiens <400> 15 ggatccatgg gatcagagcg gatg <210> 16 <211> 27 <212> DNA
<213> Homo Sapiens <400> 16 cgatcgatta ctatgcttca atagatt <210> 17 <211> 21 <212> DNA
<213> Homo Sapiens <400> 17 ccagcgggag aacgataatg c <210> 18 <211> 18 <212> DNA
<213> Homo sapiens <400> 18 cccctcagga aaagaatg <210> 19 <211> 20 <212> DNA

<213> Homo Sapiens <400> 19 cttggcggag gagggcacac <210> 20 <211> 21 <212> DNA

<213> Homo Sapiens <400> 20 tggaggcatt gagacggaag a <210> 21 <211> 27 <212> DNA

<213> Homo sapiens <400> 21 gcggatccat gaaacctcca acagaag <210> 22 <211> 26 <212> DNA
<213> Homo Sapiens <400> 22 cgatcgatta ttagtaagac tgagca <210> 23 <211> 40 <212> DNA

<213> Homo Sapiens <400> 23 gcaagcttcc accatgacaa tccgacacca aggccagcag <210> 24 <211> 36 <212> DNA

<213> Homo Sapiens <400> 24 gctctagatt acaggctctc ccaggggcag atgacc <210> 25 <211> 35 <212> DNA
<213> Homo Sapiens <400> 25 ccggatccag atgacaatcc gacaccaagg ccagc <210> 26 <211> 36 <212> DNA

<213> Homo Sapiens <400> 26 cgctcgagtt acaggctctc ccaggggcag atgacc <210> 27 <211> 28 <212> DNA
<213> Homo Sapiens <400> 27 gcggatccat gaagaaacaa acagtcgt <210> 28 <211> 27 <212> DNA
<213> Homo Sapiens <400> 28 cgatcgaatt attacaggct ctcccag <210> 29 <211> 39 <212> DNA
<213> Homo Sapiens <400> 29 gcccaagctt ccgccagcca tggcaaccga ggggctgca <210> 30 <211> 24 <212> DNA

<213> Homo Sapiens <400> 30 ccgctcgagt taggcccaga ctct <210> 31 <211> 27 <212> DNA

<213> Homo Sapiens <400> 31 cgcggatcca tgtgcaaagg gcttgca <210> 32 <211> 27 <212> DNA
<213> Homo Sapiens <400> 32 tcccccgggc ttgacttcct cttggct <210> 33 <211> 27 <212> DNA
<213> Homo Sapiens <400> 33 tcccccgggg atgagttaca acaacag <210> 34 <211> 24 <212> DNA

<213> Homo Sapiens <400> 34 cccatcgatt tagtaagact gagc <210> 35 <211> 24 <212> DNA

<213> Homo Sapiens <400> 35 cgcggatcca tggcccaggg gaat <210> 36 <211> 24 <212> DNA
<213> Homo Sapiens <400> 36 tcccccggga aaaccccatc gttt <210> 37 <211> 27 <212> DNA
<213> Homo Sapiens <400> 37 tcccccggga aatgggctga atcactg <210> 38 <211> 27 <212> DNA

<213> Homo Sapiens <400> 38 cccatcgatt taggcacact gagggac <210> 39 <211> 30 <212> DNA
<213> Homo Sapiens <400> 39 cccaagctta tggaacacat ccacgacagc <210> 40 <211> 30 <212> DNA
<213> Homo Sapiens <400> 40 ccgctcgagt catgtgttat aaattctgga _g_ <210> 41 <211> 24 <212> DNA
<213> Homo Sapiens <400> 41 tcccccggga tggcccaggg gaat <210> 42 <211> 24 <212> DNA
<213> Homo Sapiens <400> 42 cccatcgatt tagtaagact gage <210> 43 <211> 24 <212> DNA

<213> Homo Sapiens <400> 43 cccaagctta tgaacttcag cgaa <210> 44 <211> 24 <212> DNA
<213> Homo sapiens <400> 44 ccgctcgagt tacaggctct ccca <210> 45 <211> 27 <212> DNA
<213> Homo Sapiens <400> 45 cccaagcttg ctgtcaaaaa agagatc <210> 46 <211> 24 <212> DNA
<213> Homo Sapiens <400> 46 ccgctcgagt tacaggctct ccca <210> 47 <211> 34 <212> DNA

