EP1320621A2 - Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications - Google Patents

Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications

Info

Publication number
EP1320621A2
EP1320621A2 EP01975214A EP01975214A EP1320621A2 EP 1320621 A2 EP1320621 A2 EP 1320621A2 EP 01975214 A EP01975214 A EP 01975214A EP 01975214 A EP01975214 A EP 01975214A EP 1320621 A2 EP1320621 A2 EP 1320621A2
Authority
EP
European Patent Office
Prior art keywords
vector
adenovirus
pol
nef
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01975214A
Other languages
German (de)
French (fr)
Other versions
EP1320621A4 (en
Inventor
Emilio A. Emini
Rima Youil
Andrew J. Bett
Ling Chen
David C. Kaslow
John W. Shiver
Timothy J. Toner
Daniel R. Casimiro
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Publication of EP1320621A2 publication Critical patent/EP1320621A2/en
Publication of EP1320621A4 publication Critical patent/EP1320621A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10351—Methods of production or purification of viral material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA

Definitions

  • the present invention relates to recombinant, replication-deficient first generation adenovirus vaccines found to exhibit enhanced growth properties and greater cellular-mediated immunity as compared to other replication-deficient vectors.
  • the invention also relates to the associated first generation adenoviral vectors described herein, which, through the incorporation of additional 5' adenovirus sequence, enhance large scale production efficiency of the recombinant, replication- defective adenovirus described herein.
  • Another aspect of the instant invention is the surprising discovery that the intron A portion of the human cytomegalovirus (hCMV) promoter constitutes a region of instability in adenoviral vector constructs. Removal of this region from adenoviral expression constructs results in greatly improved vector stability.
  • hCMV human cytomegalovirus
  • adenoviral vectors are useful for generating recombinant adenovirus vaccines against human immunodeficiency virus (HTV).
  • HTV human immunodeficiency virus
  • the first generation adenovirus vectors disclosed herein are utilized to construct and generate adenovirus-based HTV- 1 vaccines which contain HIN-1 Gag, HIV-1 Pol and or HIV-1 ⁇ ef polynucleotide pharmaceutical products, and biologically active modifications thereof.
  • Host administration of the recombinant, replication-deficient adenovirus vaccines described herein results in expression of HTV-1 Gag, HIV-1- Pol and/or ⁇ ef protein or im-munologically relevant modifications thereof, inducing a cellular immune response which specifically recognizes HTV-1.
  • the exemplified polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HTV-1 Gag, HTV-1 Pol, derivatives of optimized HTV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HTV-1 Pol is inactivated), HIV-1 Nef, and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4.
  • HIV adenovirus vaccines of the present invention when administered alone or in a combined modality and/or prime/boost regimen, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
  • HTV-1 Human Immunodeficiency Virus-1
  • AIDS human immune deficiency syndrome
  • HIN-1 is an R ⁇ A virus of the Retro viridae family and exhibits the S'LTR-gag-pol-env- LTR 3' organization of all retro viruses.
  • the integrated form of HTV-1, known as the provirus, is approximately 9.8 Kb in length.
  • Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs).
  • LTRs long terminal repeats
  • the HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and ⁇ ef).
  • the gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene.
  • the mature p55 protein products are pl7 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
  • the pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting.
  • the viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, pl5) activities.
  • the ne gene encodes an early accessory HTV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
  • the env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gpl60) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41- kDa envelope glycoprotein (gp41). Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
  • kDa 160-kilodalton
  • gp41 transmembrane 41- kDa envelope glycoprotein
  • the tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.
  • the rev gene encodes the 13 kDa Rev protein, a RNA binding protein.
  • the Rev protein binds to a region of the viral RNA termed the Rev response element (RRE).
  • the Rev protein promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm.
  • the Rev protein is required for HIV late gene expression and in turn, HIV replication.
  • Gpl20 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules.
  • X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a R5 (T-cell line tropic) virus interacts with a CD4/CCR5 receptor complex.
  • gp41 mediates the fusion event responsible for virus entry.
  • the virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase.
  • the viral DNA known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles.
  • the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response.
  • Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection.
  • a second actor is the considerable genetic variability of the virus.
  • anti-HTV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HTV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants.
  • antigen in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins.
  • MHC major histocompatibility complex
  • CD8 + T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein.
  • Activation of naive CD8 + T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins.
  • Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4 + T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.
  • adenovirus vectors carrying an HTV gene including env or gag.
  • Various treatment regimens were used with chimpanzees and dogs, some of which included booster adenovirus or protein plus alum treatments.
  • Replication-defective adenoviral vectors harboring deletions in the El region are known, and recent adenoviral vectors have incorporated the known packaging repeats into these vectors; e.g., see EP 0707 071, disclosing, inter alia, an adenoviral vector deleted of El sequences from base pairs 459 to 3328; and U.S. Patent No. 6,033,908, disclosing, inter alia, an adenoviral vector deleted of base pairs 459-3510.
  • the packaging efficiency of adenovirus has been taught to depend on the number of incorporated individual A (packaging) repeats; see, e.g., Grable and Hearing, 1990 J. Virol. 64(5):2047-2056; Grable and Hearing, 1992 J. Virol. 66(2):723-731.
  • Larder, et al., (1987, Nature 327: 716-717) and Larder, et al., (1989, Proc. Natl. Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.
  • Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.
  • Leavitt, et al. (1993, J. Biol. Chem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show-differing effect on HIV-1 integrase (IN) activity.
  • Wiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HTV-1 IN and viral replication functions. It would be of great import in the battle against AIDS to produce a prophylactic- and/or therapeutic-based BIN vaccine which generates a strong cellular immune response against an TUN infection.
  • the present invention addresses and meets these needs by disclosing a class of adenovirus vaccines which, upon host administration, express codon optimized and modified versions of the HIN-1 genes, gag, pol and nef.
  • These recombinant, replication-defective adenovirus vaccines may be administered to a host, such as a human, alone or as part of a combined modality regimen and/or prime-boost vaccination regimen with components of the present invention and/or a distinct viral HIN D ⁇ A vaccine, non- viral HIN D ⁇ A vaccine, TUN subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIN vaccine.
  • a host such as a human, alone or as part of a combined modality regimen and/or prime-boost vaccination regimen with components of the present invention and/or a distinct viral HIN D ⁇ A vaccine, non- viral HIN D ⁇ A vaccine, TUN subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIN vaccine.
  • the present invention relates to enhanced replication-defective recombinant adenovirus vaccine vectors and associated recombinant, replication-deficient adenovirus vaccines which encode various forms of HTV-1 Gag, HIV-1 Pol, and/or HTV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HTV-1 Pol and HIV-1 Nef.
  • the adenovirus vaccines of the present invention express HTV antigens and provide for improved cellular-mediated immune responses upon host administration.
  • Potential vaccinees include but are not limited to primates and especially humans and non-human primates, and also include any non-human mammal of commercial or domestic veterinary importance.
  • an effect of the improved recombinant adenovirus-based vaccines of the present invention should be a lower transmission rate to previously uninfected individuals (i.e., prophylactic applications) and/or reduction in the levels of the viral loads within an infected individual (i.e., therapeutic applications), so as to prolong the asymptomatic phase of HTV-1 infection.
  • the present invention relates to adenoviral-based vaccines which encode various forms of codon optimized HIV-1 Gag (including but in no way limited to p55 versions of codon optimized full length (FL) Gag and tPA- Gag fusion proteins), HTV-1 Pol, HIV-1 Nef, and selected modifications of immunological relevance.
  • the administration, intracellular delivery and expression of these adenovirus vaccines elicit a host CTL and Th response.
  • the preferred replication-defective recombinant adenoviral vaccine vectors include but are not limited to synthetic DNA molecules which (1) encode codon optimized versions of wild type HIV-1 Gag; (2) encode codon optimized versions of HTV-1 Pol; (3) encode codon optimized versions of HTV-1 Pol fusion proteins; (4) encode codon optimized versions of modified HIV-1 Pol proteins and fusion proteins, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell; (5) encode codon optimized versions of wild type HIV-1 Nef; (6) codon optimized versions of HTV-1 Nef fusion proteins; and/or (7) codon optimized versions of HIV-1 Nef derivatives, including but not limited to e modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations.
  • Nef-based fusion and modified proteins may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response.
  • HTV-1 Gag, Pol and/or Nef fusion proteins include but are not limited to fusion of a leader or signal peptide at the NH -teriminal portion of the viral antigen coding region.
  • a leader peptide includes but is not limited to a tPA leader peptide.
  • the adenoviral vector utilized in construction of the HIV-1 Gag-, HIV-1 Tru/or HTV-1 Nef- based vaccines of the present invention may comprise any replication-defective adenoviral vector which provides for enhanced genetic stability of the recombinant adenoviral genome through large scale production and purification of the recombinant virus.
  • an HIV-1 Gag-, Pol- or Nef-based adenovirus vaccine of the present invention is a purified recombinant, replication- defective adenovirus which is shown to be genetically stable through multiple passages in cell culture and remains so during large scale production and purification procedures.
  • Such a recombinant adenovirus vector and harvested adenovirus vaccine lends itself to large scale dose filling and subsequent worldwide distribution procedures which will be demanded of an efficacious monovalent or multivalent HTV vaccine.
  • the present invention meets this basic requirement with description of a replication-defective adenoviral vector and vectors derived therefrom, at least partially deleted in El, comprising a wildtype adenovirus cz ' -s-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome.
  • a preferred embodiment of the instant invention comprises base pairs 1-450 of a wildtype adenovirus.
  • the replication -defective adenoviral vector has, in addition thereto, a region 3' to the El-deleted region comprising base pairs 3511-3523.
  • Basepairs 342-450 (more particularly, 400-450) constitute an extension of the 5 'region of previously disclosed vectors carrying viral antigens, particularly HTV antigens (see, e.g., PCT International Application PCT/US00/18332, published January 11, 2001 (WO 01/02067), which claims priority to U.S. Provisional Application Serial Nos. 60/142,631 and 60/148,981, filed 7/6/1999 and 8/13/1999, respectively; these documents herein incorporated by reference. Applicants have found that extending the 5' region further into the El gene into the disclosed vaccine vectors incorporated elements found to be important in optimizing the packaging of the virus.
  • vectors comprising the above region exhibited enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, a more potent virus effect, allowing lower doses of virus to be used to generate equivalent immunity; and a greater cellular-mediated immune response than replication-deficient vectors not comprising this region (basepairs 1-450).
  • adenoviral constructs derived therefrom are very stable genetically in large-scale production, particularly those comprising an expression cassette under the control of a hCMV promoter devoid of intron A.
  • a preferred embodiment of this invention is a replication-defective adenoviral vector in accordance with the above description wherein the gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.
  • the El gene other than that contained within basepairs 1-450 or, alternatively, that contained within base pairs 1-450 and 3511- 3523 has been deleted from the adenoviral vector, and the gene expression cassette has replaced the deleted El gene.
  • the replication defective adenovirus genome does not have a functional E3 gene, or the E3 gene has been deleted. Most preferably, the E3 region is present within the adenoviral genome.
  • the gene expression cassette is in an El anti-parallel (transcribed in a 3' to 5' direction relative to the vector backbone) orientation or, more preferably, an El parallel (transcribed in a 5' to 3' direction relative to the vector backbone) orientation.
  • a shuttle plasmid vector comprising: an adenoviral portion and a plasmid portion, wherein said adenovirus portion comprises: a) a replication defective adenovirus genome, at least partially deleted in El, comprising a wildtype adenovirus czs-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) of the wildtype adenovirus genome and, preferably, in addition thereto, basepairs 3511-3523 of a wildtype adenovirus sequence; and b) a gene expression cassette comprising: (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a);and (c) a transcription terminator and or a polyadenylation site.
  • aspects of this invention include a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and (b) harvesting the resultant adenoviral vectors.
  • the present invention particularly relates to harvested recombinant, replication defective virus derived from a host cell, such as but not limited to 293 cells or PER.C6 ® cells, including but not limited to harvested virus related to any of the MRKAd5 vector backbones, with or without an accompanying transgene, including but not limited to the FUN-l antigens described herein.
  • An HTV-1 vaccine is represented by any harvested, recombinant adenovirus material which expresses any one or more of the HIV-1 antigens disclosed herein. This harvested material may then be purified, formulated and stored prior to host administration.
  • Another aspect of this invention is a method of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising: a) a recombinant, replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus czs-acting adenovirus packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) and, preferably in addition thereto, base pairs 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising: ⁇ a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.
  • an adenovirus vaccine vector
  • the present invention relates to all methodology regarding administration of one or more of these adenoviral and/or DNA plasmid vaccines to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIN infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences.
  • such a treatment regimen may include a monovalent or multivalent composition, various combined modality applications, and/or a prime/boost regimen to as to optimize antigen expression and a concomitant cellular-mediated and/or humoral immune response upon inoculation into a living vertebrate tissue. Therefore, the present invention provides for methods of using the adenoviral and/or D ⁇ A plasmid vaccines disclosed herein within the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of the gag, pol and/or nef-based vaccines.
  • the present invention relates in part to methods of generating a cellular immune response in a vaccinee, preferably a human vaccinee, wherein the individual is given more than one administration of adenovirus vaccine vector, and it may be given in a regimen accompanied by the administration of a plasmid vaccine.
  • the plasmid vaccine also referred to herein as a "D ⁇ A plasmid vaccine” or "vaccine plasmid” comprises a nucleic acid encoding a protein or an immunologically relevant portion thereof, a heterologous promoter operably linked to the nucleic acid sequence, and a transcription terminator or a polyadenylation signal (such as bGH or SPA, respectively).
  • the individual can be given a first dose of plasmid vaccine, and then a second dose of plasmid vaccine.
  • the individual may be given a first dose of adenovirus vaccine, and then a second dose of adenovirus vaccine.
  • the plasmid vaccine is administered first, followed after a time by administration of the adenovirus vaccine.
  • the adenovirus vaccine may be administered first, followed by administration of plasmid vaccine after a time.
  • an individual may be given multiple doses of the same adenovirus serotype in either viral vector or plasmid form, or the virus may be of differing serotypes.
  • a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed.
  • Alternative viral vaccines include but are not limited to pox virus and Venezuelan equine encephilitis virus.
  • the present invention also relates to multivalent adenovirus vaccine compositions which comprise Gag, Pol and Nef components described herein; see, e.g., Example 29 and Table 25. Such compositions will provide for an enhanced cellular immune response subsequent to host administration, particularly given the genetic diversity of human MHCs and of circulating virus.
  • MRKAd5-vector based multivalent vaccine compositions which provide for a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components) composition.
  • a mutlivalent vaccine may be filled for a single dose or may consist of multiple inoculations of each individually filled component; and may in addition be part of a prime/boost regimen with viral or non- viral vector vaccines as introduced in the previous paragraph.
  • preferred compositions are MRKAd5 adenovirus used in combination with multiple, distinct HTV antigen classes.
  • Each HIN antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention.
  • the utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
  • a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possibly a "2+1" divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence.
  • the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES).
  • IRS internal ribosome entry sequence
  • a multivalent vaccine delivered as a single, or possibly a second harvested recombinant, replication-deficient adenovirus is contemplated as part of the present invention. Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen.
  • a mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly if pre-existing anti-vector immune responses are present.
  • This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine.
  • primings typically, 1-4, are usually employed, although more may be used.
  • the length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used.
  • the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine.
  • the use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adeno virus immune response. '
  • These recombinant adenoviral backbones may accept one or more transgenes, which may be passaged through cell culture for growth, amplification and harvest.
  • a recombinant adenovirus is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.
  • this recombinant virus is harvested and formulated for subsequent host administration. It is also an object of the present invention to provide for replication-defective adenoviral vectors wherein at least one gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.
  • an adenovirus vaccine vector comprising a) a replication defective
  • Such processes include but are not limited to multivalent HTV-1 vaccine compositions, various combined modality regimes as well as various prime/boost alternatives.
  • These methods of administration, relating to vaccine composition and/or scheduled administration will increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
  • HAART refers to — highly active antiretroviral therapy — .
  • first generation vectors are characterized as being replication-defective. They typically have a deleted or inactivated El gene region, and preferably have a deleted or inactivated E3 gene region as well.
  • AEX refers to Anion Exchange chromatography
  • QPA refers to Quick PCR-based Potency Assay.
  • bps refers to basepairs.
  • s or “str” denotes that the transgene is in the El parallel or “straight” orientation.
  • PBMCs peripheral blood monocyte cells
  • FLgag refers to a full-length optimized gag gene, as shown in Figure 2.
  • Ad5-Flgag refers to an adenovirus serotype 5 replication deficient virus which carries an expression cassette which comprises a full length optimized gag gene under the control of a CMN promoter.
  • Promoter means a recognition site on a D ⁇ A strand to which an R ⁇ A polymerase binds.
  • the promoter forms an initiation complex with R ⁇ A polymerase to initiate and drive transcriptional activity.
  • the complex can be modified by activating sequences such as enhancers or inhibiting sequences such as silencers.
  • Leader means a D ⁇ A sequence at the 5' end of a structural gene which is transcribed along with the gene. This usually results a protein having an ⁇ -terminal peptide extension, often referred to as a pro-sequences.
  • Intron means a section of D ⁇ A occurring in the middle of a gene which does not code for an amino acid in the gene product. The precursor R ⁇ A of the intron is excised and is therefore not transcribed into mR ⁇ A not translated into protein.
  • Immunologically relevant or “biologically active” means (1) with regards to a viral protein, that the protein is capable, upon administration, of eliciting a measurable immune response within an individual sufficient to retard the propagation and/or spread of the virus and/or to reduce the viral load present within the individual; or (2) with regards to a nucleotide sequence, that the sequence is capable of encoding for a protein capable of the above.
  • “Cassette” refers to a nucleic acid sequence which is to be expressed, along with its transcription and translational control sequences. By changing the cassette, a vector can express a different sequence.
  • “bGHpA” refers to the bovine growth hormone transcription terminator/polyadenylation sequence.
  • tPAgag refers to a fusion between the leader sequence of the tissue plasminogen activator leader sequence and an optimized HIV gag gene, as exemplified in Figure 30A-B, whether in a DNA or adeno virus-based vaccine vector.
  • IA or “inact” refers to an inactivated version of a gene (e.g. IApol).
  • MCS multiple cloning site
  • adenoviral constructs gene constructs are named by reference to the genes contained therein. For example:
  • Ad5 HTV-1 gag also referred to as the original HTV-1 gag adenoviral vector, is a vector containing a transgene cassette composed of a hCMV intron A promoter, the full length version of the human codon-optimized HIN-1 gag gene, and the bovine growth hormone polyadenylation signal.
  • the transgene was inserted in the El antiparallel orientation in an El and E3 deleted adenovector.
  • MRK Ad5 HIN-1 gag also referred to as "MRKAd5gag” or “Ad5gag2” is an adenoviral vector taught herein which is deleted of El, comprises basepairs 1-450 and 3511-3523, and has a human codon-optimized HTV-1 gene in an El parallel orientation under the control of a CMV promoter without intron A.
  • the construct also comprises a bovine growth hormone polyadenylation signal.
  • pNUnsHINgag also referred to as “HTVFLgagPR9901” is a plasmid comprising the CMN immediate-early (IE) promoter and intron A, a full-length codon-optimized HIN gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone.
  • pNUnsCMV(no intron)-FLgag-bGHpA is a plasmid derived from pVl JnsHTVgag which is deleted of the intron A portion of CMV and which comprises the full length HIV gag gene.
  • This plasmid is also referred to as "pVl JnsHTVgag- bGHpA", pVl Jns-hCMV-FL-gag-bGHpA" and "pVl JnsCMV(no intron) + FLgag + bGHpA".
  • "pVl JnsCMV(no intron)-FLgag-SPA” is a plasmid of the same composition as pVl JnsCMV(no intron)-FLgag-bGHpA except that the SPA termination sequence replaces that of bGHpA.
  • This plasmid is also referred to as "pVl Jns-HTVgag-SPA” and pNUns-hCMN-FLgag-SPA”.
  • pdelElsplA is a universal shuttle vector with no expression cassette (i.e., no promoter or polyA).
  • the vector comprises wildtype adenovirus serotype 5 (Ad5) sequences from bp 1 to bp 341 and bp 3524 to bp 5798, and has a multiple cloning site between the Ad5 sequences ending 341 bp and beginning 3524 bp.
  • This plasmid is also referred to as the original Ad 5 shuttle vector.
  • MRKpdelElsplA or "MRKpdelEl(Pac/pIX/pack450)" or
  • MLKpdelEl(Pac/pIX/pack450)Clal is a universal shuttle vector with no expression cassette (i.e. no promoter or polyA) comprising wildtype adenovirus serotype 5 (Ad5) sequences from bpl to bp450 and bp 3511 to bp 5798.
  • the vector has a multiple cloning site between the Ad5 sequence ending 450 bp and beginning 3511 bp.
  • This shuttle vector may be used to insert the CMV promoter and the bGHpA fragments in both the straight ("sir", or El parallel) orientation or in the opposite (opp. or El antiparallel) orientation)
  • MRKpdelEl(Pac/pIX/pack450)+CMNmin+BGHpA(str.) is still another shuttle vector which is the modified vector that contains the CMN promoter (no intron A) and the bGHpA fragments.
  • the expression unit containing the hCMN promoter (no intron A) and the bovine growth hormone polyadenylation signal has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bglll site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El/E3+)Clal pre-plasmid.
  • This shuttle vector was used to insert the respective IApol and G2A,LLAA nef genes directly into.
  • "MRKpdelEl-CMN(no intron)-FLgag-bGHpA” is a shuttle comprising Ad5 sequences from basepairs 1-450 and 3511-5798, with an expression cassette containing human CMV without intron A, the full-length human codon-optimized HIN gag gene and bovine growth hormone polyadenylation signal.
  • This plasmid is also referred to as "MRKpdelEl shuttle +hCMN-FL-gag-BGHpA"
  • “MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA” is an adenoviral vector comprising all Ad5 sequences except those nucleotides encompassing the El region (from 451-3510), a human CMV promoter without intron A, a full-length human codon-optimized HIN gag gene, and a bovine growth hormone polyadenylation signal.
  • This vector is also referred to as "MRKpAdHVE3 + hCMV-FL-gag- BGHpA", "MRKpAd5HIN-lgag”, “MRKpAd5gag”, “pMRKAd5gag” or " P Ad5gag2".
  • pNlJns-HIN-pol inact(opt) or "pNlJns-HIN IA pol (opt) is the inactivated Pol gene (contained within SEQ ID NO: 3) cloned into the Bglll site of VI Jns ( Figure 17A-C).
  • various derivatives of HIN-1 pol may be cloned into a plasmid expression vector such as Nl Jns or Nl Jns-tPA, thus serving directly as D ⁇ A vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.
  • MRKpdel+hCMVmin+FL-pol+bGHpA(s) is the "MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.)” shuttle mentioned above which contains the IA pol gene is the proper orientation. This shuttle vector is used in a bacterial recombination with MRKpAd(El-/E3+)Clal.
  • MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+ also referred to herein as
  • pMRKAd5pol is the pre-adenovirus plasmid which comprises a CMV-pol inact(opt)-pGHpA construct.
  • the construction of this pre-adenovirus plasmid is shown in Figure 22.
  • Vuns/nef (G2A,LLAA) or “VlJns/opt nef (G2A,LLAA)” comprises codon optimized HIN-1 ⁇ ef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu- 174-Leu-175 dileucine motif to Ala-174-Ala-175 (SEQ ID ⁇ O:13; which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662).
  • HIV-1 nef constructs may be cloned into a plasmid expression vector such as VlJns or VlJns- tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.
  • pMRKAd5nef is the pre-adenovirus plasmid which comprises a CMV-nef
  • FIGURES Figure 1 shows the original HIV-1 gag adeno vector (Ad5HIV-lgag). This vector is disclosed in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S. Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference.
  • Figure 2 shows the nucleic acid sequence (SEQ ID NO: 29) of the optimized human HIV-1 gag open reading frame.
  • Figure 3 shows diagrammatically the new transgene constructs in comparison with the original gag transgene.
  • Figure 4 shows the modifications made to the original adenovector backbone in the generation of the novel vectors of the instant invention.
  • Figure 5 shows the virus mixing experiments that were carried out to determine the effects of the addition made to the packaging signal region (Expt. #1) and the E3 gene on viral growth (Expt. #2). The bars denote the region of modifications made to the El deletion.
  • Figure 6 shows an autoradiograph of viral DNA analysis following the viral mixing experiments described in Examples 6 and 7.
  • Figures 7 A, 7B and 7C are as follows:
  • Figure 7 A shows the hCMV-Flgag- bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Both El parallel and El antiparallel transgene orientation are represented.
  • Figure 7B shows the hCMV-Flgag-SPA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Again, both El parallel and El antiparallel transgene orientation are represented.
  • Figure 7C shows the mCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones.
  • Figure 8 A shows the experiment designed to test the effect of transgene orientation.
  • Figure 8B shows the experiments designed to test the effect of polyadenylation signal.
  • Figure 9 shows viral DNA from the four adenoviral vectors tested (Example
  • Figure 10 shows viral DNA analysis of passages 11 and 12 of MRKpAdHVE3, MRKAd5HIV-lgag, and MRKAd5HIV-lgagE3-.
  • Figure 11 shows viral DNA analysis (Hindlll digestion) of passage 6 MRKpAdHVE3 and MRKAd5HIV-lgag used to initiate the viral competition study. The last two lanes are passage 11 analysis of duplicate passages of the competition study (each virus at MOI of 280 viral particles).
  • Figure 12 shows viral DNA analysis by Hind III digestion on high passage numbers for MRKAd5HIV-lgag in serum-containing media with collections made at specified times.
  • the first lane shows the lkb DNA size marker.
  • the other lanes represent pre-plasmid control (digested with Pacl and HindRT), MRKAd5HIN-lgag at P16, P19, and P21.
  • GTT geometric mean titers
  • Figure 14 shows a restriction map of the pMRKAd5HIV-lgag vector.
  • Figures 15A-X illustrates the nucleotide sequence of the pMRKAd5HIV-lgag vector (SEQ ID NO:27. [coding] and SEQ ID NO:28 [non-coding]).
  • Figures 16A-B shows a schematic representation of DNA vaccine expression vectors VI Jns (A) and VI Jns-tPA (B), which are utilized for HTV-1 gag, pol and nef constructs in various DNA/viral vector combined modality regimens as disclosed herein.
  • Figures 17A-C shows the nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.
  • Figure 18 shows codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-pol inact(opt) (contained within SEQ ID NOs: 7 and 8, respectively).
  • the underlined portion represents the NH 2 -terminal region of IA-Pol.
  • Figures 19A-B show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef.
  • the wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide.
  • WT wild type sequence (SEQ ID NO: 19); opt, codon-optimized sequence (contained within SEQ ID NO:l).
  • the Nef amino acid sequence is shown in one-letter code (SEQ ID NO:2).
  • Figures 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors VI Jns/nef ( Figure 20A), NlJns/nef(G2A,LLAA) ( Figure 20B), NlJns/tpanef (Figure 20C) and NlJns/tpanef(LLAA) ( Figure 20C, also).
  • 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters.
  • Nl Jns/tpanef and NUns/tpanef(LLAA) have identical sequences at the junctions.
  • Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in ⁇ ef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the putative leader peptide cleavage sites are indicated with "*", and a exogenous serine residue introduced during the construction of the mutants is underlined.
  • Figure 22 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Pol.
  • Figure 23 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Nef .
  • Figure 24 shows a comparison of clade B vs. clade C anti-gag T cell responses in clade B HTV -infected subjects.
  • Figure 25 shows a comparison of clade B vs. clade C anti-nef T cell responses in clade B HIN-infected subjects.
  • Figures 26A-AO illustrates the nucleotide sequence of the pMRKAd5EDN- lpol adenoviral vector (SEQ ID ⁇ O:32 [coding] and SEQ ID NO:33 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ ID NO3).
  • Figures 27 A- AM illustrates the nucleotide sequence of the pMRKAd5HIN-l nef adenoviral vector (SEQ ID ⁇ O:34 [coding] and SEQ ID NO:35 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ ID NO13).
  • Figure 28 shows the stability of MRKAd5 vectors comprising various promoter fragments (hCMV or mCMV) and terminations signals (bGH or SPA) in E3(+) or E3(-) backbones.
  • Figures 29A and B shows the anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi time points ( Figure 29 A) and the timcourse QPA supernatant titers (Figure 29B) for MRKAd5gag, MRKAd5pol and MRKAd5nef .
