Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/06—Antihyperlipidemics
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
  • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

• the present invention relates an isolated promoter region of the mammalian transcription factor FOXC2.
• the invention also relates to screening methods for agents modulating the expression of FOXC2 and thereby being potentially useful for the treatment of medical conditions related to obesity.
• the invention further relates to a previously unknown variant of the human FOXC2 gene, derived via the use of an alternative promoter, which produces an additional exon that generates a distinct open reading frame via splicing.
• the alternative gene encodes a variant of the FOXC2 transcription factor, which is lacking a part of the DNA-binding domain and consequently has a potential regulatory function.
• NIDDM non-insulin dependent diabetes mellitus
• HLH helix-loop-helix
• HLH proteins are key players in a wide array of developmental processes (for a review, see Massari & Murre (2000) Mol. Cell. Biol. 20: 429-440). Over 240 HLH proteins have been identified to date in organisms ranging from the yeast Saccharomyces cerevisiae to humans. Studies in Xenopus laevis, Drosophila melanogaster, and mice have convincingly demonstrated that HLH proteins are intimately involved in developmental events such as cellular differentiation, lineage commitment, and sex determination. In multicellular organisms, HLH factors are required for a multitude of important developmental processes, including neurogenesis, myogenesis, hematopoiesis, and pancreatic development.
• the winged helix / forkhead class of transcription factors is characterized by a 100-amino acid, monomeric DNA-binding domain.
• X-ray crystallography of the forkhead domain from HNF-3 ⁇ has revealed a three-dimensional structure, the "winged helix", in which two loops (wings) are connected on the C-terminal side of the helix-loop-helix (for reviews, see Brennan, R.G. (1993) Cell 74: 773-776; and Lai, E. et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90: 10421-10423).
• the International Patent Application WO 98/54216 discloses a gene encoding a Forkhead- Related Activator (FREAC)-ll (also known as S12), which is identical with the polypeptide encoded by the human FKHL14 gene disclosed by Miura, supra. This transcription factor is expressed in adipose tissue and involved in lipid metabolism and adipocyte differentiation (cf. Swedish patent application No. 0000531-4, filed February 18, 2000).
• FREAC Forkhead- Related Activator
• Figure 1 shows the general structure of the human FOXC2 gene.
• Figure 3 illustrates the predicted "enhancer" region in the human FOXC2 gene. Underlined sequences indicate likely transcription factor binding sites. Boxed sequence indicates exon sequence.
• Splice sequence predicted as splice site in the alternatively spliced gene
• E-box-like sequence resembling the "E-box” motif CANNTG known as a target for DNA binding proteins containing a helix-loop-helix domain (often associated with the activation of cell-type specific gene transcription during tissue differentiation; see Massari & Murre
• Forkhead-like sequence resembling binding site for the winged helix / forkhead class of transcription factors
• Ets-like sequence resembling consensus binding site for ETS-domain transcription factor family (see Sharrocks et al. (1997) Int. J. Biochem. Cell Biol. 29, 1371-1387).
• Figure 4 illustrates the predicted "promoter” region in the human FOXC2 gene. Underlined sequence indicates exon sequences. Boxed sequences indicate conserved block (potential transcription factor binding sites). DESCRIPTION OF THE INVENTION
• the partially known sequence (SEQ ID NO: 8) of human FOXC2 gene has been extended.
• differentially conserved regions, consistent with regulatory function, have been identified.
• an alternative transcript has been identified, which includes the use of at least two exons. The putative regulatory enhancer is immediately adjacent to the newly discovered alternative exon, suggesting that it may play a role in the alternative selection of transcript classes.
• Modulation of the FOXC2 regulation is expected to have therapeutic value in type II diabetes; obesity, hypercholesterolemia, and other cardiovascular diseases or dyslipidemias.