<213> Homo Sapiens <400> 47 tcccccgggg gcagtgcctc ccccacccca ccat <210> 48 <211> 30 <212> DNA

<213> Homo sapiens <400> 48 ccgctcgagt tagactttgg ggctctccga <210> 49 <211> 30 <212> DNA

<213> Homo Sapiens <400> 49 ccggaattca tggccgccgg ccccgcgccg <210> 50 <211> 30 <212> DNA

<213> Homo Sapiens <400> 50 cccaagcttc taggccaccc catctccacc <210> 51 <211> 30 <212> DNA
<213> Homo Sapiens <400> 51 cccaagctta tggctcaagg atccggggat <210> 52 <211> 27 <212> DNA
<213> Homo Sapiens <400> 52 ccgctcgagt caggaggact gcatcag

Claims (105)

We Claim:

1. A cell that responds to a pheromone comprising a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein the reporter is Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

2. The cell of claim 1, wherein the cell is a mammalian cell or a yeast cell.

3. The cell of claim 2, wherein the cell is a yeast cell.

4. The cell of claim 1, wherein the heterologous nucleic acid is on a plasmid.

5. The cell of claim 1, wherein the heterologous nucleic acid is integrated into the cell's genome.

6. The cell of claim 1, wherein the pheromone-responsive promoter is LUC1, FUS1, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FAR1, AGA1, AGA2, AG.alpha.1, GPA1, STE2, STE3, STE6, MFA1, MFA2, MF.alpha.1, MF.alpha.2, CIK1, or BAR1.

7. The yeast cell of claim 3, wherein the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris.

8. The yeast cell of claim 7, wherein the yeast cell is Saccharomyces cerevisiae.

9. The cell of claim 1, further comprising a heterologous nucleic acid encoding an RGS protein.

10. The cell of claim 9, wherein the RGS protein lacks a GGL or DEP domain.

11. The cell of claim 9 further comprising an endogenous nucleic acid encoding a native RGS protein corresponding to a heterologous RGS protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS
protein.

12. The cell of claim 11, wherein the mutation is either or each of a deletion, insertion, or substitution.

13. The cell of claim 9, wherein the RGS protein is RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3, RGS4, RGSS, RGS6, RGS7, RGSB, RGS9-l, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14, RGS16, RGS-PX1, GAIP, Axin, Conductin, egl-10, eat-16, p 11 SRhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain.

14. The cell of claim 13, wherein the RGS-like (RGL) domain is PLCB or gamma subunit of cGMP PDE.

15. The cell of claim 13, wherein the RGS protein is RGS2, RGS4, RGS6, RGSl 1, or RGSZ.

16. The cell of claim 9, wherein the RGS protein is a chimera.

17. The cell of claim 16, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS
domain of axin, or portions thereof.

18. The cell of claim 17, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

19. The cell of claim 17, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

20. The cell of claim 17, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

21. The cell of claim 17, wherein the C-terminus of RGS4 comprises amino acids 206 of RGS4.

22. The cell of claim 17, wherein the axin RGS domain comprises amino acids 345 of axin.

23. A cell comprising a heterologous nucleic acid encoding a chimeric RGS
protein.

24. The cell of claim 24, wherein the cell is a mammalian cell or a yeast cell.

25. The cell of claim 5, wherein the cell is a yeast cell.

26. The cell of claim 24, wherein the heterologous nucleic acid is on a plasmid.

27. The cell of claim 24, wherein the heterologous nucleic acid is integrated into the cell's genome.

28. The cell of claim 24, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS
domain of axin.

29. The cell of claim 29, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

30. The cell of claim 29, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

31. The cell of claim 29, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

32. The cell of claim 29, wherein the C-terminus of RGS4 comprises amino acids 206 of RGS4.

33. The cell of claim 29, wherein the axin RGS domain comprises amino acids 345 of axin.

34. An isolated nucleic acid encoding a chimeric RGS protein.

35. The isolated nucleic acid of claim 35, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS 10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