  • Figure 30 shows the nucleotide sequence (SEQ ED NO:36) and amino acid sequence (SEQ ID NO: 37) comprising the open reading frame of a representative tPA-gag fusion for use in the DNA and/or adenoviral vaccine disclosed herein.
  • Figure 31 shows the intracellular ⁇ lFN staining of PBMCs collected at week 10 (post DNA prime) and week 30 (post Ad boost). The cells were stimulated overnight in the presence or absence of the gag peptide pool. They were subsequently stained using fluorescence-tagged anti-CD3, anti-CD8, anti-CD4, and anti- ⁇ lFN monoclonal antibodies. Each plot shows all CD3+ T cells which were segregated in terms of positive staining for surface CD8 and ⁇ lFN production. The numbers in the upper right and lower right quadrants of each plot are the percentages of CD3 + cells that were CD8 + ⁇ IFN + and CD4 + ⁇ IFN + , respectively.
  • Figure 32 shows a comparison of single-modality adenovirus immunization with DNA + adjuvant prime/adenovirus boost immunization.
  • Figures 33A-B show the nucleotide sequence (SEQ ID NO: 38) of the open reading frame for the gag-IApol fusion of Example 29.
  • Figures 34A-B show the protein sequence (SEQ ID NO: 39) of the gag-IApol fustion frame.
  • a novel replication-defective, or "first generation,” adenoviral vector suitable for use in gene therapy or nucleotide-based vaccine vectors is described.
  • This vector is at least partially deleted in El and comprises a wildtype adenovirus czs-acting packaging region from about base pair 1 to between about base pair 342 (more preferably, 400) to about 458 (preferably, 1-450) and, preferably, 3511-3523 of a wild-type adenovirus sequence. It has been found that a vector of this description possesses enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, and is more potent allowing lower doses of virus to be used to generate equivalent immunity.
  • the vector furthermore, generates a harvested recombinant adenovirus which shows greater cellular-mediated immune responses than replication-deficient vectors not comprising this region (basepairs 342-450).
  • Adenoviral constructs derived from these vectors are, further, very stable genetically, particularly those comprising a transgene under the control of a hCMV promoter devoid of intron A. Viruses in accordance with this description were passaged continually and analyzed; see Example 12. Each virus analyzed maintained it correct genetic structure. Analysis was also carried out under propagation conditions similar to that performed in large scale production. Again, the vectors were found to possess enhanced genetic stability; see Figure 12.
  • a preferred adenoviral vector in accordance with this description is a vector comprising basepairs 1-450, which is deleted in E3. This vector can accommodate up to approximately 7,500 base pairs of foreign D ⁇ A inserts (or exogenous genetic material). Another preferred vector is one retaining E3 which comprises basepairs 1- 450. A preferred vector of this description is an E3+ vector comprising basepairs 1- 450 and 3511-3523.
  • This vector when deleted of the region spanning basepairs 451- 3510, can accommodate up to approximately, 4,850 base pairs of foreign D ⁇ A inserts (or exogenous genetic material).
  • the cloning capacities of the above vectors have been determined using 105% of the wildtype Ad5 sequence as the upper genome size limit.
  • Wildtype adenovirus serotype 5 is used as the basis for the specific basepair numbers provided throughout the specification.
  • the wildtype adenovirus serotype 5 sequence is known and described in the art; see, Chroboczek et al., 1992 J. Virology 186:280, which is hereby incorporated by reference.
  • a particular embodiment of the instant invention is a vector based on the adenovirus serotype 5 sequence.
  • One of skill in the art can readily identify the above regions in other adenovirus serotypes (e.g., serotypes 2, 4, 6, 12, 16, 17, 24, 31, 33, and 42), regions defined by basepairs corresponding to the above basepair positions given for adenovirus serotype 5.
  • the instant invention encompasses all adenoviral vectors partially deleted in El comprising basepairs corresponding to 1-450 (particularly, 342-450) and, preferably, 3511-3523 of a wild-type adenovirus serotype 5 (Ad5) nucleic acid sequence.
  • Particularly preferred embodiments of the instant invention are those derived from adenoviruses like Ad5 which are classified in subgroup C (e.g., Ad2).
  • Vectors in accordance with the instant invention are at least partially deleted in El.
  • the El region is completely deleted or inactivated.
  • the region deleted of El is within basepairs 451-3510.
  • the extended 5' and 3' regions of the disclosed vectors are believed to effectively reduce the size of the El deletion of previous constructs without overlapping any part of the E1A E1B gene present in the cell line used, i.e., the PER.C6 ® cell line transefected with base pairs 459-3510. Overlap of adenoviral sequences is avoided because of the possibility of recombination.
  • the instant invention can, therefore, be modified if a different cell line transfected with a different segment of adenovirus DNA is utilized.
  • a 5' region of base pairs 1 to up to 449 is more appropriate if a cell line is transfected with adenoviral sequence from base pairs 450-3510. This holds true as well in the consideration of segments 3' to the El deletion.
  • Preferred embodiments of the instant invention possess an intact E3 region (i.e., an E3 gene capable of encoding a functional E3).
  • Alternate embodiments have a partially deleted E3, an inactivated E3 region, or a sequence completely deleted of E3.
  • virus comprising the E3 gene were able to amplify more rapidly compared with virus not comprising an E3 gene; see Figure 6 wherein a diagnostic CsCl band corresponding to the E3+ virus tested (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus.
  • vectors in accordance with the instant invention can accommodate up to approximately 4,850 base pairs of exogenous genetic material for an E3+ vector and approximately 7,500 base pairs for an E3- vector.
  • the insert brings the adenoviral vector as close as possible to a wild-type genomic size (e.g., for Ad5, 35,935 basepairs). It is well known that adenovirus amplifies best when they are close to their wild-type genomic size.
  • the genetic material can be inserted in an El-parallel or an El anti-parallel orientation, as such is illustrated in Figure 7 A, 7B, 7C and Figure 8 A. Particularly preferred embodiments of the instant invention, have the insert in an El-parallel orientation.
  • Applicants have found, via competition experiments with plasmids containing transgenes in differing orientation ( Figure 8A), that vector constructs with the foreign DNA insert in an El-parallel orientation amplify better and actually out- compete El-antiparallel-oriented transgenes.
  • Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the El parallel orientation as compared with the El anti-parallel version.
  • Adenoviral vectors in accordance with the instant invention are particularly well suited to effectuate expression of desired proteins, one example of which is an HIV protein, particularly an HIV full length gag protein.
  • Exogenous genetic material encoding a protein of interest can exist in the form of an expression cassette.
  • a gene expression cassette preferably comprises (a) a nucleic acid encoding a protein of interest; (b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription terminator.
  • the transcriptional promoter is preferably recognized by an eukaryotic RNA polymerase.
  • the promoter is a "strong" or "efficient" promoter.
  • An example of a strong promoter is the immediate early human cytomegalovirus promoter (Chapman et al, 1991 Nucl. Acids Re.?19:3979-3986, which is incorporated by reference), preferably without intronic sequences.
  • Most preferred for use within the instant adenoviral vector is a human CMV promoter without intronic seqeunces, like intron A. Applicants have found that intron A, a portion of the human cytomegalovirus promoter (hCMV), constitutes a region of instability for adenoviral vectors.
  • CMV without intron A has been found to effectuate (Examples 1- 3) comparable expression capabilities in vitro when driving HIN gag expression and, furthermore, behaved equivalently to intron A-containing constructs in Balb/c mice in vivo with respect to their antibody and T-cell responses at both dosages of plasmid D ⁇ A tested (20 ⁇ g and 200 ⁇ g).
  • promoters such as the strong immunoglobulin, or other eukaryotic gene promoters may also be used, including the EF1 alpha promoter, the murine CMV promoter, Rous sarcoma virus (RSV) promoter, SV40 early/late promoters and the beta-actin promoter.
  • the promoter may also comprise a regulatable sequence such as the Tet operator sequence. This would be extremely useful, for example, in cases where the gene products are effecting a result other than that desired and repression is sought.
  • Preferred transcription termination sequences present within the gene expression cassette are the bovine growth hormone terminator/polyadenylation signal (bGHpA) and the short synthetic polyA signal (SPA) of 50 nucleotides in length, defined as follows: AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGT- TTTTTGTGTG (SEQ TD ⁇ O:26).
  • bGHpA bovine growth hormone terminator/polyadenylation signal
  • SPA short synthetic polyA signal
  • CMV promoter devoid of the intron A region
  • BGH terminator BGH terminator
  • a preferred leader is that from the tissue-specific plasminogen activator protein, tPA.
  • tissue-specific plasminogen activator protein tPA.
  • examples include but are not limited to the various tPA-gag, tPA-pol and tPA-nef adeno virus-based vaccines disclosed throughout this specification.
  • an essential portion of the present invention are adenoviral-based HIV vaccines comprising said adenovirus backbones which may be administered to a mammalian host, preferably a human host, in either a prophylactic or therapeutic setting.
  • the HTV vaccines of the present invention whether administered alone or in combination regimens with other viral- or non-viral-based DNA vaccines, should elicit potent and broad cellular immune responses against HIN that will either lessen the likelihood of persistent virus infection and/or lead to the establishment of a clinically significant lowered virus load subject to HIN infection or in combination with HAART therapy, mitigate the effects of previously established HTV infection (antiviral immunotherapy(ARI)).
  • HTV antigen e.g., gag, pol, nef, g ⁇ l60, gp41, gpl20, tat, rev, etc.
  • preferred embodiments include the codon optimized p55 gag antigen (herein exemplified as MRKAd5gag), pol and nef.
  • MRKAd5gag codon optimized p55 gag antigen
  • pol and nef nef.
  • Sequences based on different Clades of HIV-1 are suitable for use in the instant invention, most preferred of which are Clade B and Clade C. Particularly preferred embodiments are those sequences (especially, codon-optimized sequences) based on concensus Clade B sequences.
  • Preferred versions of the MRKAd5pol and MRKAd5nef series of adenoviral vaccines will encode modified versions of pol or nef, as discussed herein.
  • Preferred embodiments of the MRKAd5HTV-l vectors carrying HIV envelope genes and modifications thereof comprise the HIV codon- optimized env sequences of PCT International Applications PCT/US 97/02294 and PCT/US97/10517, published August 28, 1997 (WO 97/31115) and December 24, 1997, respectively; both documents of which are hereby incorporated by reference.
  • a most preferred aspect of the instant invention is the disclosed use of the adenoviral vector described above to effectuate expression of HIV gag. Sequences for many genes of many HIV strains are publicly available in GE ⁇ B A ⁇ K and primary, field isolates of HIV are available from the National Institute of Allergy and Infectious Diseases (NIATD) which has contracted with Quality Biological
  • gag gene is from an HIV-1 strain (CAM-1; Myers et al, eds. "Human Retroviruses and AIDS: 1995, UA3-IIA19, which is hereby incorporated by reference). This gene closely resembles the consensus amino acid sequence for the clade B (North
  • the transgene of choice for insertion in to a DNA or MRKAd-based adenoviral vector of the present invention is a codon optimized version of p55 gag.
  • MRKAd5gag adenoviral vector is documented in Example 11 and is at least referred to herein as MRKAd5HTV-lgag.
  • MRKAd5pol-based adenoviral vaccines which are shown herein to generate cellular immune responses subsequent to administration in mice and non-human primate studies.
  • MRKAd5hCMV-inact opt pol(E3+) which comprises the MRKAd5 backbone, the hCMN promoter (no intron A), an inactivated pol transgene, and contains the Ad5 E3 gene in the adenoviral backbone.
  • MRKAd5hCMV-inact opt pol(E3-) A second exemplified pre-adenovirus plasmid and concomitant virus is referred to as MRKAd5hCMN-inact opt pol(E3-), which is identical to the former adenoviral vector except that the E3 is deleted.
  • Both constructions contain a codon optimized, inactivated version of HIV-1 Pol, wherein at least the entire coding region is disclosed herein as SEQ ID ⁇ O:3 and the expressed protein is shown as SEQ ID NO:4 (see also Figure 17A-C and Table 1, which show targeted deletion for inactivated pol.
  • SEQ ID NO:4 see also Figure 17A-C and Table 1, which show targeted deletion for inactivated pol.
  • This and other preferred codon optimized versions of HTV Pol as disclosed herein are essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference.
  • codon optimized DNA molecules encoding codon optimized HTV-1 Pol (e.g. SEQ ID NO:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence (e.g. SEQ ID NO:6), and especially preferable, and exemplified by the MRKAd5-Pol construct in e.g., Example 19, biologically inactivated pol ("inact opt Pol"; e.g., SEQ ID NO:4) which is devoid of significant PR, RT, RNase or IN activity associated with wild type Pol.
  • a construct related to SEQ ID NO:4 which contains a leader peptide at the amino terminal region of the IA Pol protein.
  • a specific construct is ligated within an appropriate DNA plasmid vector containing regulatory regions operatively linked to the respective HIV-1 Pol coding region, with or without a nucleotide sequence encoding a functional leader peptide.
  • HIV-1 Pol constructs disclosed herein relate to open reading frames for cloning to the enhanced first generation Ad vectors of the present invention (such a series of MRKAd5pol adenoviral vaccine vectors), including but not limited to wild type Pol (comprising the DNA molecule encoding WT opt Pol, as set forth in SEQ ID NO:2), tPA-opt WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), inact opt Pol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ ID
  • tPA-inact opt Pol (comprising the DNA molecule encoding tPA-inact opt Pol, as set forth in SEQ ID NO:8).
  • the pol-based versions of enhanced first generation adenovirus vaccines elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans.
  • an effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.
  • the present invention further relates to a series of MRKAd5nef-based adenoviral vaccines which, similar to HIV gag and pol antigens, generate cellular immune responses subsequent to administration in mice and non-human primate studies.
  • the MRKAd5nef series are exemplified herein by utilizing the improved MRK adenoviral backbone in combination with modified versions of HTV nef.
  • MRKAd5nef vectors are as follows: (1) MRKAd5hCMV- nef(G2A,LLAA) (E3+), which comprises the improved MRKAd5 backbone, a human CMV promoter an intact Ad5 E3 gene and a modified nef gene: (2) MRKAd5mCMV- nef(G2A,LLAA) (E3+), which is the same as (1) above but substituting a murine CMV promoter for a human CMV promoter; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+), which is the same as (2) except that the nef transgene is tpanef(LLAA).
  • Codon optimized versions of HTV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.
  • Particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HTV- 1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO: 10.
  • Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HTV-1 Nef polypeptide.
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 11, while the expressed open reading frame is disclosed herein as SEQ ID NO: 12.
  • Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HTV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA).
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 13, while the expressed open reading frame is disclosed herein as SEQ ID NO: 14.
  • MRKAd5nef vectors (1) MRKAd5hCMV- nef(G2A,LLAA) (E3+) and (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) contain this transgene.
  • An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.
  • This DNA molecule comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO: 16.
  • the MRKAd5nef vector "MRKAd5mCMV-tpanef(LLAA) (E3+)" contains this transgene.
  • MRKAd5gag adenovirus vaccine vector generation of a MRKAd5pol and MRKAd5nef adenovirus vector provide for enhanced HTV vaccine capabilities. Namely, the generation of this trio of adenoviral vaccine vectors, all shown to generate effective cellular immune responses subsequent to host administration, provide for the ability to administer these vaccine candidates not only alone, but preferably as part of a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components).
  • a divalent i.e., gag and nef, gag and pol, or pol and nef components
  • a trivalent vaccine i.e., gag, pol and nef components
  • a preferred aspect of the present invention are vaccine formulations and associated methods of administration and concomitant generation of host cellular immune responses associated with formulating three separate series of MRKAd5- based adenoviral vector vaccines.
  • this MRKAd5 vaccine series based on distinct HIN antigens promotes expanded opportunities for formulation of a divalent or trivalent vaccine, or possibly administration of separate formulations of one or more monovalent or divalent formulations within a reasonable window of time. It is also within the scope of the present invention to embark on combined modality regimes which include multiple but distinct components from a specific antigen.
  • MRKAd5pol vectors with one vaccine vector expressing wild type Pol (SEQ ID ⁇ O:2) and another MRKAd5pol vector expressing inactivated Pol (SEQ ID NO:6).
  • Another example might be separate MRKAd5nef vectors, with one vaccine vector expressing the tPA/LLAA version of Nef (SEQ ID NO: 16) and another MRKAd5nef vector expressing the G2A,LLAA modified version of Nef (SEQ ID NO: 14). Therefore, the MRKAd5 adenoviral vectors of the present invention may be used in combination with multiple, distinct HTV antigen classes.
  • Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention.
  • the utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
  • the present invention also relates to application of a mono-, dual-, or tri- modality administration regime of the MRKAd5gag, pol and nef adenoviral vaccine series in a prime/boost vaccination schedule.
  • This prime/boost schedule may include any reasonable combination of the MRKAd5gag, pol and nef adenoviral vaccine series disclosed herein.
  • a prime/boost regime may also involve other viral and/or non- viral DNA vaccines.
  • a preferable addition to an adenoviral vaccine vector regime includes but is not limited to plasmid DNA vaccines, especially DNA plasmid vaccines that contain at least one of the codon optimized gag, pol and nef constructions, as disclosed herein.
  • one aspect of this invention is the administration of the adenoviral vector containing the optimized gag gene in a prime/boost regiment in conjunction with a plasmid DNA encoding gag.
  • this plasmid will be referred to as a "vaccine plasmid" or "DNA plasmid vaccine”.
  • VlJns-FLgag which expresses the same codon-optimized gag gene as the adenoviral vectors of this invention (see Figure 2 for the nucleotide sequence of the exemplified optimized codon version of full length p55 gag).
  • the vaccine plasmid backbone designated VI Jns contains the CMV immediate-early (IE) promoter and intron A, a bovine growth hormone-derived polyadenylation and transcription termination sequence as the gene expression regulatory elements, and a minimal pUC backbone; see Montgomery et al, 1993, DNA Cell Biol. 12:777-783.
  • the pUC sequence permits high levels of plasmid production in E. coli and has a neomycin resistance gene in place of an ampicillin resistance gene to provide selected growth in the presence of kanamycin.
  • a vaccine plasmid which has the CMV promoter deleted of intron A can be used.
  • alternative vaccine plasmid vectors may be easily substituted for these specific constructs, and this invention specifically envisions use of such alternative plasmid DNA vaccine vectors.
  • Another aspect of the present invention is a prime/boost regimen which includes a vaccine plasmid which encodes an HIV pol antigen, preferably a codon optimized form of pol and also preferably a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ ID NOs: 2, 4, 6 and 8.
  • a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ ID NOs: 2, 4, 6 and 8.
  • the variety of potential DNA plasmid vaccines which encode various biologically active forms of HTV-1 Pol, wherein administration, intracellular delivery and expression of the HIN-1 Pol gene of interest elicits a host CTL and Th response.
  • the preferred synthetic D ⁇ A molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIN-1 Pol proteins.
  • the HIN-1 pol open reading disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as delivered via a recombinant adenoviral vaccine, especially an enhanced first generation recombinant adenoviral vaccine as described herein.
  • D ⁇ A molecules which comprise a HIN-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human.
  • these D ⁇ A sequences are positioned appropriately within a recombinant adenoviral vector, such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIN-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response.
  • a recombinant adenoviral vector such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIN-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response.
  • pol genes are as disclosed herein and essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference.
  • a third series of vaccine plasmids which are useful in a combined modality and/or prime/boost regimen are vaccine plasmids which encode an HIN nef antigen or biologically and/or immunologically relevant modification thereof.
  • preferred vaccine plasmids contain a codon optimized form of nef and also preferably comprise a nucleotide sequence which encodes a ⁇ ef antigen selected from the group of ⁇ ef antigens as shown in SEQ ID ⁇ Os: 10, 12, 14 and 16.
  • SEQ ID ⁇ Os SEQ ID ⁇ Os: 10, 12, 14 and 16.
  • the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen.
  • a mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly is pre-existing anti-vector immune responses are present.
  • This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine.
  • Multiple primings typically, 1-4, are usually employed, although more may be used.
  • the length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used.
  • rhesus monkeys In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine.
  • the use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.
  • multiple HIN-1 viral antigens such as the MRKAd5 adenoviral vaccines disclosed herein, may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames.
  • a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possible a "2+1" divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence.
  • the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES), as disclosed in International Publication No.
  • IRS internal ribosome entry sequence
  • WO 95/24485 which is hereby incorporated by reference.
  • Figure 9 shows that the use of multiple promoters and termination sequences provide for similar growth properties, while Figure 28 shows that these MRKAd5 gag-based vectors are also stable at least through passage 21.
  • a distinct promoter be used to support each respective open reading frame, so as to best preserve vector stability.
  • potential multiple transgene vaccines may include a three transgene vector such as hCMN-gagpol-bGHpA + mCMV-nef-SPA in an E3 deleted backbone or hCMV-gagpol-bGHpA + mCMV-nef-SPA(E3+).
  • Potential "2+1" divalent vaccines of the present invention might be a hCMV-gag- bGHpA + mCMV-nef-SPA in an E3+ backbone (vector #1) in combination with hCMN-pol-bGHpA in an E3+ backbone (vector #2), with all transgenes in the El parallel orientation.
  • Fusion constructs other than the gag-pol fusion described above are also suitable for use in various divalent vaccine strategies and can be composed of any two HIN antigens fused to one another (e.g.,, nef-pol and gag-nef).
  • adenoviral compositions are, as above, preferably delivered along with an adenoviral composition comprising an additional HIV antigen in order to diversify the immune response generated upon administration. Therefore, a multivalent vaccine delivered in a single, or possible second, adenoviral vector is certainly contemplated as part of the present invention. Again, this mode of administration is another example of whereby an advantageous adeno virus-based HIV-1 vaccine may be administered via a combined modality regime. It is important to note, however, that in terms of deciding on an insert for the disclosed adenoviral vectors, due consideration must be dedicated to the effective packaging limitations of the adenovirus vehicle. Adenovirus has been shown to exhibit an upper cloning capacity limit of approximately 105% of the wildtype Ad5 sequence.
  • a “triplet" codon of four possible nucleotide bases can exist in 64 variant forms. That these forms provide the message for only 20 different amino acids (as well as transcription initiation and termination) means that some amino acids can be coded for by more than one codon. Indeed, some amino acids have as many as six “redundant”, alternative codons while some others have a single, required codon. For reasons not completely understood, alternative codons are not at all uniformly present in the endogenous D ⁇ A of differing types of cells and there appears to exist variable natural hierarchy or "preference" for certain codons in certain types of cells.
  • the amino acid leucine is specified by any of six D ⁇ A codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mR ⁇ A codons, CUA, CUC, CUG, CUU, UUA and UUG).
  • D ⁇ A codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mR ⁇ A codons, CUA, CUC, CUG, CUU, UUA and UUG).
  • Exhaustive analysis of genome codon frequencies for microorganisms has revealed endogenous D ⁇ A of E. coli most commonly contains the CTG leucine-specifying codon, while the D ⁇ A of yeasts and slime molds most commonly includes a TTA leucine-specifying codon. In view of this hierarchy, it is generally held that the likelihood of obtaining high levels of expression of a leucine- rich polypeptide by an E.
  • coli host will depend to some extent on the frequency of codon use. For example, a gene rich in TTA codons will in all probability be poorly expressed in E. coli, whereas a CTG rich gene will probably highly express the polypeptide. Similarly, when yeast cells are the projected transformation host cells for expression of a leucine-rich polypeptide, a preferred codon for use in an inserted DNA would be TTA.
  • one aspect of this invention is an adenovirus vector or adenovirus vector in some combination with a vaccine plasmid where both specifically include a gene which is codon optimized for expression in a human cellular environment.
  • a preferred gene for use in the instant invention is a codon-optimized HTV gene and, particularly, HTV gag, pol or nef.
  • Adenoviral vectors in accordance with the instant invention can be constructed using known techniques, such as those reviewed in Hitt et al, 1997 "Human Adenovirus Vectors for Gene Transfer into Mammalian Cells” Advances in Pharmacology 40: 137-206, which is hereby incorporated by reference.
  • adenoviral vectors of this invention it is often convenient to insert them into a plasmid or shuttle vector. These techniques are known and described in Hitt et al., supra. This invention specifically includes both the adenovirus and the adenovirus when inserted into a shuttle plasmid.
  • Preferred shuttle vectors contain an adenoviral portion and a plasmid portion.
  • the adenoviral portion is essentially the same as the adenovirus vector discussed supra, containing adenoviral sequences (with non-functional or deleted ⁇ l and ⁇ 3 regions) and the gene expression cassette, flanked by convenient restriction sites.
  • the plasmid portion of the shuttle vector often contains an antibiotic resistance marker under transcriptional control of a prokaryotic promoter so that expression of the antibiotic does not occur in eukaryotic cells. Ampicillin resistance genes, neomycin resistance genes and other pharmaceutically acceptable antibiotic resistance markers may be used.
  • the shuttle vector To aid in the high level production of the polynucleotide by fermentation in prokaryotic organisms, it is advantageous for the shuttle vector to contain a prokaryotic origin of replication and be of high copy number.
  • a number of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences. It is also desirable that the vectors not be able to replicate in eukaryotic cells. This minimizes the risk of integration of polynucleotide vaccine sequences into the recipients' genome. Tissue-specific promoters or enhancers may be used whenever it is desirable to limit expression of the polynucleotide to a particular tissue type.
  • the pre-plasmids e.g., pMRKAd5pol, pMRKAd5nef and pMRKAd5gag were generated by homologous recombination using the MRKHVE3 (and MRKHVO for the E3- version) backbones and the appropriate shuttle vector, as shown for pMRKAd5pol in Figure 22 and for pMRKAd5nef in Figure 23.
  • the plasmid in linear form is capable of replication after entering the PER.C6 ® cells and virus is produced. The infected cells and media were harvested after viral replication was complete.
  • Viral vectors can be propagated in various El complementing cell lines, including the known cell lines 293 and PER.C6 ® . Both these cell lines express the adenoviral El gene product.
  • PER.C6 ® is described in WO 97/00326 (published January 3, 1997) and issued U.S. Patent No. 6,033,908, both of which are hereby incorporated by reference. It is a primary human retinoblast cell line transduced with an El gene segment that complements the production of replication deficient (FG) adenovirus, but is designed to prevent generation of replication competent adenovirus by homologous recombination.
  • FG replication deficient
  • first generation adenoviral vectors in accordance with the above description carrying a codon-optimized HTV gag gene, regulated with a strong heterologous promoter can be used as human anti-HTV vaccines, and are capable of inducing immune responses.
  • Standard techniques of molecular biology for preparing and purifying DNA constructs enable the preparation of the DNA immunogens of this invention.
  • a vaccine composition comprising an adenoviral vector in accordance with the instant invention may contain physiologically acceptable components, such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate.
  • physiologically acceptable components such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate.
  • One preferred formulation has: 2.5-10 mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaCl, preferably about 75 mM NaCl; 2.5-10% sucrose, preferably about 5% sucrose; 0.01 -2 mM MgCl 2 ; and 0.001%-0.01% polysorbate 80 (plant derived).
  • the pH should range from about 7.0-9.0, preferably about 8.0.
  • other conventional vaccine excipients may also be used it make the formulation.
  • the preferred formulation contains 5mM TRIS, 75 mM NaCl, 5% sucrose, lmM MgCl 2 , 0.005% polysorbate 80 at pH 8.0 This has a pH and divalent cation composition which is near the optimum for Ad5 stability and minimizes the potential for adsorption of virus to a glass surface. It does not cause tissue irritation upon intramuscular injection. It is preferably frozen until use.
  • adenoviral particles in the vaccine composition to be introduced into a vaccine recipient will depend on the strength of the transcriptional and translational promoters used and on the immunogenicity of the expressed gene product.
  • an immunologically or prophylactically effective dose of lxlO 7 to lxlO 12 particles and preferably about lxlO 10 to lxlO 11 particles is administered directly into muscle tissue.
  • Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided.
  • HTV adenoviral vector Following vaccination with HTV adenoviral vector, boosting with a subsequent HTV adenoviral vector and/or plasmid may be desirable.
  • Parenteral administration such as intravenous, intramuscular, subcutaneous or other means of administration of interleukin-12 protein, concurrently with or subsequent to parenteral introduction of the vaccine compositions of this invention is also advantageous.
  • the adenoviral vector and/or vaccine plasmids of this invention polynucleotide may be unassociated with any proteins, adjuvants or other agents which impact on the recipients' immune system.