• this invention provides an isolated human FOXC2 promoter region comprising a sequence selected from:
• nucleotide sequences capable of hybridizing, under stringent hybridization conditions, to a nucleotide sequence as defined in (a) or (b).
• Promoter region refers to a region of DNA that functions to control the transcription of one or more genes, and is structurally identified by the presence of a binding site for DNA- dependent RNApolymerase and of other DNA sequences on the same molecule which interact to regulate promoter function.
• nucleic acid is a nucleic acid molecule the structure of which is not identical to that of a naturally occurring nucleic acid or that of any fragment of a naturally occurring genomic nucleic acid spanning more than one gene.
• "Stringent” hybridization conditions are hybridization in 6X SSC at about 45°C, followed by one or more washes in 0.2X SSC, 0.1%SDS at 65°C.
• Another aspect of the invention is a recombinant construct comprising the human FOXC2 promoter region as defined above.
• the human FOXC2 promoter region can be operably linked to a nucleic acid molecule encoding a detectable product, such as the human FOXC2 gene, or a reporter gene.
• operably linked means functionally fusing a promoter with a structural gene in the proper frame to express the structural gene under control of the promoter.
• reporter gene means a gene encoding a gene product that can be identified using simple, inexpensive methods or reagents and that can be operably linked to the human FOXC2 promoter region or an active fragment thereof.
• Reporter genes such as, for example, a luciferase, ⁇ -galactosidase, alkaline phosphatase, or green fluorescent protein reporter gene, can be used to determine transcriptional activity in screening assays according to the invention (see, for example, Goeddel (ed.) 3 Methods Enzymol., Vol. 185, San Diego: Academic Press, Inc. (1990); see also Sambrook, supra).
• the invention also provides a vector comprising the recombmant construct as defined above, as well as a host cell stably transformed with such a vector, or generally with the recombinant construct according to the invention.
• vector refers to any carrier of exogenous DNA that is useful for transferring the DNA to a host cell for replication and/or appropriate expression of the exogenous DNA by the host cell.
• the invention provides a method for identification of an agent regulating FOXC2 promoter activity, said method comprising the steps: (i) contacting a candidate agent with a human FOXC2 promoter region as defined above; and (ii) determining whether said candidate agent modulates expression of the FOXC2 gene, such modulation being indicative for an agent capable of regulating FOXC2 promoter activity.
• agent means a biological or chemical compound such as a simple or complex organic molecule, a peptide, a protein or an oligonucleotide.
• a transfection assay can be a particularly useful screening assay for identifying an effective agent modulating and/or regulating FOXC2 promoter activity.
• a nucleic acid containing a gene e.g. a reporter gene, operably linked to a human FOXC2 promoter or an active fragment thereof, is transfected into the desired cell type.
• a test level of reporter gene expression is assayed in the presence of a candidate agent and compared to a control level of expression.
• An effective agent is identified as an agent that results in a test level of expression that is different than a control level of reporter gene expression, which is the level of expression determined in the absence of the agent.
• the said method could e.g. comprising assaying reporter gene expression in a host cell, stably transformed with a recombinant construct comprising the human FOXC2 promoter, in the presence and absence of a candidate agent, wherein an effect on the test level of expression as compared to control level of expression is indicative of an agent capable of regulating FOXC2 promoter activity.
• Methods for identification of polypeptides regulating FOXC2 promoter activity could include various techniques known in the art, such as the yeast one-hybrid system (see: Li & Herskowitz (1993) Science 262, 1870-1874) to identify proteins binding specific sequences from the FOXC2 regulatory region, biochemical purification of proteins which bind to the regulatory region, the use of a "southwestern" cloning strategy (see e.g. Hai et al. (1989) Genes & Development 3: 2083-2090) in which a pool of bacteria infected with a "phage library” are induced to express the encoded protein and probed with radioactive DNA sequences from the FOXC2 regulatory regions to identify binding proteins.