36. The isolated nucleic acid of claim 36, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

37. The isolated nucleic acid of claim 36, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

38. The isolated nucleic acid of claim 36, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

39. The isolated nucleic acid of claim 36, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

40. The isolated nucleic acid of claim 36, wherein the axin RGS domain comprises amino acids 199-345 of axin.

41. A vector comprising the isolated nucleic acid of claim 35.

42. The vector of claim 42, wherein the vector is a plasmid or a virus.

43. The vector of claim 43, wherein the vector is a plasmid.

44. The vector of claim 44, wherein the plasmid is a low copy number plasmid.

45. A cell comprising the vector of claim 42.

46. The cell of claim 9, further comprising a heterologous nucleic acid encoding Gbeta5.

47. The cell of claim 47, wherein the Gbeta5 is human Gbeta5.

48. A method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:

(a) providing at least one first cell that responds to a pheromone, wherein the first cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal;

(b) providing at least one second cell that responds to a pheromone, wherein the second cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS
protein;

(b) incubating a test sample with the first and second cells in the presence of a pheromone under conditions suitable to detect the measurable signal;

(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter; and (d) comparing the level of expression in the first and second cells, wherein a difference in the level of expression indicates that the test sample alters RGS protein-mediated reporter gene expression.

49. The method of claim 49, wherein the test sample is used at a single concentration.

50. The method of claim 49, wherein the test sample is used in a range of concentrations.

51. The method of claim 49, wherein the level of expression of the reporter is detected in a halo assay.

52. The method of claim 49, wherein the level of expression of the reporter is detected spectrophotometrically.

53. The method of claim 53, wherein the detection is automated.

54. The method of claim 49, wherein the heterologous nucleic acid encodes a Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

55. The method according to claim 49, wherein the first and second cell is either a mammalian cell or a yeast cell.

56. The method according to claim 56, wherein the first and second cells are yeast cells.

57. The method according to claim 49, wherein the heterologous nucleic acid encoding the reporter gene is on a plasmid.

58. The method according to claim 49, wherein the heterologous nucleic acid encoding the reporter gene is integrated into the cell's genome.

59. The method according to claim 49, wherein the second heterologous nucleic acid encoding the RGS protein is on a plasmid.

60. The method according to claim 49, wherein the second heterologous nucleic acid encoding the RGS protein is integrated into the cell's genome.

61. The method according to claim 49, wherein the pheromone-responsive promoter is LUC1, FUS1, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FART, AGA1, AGA2, AG.alpha.1, GPA1, STE2, STE3, STE6, MFA1, MFA2, MF.alpha.1, MFa2, CIK1, or BAR1.

62. The method according to claim 57, wherein the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris.

63. The method according to claim 63, wherein the yeast cell is Saccharomyces cerevisiae.

64. The method according to claim 49, wherein the RGS protein lacks a GGL or DEP
domain.

65. The method according to claim 49, further comprising an endogenous nucleic acid encoding a native RGS protein corresponding to a heterologous RGS
protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS
protein.

66. The method according to claim 66, wherein the mutation is either or each of a deletion, insertion, or substitution.

67. The method according to claim 49, wherein the RGS protein is RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14, RGS16, RGS-PX1, GAIP, Axin, Conductin, egI-10, eat-16, p115RhoGEF, and isoforW s thereof or proteins containing an RGS-like (RGL) domain.

68. The method according to claim 68, wherein the RGS-like (RGL) domain is PLCB
or gamma subunit of cGMP PDE.

69. The method according to claim 68, wherein the RGS protein is RGS2, RGS4, RGS6, RGS11, or RGSZ.

70. The method according to claim 49, wherein the RGS protein is a chimera.

71. The method according to claim 71, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

72. The method according to claim 72, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

73. The method according to claim 72, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

74. The method according to claim 72, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

75. The method according to claim 72, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

76. The method according to claim 72, wherein the axin RGS domain comprises amino acids 199-345 of axin.

77. A method of detecting the ability of a test sample to alter RGS protein-mediated reporter gene expression, comprising:
(a) providing at least two aliquots of a cell that responds to a pheromone, wherein the cell comprises a heterologous nucleic acid encoding a reporter operably linked to a pheromone-responsive promoter, wherein expression of the heterologous nucleic acid produces a measurable signal, and a second heterologous nucleic acid encoding an RGS
protein;
(b) incubating the aliquots of cells in the presence of a pheromone under conditions suitable to detect the measurable signal, wherein one of the aliquots contains a test sample;
(c) detecting the level of expression of the heterologous nucleic acid encoding the reporter in the aliquots; and (d) comparing the level of expression of the reporter in the aliquots, wherein a difference in the level of expression between the aliquots indicates that the test sample alters RGS protein-mediated reporter gene expression.