  • it is desirable for the vector to be in a physiologically acceptable solution such as, but not limited to, sterile saline or sterile buffered saline.
  • the vector may be associated with an adjuvant known in the art to boost immune responses (i.e., a "biologically effective" adjuvant), such as a protein or other carrier.
  • Vaccine plasmids of this invention may, for instance, be delivered in saline (e.g., PBS) with or without an adjuvant.
  • Preferred adjuvants are Alum or CRL1005 Block Copolymer.
  • Agents which assist in the cellular uptake of DNA such as, but not limited to, calcium ions, may also be used to advantage. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable carriers. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention.
  • This invention also includes a prime and boost regimen wherein a first adenoviral vector is administered, then a booster dose is given.
  • the booster dose may be repeated at selected time intervals.
  • a preferred inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype. More preferably, the inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype, wherein the first and second adenovirus serotypes are classified within separate subgroups of adenoviruses.
  • prime/boost schemes are particularly preferred in those situations where a preexisting immunity is identified to the adenoviral vector of choice.
  • the individual or population of individuals is primed with an adenovirus of a serotype other than that to which the preexisting immunity is identified.
  • This enables the first adenovirus to effectuate sufficient expression of the transgene while evading existing immunity to the second adenovirus (the boosting adenovirus) and, further, allows for the subsequent delivery of the transgene via the boosting adenovirus to be more effective.
  • Adenovirus serotype 5 is one example of a virus to which such a scheme might be desirable.
  • a non-group C adenovirus e.g., Adl2, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus
  • a non-group C adenovirus e.g., Adl2, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus
  • Another preferred embodiment involves administration of a different adenovirus (including non-human adenovirus) vaccine followed by administration of the adenoviral vaccines disclosed.
  • a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed.
  • Alternative viral vaccines include but are not limited to pox virus and Venezuelan equine encephilitis virus.
  • CTL cancer-derived cellular immune responses
  • SIV model of HTV infection CTL similarly develops following primary infection, and it has been demonstrated that addition of anti-CD8 monoclonal antibody abrogated this control of infection and leads to disease progression.
  • This invention uses adenoviral vaccines alone or in combination with plasmid vaccines to induce CTL.
  • PNHnsHTVgag is a plasmid comprising the CMN immediate-early (IE) promoter and intron A, a full-length codon-optimized HIN gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone; see Montgomery et al, supra for a description of the plasmid backbone.
  • the amplification was performed with primers suitably positioned to flank the hCMN promoter.
  • a 5' primer was placed upstream of the Mscl site of the hCMN promoter and a 3' primer (designed to contain the BgHL recognition sequence) was placed 3' of the hCMN promoter.
  • the resulting PCR product (using high fidelity Taq polymerase) which encompassed the entire hCMN promoter (minus intron A) was cloned into TOPO PCR blunt vector and then removed by double digestion with Mscl and BgZII. This fragment was then cloned back into the original GMP grade pVl JnsHTVgag plasmid from which the original promoter, intron A, and the gag gene were removed following Mscl and BgHL digestion.
  • This ligation reaction resulted in the construction of a hCMV promoter (minus intron A) + bGHpA expression cassette within the original pVlJnsHTVgag vector backbone.
  • This vector is designated pNIJnsCMN(no intron).
  • the FLgag gene was excised from pNlJnsHTVgag using BgHL digestion and the 1,526 bp gene was gel purified and cloned into pNUnsCMN(no intron) at the BglTL site. Colonies were screened using Sm l restriction enzymes to identify clones that carried the Flgag gene in the correct orientation.
  • This plasmid designated pNl JnsCMN(no intron)-FLgag-bGHpA, was fully sequenced to confirm sequence integrity. Two additional transgenes were also constructed.
  • the sequence of the SPA is as shown, with the essential components (poly(A) site, (GT) n , and (T) n ; respectively) underlined:
  • the plasmid, pNlJns-mCMV-FLgag-bGHpA is identical to the pNUnsCMN(no intron)-FLgag-bGHpA except that the hCMN promoter has been removed and replaced with the murine CMV (mCMV) promoter.
  • Figure 3 diagrammatically shows the new transgene constructs in comparison with the original transgene.
  • Gag Expression Assay for Modified Gag Transgenes Gag Elisa was performed on culture supernatants obtained from transient tissue culture transfection experiments in which the two new hCMV-containing plasmid constructs, pVl JnsCMV(no intron)-FLgag-bGHpA and pVl JnsCMV(no intron)-FLgag-SPA, both devoid of intron A, were compared to pVl JnsHTVgag which, as noted above possesses the intron A as part of the hCMV promoter.
  • Table 2 below shows the in vitro gag expression data of the new gag plasmids compared with the GMP grade original plasmid. The results displayed in Table 2 show that both of the new hCMV gag plasmid constructs have expression capacities comparable to the original plasmid construct which contains the intron A portion of the hCMV promoter.
  • Rodent (Balb/c) Study for Modified gag Transgenes A rodent study was performed on the two new plasmid constructs described above - pVl JnsCMV(no intron)-FLgag-bGHpA and pVUnsCMV(no intron)-FLgag-SPA - in order to compare them with the construct described above possessing the intron A portion of the CMV promoter, pVl JnsHTVgag. Gag antibody and Elispot responses (described in PCT International Application No.
  • HIV191 Immunogenicity of V1 Jns-gag under different promoter and termination control elements.
  • the left ITR region was extended to include the Pad site at the junction between the vector backbone and the adenovirus left ITR sequences. This allow for easier manipulations using the bacterial homologous recombination system.
  • the packaging region was extended to include sequences of the wild-type (WT) adenovirus from 342 bp to 450 bp inclusive.
  • E3+adeno vector into E. coli BJ5183 competent cells. At least two colonies from each transformation were selected and grown in TerrificTM broth for 6-8 hours until turbidity was reached. D ⁇ A was extracted from each cell pellet and then transformed into E. coli XL1 competent cells. One colony from each transformation was selected and grown for plasmid D ⁇ A purification. The plasmid was analyzed by restriction digestions to identify correct clones. The modified adenovectors were designated MRKpAdHVO (E3- plasmid) and MRKpAdHVE3 (E3+ plasmid).
  • Virus from these new adenovectors (MRKHNO and MRKHVE3, respectively) as well as the old version of the adenovectors were generated in the PER.C6 ® cell lines to accommodate the following series of viral competition experiments.
  • the multiple cloning site of the original shuttle vector contained Clal , BamHI, Xho I, EcoRV, Hindlll, Sal I, and Bgl II sites.
  • This MCS was replaced with a new MCS containing Not I, Cla I, EcoRV and Asc I sites.
  • This new MCS has been transferred to the MRKpAdHVO and MRKpAdHVE3 pre-plasmids along with the modification made to the packaging region and pIX gene.
  • the viral DNA was extracted and digested with HindLLL and the digestion products were then radioactively labeled.
  • the respective pre-plasmids pAdHVE3 ("OLD E3+”); MRKpAdHNE3 (“NEW E3+”)) were also digested with HindL ⁇ L (and Pad to remove
  • the second set of the virus competition study involved mixing equal MOI ratio (1:1) of the newly modified viruses, that obtained from MRKpAdHVO and MRKpAdHVE3 ( Figure 5, Expt. #2). In this set, both viruses had the new modifications made to the El deletion.
  • the first virus that from MRKpAdHVO
  • the second virus that from MRKpAdHVE3 does contain the E3 gene.
  • Neither of the viruses contain a transgene. Following co- infection of the viruses, the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the total virus extracted and purified by CsCl banding.
  • the viral DNA was extracted and digested with HindLLL and the digestion products were then radioactively labeled.
  • the respective pre-plasmids MRKpAdHVO ("NEW E3-”); MRKpAdHVE3 (“NEW E3+”) were also digested with HindLLL (and R ⁇ cl to remove the vector backbone) and then labeled with [33p]dATP.
  • the radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film.
  • Figure 6 shows the results of the viral DNA analysis of the E3+ virus and E3- virus mixing experiment.
  • the diagnostic band corresponding to the E3+ virus (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus. This indicates that the virus that contains the E3 gene is able to amplify more rapidly compared with the virus that does not contain an E3 gene. This increased amplification capacity has been confirmed by growth studies; see Table 4 below.
  • the modified shuttle vector (MRKpdelEl shuttle) was linearized by digestion with EcoRV, treated with calf intestinal phosphatase and the resulting 6,479 bp fragment was then gel purified. The two purified fragments were then ligated together and several dozen clones were screened to check for insertion of the transgene within the shuttle vector. Diagnostic restriction digestion was performed to identify those clones carrying the transgene in the El parallel and El anti-parallel orientation. This strategy was followed to clone in the other gag transgenes in the MRKpdelEl shuttle vector.
  • EXAMPLE 9 Construction of the MRK FG Adenovectors
  • the shuttle vector containing the HIV-1 gag transgene in the El parallel orientation, MRKpdelEl -CMV(no intron)-FLgag-bGHpA was digested with Pa .
  • the reaction mixture was digested with BsfZlll.
  • the 5,291 bp fragment was purified by gel extraction.
  • the MRKpAdHNE3 plasmid was digested with Clal overnight at 37°C and gel purified. About 100 ng of the 5,290 bp shuttle +transgene fragment and -100 ng of linearized MRKpAdHNE3 D ⁇ A were co-transformed into E. coli BJ5183 chemically competent cells.
  • a positive clone was identified by digestion with the restriction enzyme R-stEII which cleaves within the gag gene as well as the plasmid backbone.
  • the pre-plasmid clone is designated MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA and is 37,498 bp in size.
  • This strategy was followed to generate E3- and E3+ versions of each of the other gag transgene constructions in both El parallel and El anti-parallel versions.
  • Figures 7A, 7B and 7C show the various combinations of adenovectors constructed.
  • EXAMPLE 10 Plasmid Competition Studies A series of plasmid competition studies was carried out. Briefly, the screening of the various combinations of new constructs was performed by mixing equal amounts of each of two competing plasmids. In the experiment shown in Figure 8A, plasmids containing the same transgene but in different orientations were mixed together to create a "competition" between the two plasmids. The aim was to look at the effects of transgene orientation. In the experiment shown in Figure 8B, plasmids containing different polyadenylation signals (but in the same orientation) were mixed together in equal amounts. The aim was to assess effects of polyA signals. Following the initial transfection, the virus was passaged through ten rounds and the viral DNA analyzed by radioactive restriction analysis.
  • MRK Ad5 HIV-1 gag exhibited the most desirable results.
  • This construct contains the hCMV(no intron)-FLgag-bGHpA transgene inserted into the new E3+ adenovector backbone, MRKpAdHVE3, in the El parallel orientation.
  • MRKpAdHVE3 new E3+ adenovector backbone
  • the pre-plasmid MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA was digested was Pad to release the vector backbone and 3.3 ⁇ g was transfected by calcium phosphate method (Amersham Pharmacia Biotech.) in a 6 cm dish containing PER.C6 ® cells at -60% confluence. Once CPE was reached (7-10 days), the culture was freeze/thawed three times and the cell debris pelleted. 1 ml of this cell lysate was used to infect into a 6 cm dish containing PER.C6 ® cells at 80-90% confluence. Once CPE was reached, the culture was freeze/thawed three times and the cell debris pelleted.
  • the cell lysate was then used to infect a 15 cm dish containing PER.C6 ® cells at 80-90% confluence. This infection procedure was continued and expanded at passage 6.
  • the virus was then extracted from the cell pellet by CsCl method. Two bandings were performed (3-gradient CsCl followed by a continuous CsCl gradient). Following the second banding, the virus was dialyzed in A105 buffer. Viral DNA was extracted using pronase treatment followed by phenol chloroform. The viral DNA was then digested with HindLLL and radioactively labeled with [33p]dATP. Following gel electrophoresis to separate the digestion products the gel was dried down on Whatman paper and then subjected to autoradiography.
  • the digestion products were compared with the digestion products from the pre-plasmid (that had been digested with Pacl/HindlLL prior to labeling). The expected sizes were observed, indicating that the virus had been successfully rescued. This strategy was used to rescue virus from each of the various adenovector plasmid constructs prepared.
  • EXAMPLE 12 Stability Analyses To determine whether the various adenovector constructs (e.g., MRK Ad5 HIN-1 gag) show genetic stability, the viruses were each passaged continually. The viral D ⁇ A was analyzed at passages 3, 6 and 10. Each virus maintained its correct genetic structure. In addition, the stability of the MRK Ad5 HIV-1 gag was analyzed under propagation conditions similar to that performed in large scale production.
  • the transfections of MRK Ad5 HIV-1 gag as well as three other adenoviral vectors were repeated and the virus was purified at P3.
  • the three other adenovectors were as follows: (1) that comprising hCMV(no intron)-Flgag with a bGHpA terminator in an E3- adenovector backbone; (2) that comprising hCMV(no intron)-Flgag with a SPA termination signal in an E3+ adenovector backbone, and that comprising a mCMN-Flgag with a bGHpA terminator in an E3+ adenovector backbone.
  • Viral D ⁇ A was analyzed by radioactive restriction analysis to confirm that it was correct before being delivered to fermentation cell culture for continued passaging in serum-free media.
  • each of the four viruses were purified and the viral D ⁇ A extracted for analysis by the restriction digestion and radiolabeling procedure. This virus has subsequently been used in a series of studies (in vitro gag expression in COS cells, rodent study and rhesus monkey study) as will be described below. The viruses from P5 are shown in Figure 9.
  • each of the viral D ⁇ A samples show the expected bands with no extraneous bands showing. This signifies that there are no major variant adenovirus species present that can be detected by autoradiography.
  • Figure 11 shows the results of viral competition study between MRKHNE3 and MRKAd5HIN-lgag. These viruses were mixed together at equal MOI (140 viral particles each; 280 vp total) at passage 6 and continued to be passaged until Pll. Aside from the first lane which is the DNA marker lane, the next two lanes are the pre-plasmid controls obtained from MRKpAdHVE3 and MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA. The next two lanes are the viral DNA from the starting viral material at passage six. The last two lanes are the competition studies performed in duplicate. The data in Figure 11 shows the effect the gag transgene in culture.
  • MRKAd5gag virus was compared with growth of a "transgene-less" MRKHVE3. These two viruses were infected at the same MOI (i.e. 140 vp each) at passage 6 and then passaged through to passage 11 and the viral pool was analyzed by radioactive restriction analysis. The data shows that one virus did not out compete the other. Therefore, the gag transgene did not show obvious signs of toxicity to the adenovirus.
  • Table 4 shows the QPA analysis used in the estimation of viral amplification ratios at P4.
  • the determination of the amplification ratio for the original HIV-1 gag construct is based on the clinical lot at P12. It has been shown that amplification rates increases with higher passage number for the original virus. The reason for this observation is due to the emergence of variants which exhibit increased growth rates compared to the intact adenovector. With continued passaging of the original Ad gag vector, the level of variants increases and hence amplification rates increase also.
  • the MRK Ad5 HIN-1 gag virus has also been continually passaged under process conditions (i.e., serum-free media). Viral D ⁇ A extracted from passages 11 and 12 show no evidence of rearrangement. Table 4:
  • MRK Ad5 HTV-1 gag was studied for several passages under serum-free conditions.
  • Table 5A shows the amplification ratios determined for passages P3 to P8 for MRK Ad5 HTV-1 gag.
  • the virus output is directly proportional to the virus input. Therefore, the greater the number of virus particles per cell at infection, the greater the virus amount produced.
  • Viral amplification ratios are inversely proportional to the virus input. The lower the virus input, the greater the amplification ratio.
  • Table 5B shows the amplification rates of the new E3+ vector backbone MRKpAdHNE3. It has a significantly lower rate of amplification compared with the gag transgene containing version. This may be contributed to the larger size MRK Ad5 HIN-1 gag since it contains the transgene. This inclusion of the transgene brings the size of the adenovirus closer to the size of a wild type Ad5 virus. It is well known that adenoviruses amplify best when they are at close to their wild type genomic size. Wild type Ad5 is 35,935 bp. The MRKpAdHNE3 is 32, 905 bp in length.
  • the enhanced adenovector MRK Ad5 HIV-1 gag is 35,453bp (See Figure 14 for vector map; see also Figure 15A-X show the complete pre-adenoviral vector sequence, which includes an additional 2,021 bp of the vector backbone).
  • Table 5C shows the amplification rates of the new E3- gag containing virus
  • MRK Ad5 HIV-1 gag E3- shows lower growth rate than the enhanced adenoviral vector. This may be attributed to the decreased sized of this virus (due to the E3 gene deletion) compared with wild type Ad5.
  • the MRK Ad5 HIV-1 gag E3- virus is 32,810 bp in length. This can be compared with the wild type Ad5 which is 35,935 bp and MRK Ad5 HIV-1 gag which is 35,453 bp in length.
  • Table 5A Amplification ratios determined by AEX and QPA for MRKAdSgag over several continuous passaging in serum free media. Following P5, two replicate samples were taken (rep- 1 and rep-2) and analyzed.
  • Table 5B Amplification ratios determined by AEX and QPA for MRKHVE3 over several continuous passaging in serum free media.
  • MRKHVE3 is the new vector backbone which does NOT carry a transgene.
  • Table 5C Amplification ratios determined by AEX and QPA for MRKAd5gag(E3-) over several continuous passaging in serum free media. This construct is identical to the MRKAd ⁇ gag construct except that this version is DELETED of the E3 gene.
  • titers were also comparable when E3 is deleted (MRKAd5hCMNgagbGHpA(E3-)) or SPA is substituted for bGHpA terminator (MRKAd5 hCMN-gag-SPA (E3+)) or murine CMN promoter is used in place of hCMN (MRKAd5 mCMN-gag-bGHpA (E3+)) in the MRKAd5 backbone.
  • Table 7 The results shown in Table 7 indicate that the three other vectors ( in addition to the preferred vector, MRK Ad5 HIV-1 gag, are also capable of inducing strong anti-gag antibody responses in mice. Interestingly enough, while the mCMV-FLgag construct containing bGHpA and E3+ in an El parallel orientation showed lowest gag expression in the COS cell in vitro infection (Table 6) in comparison with the other vectors tested, it generated the greatest anti-gag antibody response this in vivo Balb/c study. Table 7 also shows a dose response in anti-gag antibody production in both the research and the clinical lot. As expected, the clinical lot shows reduced anti-gag antibody induction at each dosage level compared to the same dosage used for the research lot.
  • Table 6 In vitro analysis for gag expression in COS cells by Elisa assay.
  • MRKAd5gag was produced in serum free conditions and purified at P5.
  • Research Ad5FLgag lot# 6399 e mCMVFL-gagbGHpA was produced in serum free conditions and purified at P5.
  • Table 7: mHIV020 Anti-p24 Ab Titers in Balb/c mice (n 10) vaccinated with various Adgag constructs and lots (3 week post dosel).
  • the adenovector backbone is identical to the original backbone used in the original Adgag vector. Expression at 10e7 dose from this vector is 7 fold lower then the same dose of the MRKAd ⁇ gag and 4 fold lower than the research lot.
  • the results shown in Table 8 indicate comparable responses with respect to the generation of anti-gag antibodies.
  • the frequencies of gag-specific T cells in peripheral blood assummarized in Table 9 demonstrate a strong cellular immune response generated after a single dose with the new construct MRK Ad5 HTV-1 gag. The responses are also boostable with second dose of the same vector.
  • the vector is also able to induce CD8+ T cell responses (as evident by remaining spot counts after CD4+ depletion of PBMCs) which are responsible for cytotoxic activity.
  • PBMCs peripheral blood mononuclear cells
  • MRK Ad5 HIV-1 gag represent very promising HIV-gag adenovectors with respect to their enhanced growth characteristics in both serum and, more importantly, in serum-free media conditions.
  • MRK Ad5 HIV-1 gag shows a 5-10 fold increased amplification rate.
  • This construct is able to generate significant cellular immune responses in vivo even at a relatively low dose of 10 ⁇ 9 vp.
  • the potency of the MRKAd5gag construct is comparable to, if not better than the original HTV-1 gag vector as shown in this rhesus monkey study.
  • EXAMPLE 17 CODON OPTIMIZED HIV-1 POL AND CODON OPTIMZED HIV-1 POL MODIFICATIONS The open reading frames for the various synthetic pol genes disclosed herein comprise coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN).
  • the protein sequence is based on that of Hxb2r, a clonal isolate of MB; this sequence has been shown to be closest to the consensus clade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico).
  • any available HIN-1 or HIV-2 strain provides a potential template for the generation of HIN pol D ⁇ A vaccine constructs disclosed herein.
  • the protease gene is excluded from the D ⁇ A vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation.
  • the design of the gene sequences for both wild- type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred ("humanized") codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12).
  • codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Nal (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), He (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC).
  • a particular embodiment of this portion of the invention comprisies codon optimized nucleotide sequences which encode wt-pol D ⁇ A constructs (herein, "wt- pol” or “wt-pol (codon optimized))" wherein D ⁇ A sequences encoding the protease (PR) activity are deleted, leaving codon optimized "wild type” sequences which encode RT (reverse transcriptase and R ⁇ ase H activity) and IN integrase activity.
  • wt- pol or wt-pol (codon optimized)
  • a DNA molecule which encodes this protein is disclosed herein as SEQ TD NO:l, the open reading frame being contained from an initiating Met residue at nucleotides 10- 12 to a termination codon from nucleotides 2560-2562.
  • SEQ ID NO.T is as follows: AGATCTACCA TGGCCCCCAT CTCCCCCATT GAGACTGTGC CTGTGAAGCT GAAGCCTGGC ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGATGTGGG GGATGCCTAC TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC
  • the open reading frame of the wild type pol construct disclosed as SEQ ID NO:l contains 850 amino acids, disclosed herein as SEQ ID NO:2, as follows:
  • the present invention especially relates to an adenoviral vector vaccine which comprises a codon optimized HTV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIN-1 pol (RT-RH-I ⁇ ) activity of the expressed protein. Therefore, the present invention preferably relates to an adenoviral HIN-1 D ⁇ A pol-based vaccine wherein the construct is devoid of D ⁇ A sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, R ⁇ ase and/or IN activity.
  • HIN-1 pol mutant which is part and parcel of an adenoviral vector vaccine may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIN-1 Pol.
  • a HIN-1 D ⁇ A pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, R ⁇ ase H and IN activity.
  • HIN-1 D ⁇ A pol construct in a D ⁇ A molecule which contains at least one point mutation which alters the active site of the RT, R ⁇ ase H and IN domains of Pol, such that each activity is at least substantially abolished.
  • HIN-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, R ⁇ ase H and IN activity, respectfully.
  • an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4, Figure 17A-C) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains. Therefore, an especially preferred exemplification is an adenoviral vaccine which comprises, in an appropriate fashion, a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1. An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol.
  • any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.
  • Glu 714 Ala IN It is preferred that point mutations be incorporated into the IApol mutant adenoviral vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV-1 Pol.
  • SEQ ID NO: 3 discloses the nucleotide sequence which codes for a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as "IApol":
  • inactivation of the enzymatic functions was achieved by replacing a total of nine active site residues from the enzyme subunits with alanine side-chains.
  • Table 1 all residues that comprise the catalytic triad of the polymerase, namely Aspll2, Aspl87, and Aspl88, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989, Proc. Natl. Acad. Sci. 1989, 86: 4803-4807).
  • any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based adenoviral HIV vaccine of the present invention, either when administered alone or in a combined modality regime and/or a prime-boost regimen.
  • the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4;) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.
  • HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy.
  • a preferred embodiment of the present invention as with HIV-1 Nef constructs shown herein, is to provide for a HIV-1 Pol mutant adenoviral vaccine construction wherein the pol coding region or a portion thereof is operatively linked to a leader peptide, preferably a leader peptide from human tPA.
  • a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
  • a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HTV-1 tP A/Pol protein.
  • insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest.
  • the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Pol protein of interest, including but not limited to a HTV-1 Pol protein which contains a leader peptide.
  • the amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 17).
  • another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA.
  • the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region.
  • a DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ ID NO: 6.
  • the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region ( herein, "tPA-wt-pol").
  • a DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 5, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635.
  • SEQ ID NO: 5 is as follows: GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTGTG CTGCTGCTGT GTGGAGCAGT CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA GCTGAAGCCT GGCATGGATG GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG CCCCGAGAAC CCCTACAACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG GAGGAAGCTG GTGGACTTCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA GCTGGGGATG CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGACTG TGCTGGATGT GGGGGATGCC TACTTCTCTG TG
  • the open reading frame of the wild type tPA-pol construct disclosed as SEQ ID NO:5 contains 875 amino acids, disclosed herein as SEQ ID NO:6, as follows:
  • the present invention also relates to a codon optimized HTV-1 Pol mutant contained within a recombinant adenoviral vector such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell.
  • adenoviral-based HTV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence.
  • any such leader peptide-based HTV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HDN-l Pol.
  • a leader peptide/HIN-1 D ⁇ A pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, R ⁇ ase H and T ⁇ activity.
  • An especially preferable HIV-1 D ⁇ A pol construct is a D ⁇ A molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, R ⁇ ase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished.
  • Such a HTV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully.
  • An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1.
  • SEQ ID NO:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, "tPA-opt-IApol").
  • the open reading frame begins with the initiating Met (nucleotides 8-10) and terminates with a "TAA" codon at nucleotides 2633-2635.
  • the nucleotide sequence encoding tPA- IAPol is also disclosed as follows:
  • the open reading frame ofthe tPA-IA-pol construct disclosed as SEQ ID NO:7 contains 875 amino acids, disclosed herein as tPA-IA-Pol and SEQ ID NO:8, as follows: Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Al
  • HIV-1 NEF MODIFICATIONS Codon optimized version of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US 00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.
  • particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO: 10.
  • Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HIV-1 Nef polypeptide.
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 11, while the expressed open reading frame is disclosed herein as SEQ ID NO: 12.
  • Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA).
  • the DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 13, while the expressed open reading frame is disclosed herein as SEQ ID NO: 14.
  • An additional embodiment relates to a DNA molecule encoding optimized HTV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.
  • This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO: 16.
  • nucleotide sequence of the codon optimized version of HTV-1 jrfl nef gene is disclosed herein as SEQ ID NO:9, as shown herein:
  • Preferred codon usage is as follows: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Lie (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAG).
  • WO 97/31115 PCT/US97/02294
  • Figure 19A-B for a comparion of wild type vs.
  • the open reading frame for SEQ ID NO: 9 above comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662.
  • the open reading frame of SEQ ID NO:9 provides for a 216 amino acid HIN-1 ⁇ ef protein expressed through utilization of a codon optimized D ⁇ A vaccine vector.
  • the 216 amino acid HTV-1 ⁇ ef (jfrl) protein is disclosed herein as SEQ ID NO: 10, and as follows:
  • HIN-1 Nef is a 216 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2
  • the nef -encoding region of the adenovirus vector of the present invention is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide.
  • either the D ⁇ A vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific plasminogen activator (tPA) leader.
  • a D ⁇ A vector may be modified by known recombinant D ⁇ A methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/ ⁇ ef protein.
  • insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a D ⁇ A vector housing the open reading frame for the ⁇ ef protein of interest.
  • the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HTV-1 ⁇ ef protein of interest, including but not limited to a HTV-1 ⁇ ef protein which contains a leader peptide.
  • the amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 17).
  • modifications introduced into the adenoviral vector HIV vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell.
  • a central theme of the DNA molecules and recombinant adenoviral HIV vaccines of the present invention is (1) host administration and intracellular delivery of a codon optimized nef-based adenoviral HIV vaccine; (2) expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, (3) inhibiting or at least altering known early viral functions of Nef which have been shown to promote HTV-1 replication and load within an infected host. Therefore, the nef coding region may be altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues.
  • the nef coding region may be altered so as to result in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues.
  • the adenoviral vector HTV vaccines of the present invention also relate to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, specific Nef-based constructs further include the following, as exemplification's and not limitations.
  • the present invention relates to an adenoviral vector vaccine which encodes modified forms of HIV-1, an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to amino acid residue 6-216 of HTV-1 Nef (jfrl) is referred to herein as opt tpanef.
  • the nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ ID NO: 11, as shown below:
  • the open reading frame for SEQ ID NO: 11 comprises an initiating methionine residue at nucleotides 2-4 and a "TAA" stop codon from nucleotides 713-715.
  • the open reading frame of SEQ ID NO:3 provides for a 237 amino acid HIN-1 ⁇ ef protein which comprises a tPA leader sequence fused to amino acids 6-216 of HIN-1 ⁇ ef, including the dileucine motif at amino acid residues 174 and 175.