• the invention provides an isolated human FOXC2 enhancer region comprising a sequence selected from:
• nucleotide sequences capable of hybridizing, under stringent hybridization conditions, to a nucleotide sequence as defined in (a) or (b).
• Enhancer region refers to a region of DNA that functions to control the transcriptions of one or more genes.
• the invention further provides a recombinant construct comprising a human FOXC2 enhancer region, a vector comprising the said recombinant construct, as well as a host cell stably transformed with said vector or with said recombinant construct.
• the invention provides a method for identification of an agent regulating FOXC2 enhancer activity, said method comprising the steps: (i) contacting a candidate agent with the human FOXC2 enhancer region as defined above; and (ii) determining whether said candidate agent modulates expression of the FOXC2 gene, such modulation being indicative for an agent capable of regulating FOXC2 enhancer activity.
• known steps are available for performing such a method. For instance, a "panel" of constructs which include a variety of mutations and deletions can be used in order to associate a response with a specific alteration of a single base or subsegment of the regulatory apparatus.
• a simple panel might include: enhancer plus promoter, promoter only, enhancer plus a "minimal" promoter from a distinct gene.
• a transfection assay using a host cell stably transformed with a suitable recombinant construct, can be a particularly useful screening assay for identifying an effective agent.
• the invention provides a method for identification of an agent capable of regulating a mammalian FOXC2 promoter activity, said method comprising the steps (i) contacting a candidate agent with a murine FoxC2 promoter nucleotide sequence shown as positions 216 to 2235, such as positions 216 to 475 or positions 1250 to 2235, in SEQ ID NO: 5; and (ii) determining whether said candidate agent modulates expression of a mammalian FOXC2 gene, such modulation being indicative for an agent capable of regulating mammalian FOXC2 promoter activity.
• the invention provides an isolated nucleic acid molecule selected from:
• nucleic acid molecules comprising a nucleotide sequence as shown in SEQ ID NO: 3;
• nucleic acid molecules comprising a nucleotide sequence capable of hybridizing, under stringent hybridization conditions, to a nucleotide sequence complementary the polypeptide coding region of a nucleic acid molecule as defined in (a) and which codes for a variant form of the FOXC2 transcription factor;
• nucleic acid molecules comprising a nucleic acid sequence which is degenerate as a result of the genetic code to a nucleotide sequence as defined in (a) or (b) and which codes for a variant form of the FOXC2 transcription factor.
• the said nucleic acid molecule has a nucleotide sequence identical with SEQ ID NO: 3 of the Sequence Listing.
• the nucleic acid molecule according to the invention is not to be limited strictly to the sequence shown as SEQ ID NO: 3. Rather the invention encompasses nucleic acid molecules carrying modifications like substitutions, small deletions, insertions or inversions, which nevertheless encode proteins having substantially the biochemical activity of the FOXC2 polypeptide according to the invention. Included in the invention are consequently nucleic acid molecules, the nucleotide sequence of which is at least 90% homologous, preferably at least 95% homologous, with the nucleotide sequence shown as SEQ ID NO: 3 in the Sequence Listing.
• nucleic acid molecule which nucleotide sequence is degenerate, because of the genetic code, to the nucleotide sequence shown as SEQ ID NO: 3.
• the invention includes an isolated polypeptide encoded by the nucleic acid as defined above.
• the said polypeptide has an amino acid sequence according to SEQ ID NO: 4 of the Sequence Listing.
• the polypeptide according to the invention is not to be limited strictly to a polypeptide with an amino acid sequence identical with SEQ ID NO: 4 in the Sequence Listing. Rather the invention encompasses polypeptides carrying modifications like substitutions, small deletions, insertions or inversions, which polypeptides nevertheless have substantially the biological activities of the variant FOXC2 polypeptide.