78. The method of claim 78, wherein the test sample is used at a single concentration.

79. The method of claim 78, wherein the test sample is used in a range of concentrations.

80. The method of claim 78, wherein the level of expression of the reporter is detected in a halo assay.

81. The method of claim 78, wherein the level of expression of the reporter is detected spectrophotometrically.

82. The method of claim 82, wherein the detection is automated.

83. The method of claim 78, wherein the heterologous nucleic acid encodes a Renilla luciferase, Photinus luciferase, green fluorescent protein, or a derivate of green fluorescent protein.

84. The method according to claim 78, wherein the cell is a mammalian cell or a yeast cell.

85. The method according to claim 85, wherein the cell is a yeast cell.

86. The method according to claim 78, wherein the heterologous nucleic acid encoding the reporter gene is on a plasmid.

87. The method according to claim 78, wherein the heterologous nucleic acid encoding the reporter gene is integrated into the cell's genome.

88. The method according to claim 78, wherein the second heterologous nucleic acid encoding the RGS protein is on a plasmid.

89. The method according to claim 78, wherein the second heterologous nucleic acid encoding the RGS protein is integrated into the cell's genome.

90. The method according to claim 78, wherein the pheromone-responsive promoter is LUC1, FUS1, FUS2, KAR3, FUS3, STE3, STE13, STE12, CHS1, FAR1, AGA1, AGA2, AG.alpha.1, GPA1, STE2, STE3, STE6, MFA1, MFA2, MF.alpha.1, MF.alpha.2, CIK1, or BAR1.

91. The method according to claim 86, wherein the yeast cell is Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia pastoris.

92. The method according to claim 92, wherein the yeast cell is Saccharomyces cervisiae.

93. The method according to claim 78, wherein the RGS protein lacks a GGL or DEP
domain.

94. The method according to claim 78, further comprising an endogenous nucleic acid encoding a native RGS protein corresponding to a heterologous RGS
protein, wherein the endogenous nucleic acid is mutated such that it does not produce a functional native RGS
protein.

95. The method according to claim 95, wherein the mutation is either or each of a deletion, insertion, or substitution.

96. The method according to claim 78, wherein the RGS protein is RGSZ1, RGSZ2, Ret-RGS1, RGS1, RGS2, RGS3, RGS4, RGS5, RGS6, RGS7, RGS8, RGS9-1, RGS9-2, RGS10, RGS11, RGS12, RGS13, RGS14, RGS16, RGS-PX1, GAIP, Axin, Conductin, egl-10, eat-16, p115RhoGEF, and isoforms thereof or proteins containing an RGS-like (RGL) domain.

97. The method according to claim 97, wherein the RGS-like (RGL) domain is PLCB
or gamma subunit of cGMP PDE.

98. The method according to claim 97, wherein the RGS protein is RGS2, RGS4, RGS6, RGS11, or RGSZ.

99. The method according to claim 78, wherein the RGS protein is a chimera.

100. The method according to claim 100, wherein the chimera comprises an N-terminus of RGS4 and a C-terminus of RGS7, an N-terminus of RGS7 and a C-terminus of RGS4, an N-terminus of RGS4 and a complete RGS10, an N-terminus RGS4 and a complete RGS7, an N-terminus of RGS4 and a C-terminus of RGS9 lacking a GGL domain, an N-terminus of RGS4 and a C-terminus of RGS9 having a GGL domain, and an N-terminus of RGS4 and the RGS domain of axin, or portions thereof.

101. The method according to claim 101, wherein the N-terminus of RGS4 comprises amino acids 1-57 of RGS4.

102. The method according to claim 101, wherein the C-terminus of RGS7 comprises amino acids 255-470 of RGS7.

103. The method according to claim 101, wherein the N-terminus of RGS7 comprises amino acids 1-332 of RGS7.

104. The method according to claim 101, wherein the C-terminus of RGS4 comprises amino acids 58-206 of RGS4.

105. The method according to claim 101, wherein the axin RGS domain comprises amino acids 199-345 of axin.