  • This 237 amino acid tPA/ ⁇ ef (jfrl) fusion protein is disclosed herein as SEQ ID NO: 12, and is shown as follows:
  • this exemplified Nef protein contains both a tPA leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIN-1 ⁇ ef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
  • a D ⁇ A molecule which encodes optimized HTV-1 ⁇ ef wherein the open reading frame of a recombinant adenoviral HTV vaccine encodes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175.
  • This open reading frame is herein described as opt nef (G2A,LLAA) and is disclosed as SEQ ID NO: 13, which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662.
  • SEQ ID NO: 13 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID NO: 14, as follows: Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala He Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu He His Ser Gin Lys Arg Gin Asp He Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe Pro
  • An additional embodiment of the present invention relates to another DNA molecule encoding optimized HTV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.
  • This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HTV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175 (Ala-195 and Ala-196 in this tPA-based fusion protein).
  • the nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ ID NO:15, as shown below:
  • SEQ ID NO:7 The open reading frame of SEQ ID NO:7 encoding tPA-Nef (LLAA), disclosed herein as SEQ ID NO: 16, is as follows:
  • An adenoviral vector of the present invention may comprise a DNA sequence, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIN ⁇ ef which are shown to promote a substantial cellular immune response subsequent to host administration.
  • Figure 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors Vllns/nef ( Figure 20A), VUns/nef(G2A,LLAA) ( Figure 20B), Vllns/tpanef (Figure 20C) and Vllns/tpanef (LLAA) ( Figure 20C, also).
  • 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters.
  • Vllns/tpanef and VlJns/tpanef(LLAA) have identical sequences at the junctions.
  • Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in ⁇ ef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively.
  • MRKAd5Pol Construction and Virus Rescue Construction of vector shuttle plasmid and pre-adenovirus plasmid - Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5pol, is depicted in Figure 22. Briefly, the adenoviral shuttle vector for the full-length inactivated HIV-1 pol gene is as follows. The vector
  • MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is a derivative of the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid.
  • the vector contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal.
  • the expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bglll site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal (or MRKpAdHVE3) pre- plasmid.
  • the vector similar to the original shuttle vector contains the Pad site, extension to the packaging signal region, and extension to the pIX gene.
  • the synthetic full-length codon-optimized HIN-l pol gene was isolated directly from the plasmid pNlIns-HTV-pol-inact(opt). Digestion of this plasmid with Bgl L releases the pol gene intact (comprising a codon optimized IA pol sequence as disclosed in SEQ ID NO:3).
  • the pol fragment was gel purified and ligated into the MRKpdelEl (Pac/pIX/pack450)+CMVmin+BGHpA(str.) shuttle vector at the Bg ⁇ LL site.
  • the clones were checked for the correct orientation of the gene by using restriction enzymes DraLLVNotl. A positive clone was isolated and named
  • the genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing.
  • the pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdel+hCMV-min+FL- pol+bGHpA(S) was digested with restriction enzymes R ⁇ cl and R,stll07 I (or its isoschizomer, BstZLOl I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(El-/E3+)Clal.
  • pMRKAd5pol The resulting pre-plasmid originally named MRKpAd+hCMNmin+FL- pol+bGHpA(S)E3+ is now referred to as "pMRKAd5pol".
  • the genetic structure of the resulting pMRKAd5pol was verified by PCR, restriction enzyme and D ⁇ A sequence analysis.
  • the vectors were transformed into competent E. coli XL-1 Blue for preparative production.
  • the recovered plasmid was verified by restriction enzyme digestion and D ⁇ A sequence analysis, and by expression of the pol transgene in transient transfection cell culture.
  • the complete nucleotide sequence of this pMRKAd5HIV-lpol adenoviral vector is shown in Figure 26 A-AO.
  • pMRKAd5pol The pre-adenovirus plasmid, pMRKAd5pol, was rescued as infectious virions in PER.C6 ® adherent monolayer cell culture.
  • 12 ⁇ g of pMRKAd5pol was digested with restriction enzyme R ⁇ cl (New England Biolabs) and 3.3 ⁇ g was transfected per 6 cm dish of PER.C6 cells using the calcium phosphate co- precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Pad digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6 ® cells.
  • Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at ⁇ -60°C.
  • This pol containing recombinant adenovirus is referred to herein as "MRKAd5pol”. This recombinant adenovirus expresses an inactivated HIV-1 Pol protein as shown in SEQ ID NO:6.
  • MRKpdelEl (Pac/pIX/pack450)+CMNmin+BGHpA(str.) is the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. It has been modified to contain the P ⁇ cl site, extension to the packaging signal region, and extension to the pIX gene. It contains an expression cassette with the hCMN promoter (no intronA) and the bovine growth hormone polyadenylation signal.
  • the expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bgll 1 site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal pre-plasmid.
  • the synthetic full-length codon-optimized HQN-l nef gene was isolated directly from the plasmid pVlIns/nef (G2A,LLAA). Digestion of this plasmid with Bgll 1 releases the pol gene intact, which comprises the nucleotide sequence as disclosed in SEQ ID NO: 13.
  • the nef fragment was gel purified and ligated into the MRKpdelEl+CMVmin+BGHpA(str.) shuttle vector at the Bgll 1 site.
  • the clones were checked for correction orientation of the gene by using restriction enzyme Seal.
  • a positive clone was isolated and named MRKpdelEl hCMVminFL-nefBGHpA(s).
  • the genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing.
  • the pre-adenovirus plasmid was constructed as follows.
  • the genetic structure of the resulting pMRKAd5nef was verified by PCR, restriction enzyme and DNA sequence analysis.
  • the vectors were transformed into competent E. coli XL-1 Blue for preparative production.
  • the recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the nef transgene in transient transfection cell culture.
  • the complete nucleotide sequence of this pMRKAd5HIV-lnef adenoviral vector is shown in Figure 27A-AM.
  • pMRKAd5nef The pre-adenovirus plasmid, pMRKAd5nef, was rescued as infectious virions in PER.C6 ® adherent monolayer cell culture.
  • R ⁇ cl restriction enzyme
  • 3.3 ⁇ g was transfected per 6 cm dish of PER.C6 ® cells using the calcium phosphate co- precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). E ⁇ cl digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6 ® cells.
  • Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at ⁇ -60°C. This nef containing recombinant adenovirus is now referred to as "MRKAd5nef '.
  • Murine CMV Promoter Containing Shuttle Vectors for Inactivated Pol and Nef/G2A,LLAA
  • the murine CMV was amplified from the plasmid pMH4 (supplied by Frank Graham, McMaster University) using the primer set: mCMV (Not I) Forward: 5'-ATA AGA ATG CGG CCG CCA TAT ACT GAG TCA TTA GG-3' (SEQ ID NO: 20); mCMV (Bgl II)Reverse: 5'-AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C-3' (SEQ ID NO:21).
  • the underlined nucleotides represent the Not I and the Bgl II sites respectively for each primer.
  • This PCR amplicon was used for the construction of the mCMV shuttle vector containing the transgene in the El parallel orientation.
  • the hCMV promoter was removed from the original shuttle vector (containing the hCMV-gag-bGHpA transgene in the El parallel orientation) by digestion with Not I and Bgl II.
  • the mCMN promoter (Not L/Bgl II digested PCR product) was inserted into the shuttle vector in a directional manner.
  • the shuttle vector was then digested with Bgl LL and the gag reporter gene (Bgl II fragment) was re-inserted back into the shuttle vector.
  • Several clones were screened for correct orientation of the reporter gene.
  • the mCMN promoter was amplified from the plasmid pMH4 using the following primer set: mCMN (Asc I) Forward: 5'- ATA AGA ATG GCG CGC CAT ATA CTG AGT CAT TAG G (SEQ ID ⁇ O:22); mCMV (Bgl II) Reverse: 5' AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C (SEQ ID NO:23).
  • the underlined nucleotides represent the Asc I and Bgl LL sites, respectively for each primer.
  • the shuttle vector containing the hCMV-gag transgene in the El antiparallel orientation was digested with Ascl and Bgll 1 to remove the hCMV-gag portion of the transgene.
  • the mCMV promoter (AscllBglll digested PCR product) was inserted into the shuttle vector in a directional manner.
  • the vector was then digested with Rg/11 and the gag reporter gene (RgZll fragment) was re-inserted.
  • Several clones were screened for correct orientation of the reporter gene.
  • cloning was performed using the unique Bgl LL site within the mCMN-bGHpA shuttle vector.
  • the pol and nef genes were excised from their respective pVlIns plasmids by Bgl LL digestion.
  • Recombinant pre- plasmid adenovectors containing the various transgenes in both the E3- and E3+ versions (and in the El parallel and El antiparallel orientations) were subsequently prepared in large scale following transformation into XL-1 Blue E. coli cells and analyzed by restriction analysis and sequencing.
  • EXAMPLE 23 Construction of hCMV-tpa-nef (LLAA) Adenovector
  • the tpa-nef gene was amplified out from GMP grade pVlJns-tpanef (LLAA) vector using the primer sets: Tpanef (BamHI) F 5 -ATT GGA TCC ATG GAT GCA ATG AAG AGA GGG (SEQ ID 24); Tpanef (BamHI) R 5'-ATA GGA TCC TTA GCA GTC CTT GTA GTA CTC G (SEQ ID ⁇ O:25).
  • the resulting PCR product was digested with B ⁇ n ⁇ H, gel purified and cloned into the Bgl II site of MRKAd5CMV- bGHpA shuttle vector (Bgl II digested and calf intestinal phosphatase treated).
  • Clones containing the tpanef (LLAA) gene (see SEQ ID NO: 15 for complet coding region) in the correct orientation with respect to the hCMV promoter were selected following Sea I digestion.
  • the resulting MRKAd5tpanef shuttle vector was digested with Pac I and Bst Zl 101 and cloned into the E3+ MRKAd5 adenovector via bacterial homologous recombination techniques.
  • EXAMPLE 24 Immunogenicity of MRKAd5pol and MRKAd5nef Vaccine Materials and Methods - Rodent Immunization - Groups of N 10 BALB/c mice were immunized i.m. with the following vectors: (1) MRKAd5hCMN-IApol (E3+) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp; and (2) MRKAd5hCMN-IApol (E3-) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received.
  • mice were immunized i.m. with the following vectors: (1) MRKAd5hCMV-nef(G2A,LLAA) (E3+) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp; (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp.
  • 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received.
  • sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively.
  • Ad vectors (1) MRKAd5hCMV-IApol (E3+) at either 10 ⁇ 9 vp and 10 ⁇ 11 vp dose; and (2) MRKAd5hCM
  • the vaccine was administered to chemically restrained monkeys (10 mg/kg ketamine) by needle injection of two 0.5 mL aliquots of the Ad vectors (in 5 mM Tris, 5% sucrose, 75 mM NaCl, 1 mM MgCl 2 , 0.005% polysorbate 80, pH 8.0) into both deltoid muscles.
  • Murine anti-RT and anti-nef ELISA - Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, NY) were coated by overnight incubation with 100 ⁇ L of 1 ⁇ g /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, MD) in PBS. For anti-nef ELISA, 100 uL of 1 ug/mL HIV-1 nef (Advanced Biotechnologies, Columbia, MD) was used to coat the plates.
  • the plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, AL) and incubated for 2 h with 200 ⁇ L/well of blocking solution (PBS/0.05% tween/1% BSA). An initial serum dilution of 100-fold was performed followed by 4-fold serial dilution. 100- ⁇ L aliquots of serially diluted samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 ⁇ L of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, CA) were added with 1 h incubation.
  • Non-human primate and murine ELIspot assays The enzyme-linked immuno-spot (ELISpot) assay was utilized to enumerate antigen-specific INF ⁇ - secreting cells from mouse spleens (Miyahira, et al.1995, J. Immunol. Methods 181:45-54) or macaque PBMCs.
  • Mouse spleens were pooled from 5 mice/cohort and single cell suspensions were prepared at 5xl0 6 /mL in complete RPMI media (RPMI1640, 10% FBS, 2mM L-glutamine, lOOU/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM ⁇ -ME).
  • Rhesus PBMCs were prepared from 8- 15 mL of heparinized blood following standard Ficoll gradient separation (Coligan, et al, 1998, Current Protocols in Immunology. lohn Wiley & Sons, Inc.). Multiscreen opaque plates (Millipore, France) were coated with 100 ⁇ L/well of either 5 ⁇ g/mL purified rat anti-mouse IFN- ⁇ IgGl, clone R4-6A2 (Pharmingen, San Diego, CA), or 15 ug/mL mouse anti-human IFN- ⁇ IgG 2a (Cat. No. 1598-00, R&D Systems, Minneapolis, MN) in PBS at 4°C overnight for murine or monkey assays, respectively. The plates were washed with PBS/penicillin/streptomycin and blocked with 200 ⁇ L/well of complete RPMI media for 37 °C for at least 2 h.
  • DMSO DMSO were added; for specific responses, either selected peptides or peptide pools (4 ug/mL per peptide final concentration) were added.
  • stimulation was conducted using a pool of CD4 + -epitope containing 20-mer peptides (aa21-40, aa411-430, aa641-660, aa731-750, aa771-790) or a pool of CD8 + -epitope containing peptides (aa201-220, aa311-330, aa781-800).
  • aa51-70 (CD8 + T cell epitope) or aa81-100 (CD4 + ) peptide derived from the nef sequence was added for specific stimulation.
  • the responses against pol were evaluated using two pools (L and R) of 20-aa peptides that encompass the entire pol sequence and overlap by 10 amino acids.
  • a single pool containing 20-mer peptides covering the entire HIV-1 nef sequence and overlapping by 10 aa was used.
  • Each sample/antigen mixture was performed in triplicate wells for murine samples or in duplicate wells for rhesus PBMCs.
  • the plates were washed and incubated with 100 ⁇ L/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37 °C. Spots were developed by incubating with 100 ⁇ L/well 1- step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 10 6 cell input.
  • Non-human Primate anti-RT ELISA The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (#97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN 3 ) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature.
  • lysis buffer Coulter p24 antigen assay kit
  • Anti-pol IgG levels were determined by an ELISA assay using RT as a surrogate antigen.
  • Cellular response were quantified via TFN ⁇ ELISpot assay against pools of pol-epitope containing peptides. The results of these assays are summarized in Table 10.
  • mice vaccinees exhibited detectable anti-RT IgGs with an adenovector dose as low as 10 ⁇ 7 vp.
  • the humoral responses are highly dose- dependent and are boostable with a second immunization.
  • One or two doses of either pol vectors elicit high frequencies of antigen-specific CD4 + and CD8 + T cells; the responses are weakly dose-dependent but are boostable with a second immunization.
  • C57/BL6 mice were immunized once or twice with varying doses of MRKAd5hCMV-nef(G2A,LLAA) (E3+), MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10 ⁇ 7 vp and(3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10 ⁇ 7 vp and 10 ⁇ 9 vp.
  • the immune response were analyzed using similar protocols and the results are listed in Table 11. While anti-nef IgG responses could not be detected in this model system with any of the constructs, there are strong indications of a cellular immunity generated against nef using the ELIspot assay.
  • PBMC samples collected from two dozens of patients infected with HTV-1 in US were tested in ELISPOT assays with peptide pools of 20-mer peptides overlapping by 10 amino acids.
  • Four different peptide pools were tested for cross-clade recognition, and they were either derived from a clade B-based isolate (gag H-b; nef- b) or a clade C-based isolate (gag H-c, nef-c).
  • Data in Table 15 shows that T cells from these patients presumably infected with clade B HIV-1 could recognize clade C gag and nef antigens in ELISPOT assay.
  • roller Bottle Passaging Passaging of the pol and He/constructs continued through passage seven.
  • MRKAd5pol is ca. 70% as productive as MRKAd5gag while MRKAd5nef is ca. 25% as productive as MRKAd5gag.
  • Samples of P7 virus for both constructs were analyzed by V&CB by
  • the cells were infected with uncloned 30 MRKAd5nef (G2A,LLAA) at a MOI of 280 virus particles (vp)/cell.
  • the second batch B 20010202
  • the same procedure as the first run was used, except the cells were infected with cloned MRAd5nef.
  • the bioreactors were harvested 48 hours post-infection. Samples were taken and virus concentrations were determined from whole broth (with triton lysis), supernatant, and cell pellets (3 X freeze/thaw) with the AEX and QPA assays. Metabolites were measured with BioProfile 250 throughout the process.
  • Table 21 Virus source used for experiments.
  • Results - Table 22 and 23 show an the ability to scale up production of MRKAd5nef by growth in a bioreactor.
  • Groups of 3-5 rhesus macaques were immunized with (a) 5 mgs of VlJns- Flgag (pVIJnsCMN(no intron)-FL-gag-bGHpA), (b) 5 mgs of NlJns-Flgag formulated with 45 mgs of a non-ionic block copolymer CRL1005, or (c) 5 mgs of VI Jns-Flgag formulated with 7.5 mgs of CRL1005 and 0.6 mM benzalkonium chloride at weeks 0, 4, and 8. All animals received a single dose of 10e7 viral particles (vp) of the MRKAd5HIN-lgag at week 26.
  • PBMCs peripheral blood mononuclear cells
  • ELISpot assay ELISpot assay
  • MRKAd5HIV-lgag was very effective in boosting the T cell immune responses in these monkeys.
  • the number of gag-specific T cells per million PBMCs increased 2-48 fold compared to the levels observed at week 24 or 2 weeks prior to the boost.
  • the PBMCs were also analyzed by intracellular gamma-interferon staining prior to (at week 10) and after the MRKAd5gag boost (at week 30). The results for select animals are shown on Figure 31.
  • the open reading frames for the codon-optimized HIN-1 gag gene was fused directly to the open reading frame of the IA pol gene (consisting of RT, R ⁇ AseH and integrase domains) by stepwise PCR. Because the gene (SEQ ID NO: 38) does not include the protease gene and the frameshift sequence, it encodes a single polypeptide of the combined size of p55, RT, RNAse H and integrase (1350 amino acids; SEQ ID NO: 39).
  • the fragment that extends from the BstEII site within the gag gene to the last non-stop codon was ligated via PCR to a fragment that extends from the start codon of the IApol to a unique BamH-Z site.
  • This fragment was digested with BstER and BamHE Construction of gag-IApol fusion was achieved via three-fragment ligation involving the PstEBst ⁇ U gag digestion fragment, the Bst ⁇ ZZ/BamHZ digested PCR product and long PstEBamH/ VlR-FLpol backbone fragment.
  • the MRKAd5-gagpol adenovirus vector was constructed using the BgliZ fragment of the NlR-gagpol containing the entire ORF of gag-IApol fusion gene.
  • MRKAd5 HIN-1 vaccines (1) MR Ad5gag; (2) MRKAd5pol; (3) MRKAd5nef; (4) a mixture containing equal amounts of MRKAd5gag, MRKAd5pol, and MRKAd5nef, or (5) a mixture of equal amounts of MRKAd5gagpol and MRKAd5nef.
  • the vaccines were administered at weeks 0 and 4.
  • T cell responses against each of the HIN-1 antigens were assayed by IF ⁇ - gamma ELISpot assay using pools of 20-aa peptides that encompass the entire protein sequence of each antigen.
  • the results (Table 25) are expressed as the number of spot- forming cells (sfc) per million peripheral blood mononuclear cells (PBMC) that respond to each of the peptide pools.
  • results indicate the following observations: (1) each of the single gene constructs (MRKAd5gag, MRKAd5pol, or MRKAd5nef) is able to elicit high levels of antigen-specific T cells in monkeys; (2) the single-gene MRKAd5 constructs can be mixed as a multi-cocktail formulation capable of eliciting very broad T cell responses against gag, pol, and nef; (3) the MRKAd5 vector expressing the fusion protein of gag plus IA pol is capable of inducing strong T cell responses to both gag and pol.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • AIDS & HIV (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

First generation adenoviral vectors and associated recombinant adenovirus-based HIV vaccines which show enhanced stability and growth properties and greater cellular-mediated immunity are described within this specification. These adenoviral vectors are utilized to generate and produce through cell culture various adenoviral-based HIV-1 vaccines which contain HIV-1 gag, HIV-1 pol and/or HIV-1 nef polynucleotide pharmaceutical products, and biologically relevant modifications thereof. These adenovirus vaccines, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV1- Gag, Pol and/or Nef protein or biologically modification thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding HIV-1 Gag, encoding codon optimized HIV-1 Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The adenoviral vaccines of the present invention, when administered alone or in a combined modality regime, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.

Description

TΓΓLE OF THE INVENTION
ENHANCED FIRST GENERATION ADENOVIRUS VACCINES EXPRESSING
CODON OPTIMIZED H1V1-GAG, POL, NEF AND MODIFICATIONS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit, under 35 U.S.C. §119(e), of U.S. provisional applications 60/233,180, 60/279,056, and Attorney Docket 20867PV2 (serial number unassigned), filed September 15, 2000, March 27, 2001, and September 7, 2001, respectively.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not Applicable
REFERENCE TO MICROFICHE APPENDIX Not Applicable
FIELD OF THE INVENTION
The present invention relates to recombinant, replication-deficient first generation adenovirus vaccines found to exhibit enhanced growth properties and greater cellular-mediated immunity as compared to other replication-deficient vectors. The invention also relates to the associated first generation adenoviral vectors described herein, which, through the incorporation of additional 5' adenovirus sequence, enhance large scale production efficiency of the recombinant, replication- defective adenovirus described herein. Another aspect of the instant invention is the surprising discovery that the intron A portion of the human cytomegalovirus (hCMV) promoter constitutes a region of instability in adenoviral vector constructs. Removal of this region from adenoviral expression constructs results in greatly improved vector stability. Therefore, improved vectors expressing a transgene under the control of an intron A-deleted CMV promoter constitute a further aspect of this invention. These adenoviral vectors are useful for generating recombinant adenovirus vaccines against human immunodeficiency virus (HTV). In particular, the first generation adenovirus vectors disclosed herein are utilized to construct and generate adenovirus-based HTV- 1 vaccines which contain HIN-1 Gag, HIV-1 Pol and or HIV-1 Νef polynucleotide pharmaceutical products, and biologically active modifications thereof. Host administration of the recombinant, replication-deficient adenovirus vaccines described herein results in expression of HTV-1 Gag, HIV-1- Pol and/or Νef protein or im-munologically relevant modifications thereof, inducing a cellular immune response which specifically recognizes HTV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HTV-1 Gag, HTV-1 Pol, derivatives of optimized HTV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HTV-1 Pol is inactivated), HIV-1 Nef, and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The HIV adenovirus vaccines of the present invention, when administered alone or in a combined modality and/or prime/boost regimen, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
BACKGROUND OF THE INVENTION Human Immunodeficiency Virus-1 (HTV-1) is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders. HIN-1 is an RΝA virus of the Retro viridae family and exhibits the S'LTR-gag-pol-env- LTR 3' organization of all retro viruses. The integrated form of HTV-1, known as the provirus, is approximately 9.8 Kb in length. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Νef).
The gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene. The mature p55 protein products are pl7 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
The pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting. The viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, pl5) activities. The ne gene encodes an early accessory HTV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
The env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gpl60) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41- kDa envelope glycoprotein (gp41). Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
The tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.
The rev gene encodes the 13 kDa Rev protein, a RNA binding protein. The Rev protein binds to a region of the viral RNA termed the Rev response element (RRE). The Rev protein promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm. The Rev protein is required for HIV late gene expression and in turn, HIV replication.
Gpl20 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules. X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a R5 (T-cell line tropic) virus interacts with a CD4/CCR5 receptor complex.
After gpl20 binds to CD4, gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase. The viral DNA, known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles. Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS. Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3 -week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease. Destruction of CD4 helper T lymphocytes, which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection. The loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.
Effective treatment regimens for HTV-1 infected individuals have become available recently. However, these drugs will not have a significant impact on the disease in many parts of the world and they will have a minimal impact in halting the spread of infection within the human population. As is true of many other infectious diseases, a significant epidemiologic impact on the spread of HIN-l infection will only occur subsequent to the development and introduction of an effective vaccine. There are a number of factors that have contributed to the lack of successful vaccine development to date. As noted above, it is now apparent that in a chronically infected person there exists constant virus production in spite of the presence of anti-HTV-1 humoral and cellular immune responses and destruction of virally infected cells. As in the case of other infectious diseases, the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response. Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection. A second actor is the considerable genetic variability of the virus. Although anti-HTV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HTV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants. Given this latter observation, it would be useful to identify immunogens and related delivery technologies that are likely to elicit anti-HTV-1 cellular immune responses. It is known that in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins. CD8+ T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein. Activation of naive CD8+ T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins. Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4+ T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.
European Patent Applications 0 638 316 (Published February 15, 1995) and 0 586 076 (Published March 9, 1994), (both assigned to American Home Products
Corporation) describe replicating adenovirus vectors carrying an HTV gene, including env or gag. Various treatment regimens were used with chimpanzees and dogs, some of which included booster adenovirus or protein plus alum treatments.
Replication-defective adenoviral vectors harboring deletions in the El region are known, and recent adenoviral vectors have incorporated the known packaging repeats into these vectors; e.g., see EP 0707 071, disclosing, inter alia, an adenoviral vector deleted of El sequences from base pairs 459 to 3328; and U.S. Patent No. 6,033,908, disclosing, inter alia, an adenoviral vector deleted of base pairs 459-3510. The packaging efficiency of adenovirus has been taught to depend on the number of incorporated individual A (packaging) repeats; see, e.g., Grable and Hearing, 1990 J. Virol. 64(5):2047-2056; Grable and Hearing, 1992 J. Virol. 66(2):723-731.
Larder, et al., (1987, Nature 327: 716-717) and Larder, et al., (1989, Proc. Natl. Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.
Davies, et al. (1991, Science 252:, 88-95) disclose the crystal structure of the RNase H domain of HIV-1 Pol.
Schatz, et al. (1989, FEBS Lett. 257: 311-314) disclose that mutations Glu478Gln and His539Phe in a complete HIV-1 RT/RNase H DNA fragment results in defective RNase activity without effecting RT activity.
Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein. Leavitt, et al. (1993, J. Biol. Chem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show-differing effect on HIV-1 integrase (IN) activity.
Wiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HTV-1 IN and viral replication functions. It would be of great import in the battle against AIDS to produce a prophylactic- and/or therapeutic-based BIN vaccine which generates a strong cellular immune response against an TUN infection. The present invention addresses and meets these needs by disclosing a class of adenovirus vaccines which, upon host administration, express codon optimized and modified versions of the HIN-1 genes, gag, pol and nef. These recombinant, replication-defective adenovirus vaccines may be administered to a host, such as a human, alone or as part of a combined modality regimen and/or prime-boost vaccination regimen with components of the present invention and/or a distinct viral HIN DΝA vaccine, non- viral HIN DΝA vaccine, TUN subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIN vaccine.