• isolated polypeptide is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
• the polypeptide includes an amino acid sequence that is at least about 70%, 75%o, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence of SEQ ID NO: 4.
• a further aspect of the invention is a vector comprising the nucleic acid molecule according to the invention.
• the said vector can e.g. be a replicable expression vector, which carries and is capable of mediating the expression of a DNA molecule according to the invention.
• replicable means that the vector is able to replicate in a given type of host cell into which is has been introduced.
• vectors are viruses such as bacteriophages, cosmids, plasmids and other recombination vectors.
• Nucleic acid molecules are inserted into vector genomes by methods well known in the art.
• a cultured host cell harboring a vector according to the invention.
• a host cell can be a prokaryotic cell, a unicellular eukaryotic cell or a cell derived from a multicellular organism.
• the host cell can thus e.g. be a bacterial cell such as an E. coli cell; a cell from yeast such as Saccharomyces cervisiae or Pichiapastoris, or a mammalian cell.
• the methods employed to effect introduction of the vector into the host cell are standard methods well known to a person familiar with recombinant DNA methods.
• the invention includes a method for identifying an agent capable of regulating expression of the nucleic acid molecule as defined above, said method comprising the steps (i) contacting a candidate agent with the said nucleic acid molecule; and (ii) determining whether said candidate agent modulates expression of the said nucleic acid molecule.
• the invention provides an antisense oligonucleotide having a sequence capable of specifically hybridizing to RNA transcribed by the alternatively spliced nucleic acid molecule shown as SEQ ID NO: 3, so as to prevent translation of the said RNA.
• Antisense nucleic acids preferably 10 to 20 base-pair oligonucleotides
• capable of specifically binding to control sequences for the alternatively spliced FOXC2 gene are introduced into cells, e.g. by a viral vector or colloidal dispersion system such as a liposome.
• the antisense nucleic acid binds to the target nucleotide sequence in the cell and prevents transcription and/or translation of the target sequence.
• Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. Suppression of expression of the alternatively spliced FOXC2 gene, at either the transcriptional or translational level, is useful to generate cellular or animal models for diseases/conditions related to lipid metabolism.
• the invention provides a method for the identification of polypeptides which bind to nucleotide sequences involved in the biological pathway regulating lipid metabolism and/or adipocyte differentiation, comprising the steps of:
• step (d) recovering cDNA from the cells isolated in step (c), by standard procedures, e.g. PCR or a CRE-LOX mediated procedure (see e.g. Sauer (1998) Methods 14: 381-392); and (e) identifying the polypeptide expressed by the cDNA recovered in step (d), e.g. by sequencing the cDNA and comparing the obtained sequence against sequence databases.
• standard procedures e.g. PCR or a CRE-LOX mediated procedure (see e.g. Sauer (1998) Methods 14: 381-392)
• identifying the polypeptide expressed by the cDNA recovered in step (d) e.g. by sequencing the cDNA and comparing the obtained sequence against sequence databases.
• standard protocols and “standard procedures”, when used in the context of molecular biology techniques, are to be understood as protocols and procedures found in an ordinary laboratory manual such as: Current Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and Sons, hie. 1994, or Sambrook, J., Fritsch, E.F. and Maniatis, T, Molecular Cloning: A laboratory manual, 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989.
• GenBank accession number NM_00521 GenBank accession number NM_00521 (SEQ ID NO: 9)
• the BLAST algorithm Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402) was used for determimng sequence identity.
• Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).