SUMMARY OF THE INVENTION
The present invention relates to enhanced replication-defective recombinant adenovirus vaccine vectors and associated recombinant, replication-deficient adenovirus vaccines which encode various forms of HTV-1 Gag, HIV-1 Pol, and/or HTV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HTV-1 Pol and HIV-1 Nef. The adenovirus vaccines of the present invention express HTV antigens and provide for improved cellular-mediated immune responses upon host administration. Potential vaccinees include but are not limited to primates and especially humans and non-human primates, and also include any non-human mammal of commercial or domestic veterinary importance. An effect of the improved recombinant adenovirus-based vaccines of the present invention should be a lower transmission rate to previously uninfected individuals (i.e., prophylactic applications) and/or reduction in the levels of the viral loads within an infected individual (i.e., therapeutic applications), so as to prolong the asymptomatic phase of HTV-1 infection. In particular, the present invention relates to adenoviral-based vaccines which encode various forms of codon optimized HIV-1 Gag (including but in no way limited to p55 versions of codon optimized full length (FL) Gag and tPA- Gag fusion proteins), HTV-1 Pol, HIV-1 Nef, and selected modifications of immunological relevance. The administration, intracellular delivery and expression of these adenovirus vaccines elicit a host CTL and Th response. The preferred replication-defective recombinant adenoviral vaccine vectors include but are not limited to synthetic DNA molecules which (1) encode codon optimized versions of wild type HIV-1 Gag; (2) encode codon optimized versions of HTV-1 Pol; (3) encode codon optimized versions of HTV-1 Pol fusion proteins; (4) encode codon optimized versions of modified HIV-1 Pol proteins and fusion proteins, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell; (5) encode codon optimized versions of wild type HIV-1 Nef; (6) codon optimized versions of HTV-1 Nef fusion proteins; and/or (7) codon optimized versions of HIV-1 Nef derivatives, including but not limited to e modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations. The Nef-based fusion and modified proteins, disclosed within this specification and expressed from an adenoviral-based vector vaccine this specification, may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response. Examples of HTV-1 Gag, Pol and/or Nef fusion proteins include but are not limited to fusion of a leader or signal peptide at the NH -teriminal portion of the viral antigen coding region. Such a leader peptide includes but is not limited to a tPA leader peptide. The adenoviral vector utilized in construction of the HIV-1 Gag-, HIV-1 Poland/or HTV-1 Nef- based vaccines of the present invention may comprise any replication-defective adenoviral vector which provides for enhanced genetic stability of the recombinant adenoviral genome through large scale production and purification of the recombinant virus. In other words, an HIV-1 Gag-, Pol- or Nef-based adenovirus vaccine of the present invention is a purified recombinant, replication- defective adenovirus which is shown to be genetically stable through multiple passages in cell culture and remains so during large scale production and purification procedures. Such a recombinant adenovirus vector and harvested adenovirus vaccine lends itself to large scale dose filling and subsequent worldwide distribution procedures which will be demanded of an efficacious monovalent or multivalent HTV vaccine. The present invention meets this basic requirement with description of a replication-defective adenoviral vector and vectors derived therefrom, at least partially deleted in El, comprising a wildtype adenovirus cz'-s-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome. A preferred embodiment of the instant invention comprises base pairs 1-450 of a wildtype adenovirus. In other preferred embodiments, the replication -defective adenoviral vector has, in addition thereto, a region 3' to the El-deleted region comprising base pairs 3511-3523. Basepairs 342-450 (more particularly, 400-450) constitute an extension of the 5 'region of previously disclosed vectors carrying viral antigens, particularly HTV antigens (see, e.g., PCT International Application PCT/US00/18332, published January 11, 2001 (WO 01/02067), which claims priority to U.S. Provisional Application Serial Nos. 60/142,631 and 60/148,981, filed 7/6/1999 and 8/13/1999, respectively; these documents herein incorporated by reference. Applicants have found that extending the 5' region further into the El gene into the disclosed vaccine vectors incorporated elements found to be important in optimizing the packaging of the virus.
As compared to previous vectors not comprising basepairs from about 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome, vectors comprising the above region exhibited enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, a more potent virus effect, allowing lower doses of virus to be used to generate equivalent immunity; and a greater cellular-mediated immune response than replication-deficient vectors not comprising this region (basepairs 1-450). Even more important, adenoviral constructs derived therefrom are very stable genetically in large-scale production, particularly those comprising an expression cassette under the control of a hCMV promoter devoid of intron A. This is because Applicants have surprisingly found that the intron A portion of the hCMV promoter constituted a region of instability when employed in adenoviral vectors. Applicants have, therefore, identified an enhanced adenoviral vector which is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.
A preferred embodiment of this invention is a replication-defective adenoviral vector in accordance with the above description wherein the gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.
In preferred embodiments, the El gene, other than that contained within basepairs 1-450 or, alternatively, that contained within base pairs 1-450 and 3511- 3523 has been deleted from the adenoviral vector, and the gene expression cassette has replaced the deleted El gene. In other preferred embodiments, the replication defective adenovirus genome does not have a functional E3 gene, or the E3 gene has been deleted. Most preferably, the E3 region is present within the adenoviral genome. Further preferred embodiments are wherein the gene expression cassette is in an El anti-parallel (transcribed in a 3' to 5' direction relative to the vector backbone) orientation or, more preferably, an El parallel (transcribed in a 5' to 3' direction relative to the vector backbone) orientation.
Further embodiments relate to a shuttle plasmid vector comprising: an adenoviral portion and a plasmid portion, wherein said adenovirus portion comprises: a) a replication defective adenovirus genome, at least partially deleted in El, comprising a wildtype adenovirus czs-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) of the wildtype adenovirus genome and, preferably, in addition thereto, basepairs 3511-3523 of a wildtype adenovirus sequence; and b) a gene expression cassette comprising: (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a);and (c) a transcription terminator and or a polyadenylation site.
Other aspects of this invention include a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and (b) harvesting the resultant adenoviral vectors.
To this end, the present invention particularly relates to harvested recombinant, replication defective virus derived from a host cell, such as but not limited to 293 cells or PER.C6® cells, including but not limited to harvested virus related to any of the MRKAd5 vector backbones, with or without an accompanying transgene, including but not limited to the FUN-l antigens described herein. An HTV-1 vaccine is represented by any harvested, recombinant adenovirus material which expresses any one or more of the HIV-1 antigens disclosed herein. This harvested material may then be purified, formulated and stored prior to host administration.
Another aspect of this invention is a method of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising: a) a recombinant, replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus czs-acting adenovirus packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) and, preferably in addition thereto, base pairs 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:© a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site. In view of the efficacious nature of the adenoviral and/or DNA plasmid vaccines described herein, the present invention relates to all methodology regarding administration of one or more of these adenoviral and/or DNA plasmid vaccines to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIN infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences. As discussed herein, such a treatment regimen may include a monovalent or multivalent composition, various combined modality applications, and/or a prime/boost regimen to as to optimize antigen expression and a concomitant cellular-mediated and/or humoral immune response upon inoculation into a living vertebrate tissue. Therefore, the present invention provides for methods of using the adenoviral and/or DΝA plasmid vaccines disclosed herein within the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of the gag, pol and/or nef-based vaccines. To this end, the present invention relates in part to methods of generating a cellular immune response in a vaccinee, preferably a human vaccinee, wherein the individual is given more than one administration of adenovirus vaccine vector, and it may be given in a regimen accompanied by the administration of a plasmid vaccine. The plasmid vaccine (also referred to herein as a "DΝA plasmid vaccine" or "vaccine plasmid" comprises a nucleic acid encoding a protein or an immunologically relevant portion thereof, a heterologous promoter operably linked to the nucleic acid sequence, and a transcription terminator or a polyadenylation signal (such as bGH or SPA, respectively). There may be a predetermined minimum amount of time separating the administrations. The individual can be given a first dose of plasmid vaccine, and then a second dose of plasmid vaccine. Alternatively, the individual may be given a first dose of adenovirus vaccine, and then a second dose of adenovirus vaccine. In other embodiments, the plasmid vaccine is administered first, followed after a time by administration of the adenovirus vaccine. Conversely, the adenovirus vaccine may be administered first, followed by administration of plasmid vaccine after a time. In these embodiments, an individual may be given multiple doses of the same adenovirus serotype in either viral vector or plasmid form, or the virus may be of differing serotypes. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and Venezuelan equine encephilitis virus. The present invention also relates to multivalent adenovirus vaccine compositions which comprise Gag, Pol and Nef components described herein; see, e.g., Example 29 and Table 25. Such compositions will provide for an enhanced cellular immune response subsequent to host administration, particularly given the genetic diversity of human MHCs and of circulating virus. Examples, but not limitations, include MRKAd5-vector based multivalent vaccine compositions which provide for a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components) composition. Such a mutlivalent vaccine may be filled for a single dose or may consist of multiple inoculations of each individually filled component; and may in addition be part of a prime/boost regimen with viral or non- viral vector vaccines as introduced in the previous paragraph. To this end, preferred compositions are MRKAd5 adenovirus used in combination with multiple, distinct HTV antigen classes. Each HIN antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
The concept of a "combined modality" as disclosed herein also covers the alternative mode of administration whereby multiple HIN-1 viral antigens may be ligated into a proper shuttle plasmid for generation of a pre-adeno viral plasmid comprising multiple open reading frames. For example, a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possibly a "2+1" divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES). Therefore, a multivalent vaccine delivered as a single, or possibly a second harvested recombinant, replication-deficient adenovirus is contemplated as part of the present invention. Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly if pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adeno virus immune response. '
It is an object of the present invention to provide for enhanced replication-defective recombinant adenoviral vaccine vector backbones. These recombinant adenoviral backbones may accept one or more transgenes, which may be passaged through cell culture for growth, amplification and harvest.
It is a further object to provide for enhanced replication-defective recombinant adenoviral vaccine vectors which encode various transgenes.
It is also an object of the present invention to provide for a harvested recombinant, replication-deficient adenovirus which shows enhanced growth and amplification rates while in combination with increased virus stability after continuous passage in cell culture. Such a recombinant adenovirus is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.
To this end, it is an object of the present invention to provide for (1) enhanced replication-defective recombinant adenoviral vaccine vectors as described herein - which encode various forms of HJN-1 Gag, HIN-1 Pol, and/or HIN-1 Νef, including immunologically relevant modifications of HIN-1 Gag, HIV-1 Pol and HIV-1 Νef, and (2) harvested, purified recombinant replication-deficient adenovirus generated by passage of the adenoviral vectors of (1) through one or multiple passages through cell culture, including but not limited to passage through 293 cells or PER.C6® cells. It is also an object of the present invention to provide for recombinant adenovirus harvested by one or multiple passages through cell culture. As relating to recombinant adenoviral vaccine vector, this recombinant virus is harvested and formulated for subsequent host administration. It is also an object of the present invention to provide for replication-defective adenoviral vectors wherein at least one gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator. It is also an object of the present invention to provide for a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and (b) harvesting the resultant adenoviral vectors. It is a further object of the present invention to provide for methods of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising a) a replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus cz'-y-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about 450 (preferably, 1-450) and, preferably, 3511- 3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising: (i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.
It is also an object of the present invention to provide various alternatives for vaccine administration regimes, namely administration of one or more adenoviral and/or DNA plasmid vaccines described herein to provide effective immunoprophylaxis for uninfected individuals or a therapeutic treatment for HTV infected patients. Such processes include but are not limited to multivalent HTV-1 vaccine compositions, various combined modality regimes as well as various prime/boost alternatives. These methods of administration, relating to vaccine composition and/or scheduled administration, will increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen. As used throughout the specification and claims, the following definitions and abbreviations are used:
"HAART" refers to — highly active antiretroviral therapy — .
"first generation" vectors are characterized as being replication-defective. They typically have a deleted or inactivated El gene region, and preferably have a deleted or inactivated E3 gene region as well.
"AEX" refers to Anion Exchange chromatography.
"QPA" refers to Quick PCR-based Potency Assay.
"bps" refers to basepairs. "s" or "str" denotes that the transgene is in the El parallel or "straight" orientation.
"PBMCs" refers to peripheral blood monocyte cells.
"FL" refers to full length.
"FLgag" refers to a full-length optimized gag gene, as shown in Figure 2. "Ad5-Flgag" refers to an adenovirus serotype 5 replication deficient virus which carries an expression cassette which comprises a full length optimized gag gene under the control of a CMN promoter.
"Promoter" means a recognition site on a DΝA strand to which an RΝA polymerase binds. The promoter forms an initiation complex with RΝA polymerase to initiate and drive transcriptional activity. The complex can be modified by activating sequences such as enhancers or inhibiting sequences such as silencers.
"Leader" means a DΝA sequence at the 5' end of a structural gene which is transcribed along with the gene. This usually results a protein having an Ν-terminal peptide extension, often referred to as a pro-sequences. "Intron" means a section of DΝA occurring in the middle of a gene which does not code for an amino acid in the gene product. The precursor RΝA of the intron is excised and is therefore not transcribed into mRΝA not translated into protein.
"Immunologically relevant" or "biologically active" means (1) with regards to a viral protein, that the protein is capable, upon administration, of eliciting a measurable immune response within an individual sufficient to retard the propagation and/or spread of the virus and/or to reduce the viral load present within the individual; or (2) with regards to a nucleotide sequence, that the sequence is capable of encoding for a protein capable of the above.
"Cassette" refers to a nucleic acid sequence which is to be expressed, along with its transcription and translational control sequences. By changing the cassette, a vector can express a different sequence. "bGHpA" refers to the bovine growth hormone transcription terminator/polyadenylation sequence.
"tPAgag" refers to a fusion between the leader sequence of the tissue plasminogen activator leader sequence and an optimized HIV gag gene, as exemplified in Figure 30A-B, whether in a DNA or adeno virus-based vaccine vector. Where utilized, "IA" or "inact" refers to an inactivated version of a gene (e.g. IApol).
"MCS" is "multiple cloning site".
In general, adenoviral constructs, gene constructs are named by reference to the genes contained therein. For example:
"Ad5 HTV-1 gag", also referred to as the original HTV-1 gag adenoviral vector, is a vector containing a transgene cassette composed of a hCMV intron A promoter, the full length version of the human codon-optimized HIN-1 gag gene, and the bovine growth hormone polyadenylation signal. The transgene was inserted in the El antiparallel orientation in an El and E3 deleted adenovector.
"MRK Ad5 HIN-1 gag" also referred to as "MRKAd5gag" or "Ad5gag2" is an adenoviral vector taught herein which is deleted of El, comprises basepairs 1-450 and 3511-3523, and has a human codon-optimized HTV-1 gene in an El parallel orientation under the control of a CMV promoter without intron A. The construct also comprises a bovine growth hormone polyadenylation signal.
"pNUnsHINgag", also referred to as "HTVFLgagPR9901", is a plasmid comprising the CMN immediate-early (IE) promoter and intron A, a full-length codon-optimized HIN gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone. "pNUnsCMV(no intron)-FLgag-bGHpA" is a plasmid derived from pVl JnsHTVgag which is deleted of the intron A portion of CMV and which comprises the full length HIV gag gene. This plasmid is also referred to as "pVl JnsHTVgag- bGHpA", pVl Jns-hCMV-FL-gag-bGHpA" and "pVl JnsCMV(no intron) + FLgag + bGHpA". "pVl JnsCMV(no intron)-FLgag-SPA" is a plasmid of the same composition as pVl JnsCMV(no intron)-FLgag-bGHpA except that the SPA termination sequence replaces that of bGHpA. This plasmid is also referred to as "pVl Jns-HTVgag-SPA" and pNUns-hCMN-FLgag-SPA".
"pdelElsplA" is a universal shuttle vector with no expression cassette (i.e., no promoter or polyA). The vector comprises wildtype adenovirus serotype 5 (Ad5) sequences from bp 1 to bp 341 and bp 3524 to bp 5798, and has a multiple cloning site between the Ad5 sequences ending 341 bp and beginning 3524 bp. This plasmid is also referred to as the original Ad 5 shuttle vector. "MRKpdelElsplA" or "MRKpdelEl(Pac/pIX/pack450)" or
"MRKpdelEl(Pac/pIX/pack450)Clal" is a universal shuttle vector with no expression cassette (i.e. no promoter or polyA) comprising wildtype adenovirus serotype 5 (Ad5) sequences from bpl to bp450 and bp 3511 to bp 5798. The vector has a multiple cloning site between the Ad5 sequence ending 450 bp and beginning 3511 bp. This shuttle vector may be used to insert the CMV promoter and the bGHpA fragments in both the straight ("sir", or El parallel) orientation or in the opposite (opp. or El antiparallel) orientation)
"MRKpdelEl(Pac/pIX/pack450)+CMNmin+BGHpA(str.)" is still another shuttle vector which is the modified vector that contains the CMN promoter (no intron A) and the bGHpA fragments. The expression unit containing the hCMN promoter (no intron A) and the bovine growth hormone polyadenylation signal has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bglll site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El/E3+)Clal pre-plasmid. This shuttle vector, as shown in Figures 22 and 23, was used to insert the respective IApol and G2A,LLAA nef genes directly into. "MRKpdelEl-CMN(no intron)-FLgag-bGHpA" is a shuttle comprising Ad5 sequences from basepairs 1-450 and 3511-5798, with an expression cassette containing human CMV without intron A, the full-length human codon-optimized HIN gag gene and bovine growth hormone polyadenylation signal. This plasmid is also referred to as "MRKpdelEl shuttle +hCMN-FL-gag-BGHpA" "MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA" is an adenoviral vector comprising all Ad5 sequences except those nucleotides encompassing the El region (from 451-3510), a human CMV promoter without intron A, a full-length human codon-optimized HIN gag gene, and a bovine growth hormone polyadenylation signal. This vector is also referred to as "MRKpAdHVE3 + hCMV-FL-gag- BGHpA", "MRKpAd5HIN-lgag", "MRKpAd5gag", "pMRKAd5gag" or "PAd5gag2".
"pNlJns-HIN-pol inact(opt)" or "pNlJns-HIN IA pol (opt) is the inactivated Pol gene (contained within SEQ ID NO: 3) cloned into the Bglll site of VI Jns (Figure 17A-C). As noted herein, various derivatives of HIN-1 pol may be cloned into a plasmid expression vector such as Nl Jns or Nl Jns-tPA, thus serving directly as DΝA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector. "MRKpdel+hCMVmin+FL-pol+bGHpA(s)" is the "MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.)" shuttle mentioned above which contains the IA pol gene is the proper orientation. This shuttle vector is used in a bacterial recombination with MRKpAd(El-/E3+)Clal. "MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+", also referred to herein as
"pMRKAd5pol", is the pre-adenovirus plasmid which comprises a CMV-pol inact(opt)-pGHpA construct. The construction of this pre-adenovirus plasmid is shown in Figure 22.
"pVUns/nef (G2A,LLAA)" or "VlJns/opt nef (G2A,LLAA)" comprises codon optimized HIN-1 Νef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu- 174-Leu-175 dileucine motif to Ala-174-Ala-175 (SEQ ID ΝO:13; which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662). This fragment is subcloned into the Bgl II site of VI Jns and/orVUns-tPA (Figures 16A-B). As noted above for HIV-1 pol, HIV-1 nef constructs may be cloned into a plasmid expression vector such as VlJns or VlJns- tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.
"MRKpdelElhCMVminFL-nefBGHρA(s)", also referred to herein as "pMRKAd5nef ', is the pre-adenovirus plasmid which comprises a CMV-nef
(G2A,LLAA) codon optimized sequence. The construction of this pre-adenovirus plasmid is shown in Figure 23.
BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the original HIV-1 gag adeno vector (Ad5HIV-lgag). This vector is disclosed in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S. Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference. Figure 2 shows the nucleic acid sequence (SEQ ID NO: 29) of the optimized human HIV-1 gag open reading frame.
Figure 3 shows diagrammatically the new transgene constructs in comparison with the original gag transgene.
Figure 4 shows the modifications made to the original adenovector backbone in the generation of the novel vectors of the instant invention. Figure 5 shows the virus mixing experiments that were carried out to determine the effects of the addition made to the packaging signal region (Expt. #1) and the E3 gene on viral growth (Expt. #2). The bars denote the region of modifications made to the El deletion. Figure 6 shows an autoradiograph of viral DNA analysis following the viral mixing experiments described in Examples 6 and 7.
Figures 7 A, 7B and 7C are as follows: Figure 7 A shows the hCMV-Flgag- bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Both El parallel and El antiparallel transgene orientation are represented. Figure 7B shows the hCMV-Flgag-SPA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Again, both El parallel and El antiparallel transgene orientation are represented. Figure 7C shows the mCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Once again, both El parallel and El antiparallel transgene orientation are represented.
Figure 8 A shows the experiment designed to test the effect of transgene orientation.
Figure 8B shows the experiments designed to test the effect of polyadenylation signal. Figure 9 shows viral DNA from the four adenoviral vectors tested (Example
12) at P5, following R-ytEll digestion.
Figure 10 shows viral DNA analysis of passages 11 and 12 of MRKpAdHVE3, MRKAd5HIV-lgag, and MRKAd5HIV-lgagE3-.
Figure 11 shows viral DNA analysis (Hindlll digestion) of passage 6 MRKpAdHVE3 and MRKAd5HIV-lgag used to initiate the viral competition study. The last two lanes are passage 11 analysis of duplicate passages of the competition study (each virus at MOI of 280 viral particles).
Figure 12 shows viral DNA analysis by Hind III digestion on high passage numbers for MRKAd5HIV-lgag in serum-containing media with collections made at specified times. The first lane shows the lkb DNA size marker. The other lanes represent pre-plasmid control (digested with Pacl and HindRT), MRKAd5HIN-lgag at P16, P19, and P21.
Figure 13 shows serum anti-p24 levels at 3 wks post i.m. immunization of balb/c mice (n=10) with varying doses of several Adgag constructs: (A) MRK Ad5 HIV-1 gag (through passage 5); (B) MRKAd5 hCMV-FLgag-bGHpA (E3-); (C) MRKAd5 hCMV-FLgag-SPA (E3+); (D) MRKAd5 mCMV-FLgag-bGHpA (E3+); (E) research lot (293 cell-derived) of Ad5BQN-l gag; and (F) clinical lot (Ad5gagFΝ0001) of Ad5HIV-l gag. Reported are the geometric mean titers (GMT) for each cohort along with the standard error bars.
Figure 14 shows a restriction map of the pMRKAd5HIV-lgag vector. Figures 15A-X illustrates the nucleotide sequence of the pMRKAd5HIV-lgag vector (SEQ ID NO:27. [coding] and SEQ ID NO:28 [non-coding]).
Figures 16A-B shows a schematic representation of DNA vaccine expression vectors VI Jns (A) and VI Jns-tPA (B), which are utilized for HTV-1 gag, pol and nef constructs in various DNA/viral vector combined modality regimens as disclosed herein.
Figures 17A-C shows the nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.
Figure 18 shows codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-pol inact(opt) (contained within SEQ ID NOs: 7 and 8, respectively). The underlined portion represents the NH2-terminal region of IA-Pol.
Figures 19A-B show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef. The wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide. WT, wild type sequence (SEQ ID NO: 19); opt, codon-optimized sequence (contained within SEQ ID NO:l). The Nef amino acid sequence is shown in one-letter code (SEQ ID NO:2).
Figures 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors VI Jns/nef (Figure 20A), NlJns/nef(G2A,LLAA) (Figure 20B), NlJns/tpanef (Figure 20C) and NlJns/tpanef(LLAA) (Figure 20C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. Nl Jns/tpanef and NUns/tpanef(LLAA) have identical sequences at the junctions.
Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Νef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the putative leader peptide cleavage sites are indicated with "*", and a exogenous serine residue introduced during the construction of the mutants is underlined.
Figure 22 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Pol. Figure 23 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Nef .
Figure 24 shows a comparison of clade B vs. clade C anti-gag T cell responses in clade B HTV -infected subjects.
Figure 25 shows a comparison of clade B vs. clade C anti-nef T cell responses in clade B HIN-infected subjects.
Figures 26A-AO illustrates the nucleotide sequence of the pMRKAd5EDN- lpol adenoviral vector (SEQ ID ΝO:32 [coding] and SEQ ID NO:33 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ ID NO3).
Figures 27 A- AM illustrates the nucleotide sequence of the pMRKAd5HIN-l nef adenoviral vector (SEQ ID ΝO:34 [coding] and SEQ ID NO:35 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ ID NO13).
Figure 28 shows the stability of MRKAd5 vectors comprising various promoter fragments (hCMV or mCMV) and terminations signals (bGH or SPA) in E3(+) or E3(-) backbones. Figures 29A and B shows the anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi time points (Figure 29 A) and the timcourse QPA supernatant titers (Figure 29B) for MRKAd5gag, MRKAd5pol and MRKAd5nef .
Figure 30 shows the nucleotide sequence (SEQ ED NO:36) and amino acid sequence (SEQ ID NO: 37) comprising the open reading frame of a representative tPA-gag fusion for use in the DNA and/or adenoviral vaccine disclosed herein.
Figure 31 shows the intracellular γlFN staining of PBMCs collected at week 10 (post DNA prime) and week 30 (post Ad boost). The cells were stimulated overnight in the presence or absence of the gag peptide pool. They were subsequently stained using fluorescence-tagged anti-CD3, anti-CD8, anti-CD4, and anti-γlFN monoclonal antibodies. Each plot shows all CD3+ T cells which were segregated in terms of positive staining for surface CD8 and γlFN production. The numbers in the upper right and lower right quadrants of each plot are the percentages of CD3+ cells that were CD8+γIFN+ and CD4+γIFN+, respectively. Figure 32 shows a comparison of single-modality adenovirus immunization with DNA + adjuvant prime/adenovirus boost immunization. Figures 33A-B show the nucleotide sequence (SEQ ID NO: 38) of the open reading frame for the gag-IApol fusion of Example 29.
Figures 34A-B show the protein sequence (SEQ ID NO: 39) of the gag-IApol fustion frame.
DETAILED DESCRIPTION OF THE INVENTION
A novel replication-defective, or "first generation," adenoviral vector suitable for use in gene therapy or nucleotide-based vaccine vectors is described. This vector is at least partially deleted in El and comprises a wildtype adenovirus czs-acting packaging region from about base pair 1 to between about base pair 342 (more preferably, 400) to about 458 (preferably, 1-450) and, preferably, 3511-3523 of a wild-type adenovirus sequence. It has been found that a vector of this description possesses enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, and is more potent allowing lower doses of virus to be used to generate equivalent immunity. The vector, furthermore, generates a harvested recombinant adenovirus which shows greater cellular-mediated immune responses than replication-deficient vectors not comprising this region (basepairs 342-450). Adenoviral constructs derived from these vectors are, further, very stable genetically, particularly those comprising a transgene under the control of a hCMV promoter devoid of intron A. Viruses in accordance with this description were passaged continually and analyzed; see Example 12. Each virus analyzed maintained it correct genetic structure. Analysis was also carried out under propagation conditions similar to that performed in large scale production. Again, the vectors were found to possess enhanced genetic stability; see Figure 12. Following 21 passages, the viral DΝA showed no evidence of rearrangement, and was highly reproducible from one production lot to the next. The outcome of all relevant tests indicate that the adenoviral vector is extremely well suited for large-scale production of recombinant, replication-deficient adenovirus, as shown herein with the data associated with Figure 28. A preferred adenoviral vector in accordance with this description is a vector comprising basepairs 1-450, which is deleted in E3. This vector can accommodate up to approximately 7,500 base pairs of foreign DΝA inserts (or exogenous genetic material). Another preferred vector is one retaining E3 which comprises basepairs 1- 450. A preferred vector of this description is an E3+ vector comprising basepairs 1- 450 and 3511-3523. This vector, when deleted of the region spanning basepairs 451- 3510, can accommodate up to approximately, 4,850 base pairs of foreign DΝA inserts (or exogenous genetic material). The cloning capacities of the above vectors have been determined using 105% of the wildtype Ad5 sequence as the upper genome size limit.
Wildtype adenovirus serotype 5 is used as the basis for the specific basepair numbers provided throughout the specification. The wildtype adenovirus serotype 5 sequence is known and described in the art; see, Chroboczek et al., 1992 J. Virology 186:280, which is hereby incorporated by reference. Accordingly, a particular embodiment of the instant invention is a vector based on the adenovirus serotype 5 sequence. One of skill in the art can readily identify the above regions in other adenovirus serotypes (e.g., serotypes 2, 4, 6, 12, 16, 17, 24, 31, 33, and 42), regions defined by basepairs corresponding to the above basepair positions given for adenovirus serotype 5. Accordingly, the instant invention encompasses all adenoviral vectors partially deleted in El comprising basepairs corresponding to 1-450 (particularly, 342-450) and, preferably, 3511-3523 of a wild-type adenovirus serotype 5 (Ad5) nucleic acid sequence. Particularly preferred embodiments of the instant invention are those derived from adenoviruses like Ad5 which are classified in subgroup C (e.g., Ad2).
Vectors in accordance with the instant invention are at least partially deleted in El. Preferably the El region is completely deleted or inactivated. Most preferably, the region deleted of El is within basepairs 451-3510. It is to be noted that the extended 5' and 3' regions of the disclosed vectors are believed to effectively reduce the size of the El deletion of previous constructs without overlapping any part of the E1A E1B gene present in the cell line used, i.e., the PER.C6® cell line transefected with base pairs 459-3510. Overlap of adenoviral sequences is avoided because of the possibility of recombination. One of ordinary skill in the art can certainly appreciate that the instant invention can, therefore, be modified if a different cell line transfected with a different segment of adenovirus DNA is utilized. For purposes of exemplification, a 5' region of base pairs 1 to up to 449 is more appropriate if a cell line is transfected with adenoviral sequence from base pairs 450-3510. This holds true as well in the consideration of segments 3' to the El deletion.
Preferred embodiments of the instant invention possess an intact E3 region (i.e., an E3 gene capable of encoding a functional E3). Alternate embodiments have a partially deleted E3, an inactivated E3 region, or a sequence completely deleted of E3. Applicants have found, in accordance with the instant invention, that virus comprising the E3 gene were able to amplify more rapidly compared with virus not comprising an E3 gene; see Figure 6 wherein a diagnostic CsCl band corresponding to the E3+ virus tested (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus. These results were obtained following a virus competition study involving mixing equal MOI ratio (1:1) of adenovectors both comprising the E3 gene and not comprising the E3 gene. This increased amplification capacity of the E3+ adenovectors was subsequently confirmed with growth studies; see Table 4A, wherein the E3+ virus exhibit amplification ratios of 470, 420 and 320 as compared with the 115 and 40-50 of the E3- constructs.
As stated above, vectors in accordance with the instant invention can accommodate up to approximately 4,850 base pairs of exogenous genetic material for an E3+ vector and approximately 7,500 base pairs for an E3- vector. Preferably, the insert brings the adenoviral vector as close as possible to a wild-type genomic size (e.g., for Ad5, 35,935 basepairs). It is well known that adenovirus amplifies best when they are close to their wild-type genomic size.
The genetic material can be inserted in an El-parallel or an El anti-parallel orientation, as such is illustrated in Figure 7 A, 7B, 7C and Figure 8 A. Particularly preferred embodiments of the instant invention, have the insert in an El-parallel orientation. Applicants have found, via competition experiments with plasmids containing transgenes in differing orientation (Figure 8A), that vector constructs with the foreign DNA insert in an El-parallel orientation amplify better and actually out- compete El-antiparallel-oriented transgenes. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the El parallel orientation as compared with the El anti-parallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the El parallel orientation for both transgenes tested. Adenoviral vectors in accordance with the instant invention are particularly well suited to effectuate expression of desired proteins, one example of which is an HIV protein, particularly an HIV full length gag protein. Exogenous genetic material encoding a protein of interest can exist in the form of an expression cassette. A gene expression cassette preferably comprises (a) a nucleic acid encoding a protein of interest; (b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription terminator.
The transcriptional promoter is preferably recognized by an eukaryotic RNA polymerase. In a preferred embodiment, the promoter is a "strong" or "efficient" promoter. An example of a strong promoter is the immediate early human cytomegalovirus promoter (Chapman et al, 1991 Nucl. Acids Re.?19:3979-3986, which is incorporated by reference), preferably without intronic sequences. Most preferred for use within the instant adenoviral vector is a human CMV promoter without intronic seqeunces, like intron A. Applicants have found that intron A, a portion of the human cytomegalovirus promoter (hCMV), constitutes a region of instability for adenoviral vectors. CMV without intron A has been found to effectuate (Examples 1- 3) comparable expression capabilities in vitro when driving HIN gag expression and, furthermore, behaved equivalently to intron A-containing constructs in Balb/c mice in vivo with respect to their antibody and T-cell responses at both dosages of plasmid DΝA tested (20 μg and 200 μg). Those skilled in the art will appreciate that any of a number of other known promoters, such as the strong immunoglobulin, or other eukaryotic gene promoters may also be used, including the EF1 alpha promoter, the murine CMV promoter, Rous sarcoma virus (RSV) promoter, SV40 early/late promoters and the beta-actin promoter.
In preferred embodiments, the promoter may also comprise a regulatable sequence such as the Tet operator sequence. This would be extremely useful, for example, in cases where the gene products are effecting a result other than that desired and repression is sought.
Preferred transcription termination sequences present within the gene expression cassette are the bovine growth hormone terminator/polyadenylation signal (bGHpA) and the short synthetic polyA signal (SPA) of 50 nucleotides in length, defined as follows: AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGT- TTTTTGTGTG (SEQ TD ΝO:26).
The combination of the CMV promoter (devoid of the intron A region) with the BGH terminator is particularly preferred although other promoter/terminator combinations in the context of FG adenovirus may also be used. Other embodiments incorporate a leader or signal peptide into the transgene.
A preferred leader is that from the tissue-specific plasminogen activator protein, tPA. Examples include but are not limited to the various tPA-gag, tPA-pol and tPA-nef adeno virus-based vaccines disclosed throughout this specification.
In view of the improved adenovirus vectors described herein, an essential portion of the present invention are adenoviral-based HIV vaccines comprising said adenovirus backbones which may be administered to a mammalian host, preferably a human host, in either a prophylactic or therapeutic setting. The HTV vaccines of the present invention, whether administered alone or in combination regimens with other viral- or non-viral-based DNA vaccines, should elicit potent and broad cellular immune responses against HIN that will either lessen the likelihood of persistent virus infection and/or lead to the establishment of a clinically significant lowered virus load subject to HIN infection or in combination with HAART therapy, mitigate the effects of previously established HTV infection (antiviral immunotherapy(ARI)). While any HTV antigen (e.g., gag, pol, nef, gρl60, gp41, gpl20, tat, rev, etc.) may be utilized in the herein described recombinant adenoviral vectors, preferred embodiments include the codon optimized p55 gag antigen (herein exemplified as MRKAd5gag), pol and nef. Sequences based on different Clades of HIV-1 are suitable for use in the instant invention, most preferred of which are Clade B and Clade C. Particularly preferred embodiments are those sequences (especially, codon-optimized sequences) based on concensus Clade B sequences. Preferred versions of the MRKAd5pol and MRKAd5nef series of adenoviral vaccines will encode modified versions of pol or nef, as discussed herein. Preferred embodiments of the MRKAd5HTV-l vectors carrying HIV envelope genes and modifications thereof comprise the HIV codon- optimized env sequences of PCT International Applications PCT/US 97/02294 and PCT/US97/10517, published August 28, 1997 (WO 97/31115) and December 24, 1997, respectively; both documents of which are hereby incorporated by reference. A most preferred aspect of the instant invention is the disclosed use of the adenoviral vector described above to effectuate expression of HIV gag. Sequences for many genes of many HIV strains are publicly available in GEΝB AΝK and primary, field isolates of HIV are available from the National Institute of Allergy and Infectious Diseases (NIATD) which has contracted with Quality Biological
(Gaithersburg, MD) to make these strains available. Strains are also available from the World Health Organization (WHO), Geneva Switzerland. It is preferred that the gag gene be from an HIV-1 strain (CAM-1; Myers et al, eds. "Human Retroviruses and AIDS: 1995, UA3-IIA19, which is hereby incorporated by reference). This gene closely resembles the consensus amino acid sequence for the clade B (North
American/European) sequence. Therefore, it is within the purview of the skilled artisan to choose an appropriate nucleotide sequence which encodes a specific HTV gag antigen, or immunologically relevant portion thereof. As shown in Example 25, a clade B or clade C based p55 gag antigen will potentially be useful on a global scale. As noted herein, the transgene of choice for insertion in to a DNA or MRKAd-based adenoviral vector of the present invention is a codon optimized version of p55 gag. Such a MRKAd5gag adenoviral vector is documented in Example 11 and is at least referred to herein as MRKAd5HTV-lgag. Of course, additional versions are contemplated, including but not limited to modifications such as promoter (e.g., mCMV for hCMV) and/or pA-terminations signal (SPA for bGH) switching, as well as generating MRK Ad5 backbones with or without deletion of the Ad5 E3 gene. The present invention also relates a series of MRKAd5pol-based adenoviral vaccines which are shown herein to generate cellular immune responses subsequent to administration in mice and non-human primate studies. Several of the MRKAd5pol series are exemplified herein. One such adenoviral vector is referred to as MRKAd5hCMV-inact opt pol(E3+), which comprises the MRKAd5 backbone, the hCMN promoter (no intron A), an inactivated pol transgene, and contains the Ad5 E3 gene in the adenoviral backbone. A second exemplified pre-adenovirus plasmid and concomitant virus is referred to as MRKAd5hCMN-inact opt pol(E3-), which is identical to the former adenoviral vector except that the E3 is deleted. Both constructions contain a codon optimized, inactivated version of HIV-1 Pol, wherein at least the entire coding region is disclosed herein as SEQ ID ΝO:3 and the expressed protein is shown as SEQ ID NO:4 (see also Figure 17A-C and Table 1, which show targeted deletion for inactivated pol. This and other preferred codon optimized versions of HTV Pol as disclosed herein are essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference. As disclosed in the above-mentioned documents, the open reading frame for these codon-optimized HTV-1 Pol-based DNA vaccines are represented by codon optimized DNA molecules encoding codon optimized HTV-1 Pol (e.g. SEQ ID NO:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence (e.g. SEQ ID NO:6), and especially preferable, and exemplified by the MRKAd5-Pol construct in e.g., Example 19, biologically inactivated pol ("inact opt Pol"; e.g., SEQ ID NO:4) which is devoid of significant PR, RT, RNase or IN activity associated with wild type Pol. In addition, a construct related to SEQ ID NO:4 is contemplated which contains a leader peptide at the amino terminal region of the IA Pol protein. A specific construct is ligated within an appropriate DNA plasmid vector containing regulatory regions operatively linked to the respective HIV-1 Pol coding region, with or without a nucleotide sequence encoding a functional leader peptide. To this end, various HIV-1 Pol constructs disclosed herein relate to open reading frames for cloning to the enhanced first generation Ad vectors of the present invention (such a series of MRKAd5pol adenoviral vaccine vectors), including but not limited to wild type Pol (comprising the DNA molecule encoding WT opt Pol, as set forth in SEQ ID NO:2), tPA-opt WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), inact opt Pol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ ID
NO:4), and tPA-inact opt Pol, (comprising the DNA molecule encoding tPA-inact opt Pol, as set forth in SEQ ID NO:8). The pol-based versions of enhanced first generation adenovirus vaccines elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans. As noted in the above, an effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.
The present invention further relates to a series of MRKAd5nef-based adenoviral vaccines which, similar to HIV gag and pol antigens, generate cellular immune responses subsequent to administration in mice and non-human primate studies. The MRKAd5nef series are exemplified herein by utilizing the improved MRK adenoviral backbone in combination with modified versions of HTV nef. These exemplified MRKAd5nef vectors are as follows: (1) MRKAd5hCMV- nef(G2A,LLAA) (E3+), which comprises the improved MRKAd5 backbone, a human CMV promoter an intact Ad5 E3 gene and a modified nef gene: (2) MRKAd5mCMV- nef(G2A,LLAA) (E3+), which is the same as (1) above but substituting a murine CMV promoter for a human CMV promoter; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+), which is the same as (2) except that the nef transgene is tpanef(LLAA). Codon optimized versions of HTV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference. Particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HTV- 1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO: 10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH2-terminus of the HTV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 11, while the expressed open reading frame is disclosed herein as SEQ ID NO: 12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HTV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 13, while the expressed open reading frame is disclosed herein as SEQ ID NO: 14. MRKAd5nef vectors (1) MRKAd5hCMV- nef(G2A,LLAA) (E3+) and (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) contain this transgene. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO: 16. The MRKAd5nef vector "MRKAd5mCMV-tpanef(LLAA) (E3+)" contains this transgene. Along with the improved MRKAd5gag adenovirus vaccine vector described herein, generation of a MRKAd5pol and MRKAd5nef adenovirus vector provide for enhanced HTV vaccine capabilities. Namely, the generation of this trio of adenoviral vaccine vectors, all shown to generate effective cellular immune responses subsequent to host administration, provide for the ability to administer these vaccine candidates not only alone, but preferably as part of a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components). Therefore, a preferred aspect of the present invention are vaccine formulations and associated methods of administration and concomitant generation of host cellular immune responses associated with formulating three separate series of MRKAd5- based adenoviral vector vaccines. Of course, this MRKAd5 vaccine series based on distinct HIN antigens promotes expanded opportunities for formulation of a divalent or trivalent vaccine, or possibly administration of separate formulations of one or more monovalent or divalent formulations within a reasonable window of time. It is also within the scope of the present invention to embark on combined modality regimes which include multiple but distinct components from a specific antigen. An example, but certainly not a limitation, would be separate MRKAd5pol vectors, with one vaccine vector expressing wild type Pol (SEQ ID ΝO:2) and another MRKAd5pol vector expressing inactivated Pol (SEQ ID NO:6). Another example might be separate MRKAd5nef vectors, with one vaccine vector expressing the tPA/LLAA version of Nef (SEQ ID NO: 16) and another MRKAd5nef vector expressing the G2A,LLAA modified version of Nef (SEQ ID NO: 14). Therefore, the MRKAd5 adenoviral vectors of the present invention may be used in combination with multiple, distinct HTV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
The present invention also relates to application of a mono-, dual-, or tri- modality administration regime of the MRKAd5gag, pol and nef adenoviral vaccine series in a prime/boost vaccination schedule. This prime/boost schedule may include any reasonable combination of the MRKAd5gag, pol and nef adenoviral vaccine series disclosed herein. In addition, a prime/boost regime may also involve other viral and/or non- viral DNA vaccines. A preferable addition to an adenoviral vaccine vector regime includes but is not limited to plasmid DNA vaccines, especially DNA plasmid vaccines that contain at least one of the codon optimized gag, pol and nef constructions, as disclosed herein.
Therefore, one aspect of this invention is the administration of the adenoviral vector containing the optimized gag gene in a prime/boost regiment in conjunction with a plasmid DNA encoding gag. To distinguish this plasmid from the adenoviral- containing shuttle plasmids used in the construction of an adenovirus vector, this plasmid will be referred to as a "vaccine plasmid" or "DNA plasmid vaccine".
Preferred vaccine plasmids for use in this administration protocol are disclosed in pending U.S. patent application 09/017,981, filed February 3, 1998 and WO98/34640, published August 13, 1998, both of which are hereby incorporated by reference. Briefly, the preferred vaccine plasmid is designated VlJns-FLgag, which expresses the same codon-optimized gag gene as the adenoviral vectors of this invention (see Figure 2 for the nucleotide sequence of the exemplified optimized codon version of full length p55 gag). The vaccine plasmid backbone, designated VI Jns contains the CMV immediate-early (IE) promoter and intron A, a bovine growth hormone-derived polyadenylation and transcription termination sequence as the gene expression regulatory elements, and a minimal pUC backbone; see Montgomery et al, 1993, DNA Cell Biol. 12:777-783. The pUC sequence permits high levels of plasmid production in E. coli and has a neomycin resistance gene in place of an ampicillin resistance gene to provide selected growth in the presence of kanamycin. Alternatively, a vaccine plasmid which has the CMV promoter deleted of intron A can be used. Those of skill in the art will recognize that alternative vaccine plasmid vectors may be easily substituted for these specific constructs, and this invention specifically envisions use of such alternative plasmid DNA vaccine vectors.
Another aspect of the present invention is a prime/boost regimen which includes a vaccine plasmid which encodes an HIV pol antigen, preferably a codon optimized form of pol and also preferably a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ ID NOs: 2, 4, 6 and 8. The variety of potential DNA plasmid vaccines which encode various biologically active forms of HTV-1 Pol, wherein administration, intracellular delivery and expression of the HIN-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DΝA molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIN-1 Pol proteins. The HIN-1 pol open reading disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as delivered via a recombinant adenoviral vaccine, especially an enhanced first generation recombinant adenoviral vaccine as described herein. Several embodiments of this portion of the invention are provided in detail below, namely DΝA molecules which comprise a HIN-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human. Again, these DΝA sequences are positioned appropriately within a recombinant adenoviral vector, such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIN-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response. Again, these preferred, but in no way limiting, pol genes are as disclosed herein and essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference.
A third series of vaccine plasmids which are useful in a combined modality and/or prime/boost regimen are vaccine plasmids which encode an HIN nef antigen or biologically and/or immunologically relevant modification thereof. As noted elsewhere, preferred vaccine plasmids contain a codon optimized form of nef and also preferably comprise a nucleotide sequence which encodes a Νef antigen selected from the group of Νef antigens as shown in SEQ ID ΝOs: 10, 12, 14 and 16. These preferred nef coding regions are disclosed herein, as well as being described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US 00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.
Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly is pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.
Furthermore and in the alternative, multiple HIN-1 viral antigens, such as the MRKAd5 adenoviral vaccines disclosed herein, may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possible a "2+1" divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES), as disclosed in International Publication No. WO 95/24485, which is hereby incorporated by reference. Figure 9 shows that the use of multiple promoters and termination sequences provide for similar growth properties, while Figure 28 shows that these MRKAd5 gag-based vectors are also stable at least through passage 21. In the absence of the use of IRES-based technology, it is preferred that a distinct promoter be used to support each respective open reading frame, so as to best preserve vector stability. As examples, and certainly not as limitations, potential multiple transgene vaccines may include a three transgene vector such as hCMN-gagpol-bGHpA + mCMV-nef-SPA in an E3 deleted backbone or hCMV-gagpol-bGHpA + mCMV-nef-SPA(E3+). Potential "2+1" divalent vaccines of the present invention might be a hCMV-gag- bGHpA + mCMV-nef-SPA in an E3+ backbone (vector #1) in combination with hCMN-pol-bGHpA in an E3+ backbone (vector #2), with all transgenes in the El parallel orientation. Fusion constructs other than the gag-pol fusion described above are also suitable for use in various divalent vaccine strategies and can be composed of any two HIN antigens fused to one another (e.g.,, nef-pol and gag-nef). These adenoviral compositions are, as above, preferably delivered along with an adenoviral composition comprising an additional HIV antigen in order to diversify the immune response generated upon administration. Therefore, a multivalent vaccine delivered in a single, or possible second, adenoviral vector is certainly contemplated as part of the present invention. Again, this mode of administration is another example of whereby an efficaceous adeno virus-based HIV-1 vaccine may be administered via a combined modality regime. It is important to note, however, that in terms of deciding on an insert for the disclosed adenoviral vectors, due consideration must be dedicated to the effective packaging limitations of the adenovirus vehicle. Adenovirus has been shown to exhibit an upper cloning capacity limit of approximately 105% of the wildtype Ad5 sequence. Regardless of the gene chosen for expression, it is preferred that the sequence be "optimized" for expression in a human cellular environment. A "triplet" codon of four possible nucleotide bases can exist in 64 variant forms. That these forms provide the message for only 20 different amino acids (as well as transcription initiation and termination) means that some amino acids can be coded for by more than one codon. Indeed, some amino acids have as many as six "redundant", alternative codons while some others have a single, required codon. For reasons not completely understood, alternative codons are not at all uniformly present in the endogenous DΝA of differing types of cells and there appears to exist variable natural hierarchy or "preference" for certain codons in certain types of cells. As one example, the amino acid leucine is specified by any of six DΝA codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mRΝA codons, CUA, CUC, CUG, CUU, UUA and UUG). Exhaustive analysis of genome codon frequencies for microorganisms has revealed endogenous DΝA of E. coli most commonly contains the CTG leucine-specifying codon, while the DΝA of yeasts and slime molds most commonly includes a TTA leucine-specifying codon. In view of this hierarchy, it is generally held that the likelihood of obtaining high levels of expression of a leucine- rich polypeptide by an E. coli host will depend to some extent on the frequency of codon use. For example, a gene rich in TTA codons will in all probability be poorly expressed in E. coli, whereas a CTG rich gene will probably highly express the polypeptide. Similarly, when yeast cells are the projected transformation host cells for expression of a leucine-rich polypeptide, a preferred codon for use in an inserted DNA would be TTA.
The implications of codon preference phenomena on recombinant DNA techniques are manifest, and the phenomenon may serve to explain many prior failures to achieve high expression levels of exogenous genes in successfully transformed host organisms—a less "preferred" codon may be repeatedly present in the inserted gene and the host cell machinery for expression may not operate as efficiently. This phenomenon suggests that synthetic genes which have been designed to include a projected host cell's preferred codons provide a preferred form of foreign genetic material for practice of recombinant DNA techniques. Thus, one aspect of this invention is an adenovirus vector or adenovirus vector in some combination with a vaccine plasmid where both specifically include a gene which is codon optimized for expression in a human cellular environment. As noted herein, a preferred gene for use in the instant invention is a codon-optimized HTV gene and, particularly, HTV gag, pol or nef. Adenoviral vectors in accordance with the instant invention can be constructed using known techniques, such as those reviewed in Hitt et al, 1997 "Human Adenovirus Vectors for Gene Transfer into Mammalian Cells" Advances in Pharmacology 40: 137-206, which is hereby incorporated by reference.
In constructing the adenoviral vectors of this invention, it is often convenient to insert them into a plasmid or shuttle vector. These techniques are known and described in Hitt et al., supra. This invention specifically includes both the adenovirus and the adenovirus when inserted into a shuttle plasmid.
Preferred shuttle vectors contain an adenoviral portion and a plasmid portion. The adenoviral portion is essentially the same as the adenovirus vector discussed supra, containing adenoviral sequences (with non-functional or deleted Εl and Ε3 regions) and the gene expression cassette, flanked by convenient restriction sites. The plasmid portion of the shuttle vector often contains an antibiotic resistance marker under transcriptional control of a prokaryotic promoter so that expression of the antibiotic does not occur in eukaryotic cells. Ampicillin resistance genes, neomycin resistance genes and other pharmaceutically acceptable antibiotic resistance markers may be used. To aid in the high level production of the polynucleotide by fermentation in prokaryotic organisms, it is advantageous for the shuttle vector to contain a prokaryotic origin of replication and be of high copy number. A number of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences. It is also desirable that the vectors not be able to replicate in eukaryotic cells. This minimizes the risk of integration of polynucleotide vaccine sequences into the recipients' genome. Tissue-specific promoters or enhancers may be used whenever it is desirable to limit expression of the polynucleotide to a particular tissue type.
In one embodiment of this invention, the pre-plasmids (e.g., pMRKAd5pol, pMRKAd5nef and pMRKAd5gag were generated by homologous recombination using the MRKHVE3 (and MRKHVO for the E3- version) backbones and the appropriate shuttle vector, as shown for pMRKAd5pol in Figure 22 and for pMRKAd5nef in Figure 23. The plasmid in linear form is capable of replication after entering the PER.C6® cells and virus is produced. The infected cells and media were harvested after viral replication was complete.
Viral vectors can be propagated in various El complementing cell lines, including the known cell lines 293 and PER.C6®. Both these cell lines express the adenoviral El gene product. PER.C6® is described in WO 97/00326 (published January 3, 1997) and issued U.S. Patent No. 6,033,908, both of which are hereby incorporated by reference. It is a primary human retinoblast cell line transduced with an El gene segment that complements the production of replication deficient (FG) adenovirus, but is designed to prevent generation of replication competent adenovirus by homologous recombination. Cells of particular interest have been stably transformed with a transgene that encodes the AD5E1 A and E1B gene, like PER.C6®, from 459 bp to 3510 bp inclusive. 293 cells are described in Graham et al., 1977 J. Gen. Virol 36:59-72, which is hereby incorporated by reference. As stated above, consideration must be given to the adenoviral sequences present in the complementing cell line used. It is important that the sequences not overlap with that present in the vector if the possibility of recombination is to be minimized. It has been found that vectors generated in accordance with the above description are more effective in inducing an immune response and, thus, constitute very promising vaccine candidates. More particularly, it has been found that first generation adenoviral vectors in accordance with the above description carrying a codon-optimized HTV gag gene, regulated with a strong heterologous promoter can be used as human anti-HTV vaccines, and are capable of inducing immune responses. Standard techniques of molecular biology for preparing and purifying DNA constructs enable the preparation of the DNA immunogens of this invention.
A vaccine composition comprising an adenoviral vector in accordance with the instant invention may contain physiologically acceptable components, such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate. One preferred formulation has: 2.5-10 mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaCl, preferably about 75 mM NaCl; 2.5-10% sucrose, preferably about 5% sucrose; 0.01 -2 mM MgCl2; and 0.001%-0.01% polysorbate 80 (plant derived). The pH should range from about 7.0-9.0, preferably about 8.0. One skilled in the art will appreciate that other conventional vaccine excipients may also be used it make the formulation. The preferred formulation contains 5mM TRIS, 75 mM NaCl, 5% sucrose, lmM MgCl2, 0.005% polysorbate 80 at pH 8.0 This has a pH and divalent cation composition which is near the optimum for Ad5 stability and minimizes the potential for adsorption of virus to a glass surface. It does not cause tissue irritation upon intramuscular injection. It is preferably frozen until use.
The amount of adenoviral particles in the vaccine composition to be introduced into a vaccine recipient will depend on the strength of the transcriptional and translational promoters used and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of lxlO7 to lxlO12 particles and preferably about lxlO10 to lxlO11 particles is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided. Following vaccination with HTV adenoviral vector, boosting with a subsequent HTV adenoviral vector and/or plasmid may be desirable. Parenteral administration, such as intravenous, intramuscular, subcutaneous or other means of administration of interleukin-12 protein, concurrently with or subsequent to parenteral introduction of the vaccine compositions of this invention is also advantageous.
The adenoviral vector and/or vaccine plasmids of this invention polynucleotide may be unassociated with any proteins, adjuvants or other agents which impact on the recipients' immune system. In this case, it is desirable for the vector to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the vector may be associated with an adjuvant known in the art to boost immune responses (i.e., a "biologically effective" adjuvant), such as a protein or other carrier. Vaccine plasmids of this invention may, for instance, be delivered in saline (e.g., PBS) with or without an adjuvant. Preferred adjuvants are Alum or CRL1005 Block Copolymer. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, may also be used to advantage. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable carriers. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention.
This invention also includes a prime and boost regimen wherein a first adenoviral vector is administered, then a booster dose is given. The booster dose may be repeated at selected time intervals. Alternatively, a preferred inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype. More preferably, the inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype, wherein the first and second adenovirus serotypes are classified within separate subgroups of adenoviruses. The above prime/boost schemes are particularly preferred in those situations where a preexisting immunity is identified to the adenoviral vector of choice. In this type of scheme, the individual or population of individuals is primed with an adenovirus of a serotype other than that to which the preexisting immunity is identified. This enables the first adenovirus to effectuate sufficient expression of the transgene while evading existing immunity to the second adenovirus (the boosting adenovirus) and, further, allows for the subsequent delivery of the transgene via the boosting adenovirus to be more effective. Adenovirus serotype 5 is one example of a virus to which such a scheme might be desirable. In accordance with this invention, therefore, one might decide to prime with a non-group C adenovirus (e.g., Adl2, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus) to evade anti-Ad5 immunity and then boost with Ad5, a group C adenovirus. Another preferred embodiment involves administration of a different adenovirus (including non-human adenovirus) vaccine followed by administration of the adenoviral vaccines disclosed. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and Venezuelan equine encephilitis virus.
A large body of human and animal data supports the importance of cellular immune responses, especially CTL in controlling (or eliminating) HIV infection. In humans, very high levels of CTL develop following primary infection and correlate with the control of viremia. Several small groups of individuals have been described who are repeatedly exposed to HIV by remain uninfected; CTL has been noted in several of these cohorts. In the SIV model of HTV infection, CTL similarly develops following primary infection, and it has been demonstrated that addition of anti-CD8 monoclonal antibody abrogated this control of infection and leads to disease progression. This invention uses adenoviral vaccines alone or in combination with plasmid vaccines to induce CTL.
The following non-limiting Examples are presented to better illustrate the invention.
EXAMPLE 1 Removal of the Intron A Portion of the hCMV Promoter GMP grade pNIJnsHINgag was used as the starting material to amplify the hCMN promoter. PNHnsHTVgag is a plasmid comprising the CMN immediate-early (IE) promoter and intron A, a full-length codon-optimized HIN gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone; see Montgomery et al, supra for a description of the plasmid backbone. The amplification was performed with primers suitably positioned to flank the hCMN promoter. A 5' primer was placed upstream of the Mscl site of the hCMN promoter and a 3' primer (designed to contain the BgHL recognition sequence) was placed 3' of the hCMN promoter. The resulting PCR product (using high fidelity Taq polymerase) which encompassed the entire hCMN promoter (minus intron A) was cloned into TOPO PCR blunt vector and then removed by double digestion with Mscl and BgZII. This fragment was then cloned back into the original GMP grade pVl JnsHTVgag plasmid from which the original promoter, intron A, and the gag gene were removed following Mscl and BgHL digestion. This ligation reaction resulted in the construction of a hCMV promoter (minus intron A) + bGHpA expression cassette within the original pVlJnsHTVgag vector backbone. This vector is designated pNIJnsCMN(no intron). The FLgag gene was excised from pNlJnsHTVgag using BgHL digestion and the 1,526 bp gene was gel purified and cloned into pNUnsCMN(no intron) at the BglTL site. Colonies were screened using Sm l restriction enzymes to identify clones that carried the Flgag gene in the correct orientation. This plasmid, designated pNl JnsCMN(no intron)-FLgag-bGHpA, was fully sequenced to confirm sequence integrity. Two additional transgenes were also constructed. The plasmid, pVl JnsCMV(no intron)-FLgag-SPA, is identical to pNl JnsCMN(no intron)-FLgag- bGHpA except that the bovine growth hormone polyadenylation signal has been replaced with a short synthetic polyA signal (SPA) of 50 nucleotides in length. The sequence of the SPA is as shown, with the essential components (poly(A) site, (GT)n, and (T)n; respectively) underlined:
AATAAAAGATCTTTATTTTCATTAGATCTGTGTG TTGGTTTTTTGTGTG (SEQ ID NO: 18).