• Regions in sequence AC009108 matching portions of the FOXC2 cDNA sequence NM_005251 were combined using the PHRAP software, developed at the University of Washington (http://www.genome.washington.edu/UWGC/analysistools/phrap.htm). Two contigs of 9780 bp (positions 116445 to 126224 in GenBank AC009108.6) and 3784 bp (positions 42927 to 46710 in GenBank AC0091108.6), respectively, were assembled to generate a human FOXC2 genomic fragment of 13451 bp.
• the ClustalW multiple sequence alignment program, version 1.8 Thimpson et al.
• SEQ ID NO: 1 The open reading frame in SEQ ED NO: 1 encodes a polypeptide (SEQ ID NO: 2) identical with the known human FOXC2 polypeptide shown as SEQ ID NO: 10.
• EXAMPLE 2 Identification of potential regulatory sequences in the human and mouse FOXC2 genomic sequences
• positions 33 to 182 in the EST with accession no. AW271272 were identical to positions 66 to 215 in the extended FOXC2 genomic sequence (SEQ ED NO: 1), and that positions 183 to 327 in SEQ ED NO: 11 were identical to positions 2516 to 2660 in SEQ ED NO: 1.
• positions 5 to 55 in the EST with accession no. AW793237 were identical to positions 165 to 215 in the extended FOXC2 genomic sequence (SEQ ED NO: 1), and positions 56 to 157 in SEQ ED NO: 12 were identical to positions 2516 to 2607 in SEQ ED NO: 1.
• an alternative gene sequence (SEQ ID NO: 3) is derived by joining the regions shown as positions 1-215 and 2516-6458 in SEQ ED NO: 1.
• Alternative splicing patterns are known to regulate the synthesis of a variety of peptides and proteins. It may result in proteins with an entirely different function or in dysfunctional or inhibitory splice products (for a review, see McKeown (1992) Annu. Rev. Cell. Biol. 8: 133-155).
• the DNA region corresponding to nucleotide 176 to nucleotide 2233 (SEQ ED NO. 1 version 2) has been cloned using nested PCR on human genomic DNA.
• the PCR was performed according the HerculaseTM protocol (Stratagene catalog #600260; http://www.stratagene.com/pcr/herculase.htm) and with the inclusion of 8-10% DMSO.
• the 5 '-primer KRKXl 31 (CCATTGCCTTCTAGTCGCCTCC) was used together with the 3 '-primer KRKXl 33 (CGTTGGGGTCGGACACGGAGTA) using 250 ng Clontech Genomic DNA # 6550-1 as template.
• the nested reaction was performed on 1/100 of the initial PCR reaction using the 5'-primer KRKX132 (GGTACCTACGCAGCCGATGAACAGCCA) and the 3'-primer KRKX134 (GCTAGCTGCTTCCGAGACGGCTCG).
• the product was analyzed by electrophoresis in a 1.2% agarose gel, and a PCR product of the expected size was obtained and extracted for ligation into a TOPO PCR2.1 vector (Invitrogen, Carlsbad, CA) by standard cloning procedures and thereafter sequenced.
• the PCR reaction and cloning procedure was repeated in two parallel separate experiments, and sequence data from the two separate reactions were compared with the bioinformatically assembled sequence.
• KRKXl 34 (GCTAGCGCTGCTTCCGAGACGGCTCG) using 250 ng genomic DNA as a template.
• the PCR reaction and cloning procedure was repeated in four parallel separate experiments, and sequence data from the four separate reactions were compared with the bioinformatically assembled sequence.
• RNA samples from human adipose tissue (Invitrogen, D6005-01) and primary adipocytes (Zen- Bio, SA75, RNA prepared according to the Trizol protocol) were analyzed.
• RT-PCR was performed according to SMART RACE protocol (Clontech). First strand cDNA synthesis was made using a oligo dT primer provided in the SMART RACE kit.
• nested 5' primer specific for the alternative transcript was used (initial PCR step ROLX56 5'ATG AAC AGC CAG GAA GGG TGC AAG G3' and nested primer ROLX58 5'ACA GCC AGG AAG GGT GCA AGG AAA C3') while the nested 3' primers anneals to sequence common for both the alternative and the normal transcript (initial PCR step ROLX57 5 'GAA GCT GCC GTT CTC GAA CAT GTT G 3' and nested primer ROLX59 5'GTA GGA GTC CGG GTC CAG GGT CCA G 3' ). PCR was performed using the SMART RACE protocol.
• the primers anneal to sequence on either side of the suggested splice site.
• a PCR product of the expected size of 223 bp was obtained when amplifying cDNA derived from the alternative transcript, while amplification of contaminating genomic DNA containing the intron sequence yielded a PCR product of much larger size.
• expression of the alternative transcript was detected in human adipose tissue and primary adipocytes.