The plasmid, pNlJns-mCMV-FLgag-bGHpA, is identical to the pNUnsCMN(no intron)-FLgag-bGHpA except that the hCMN promoter has been removed and replaced with the murine CMV (mCMV) promoter.
Figure 3 diagrammatically shows the new transgene constructs in comparison with the original transgene.
EXAMPLE 2
Gag Expression Assay for Modified Gag Transgenes Gag Elisa was performed on culture supernatants obtained from transient tissue culture transfection experiments in which the two new hCMV-containing plasmid constructs, pVl JnsCMV(no intron)-FLgag-bGHpA and pVl JnsCMV(no intron)-FLgag-SPA, both devoid of intron A, were compared to pVl JnsHTVgag which, as noted above possesses the intron A as part of the hCMV promoter. Table 2 below shows the in vitro gag expression data of the new gag plasmids compared with the GMP grade original plasmid. The results displayed in Table 2 show that both of the new hCMV gag plasmid constructs have expression capacities comparable to the original plasmid construct which contains the intron A portion of the hCMV promoter.
aGMP grade pVlJns-hCMVintronA-FLgag-bGHpA. New plasmid constructions that have the intron A portion removed from the hCMV promoter. c In this construct the bGH terminator has been replaced with the short synthetic polyadenylation signal (SPA)
EXAMPLE 3
Rodent (Balb/c) Study for Modified gag Transgenes A rodent study was performed on the two new plasmid constructs described above - pVl JnsCMV(no intron)-FLgag-bGHpA and pVUnsCMV(no intron)-FLgag-SPA - in order to compare them with the construct described above possessing the intron A portion of the CMV promoter, pVl JnsHTVgag. Gag antibody and Elispot responses (described in PCT International Application No.
PCT/US00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S.
Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S.
Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference) were measured. The results displayed in Table
3 below, show that the new plasmid constructs behaved equivalently to the original construct in Balb/c mice with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested, 20 μg and 200 μg.
EXAMPLE 4
Table 3: HIV191 : Immunogenicity of V1 Jns-gag under different promoter and termination control elements.
ain PBS bi.m. Injections into both quads, 50 μl_ per quad cn=10;G T, geometric mean titer; SE, standard, error dn=5, pooled spleens; mean of triplicate wells and standard, deviation, in parentheses;
Construction of the Modified Shuttle Vector -"MRKpdelEl Shuttle" The modifications to the original Ad5 shuttle vector (pdelElsplA; a vector comprising Ad5 sequences from basepairs 1-341 and 3524-5798, with a multiple cloning region between nucleotides 341 and 3524 of Ad5, included the following three manipulations carried out in sequential cloning steps as follows:
(1) The left ITR region was extended to include the Pad site at the junction between the vector backbone and the adenovirus left ITR sequences. This allow for easier manipulations using the bacterial homologous recombination system. (2) The packaging region was extended to include sequences of the wild-type (WT) adenovirus from 342 bp to 450 bp inclusive.
(3) The area downstream of pIX was extended 13 nucleotides (i.e., nucleotides 3511-
3523 inclusive).
These modifications (Figure 4) effectively reduced the size of the El deletion without overlapping with any part of the E1A/E1B gene present in the transformed PER.C6 R cell line. All manipulations were performed by modifying the Ad shuttle vector pdelElsplA.
Once the modifications were made to the shuttle vector, the changes were incorporated into the original Ad5 adenovector backbones (pAdHVO and pAdHVE3) by bacterial homologous recombination using E. coli BJ5183 chemically competent cells. EXAMPLE 5 Construction of Modified Adenovector Backbones (E3+ andE3- The original adenovectors pAdHNO (comprising all Ad5 sequences except those nucleotides encompassing the El and E3 regions ) and pADHNE3 (comprising all Ad5 sequences except those nucleotides encompassing the El region), were each reconstructed so that they contained the modifications to the El region. This was accomplished by digesting the newly modified shuttle vector (MRKpdelEl shuttle) with Pad and BstZL 101 and isolating the 2,734 bp fragment which corresponds to the adenovirus sequence. This fragment was co-transformed with DΝA from either ClάL linearized pAdHVO (E3- adenovector) or Clal linearized pAdHNE3
(E3+adeno vector) into E. coli BJ5183 competent cells. At least two colonies from each transformation were selected and grown in Terrific™ broth for 6-8 hours until turbidity was reached. DΝA was extracted from each cell pellet and then transformed into E. coli XL1 competent cells. One colony from each transformation was selected and grown for plasmid DΝA purification. The plasmid was analyzed by restriction digestions to identify correct clones. The modified adenovectors were designated MRKpAdHVO (E3- plasmid) and MRKpAdHVE3 (E3+ plasmid). Virus from these new adenovectors (MRKHNO and MRKHVE3, respectively) as well as the old version of the adenovectors were generated in the PER.C6® cell lines to accommodate the following series of viral competition experiments. In addition, the multiple cloning site of the original shuttle vector contained Clal , BamHI, Xho I, EcoRV, Hindlll, Sal I, and Bgl II sites. This MCS was replaced with a new MCS containing Not I, Cla I, EcoRV and Asc I sites. This new MCS has been transferred to the MRKpAdHVO and MRKpAdHVE3 pre-plasmids along with the modification made to the packaging region and pIX gene.
EXAMPLE 6 Analysis of the Effect of the Packaging Signal Extension To study the effects of the modifications made to the El deletion region, the viruses obtained from the original backbone (pAdHVE3) and the new backbone (MRKpAdHNE3) were mixed together in equal MOI ratios (1:1 and 5:5) and passaged through several rounds; see Figure 5, Expt.#l. Both of the viruses in the experiment contained the E3 gene intact and did not contain a transgene. The only difference between the two viruses was within the region of the El deletion. Following the coinfection of the viruses at PI (passage 1), the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindLLL and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids (pAdHVE3 ("OLD E3+"); MRKpAdHNE3 ("NEW E3+")) were also digested with HindLΪL (and Pad to remove
33 the vector backbone) and subsequently labeled with [ PjdATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure 6 clearly shows that the new adenovirus which has the addition made to the packaging signal region has a growth advantage compared with the original adenovirus. In the experiments performed (at either ratio tested), only the digestion bands pertaining to the newly modified virus were present. The diagnostic band of size 3,206 (from the new virus) was clearly present. However, there was no evidence of the diagnostic band of size 2,737 bp expected from the original virus.
EXAMPLE 7
Analysis of the Effect of the E3 Gene The second set of the virus competition study involved mixing equal MOI ratio (1:1) of the newly modified viruses, that obtained from MRKpAdHVO and MRKpAdHVE3 (Figure 5, Expt. #2). In this set, both viruses had the new modifications made to the El deletion. The first virus (that from MRKpAdHVO) does not contain an E3 gene. The second virus (that from MRKpAdHVE3) does contain the E3 gene. Neither of the viruses contain a transgene. Following co- infection of the viruses, the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the total virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindLLL and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids MRKpAdHVO ("NEW E3-"); MRKpAdHVE3 ("NEW E3+") were also digested with HindLLL (and Rαcl to remove the vector backbone) and then labeled with [33p]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure 6 shows the results of the viral DNA analysis of the E3+ virus and E3- virus mixing experiment. The diagnostic band corresponding to the E3+ virus (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus. This indicates that the virus that contains the E3 gene is able to amplify more rapidly compared with the virus that does not contain an E3 gene. This increased amplification capacity has been confirmed by growth studies; see Table 4 below.
EXAMPLE 8 Construction of the new shuttle vector containing modified gag transgene -
"MRKpdelEl-CMN(no intron)-FLgag-bGHpA" The modified plasmid pVl JnsCMV(no intron)-FLgag-bGHpA was digested with Mscl overnight and then digested with Sfil for 2 hours at 50°C. The DΝA was then treated with Mungbean nuclease for 30 mins at 30°C. The DΝA mixture was desalted using the Qiaex II kit and then Klenow treated for 30 mins at 37°C to fully blunt the ends of the transgene fragment. The 2,559 bp transgene fragment was then gel purified. The modified shuttle vector (MRKpdelEl shuttle) was linearized by digestion with EcoRV, treated with calf intestinal phosphatase and the resulting 6,479 bp fragment was then gel purified. The two purified fragments were then ligated together and several dozen clones were screened to check for insertion of the transgene within the shuttle vector. Diagnostic restriction digestion was performed to identify those clones carrying the transgene in the El parallel and El anti-parallel orientation. This strategy was followed to clone in the other gag transgenes in the MRKpdelEl shuttle vector.
EXAMPLE 9 Construction of the MRK FG Adenovectors The shuttle vector containing the HIV-1 gag transgene in the El parallel orientation, MRKpdelEl -CMV(no intron)-FLgag-bGHpA, was digested with Pa . The reaction mixture was digested with BsfZlll. The 5,291 bp fragment was purified by gel extraction. The MRKpAdHNE3 plasmid was digested with Clal overnight at 37°C and gel purified. About 100 ng of the 5,290 bp shuttle +transgene fragment and -100 ng of linearized MRKpAdHNE3 DΝA were co-transformed into E. coli BJ5183 chemically competent cells. Several clones were selected and grown in 2 ml Terrific™ broth for 6-8 hours, until turbidity was reached. The total DΝA from the cell pellet was purified using Qiagen alkaline lysis and phenol chloroform method. The DΝA was precipitated with isopropanol and resuspended in 20 μl dH20. A 2 μl aliquot of this DΝA was transformed into E. coli XL-1 competent cells. A single colony from each separate transformation was selected and grown overnight in 3 ml LB +100 μg/ml ampicillin. The DΝA was isolated using Qiagen columns. A positive clone was identified by digestion with the restriction enzyme R-stEII which cleaves within the gag gene as well as the plasmid backbone. The pre-plasmid clone is designated MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA and is 37,498 bp in size. This strategy was followed to generate E3- and E3+ versions of each of the other gag transgene constructions in both El parallel and El anti-parallel versions. Figures 7A, 7B and 7C show the various combinations of adenovectors constructed.
EXAMPLE 10 Plasmid Competition Studies A series of plasmid competition studies was carried out. Briefly, the screening of the various combinations of new constructs was performed by mixing equal amounts of each of two competing plasmids. In the experiment shown in Figure 8A, plasmids containing the same transgene but in different orientations were mixed together to create a "competition" between the two plasmids. The aim was to look at the effects of transgene orientation. In the experiment shown in Figure 8B, plasmids containing different polyadenylation signals (but in the same orientation) were mixed together in equal amounts. The aim was to assess effects of polyA signals. Following the initial transfection, the virus was passaged through ten rounds and the viral DNA analyzed by radioactive restriction analysis.
Analysis of the viral species from the plasmid mixing experiment (Figure 8A) showed that adenovectors which had the transgene inserted in the El parallel orientation amplified better and were able to out-compete the adenovirus which had the transgene inserted in the El anti-parallel orientation. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the El parallel orientation compared with the El antiparallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the El parallel orientation for both transgenes tested (hCMV(no intron)- FLgag-bGHpA and hCMV(no intron)-FLgag-SPA).
Analysis of the viral species from the plasmid mixing experiment #2 (Figure 8B) at passages 3 and 6 showed that the polyadenylation signals tested (bGHpA and SPA) did not have an effect on the growth of the virus. Even at passage 10 the two viral species in the mixture were still present in equal amounts. EXAMPLE 11 Virus generation of an enhanced adenoviral construct - "MRK Ad5 HTV-1 gag" The results obtained from the competition study allowed us to make the following conclusions: (1) The packaging signal extension is beneficial; (2) Presence of E3 does enhance viral growth; (3) El parallel orientation is recommended; and (4) PolyA signals have no effect on the growth of the adenovirus.
MRK Ad5 HIV-1 gag exhibited the most desirable results. This construct contains the hCMV(no intron)-FLgag-bGHpA transgene inserted into the new E3+ adenovector backbone, MRKpAdHVE3, in the El parallel orientation. We have designated this adenovector MRK Ad5 HIV-1 gag. This construct was prepared as outlined below:
The pre-plasmid MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA was digested was Pad to release the vector backbone and 3.3 μg was transfected by calcium phosphate method (Amersham Pharmacia Biotech.) in a 6 cm dish containing PER.C6® cells at -60% confluence. Once CPE was reached (7-10 days), the culture was freeze/thawed three times and the cell debris pelleted. 1 ml of this cell lysate was used to infect into a 6 cm dish containing PER.C6® cells at 80-90% confluence. Once CPE was reached, the culture was freeze/thawed three times and the cell debris pelleted. The cell lysate was then used to infect a 15 cm dish containing PER.C6® cells at 80-90% confluence. This infection procedure was continued and expanded at passage 6. The virus was then extracted from the cell pellet by CsCl method. Two bandings were performed (3-gradient CsCl followed by a continuous CsCl gradient). Following the second banding, the virus was dialyzed in A105 buffer. Viral DNA was extracted using pronase treatment followed by phenol chloroform. The viral DNA was then digested with HindLLL and radioactively labeled with [33p]dATP. Following gel electrophoresis to separate the digestion products the gel was dried down on Whatman paper and then subjected to autoradiography. The digestion products were compared with the digestion products from the pre-plasmid (that had been digested with Pacl/HindlLL prior to labeling). The expected sizes were observed, indicating that the virus had been successfully rescued. This strategy was used to rescue virus from each of the various adenovector plasmid constructs prepared. EXAMPLE 12 Stability Analyses To determine whether the various adenovector constructs (e.g., MRK Ad5 HIN-1 gag) show genetic stability, the viruses were each passaged continually. The viral DΝA was analyzed at passages 3, 6 and 10. Each virus maintained its correct genetic structure. In addition, the stability of the MRK Ad5 HIV-1 gag was analyzed under propagation conditions similar to that performed in large scale production. For this analysis, the transfections of MRK Ad5 HIV-1 gag as well as three other adenoviral vectors were repeated and the virus was purified at P3. The three other adenovectors were as follows: (1) that comprising hCMV(no intron)-Flgag with a bGHpA terminator in an E3- adenovector backbone; (2) that comprising hCMV(no intron)-Flgag with a SPA termination signal in an E3+ adenovector backbone, and that comprising a mCMN-Flgag with a bGHpA terminator in an E3+ adenovector backbone. All of the vectors have the transgene inserted in the El parallel orientation. Viral DΝA was analyzed by radioactive restriction analysis to confirm that it was correct before being delivered to fermentation cell culture for continued passaging in serum-free media. At P5 each of the four viruses were purified and the viral DΝA extracted for analysis by the restriction digestion and radiolabeling procedure. This virus has subsequently been used in a series of studies (in vitro gag expression in COS cells, rodent study and rhesus monkey study) as will be described below. The viruses from P5 are shown in Figure 9.
The passaging under serum-free conditions was continued for the MRKHNΕ3 (transgene-less, obtained from MRKpAdHVE3 pre-plasmid) and the MRKAd5HTV-lgag (obtained from MRKpAdHVE3+CMV(no intron)-FLgag- bGHpA pre-plasmid) viruses. Figure 10 shows viral DΝA analysis by radioactive restriction digestion at passage 11 for MRKHNE3, MRKAd5HTV-lgagE3-, and passage 11 and 12 for MRKAd5HIV-lgag. Aside from the first lane which is the DΝA marker lane, the next three lanes are virus from the pre-plasmid controls (controls based on the original virus) - MRKpAdHVE3 (also referred to as "pMRKHVE3"), MRKpAdHNE3+CMV(no intron)-FLgag-bGHpA, and pMRKAd5gag(E3-), respectively. As seen in Figure 10, each of the viral DΝA samples show the expected bands with no extraneous bands showing. This signifies that there are no major variant adenovirus species present that can be detected by autoradiography. Figure 11 shows the results of viral competition study between MRKHNE3 and MRKAd5HIN-lgag. These viruses were mixed together at equal MOI (140 viral particles each; 280 vp total) at passage 6 and continued to be passaged until Pll. Aside from the first lane which is the DNA marker lane, the next two lanes are the pre-plasmid controls obtained from MRKpAdHVE3 and MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA. The next two lanes are the viral DNA from the starting viral material at passage six. The last two lanes are the competition studies performed in duplicate. The data in Figure 11 shows the effect the gag transgene in culture. Growth of a MRKAd5gag virus was compared with growth of a "transgene-less" MRKHVE3. These two viruses were infected at the same MOI (i.e. 140 vp each) at passage 6 and then passaged through to passage 11 and the viral pool was analyzed by radioactive restriction analysis. The data shows that one virus did not out compete the other. Therefore, the gag transgene did not show obvious signs of toxicity to the adenovirus.
Analysis by HindLLL digestion shows that each virus specie is present in approximately equal amounts. As above, there does not appear to be signs of any extraneous bands. Figure 12 shows higher passage numbers for MRKAd5HIV-lgag grown under serum-containing conditions. The genome integrity again has been maintained and there is no evidence of rearrangements, even at the highest passage level (P21).
Each of the four vectors shown in Figure 9 were analyzed for amplification capacity. Table 4 below shows the QPA analysis used in the estimation of viral amplification ratios at P4. The determination of the amplification ratio for the original HIV-1 gag construct is based on the clinical lot at P12. It has been shown that amplification rates increases with higher passage number for the original virus. The reason for this observation is due to the emergence of variants which exhibit increased growth rates compared to the intact adenovector. With continued passaging of the original Ad gag vector, the level of variants increases and hence amplification rates increase also.
The MRK Ad5 HIN-1 gag virus has also been continually passaged under process conditions (i.e., serum-free media). Viral DΝA extracted from passages 11 and 12 show no evidence of rearrangement. Table 4:
Amplification Ratios Based on AEX and QPA Analysis of
Virus Amplification from Passage 3 to Passage 4.
* This estimation is based on the clinical lot growth characteristics at Passage 12.
EXAMPLE 13 Analytical Evaluation of the enhanced Ad5 Constructs
To study the effects of the transgene and the E3 gene on virus amplification, the enhanced adenoviral vector, MRK Ad5 HTV-1 gag, along with its transgene-less version (MRKpAdHVE3) and its E3- version (MRK Ad5 HTV-1 gag E3-), was studied for several passages under serum-free conditions. Table 5A shows the amplification ratios determined for passages P3 to P8 for MRK Ad5 HTV-1 gag. Within a certain MOI range, it has been determined that the virus output is directly proportional to the virus input. Therefore, the greater the number of virus particles per cell at infection, the greater the virus amount produced. Viral amplification ratios, on the other hand, are inversely proportional to the virus input. The lower the virus input, the greater the amplification ratio.
Table 5B shows the amplification rates of the new E3+ vector backbone MRKpAdHNE3. It has a significantly lower rate of amplification compared with the gag transgene containing version. This may be contributed to the larger size MRK Ad5 HIN-1 gag since it contains the transgene. This inclusion of the transgene brings the size of the adenovirus closer to the size of a wild type Ad5 virus. It is well known that adenoviruses amplify best when they are at close to their wild type genomic size. Wild type Ad5 is 35,935 bp. The MRKpAdHNE3 is 32, 905 bp in length. The enhanced adenovector MRK Ad5 HIV-1 gag is 35,453bp (See Figure 14 for vector map; see also Figure 15A-X show the complete pre-adenoviral vector sequence, which includes an additional 2,021 bp of the vector backbone). Table 5C shows the amplification rates of the new E3- gag containing virus
MRK Ad5 HIV-1 gag E3-. Once again, this virus shows lower growth rate than the enhanced adenoviral vector. This may be attributed to the decreased sized of this virus (due to the E3 gene deletion) compared with wild type Ad5. The MRK Ad5 HIV-1 gag E3- virus is 32,810 bp in length. This can be compared with the wild type Ad5 which is 35,935 bp and MRK Ad5 HIV-1 gag which is 35,453 bp in length.
Table 5A: Amplification ratios determined by AEX and QPA for MRKAdSgag over several continuous passaging in serum free media. Following P5, two replicate samples were taken (rep- 1 and rep-2) and analyzed.
MRKAdSgag repl
Table 5B: Amplification ratios determined by AEX and QPA for MRKHVE3 over several continuous passaging in serum free media. MRKHVE3 is the new vector backbone which does NOT carry a transgene.
MRKHVE3
Table 5C. Amplification ratios determined by AEX and QPA for MRKAd5gag(E3-) over several continuous passaging in serum free media. This construct is identical to the MRKAdδgag construct except that this version is DELETED of the E3 gene.
MRKAd5gag(E3 )
EXAMPLE 14 Gag Expression Analysis of the Novel Constructs In vitro gag analysis of the MRK Ad5 HTV-1 gag and the original HTV-gag vectors (research and clinical lot) show comparable gag expression. The clinical lot shows only a slightly reduced gag expression level. The most noticeable difference is with the mCMV vector. This vector shows roughly 3 fold lower expression levels compared with the other vectors tested (which all contain hCMV promoters). The mCMV-FLgag with bGHpA assay was performed three times using different propagation and purification lots and it consistently exhibited weaker gag expression.
EXAMPLE 15 Evaluation of MRK Ad5 HIV-1 gag and Other gag-Containing Adenovectors in Balb/c Mice Cohorts of 10 balb/c mice were vaccinated intramuscularly with escalating doses of MRK Ad5 HIV-1 gag, and the research and clinical lots of original Ad5HTV-lgag. Serum samples were collected 3 weeks post dose 1 and analyzed by anti-p24 sandwich ELIS A. Anti-p24 titers in mice that received MRK Ad5 HIV-1 gag (107 and 109 vp(viral particle) doses) were comparable (Figure 13) to those of the research lot of Ad5HTV-l gag, for which much of the early rhesus data were generated on. These titers were also comparable when E3 is deleted (MRKAd5hCMNgagbGHpA(E3-)) or SPA is substituted for bGHpA terminator (MRKAd5 hCMN-gag-SPA (E3+)) or murine CMN promoter is used in place of hCMN (MRKAd5 mCMN-gag-bGHpA (E3+)) in the MRKAd5 backbone.
The results shown in Table 7 indicate that the three other vectors ( in addition to the preferred vector, MRK Ad5 HIV-1 gag, are also capable of inducing strong anti-gag antibody responses in mice. Interestingly enough, while the mCMV-FLgag construct containing bGHpA and E3+ in an El parallel orientation showed lowest gag expression in the COS cell in vitro infection (Table 6) in comparison with the other vectors tested, it generated the greatest anti-gag antibody response this in vivo Balb/c study. Table 7 also shows a dose response in anti-gag antibody production in both the research and the clinical lot. As expected, the clinical lot shows reduced anti-gag antibody induction at each dosage level compared to the same dosage used for the research lot.
Table 6: In vitro analysis for gag expression in COS cells by Elisa assay.
a A260nm absorbance readings taken for viral particle determinations. MRKAd5gag was produced in serum free conditions and purified at P5. c Clinical lot# Ad5gagFΝ0001 d Research Ad5FLgag lot# 6399 e mCMVFL-gagbGHpA was produced in serum free conditions and purified at P5. Table 7: mHIV020 Anti-p24 Ab Titers in Balb/c mice (n=10) vaccinated with various Adgag constructs and lots (3 week post dosel).
*2x50 μL i.m. (quad) injections/animal P.l.s: Youil, Chen, Casimiro Vaccination: T. Toner, Q. Su Assay: M. Chen aThe structure of MRKAdδgag is: hCMVFL-gagbGHpA [E3+] → The same lot of MRKAdδgag used in this rodent study was used in the Rhesus monkey study (Tables 7 and 8). The same lot of mCMVFL-gagbGHpA[E3 +] used in the in vitro study (Table 6) ws used here. cThis construct was designed by Volker Sandig. It contains a shorter version of the hCMV promoter than that used in the MRK constructs. The adenovector backbone is identical to the original backbone used in the original Adgag vector. Expression at 10e7 dose from this vector is 7 fold lower then the same dose of the MRKAdδgag and 4 fold lower than the research lot.
EXAMPLE 16 Comparison of Humoral and Cellular Responses Towards the Original Ad-gag Construct with the New MRK Ad5 HTV-1 gag in Rhesus Monkeys Cohorts of 3 rhesus monkeys were vaccinated intramuscularly with MRK Ad5
11 0
HIV-1 gag or the clinical Ad5gag bulk at two doses, 10 vp and 10 vp. Immunizations were conducted at week 0, 4, and 25. Serum and PBMC samples were collected at selected time points. The serum sample were assayed for anti-p24 Ab titers (using competitive based assay) and the PBMCs for antigen-specific IFN- gam a secretion following overnight stimulation with gag 20-mer peptide pool (via ELISpot assay).
The results shown in Table 8 indicate comparable responses with respect to the generation of anti-gag antibodies. The frequencies of gag-specific T cells in peripheral blood assummarized in Table 9 demonstrate a strong cellular immune response generated after a single dose with the new construct MRK Ad5 HTV-1 gag. The responses are also boostable with second dose of the same vector. The vector is also able to induce CD8+ T cell responses (as evident by remaining spot counts after CD4+ depletion of PBMCs) which are responsible for cytotoxic activity.
Table 8 Anti-p24 antibody titers (in mMU/mL) in rhesus macaques immunized with a -ex ressin adenovectors (Protocol HTV203).
Table 9. Number of gag-specific T cells per million peripheral blood mononuclear cells (PBMCs) in rhesus monkeys immunized with gag-expressing adenovectors. Also included are those frequencies in PBMCs depleted of CD4+ T cells.
Bcεedon either 4 10^ or 2xl0'δ c-ells per wall (cbpsndng on spot denslly)
ND, nσtcteterrrinecl tVπod or no petflcte oontr bPod of 20-ααpepticfes overtaxing by lO cπαidenconrpcεslnαttieααase-uencθ
The adenovectors described herein and, particularly, MRK Ad5 HIV-1 gag, represent very promising HIV-gag adenovectors with respect to their enhanced growth characteristics in both serum and, more importantly, in serum-free media conditions. In comparison with the current HIV-1 gag adenovector construct, MRK Ad5 HIV-1 gag shows a 5-10 fold increased amplification rate. We have shown that it is genetically stable at passage 21. This construct is able to generate significant cellular immune responses in vivo even at a relatively low dose of 10Λ9 vp. The potency of the MRKAd5gag construct is comparable to, if not better than the original HTV-1 gag vector as shown in this rhesus monkey study.
EXAMPLE 17 CODON OPTIMIZED HIV-1 POL AND CODON OPTIMZED HIV-1 POL MODIFICATIONS The open reading frames for the various synthetic pol genes disclosed herein comprise coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN). The protein sequence is based on that of Hxb2r, a clonal isolate of MB; this sequence has been shown to be closest to the consensus clade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico). The skilled artisan will understand after review of this specification that any available HIN-1 or HIV-2 strain provides a potential template for the generation of HIN pol DΝA vaccine constructs disclosed herein. It is further noted that the protease gene is excluded from the DΝA vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation. The design of the gene sequences for both wild- type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred ("humanized") codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12). As can be discerned by inspecting the codon usage in SEQ ID ΝOs: 1, 3, 5 and 7, the following codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Nal (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), He (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which, as noted elsewhere in this specification, is hereby incorporated by reference. It is intended that the skilled artisan may use alternative versions of codon optimization or may omit this step when generating HIN pol vaccine constructs within the scope of the present invention. Therefore, the present invention also relates to non-codon optimized versions of DΝA molecules and associated recombinant adenoviral HIV vaccines which encode the various wild type and modified forms of the HIV Pol protein disclosed herein. However, codon optimization of these constructs is a preferred embodiment of this invention.