• Expression of the alternative gene product (SEQ ED NO: 4) in adipocytes and adipose tissue may be indicative of a regulatory function in this cell type.
• EXAMPLE 6 Mapping of the 5'-UTR of the alternative exon using cDNA walking.
• a cDNA walking method was used in order to map the 5 '-UTR of the alternative exon. • Human adipose total RNA was obtained from Invitrogen (D6005-01). First strand 5' RACE cDNA was synthesized according to standard procedure as described in the Clontech manual. The cDNA was amplified according to the manual but using gene specific primers. The 3 '-PCR primers used in all reactions anneals to a sequence at the 3'- end of the splice site. Amplification of contaminating genomic DNA yields a PCR product of a larger size, as this would contain the intron sequence.
• the 5'-PCR primers anneals to sequence upstream of the putative initiation codon of the alternative exon, with approximate 100 bp intervals.
• PCR products were subsequently cloned using TA cloning in a TOPO vector (Invitrogen) according to manual, and sequenced using standard procedure.
• nested 5 '-primers were used (initial PCR step 5'-GCGTTCGGCTCACTGACTTACAAGGT-3' and nested primer 5'- GGAAGTGTCTCTCTCACCTTTTCTGTCTTGA-3') together with nested 3 '-primers (initial PCR step 5'-GAAGCTGCCGTTCTCGAACATGTTG-3' and nested primer 5'- GTAGGAGTCCGGGTCCAGGGTCCAG-3').
• the identified regulatory regions are analyzed to determine their impact on the transcription of the FOXC2 gene or a reporter gene substituted for FOXC2.
• a PCR reaction is performed to isolate the promoter region adjacent to the published exon sequence, possibly including the sequences extending to the beginning of the ATG encoding the first methionine.
• This PCR product is cloned into a reporter plasmid adjacent to a reporter gene (e.g. luciferase).
• the upstream regulatory region i.e. regions containing both upstream and promoter proximal sequences, or these sequences bearing artificially induced differences, are cloned in a similar manner.
• constructs are transfected into a cell culture model system and the level activity of the protein encoded by the reporter gene is determined. This would provide information on the function of the identified regions, and used to assess the impact of the different regions on transcriptional regulation.
• upstream regulatory region a region containing both upstream and promoter proximal sequences, or these sequences bearing artificially induced differences can be cloned and used to assess the impact of these regions on the transcription of the reporter gene.
• Reporter gene assays are well known as tools to signal transcriptional activity in cells.
• the photoprotein luciferase provides a useful tool for assaying for modulators of promoter activity.
• Cells are transiently transfected with a reporter construct which includes a gene for the luciferase protein downstream from the FOXC2 promoter and enhancer region, or fragments thereof regulating the FOXC2 activity.
• Luciferase activity maybe quantitatively measured using e.g. luciferase assay reagents that are commercially available from Promega (Madison, WI). Differences in luminescence in the presence versus the absence of a candidate modulator compound are indicative of modulatory activity.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biophysics (AREA)
• Biomedical Technology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Hematology (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Immunology (AREA)
• Pharmacology & Pharmacy (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Obesity (AREA)
• Analytical Chemistry (AREA)
• Diabetes (AREA)
• Plant Pathology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)
• Jellies, Jams, And Syrups (AREA)
• Seasonings (AREA)

Applications Claiming Priority (7)

Publications (1)

Family

ID=27354602

Family Applications (1)

Country Status (5)

Families Citing this family (3)

Family Cites Families (2)

• 2001
  • 2001-09-26 EP EP01972843A patent/EP1320623A1/de not_active Withdrawn
  • 2001-09-26 WO PCT/SE2001/002098 patent/WO2002027008A1/en active Application Filing
  • 2001-09-26 CA CA002421620A patent/CA2421620A1/en not_active Abandoned
  • 2001-09-26 AU AU2001292481A patent/AU2001292481A1/en not_active Abandoned
  • 2001-09-26 JP JP2002530771A patent/JP2004510417A/ja active Pending

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events