A particular embodiment of this portion of the invention comprisies codon optimized nucleotide sequences which encode wt-pol DΝA constructs (herein, "wt- pol" or "wt-pol (codon optimized))" wherein DΝA sequences encoding the protease (PR) activity are deleted, leaving codon optimized "wild type" sequences which encode RT (reverse transcriptase and RΝase H activity) and IN integrase activity. A DNA molecule which encodes this protein is disclosed herein as SEQ TD NO:l, the open reading frame being contained from an initiating Met residue at nucleotides 10- 12 to a termination codon from nucleotides 2560-2562. SEQ ID NO.T is as follows: AGATCTACCA TGGCCCCCAT CTCCCCCATT GAGACTGTGC CTGTGAAGCT GAAGCCTGGC ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGATGTGGG GGATGCCTAC TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC TGCCCCAGGG CTGGAAGGGC TCCCCTGCCA TCTTCCAGTC CTCCATGACC AAGATCCTGG AGCCCTTCAG GAAGCAGAAC CCTGACATTG TGATCTACCA GTACATGGAT GACCTGTATG TGGGCTCTGA CCTGGAGATT GGGCAGCACA GGACCAAGAT TGAGGAGCTG AGGCAGCACC TGCTGAGGTG GGGCCTGACC ACCCCTGACA AGAAGCACCA GAAGGAGCCC CCCTTCCTGT GGATGGGCTA TGAGCTGCAC CCCGACAAGT GGACTGTGCA GCCCATTGTG CTGCCTGAGA AGGACTCCTG GACTGTGAAT GACATCCAGA AGCTGGTGGG CAAGCTGAAC TGGGCCTCCC AAATCTACCC TGGCATCAAG GTGAGGCAGC TGTGCAAGCT GCTGAGGGGC ACCAAGGCCC TGACTGAGGT GATCCCCCTG ACTGAGGAGG CTGAGCTGGA GCTGGCTGAG AACAGGGAGA TCCTGAAGGA GCCTGTGCAT GGGGTGTACT ATGACCCCTC CAAGGACCTG ATTGCTGAGA TCCAGAAGC GGGCCAGGGC CAGTGGACCT ACCAAATCTA CCAGGAGCCC TTCAAGAACC TGAAGACTGG CAAGTATGCC AGGATGAGGG GGGCCCACAC CAATGATGTG AAGCAGCTGA CTGAGGCTGT GCAGAAGATC ACCACTGAGT CCATTGTGAT CTGGGGCAAG ACCCCCAAGT TCAAGCTGCC CATCCAGAAG GAGACCTGGG AGACCTGGTG GACTGAGTAC TGGCAGGCCA CCTGGATCCC TGAGTGGGAG TTTGTGAACA CCCCCCCCCT GGTGAAGCTG TGGTACCAGC TGGAGAAGGA GCCCATTGTG GGGGCTGAGA CCTTCTATGT GGATGGGGCT GCCAACAGGG AGACCAAGCT GGGCAAGGCT GGCTATGTGA CCAACAGGGG CAGGCAGAAG GTGGTGACCC TGACTGACAC CACCAACCAG AAGACTGAGC TCCAGGCCAT CTACCTGGCC CTCCAGGACT CTGGCCTGGA GGTGAACATT GTGACTGACT CCCAGTATGC CCTGGGCATC ATCCAGGCCC AGCCTGATCA GTCTGAGTCT GAGCTGGTGA ACCAGATCAT TGAGCAGCTG ATCAAGAAGG AGAAGGTGTA CCTGGCCTGG GTGCCTGCCC ACAAGGGCAT TGGGGGCAAT GAGCAGGTGG ACAAGCTGGT GTCTGCTGGC ATCAGGAAGG TGCTGTTCCT GGATGGCATT GACAAGGCCC AGGATGAGCA TGAGAAGTAC CACTCCAACT GGAGGGCTAT GGCCTCTGAC TTCAACCTGC CCCCTGTGGT GGCTAAGGAG ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC TGCTCCCCTG GCATCTGGCA GCTGGACTGC ACCCACCTGG AGGGCAAGGT GATCCTGGTG GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT GACAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGA GTCCATGAAC AAGGAGCTGA AGAAGATCAT TGGGCAGGTG AGGGACCAGG CTGAGCACCT GAAGACAGCT GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG CAGATCACCA AGATCCAGAA CTTCAGGGTG TACTACAGGG ACTCCAGGAA CCCCCTGTGG AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG GAGGGGGCTG TGGTGATCCA GGACAACTCT GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT (SEQ ID NO:l) .
The open reading frame of the wild type pol construct disclosed as SEQ ID NO:l contains 850 amino acids, disclosed herein as SEQ ID NO:2, as follows:
Met Ala Pro lie Ser Pro lie Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys lie Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr He Pro Ser He Asn Asn Glu Thr Pro Gly He Arg Tyr Gin Tyr Asn Val Leu Pro Gin Gly Trp Lys Gly Ser Pro Ala He Phe Gin Ser Ser Met Thr Lys He Leu Glu Pro Phe Arg Lys Gin Asn Pro Asp He Val He Tyr Gin Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu He Gly Gin His Arg Thr Lys He Glu Glu Leu Arg Gin His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gin Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gin Pro He Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp He Gin Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gin He Tyr Pro Gly He Lys Val Arg Gin Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val He Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu He Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu He Ala Glu He Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin He Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys He Thr Thr Glu Ser He Val He Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro He Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp He Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro He Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr Glu Leu Gin Ala He Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn He Val Thr Asp Ser Gin Tyr Ala Leu Gly He He Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin He He Glu Gin Leu He Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly He Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly He Arg Lys Val Leu Phe Leu Asp Gly He Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu He Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly He Trp Gin Leu Asp Cys Thr His Leu Glu Gly Lys Val He Leu Val Ala Val His Val Ala Ser Gly Tyr He Glu Ala Glu Val He Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr He His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly He Lys Gin Glu Phe Gly He Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys He He Gly Gin Val Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe He His Asn Phe Lys Arg Lys Gly Gly He Gly Gly Tyr Ser Ala Gly Glu Arg He Val Asp He He Ala Thr Asp He Gin Thr Lys Glu Leu Gin Lys Gin He Thr Lys He Gin Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val He Gin Asp Asn Ser Asp He Lys Val Val Pro Arg Arg Lys Ala Lys He He Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO: 2) .
The present invention especially relates to an adenoviral vector vaccine which comprises a codon optimized HTV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIN-1 pol (RT-RH-IΝ) activity of the expressed protein. Therefore, the present invention preferably relates to an adenoviral HIN-1 DΝA pol-based vaccine wherein the construct is devoid of DΝA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RΝase and/or IN activity. One type of HIN-1 pol mutant which is part and parcel of an adenoviral vector vaccine may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIN-1 Pol. In a preferred embodiment of this portion of the invention, a HIN-1 DΝA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RΝase H and IN activity. An especially preferable HIN-1 DΝA pol construct in a DΝA molecule which contains at least one point mutation which alters the active site of the RT, RΝase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIN-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RΝase H and IN activity, respectfully. To this end, an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4, Figure 17A-C) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains. Therefore, an especially preferred exemplification is an adenoviral vaccine which comprises, in an appropriate fashion, a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1. An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol. Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.
Table 1 wt aa aa residue mutant aa enzyme function
Asp 112 Ala RT
Asp 187 Ala RT Asp 188 Ala RT
Asp 445 Ala RNase H
Glu 480 Ala RNase H
Asp 500 Ala RNase H
Asp 626 Ala IN Asp 678 Ala IN
Glu 714 Ala IN It is preferred that point mutations be incorporated into the IApol mutant adenoviral vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV-1 Pol.
To this end, SEQ ID NO: 3 discloses the nucleotide sequence which codes for a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as "IApol":
AGATCTACCA TGGCCCCCAT CTCCCCCATT GAGACTGTGC CTGTGAAGCT GAAGCCTGGC ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGCTGTGGG GGATGCCTAC TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC TGCCCCAGGG CTGGAAGGGC TCCCCTGCCA TCTTCCAGTC CTCCATGACC AAGATCCTGG AGCCCTTCAG GAAGCAGAAC CCTGACATTG TGATCTACCA GTACATGGCT GCCCTGTATG TGGGCTCTGA CCTGGAGATT GGGCAGCACA GGACCAAGAT TGAGGAGCTG AGGCAGCACC TGCTGAGGTG GGGCCTGACC ACCCCTGACA AGAAGCACCA GAAGGAGCCC CCCTTCCTGT GGATGGGCTA TGAGCTGCAC CCCGACAAGT GGACTGTGCA GCCCATTGTG CTGCCTGAGA AGGACTCCTG GACTGTGAAT GACATCCAGA AGCTGGTGGG CAAGCTGAAC TGGGCCTCCC AAATCTACCC TGGCATCAAG GTGAGGCAGC TGTGCAAGCT GCTGAGGGGC ACCAAGGCCC TGACTGAGGT GATCCCCCTG ACTGAGGAGG CTGAGCTGGA GCTGGCTGAG AACAGGGAGA TCCTGAAGGA GCCTGTGCAT GGGGTGTACT ATGACCCCTC CAAGGACCTG ATTGCTGAGA TCCAGAAGCA GGGCCAGGGC CAGTGGACCT ACCAAATCTA CCAGGAGCCC TTCAAGAACC TGAAGACTGG CAAGTATGCC AGGATGAGGG GGGCCCACAC CAATGATGTG AAGCAGCTGA CTGAGGCTGT GCAGAAGATC ACCACTGAGT CCATTGTGAT CTGGGGCAAG ACCCCCAAGT TCAAGCTGCC CATCCAGAAG GAGACCTGGG AGACCTGGTG GACTGAGTAC TGGCAGGCCA CCTGGATCCC TGAGTGGGAG TTTGTGAACA CCCCCCCCCT GGTGAAGCTG TGGTACCAGC TGGAGAAGGA GCCCATTGTG GGGGCTGAGA CCTTCTATGT GGCTGGGGCT GCCAACAGGG AGACCAAGCT GGGCAAGGCT GGCTATGTGA CCAACAGGGG CAGGCAGAAG GTGGTGACCC TGACTGACAC CACCAACCAG AAGACTGCCC TCCAGGCCAT CTACCTGGCC CTCCAGGACT CTGGCCTGGA GGTGAACATT GTGACTGCCT CCCAGTATGC CCTGGGCATC ATCCAGGCCC AGCCTGATCA GTCTGAGTCT GAGCTGGTGA ACCAGATCAT TGAGCAGCTG ATCAAGAAGG AGAAGGTGTA CCTGGCCTGG GTGCCTGCCC ACAAGGGCAT TGGGGGCAAT GAGCAGGTGG ACAAGCTGGT GTCTGCTGGC ATCAGGAAGG TGCTGTTCCT GGATGGCATT GACAAGGCCC AGGATGAGCA TGAGAAGTAC CACTCCAACT GGAGGGCTAT GGCCTCTGAC TTCAACCTGC CCCCTGTGGT GGCTAAGGAG ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC TGCTCCCCTG GCATCTGGCA GCTGGCCTGC ACCCACCTGG AGGGCAAGGT GATCCTGGTG GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT GCCAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGC CTCCATGAAC AAGGAGCTGA AGAAGATCAT TGGGCAGGTG AGGGACCAGG CTGAGCACCT GAAGACAGCT GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG CAGATCACCA AGATCCAGAA CTTCAGGGTG TACTACAGGG ACTCCAGGAA CCCCCTGTGG AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG GAGGGGGCTG TGGTGATCCA GGACAACTCT GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT (SEQ ID NO : 3 ) . In order to produce the IA-pol-based adenoviral vaccines of the present invention, inactivation of the enzymatic functions was achieved by replacing a total of nine active site residues from the enzyme subunits with alanine side-chains. As shown in Table 1, all residues that comprise the catalytic triad of the polymerase, namely Aspll2, Aspl87, and Aspl88, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989, Proc. Natl. Acad. Sci. 1989, 86: 4803-4807). Three additional mutations were introduced at Asp445, Glu480 and Asp500 to abolish RNase H activity (Asp551 was left unchanged in this IA Pol construct), with each residue being substituted for an Ala residue, respectively (Davies, et al., 1991, Science 252:, 88-95; Schatz, et al., 1989, FEBS Lett. 257: 311- 314; Mizrahi, et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353). HTV pol integrase function was abolished through three mutations at Asp626, Asp678 and Glu714. Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, 1. Virol. 69: 376-386; Leavitt, et al., 1993, 1. Biol. Chem. 268: 2113- 2119). Amino acid residue Pro3 of SEQ ID NO:4 marks the start of the RT gene. The complete amino acid sequence of IA-Pol is disclosed herein as SEQ ID NO:4 and Figure 17A-C, as follows:
Met Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr He Pro Ser He Asn Asn Glu Thr Pro Gly He Arg Tyr Gin Tyr Asn Val Leu Pro Gin Gly Trp Lys Gly Ser Pro Ala He Phe Gin Ser Ser Met Thr Lys He Leu Glu Pro Phe Arg Lys Gin Asn Pro Asp He Val He Tyr Gin Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu He Gly Gin His Arg Thr Lys He Glu Glu Leu Arg Gin His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gin Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gin Pro He Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp He Gin Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gin He Tyr Pro Gly He Lys Val Arg Gin Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val He Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu He Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu He Ala Glu He Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin He Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys He Thr Thr Glu Ser He Val He Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro He Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp He Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro He Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr Ala Leu Gin Ala He Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn He Val Thr Ala Ser Gin Tyr Ala Leu Gly He He Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin He He Glu Gin Leu He Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly He Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly He Arg Lys Val Leu Phe Leu Asp Gly He Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu He Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly He Trp Gin Leu Ala Cys Thr His Leu Glu Gly Lys Val He Leu Val Ala Val His Val Ala Ser Gly Tyr He Glu Ala Glu Val He Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr He His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly He Lys Gin Glu Phe Gly He Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys He He Gly Gin Val Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe He His Asn Phe Lys Arg Lys Gly Gly He Gly Gly Tyr Ser Ala Gly Glu Arg He Val Asp He He Ala Thr Asp He Gin Thr Lys Glu Leu Gin Lys Gin He Thr Lys He Gin Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val He Gin Asp Asn Ser Asp He Lys Val Val Pro Arg Arg Lys Ala Lys He He Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO : 4) .
As noted above, it will be understood that any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based adenoviral HIV vaccine of the present invention, either when administered alone or in a combined modality regime and/or a prime-boost regimen. For example, it may be possible to mutate only 2 of the 3 residues within the respective reverse transcriptase, RNase H, and integrase coding regions while still abolishing these enzymatic activities. However, the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4;) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.
Another aspect of this portion of the invention are codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy. However, a preferred embodiment of the present invention, as with HIV-1 Nef constructs shown herein, is to provide for a HIV-1 Pol mutant adenoviral vaccine construction wherein the pol coding region or a portion thereof is operatively linked to a leader peptide, preferably a leader peptide from human tPA. In other words, a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. As noted in Figure 16A-B, a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HTV-1 tP A/Pol protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Pol protein of interest, including but not limited to a HTV-1 Pol protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 17). Therefore, another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA. To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ ID NO: 6.
To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region ( herein, "tPA-wt-pol"). A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 5, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635. SEQ ID NO: 5 is as follows: GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA GCTGAAGCCT GGCATGGATG GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG GAGGAAGCTG GTGGACTTCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA GCTGGGGATG CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGATGT GGGGGATGCC TACTTCTCTG TGCCCCTGGA TGAGGACTTC AGGAAGTACA CTGCCTTCAC CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT CAGGAAGCAG AACCCTGACA TTGTGATCTA CCAGTACATG GATGACCTGT ATGTGGGCTC TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG GTGGGGCCTG ACCACCCCTG ACAAGAAGCA CCAGAAGGAG CCCCCCTTCC TGTGGATGGG CTATGAGCTG CACCCCGACA AGTGGACTGT GGAGCCCATT GTGCTGCCTG AGAAGGACTC CTGGACTGTG AATGACATCC AGAAGCTGGT GGGCAAGCTG AACTGGGCCT CCCAAATCTA CCCTGGCATC AAGGTGAGGC AGCTGTGCAA GCTGCTGAGG GGCACCAAGG CCCTGACTGA GGTGATCCCC CTGACTGAGG AGGCTGAGCT GGAGCTGGCT GAGAACAGGG AGATCCTGAA GGAGCCTGTG CATGGGGTGT ACTATGACCC CTCCAAGGAC CTGATTGCTG AGATCCAGAA GCAGGGCCAG GGCCAGTGGA CCTACCAAAT CTACCAGGAG CCCTTCAAGA ACCTGAAGAC TGGCAAGTAT GCCAGGATGA GGGGGGCCCA CACCAATGAT GTGAAGCAGC TGACTGAGGC TGTGCAGAAG ATCACCACTG AGTCCATTGT GATCTGGGGC AAGACCCCCA AGTTCAAGCT GCCCATCCAG AAGGAGACCT GGGAGACCTG GTGGACTGAG TACTGGCAGG CCACCTGGAT CCCTGAGTGG GAGTTTGTGA ACACCCCCCC CCTGGTGAAG CTGTGGTACC AGCTGGAGAA GGAGCCCATT GTGGGGGCTG AGACCTTCTA TGTGGATGGG GCTGCCAACA GGGAGACCAA GCTGGGCAAG GCTGGCTATG TGACCAACAG GGGCAGGCAG AAGGTGGTGA CCCTGACTGA CACCACCAAC CAGAAGACTG AGCTCCAGGC CATCTACCTG GCCCTCCAGG ACTCTGGCCT GGAGGTGAAC ATTGTGACTG ACTCCCAGTA TGCCCTGGGC ATCATCCAGG CCCAGCCTGA TCAGTCTGAG TCTGAGCTGG TGAACCAGAT CATTGAGCAG CTGATCAAGA AGGAGAAGGT GTACCTGGCC TGGGTGCCTG CCCACAAGGG CATTGGGGGC AATGAGCAGG TGGACAAGCT GGTGTCTGCT GGCATCAGGA AGGTGCTGTT CCTGGATGGC ATTGACAAGG CCCAGGATGA GCATGAGAAG TACCACTCCA ACTGGAGGGC TATGGCCTCT GACTTCAACC TGCCCCCTGT GGTGGCTAAG GAGATTGTGG CCTCCTGTGA CAAGTGCCAG CTGAAGGGGG AGGCCATGCA TGGGCAGGTG GACTGCTCCC CTGGCATCTG GCAGCTGGAC TGCACCCACC TGGAGGGCAA GGTGATCCTG GTGGCTGTGC ATGTGGCCTC CGGCTACATT GAGGCTGAGG TGATCCCTGC TGAGACAGGC CAGGAGACTG CCTACTTCCT GCTGAAGCTG GCTGGCAGGT GGCCTGTGAA GACCATCCAC ACTGACAATG GCTCCAACTT CACTGGGGCC ACAGTGAGGG CTGCCTGCTG GTGGGCTGGC ATCAAGCAGG AGTTTGGCAT CCCCTACAAC CCCCAGTCCC AGGGGGTGGT GGAGTCCATG AACAAGGAGC TGAAGAAGAT CATTGGGCAG GTGAGGGACC AGGCTGAGCA CCTGAAGACA GCTGTGCAGA TGGCTGTGTT CATCCACAAC TTCAAGAGGA AGGGGGGCAT CGGGGGCTAC TCCGCTGGGG AGAGGATTGT GGACATCATT GCCACAGACA TCCAGACCAA GGAGCTCCAG AAGCAGATCA CCAAGATCCA GAACTTCAGG GTGTACTACA GGGACTCCAG GAACCCCCTG TGGAAGGGCC CTGCCAAGCT GCTGTGGAAG GGGGAGGGGG CTGTGGTGAT CCAGGACAAC TCTGACATCA AGGTGGTGCC CAGGAGGAAG GCCAAGATCA TCAGGGACTA TGGCAAGCAG ATGGCTGGGG ATGACTGTGT GGCCTCCAGG CAGGATGAGG ACTAAAGCCC GGGCAGATCT ( SEQ ID NO : 5 ) .
The open reading frame of the wild type tPA-pol construct disclosed as SEQ ID NO:5 contains 875 amino acids, disclosed herein as SEQ ID NO:6, as follows:
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr He Pro Ser He Asn Asn Glu Thr Pro Gly He Arg Tyr Gin Tyr Asn Val Leu Pro Gin Gly Trp Lys Gly Ser Pro Ala He Phe Gin Ser Ser Met Thr Lys He Leu Glu Pro Phe Arg Lys Gin Asn Pro Asp He Val He Tyr Gin Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu He Gly Gin His Arg Thr Lys He Glu Glu Leu Arg Gin His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gin Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gin Pro He Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp He Gin Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gin He Tyr Pro Gly He Lys Val Arg Gin Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val He Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu He Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu He Ala Glu He Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin He Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys He Thr Thr Glu Ser He Val He Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro He Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp He Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro He Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr -Glu Leu Gin Ala He Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn He Val Thr Asp Ser Gin Tyr Ala Leu Gly He He Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin He He Glu Gin Leu He Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly He Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly He Arg Lys Val Leu Phe Leu Asp Gly He Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu He Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly He Trp Gin Leu Asp Cys Thr His Leu Glu Gly Lys Val He Leu Val Ala Val His Val Ala Ser Gly Tyr He Glu Ala Glu Val He Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr He His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly He Lys Gin Glu Phe Gly He Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys He He Gly Gin Val Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe He His Asn Phe Lys Arg Lys Gly Gly He Gly Gly Tyr Ser Ala Gly Glu Arg He Val Asp He He Ala Thr Asp He Gin Thr Lys Glu Leu Gin Lys Gin He Thr Lys He Gin Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val He Gin Asp Asn Ser Asp He Lys Val Val Pro Arg Arg Lys Ala Lys He He Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO : 6 ) .
The present invention also relates to a codon optimized HTV-1 Pol mutant contained within a recombinant adenoviral vector such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. Any such adenoviral-based HTV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence. Therefore, any such leader peptide-based HTV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HDN-l Pol. In a preferred embodiment of this portion of the invention, a leader peptide/HIN-1 DΝA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RΝase H and TΝ activity. An especially preferable HIV-1 DΝA pol construct is a DΝA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RΝase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HTV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in Figure 18. The complete amino acid sequence of the expressed protein is set forth in SEQ ID NO:8. To this end, SEQ ID NO:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, "tPA-opt-IApol"). The open reading frame begins with the initiating Met (nucleotides 8-10) and terminates with a "TAA" codon at nucleotides 2633-2635. The nucleotide sequence encoding tPA- IAPol is also disclosed as follows:
GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA GCTGAAGCCT GGCATGGATG GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG GAGGAAGCTG GTGGACTTCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA GCTGGGCATC CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGCTGT GGGGGATGCC TACTTCTCTG TGCCCCTGGA TGAGGACTTC AGGAAGTACA CTGCCTTCAC CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT CAGGAAGCAG AACCCTGACA TTGTGATCTA CCAGTACATG GCTGCCCTGT ATGTGGGCTC TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG GTGGGGCCTG ACCACCCCTG ACAAGAAGCA CCAGAAGGAG CCCCCCTTCC TGTGGATGGG CTATGAGCTG CACCCCGACA AGTGGACTGT GCAGCCCATT GTGCTGCCTG AGAAGGACTC CTGGACTGTG AATGACATCC AGAAGCTGGT GGGCAAGCTG AACTGGGCCT CCCAAATCTA CCCTGGCATC AAGGTGAGGC AGCTGTGCAA GCTGCTGAGG GGCACCAAGG CCCTGACTGA GGTGATCCCC CTGACTGAGG AGGCTGAGCT GGAGCTGGCT GAGAACAGGG AGATCCTGAA GGAGCCTGTG CATGGGGTGT ACTATGACCC CTCCAAGGAC CTGATTGCTG AGATCCAGAA
-GCAGGGCCAG GGCCAGTGGA CCTACCAAAT CTACCAGGAG CCCTTCAAGA ACCTGAAGAC
TGGCAAGTAT GCCAGGATGA GGGGGGCCCA CACCAATGAT GTGAAGCAGC TGACTGAGGC
TGTGCAGAAG ATCACCACTG AGTCCATTGT GATCTGGGGC AAGACCCCCA AGTTCAAGCT
GCCCATCCAG AAGGAGACCT GGGAGACCTG GTGGACTGAG TACTGGCAGG CCACCTGGAT CCCTGAGTGG GAGTTTGTGA ACACCCCCCC CCTGGTGAAG CTGTGGTACC AGCTGGAGAA GGAGCCCATT GTGGGGGCTG AGACCTTCTA TGTGGCTGGG GCTGCCAACA GGGAGACCAA GCTGGGCAAG GCTGGCTATG TGACCAACAG GGGCAGGCAG AAGGTGGTGA CCCTGACTGA CACCACCAAC CAGAAGACTG CCCTCCAGGC CATCTACCTG GCCCTCCAGG ACTCTGGCCT GGAGGTGAAC ATTGTGACTG CCTCCCAGTA TGCCCTGGGC ATCATCCAGG CCCAGCCTGA TCAGTCTGAG TCTGAGCTGG TGAACCAGAT CATTGAGCAG CTGATCAAGA AGGAGAAGGT GTACCTGGCC TGGGTGCCTG CCCACAAGGG CATTGGGGGC AATGAGCAGG TGGACAAGCT GGTGTCTGCT GGCATCAGGA AGGTGCTGTT CCTGGATGGC ATTGACAAGG CCCAGGATGA GCATGAGAAG TACCACTCCA ACTGGAGGGC TATGGCCTCT GACTTCAACC TGCCCCCTGT GGTGGCTAAG GAGATTGTGG CCTCCTGTGA CAAGTGCCAG CTGAAGGGGG AGGCCATGCA TGGGCAGGTG GACTGCTCCC CTGGCATCTG GCAGCTGGCC TGCACCCACC TGGAGGGCAA GGTGATCCTG GTGGCTGTGC ATGTGGCCTC CGGCTACATT GAGGCTGAGG TGATCCCTGC TGAGACAGGC CAGGAGACTG CCTACTTCCT GCTGAAGCTG GCTGGCAGGT GGCCTGTGAA GACCATCCAC ACTGCCAATG GCTCCAACTT CACTGGGGCC ACAGTGAGGG CTGCCTGCTG GTGGGCTGGC ATCAAGCAGG AGTTTGGCAT CCCCTACAAC CCCCAGTCCC AGGGGGTGGT GGCCTCCATG AACAAGGAGC TGAAGAAGAT CATTGGGCAG GTGAGGGACC AGGCTGAGCA CCTGAAGACA GCTGTGCAGA TGGCTGTGTT CATCCAGAAG TTCAAGAGGA AGGGGGGCAT CGGGGGCTAC TCCGCTGGGG AGAGGATTGT GGACATCATT GCCACAGACA TCCAGACCAA GGAGCTCCAG AAGCAGATCA CCAAGATCCA GAACTTCAGG GTGTACTACA GGGACTCCAG GAACCCCCTG TGGAAGGGCC CTGCCAAGCT GCTGTGGAAG GGGGAGGGGG CTGTGGTGAT CCAGGACAAC TCTGACATCA AGGTGGTGCC CAGGAGGAAG GCCAAGATCA TCAGGGACTA TGGCAAGCAG ATGGCTGGGG ATGACTGTGT GGCCTCCAGG CAGGATGAGG ACTAAAGCCC GGGCAGATCT (SEQ ID NO: 7 ) .
The open reading frame ofthe tPA-IA-pol construct disclosed as SEQ ID NO:7 contains 875 amino acids, disclosed herein as tPA-IA-Pol and SEQ ID NO:8, as follows: Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ala Pro He Ser Pro He Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gin Trp Pro Leu Thr Glu Glu Lys He Lys Ala Leu Val Glu He Cys Thr Glu Met Glu Lys Glu Gly Lys He Ser Lys He Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala He Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gin Asp Phe Trp Glu Val Gin Leu Gly He Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr He Pro Ser He Asn Asn Glu Thr Pro Gly He Arg Tyr Gin Tyr Asn Val Leu Pro Gin Gly Trp Lys Gly Ser Pro Ala He Phe Gin Ser Ser Met Thr Lys He Leu Glu Pro Phe Arg Lys Gin Asn Pro Asp He Val He Tyr Gin Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu He Gly Gin His Arg Thr Lys He Glu Glu Leu Arg Gin His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gin Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gin Pro He Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp He Gin Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gin He Tyr Pro Gly He Lys Val Arg Gin Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val He Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu He Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu He Ala Glu He Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin He Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys He Thr Thr Glu Ser He Val He Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro He Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp He Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro He Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr Ala Leu Gin Ala He Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn He Val Thr Ala Ser Gin Tyr Ala Leu Gly He He Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin He He Glu Gin Leu He Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly He Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly He Arg Lys Val Leu Phe Leu Asp Gly He Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu He Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly He Trp Gin Leu Ala Cys Thr His Leu Glu Gly Lys Val He Leu Val Ala Val His Val Ala Ser Gly Tyr He Glu Ala Glu Val He Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr He His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly He Lys Gin Glu Phe Gly He Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys He He Gly Gin Val Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe He His Asn Phe Lys Arg Lys Gly Gly He Gly Gly Tyr Ser Ala Gly
Glu Arg He Val Asp He He Ala Thr Asp He Gin Thr Lys Glu Leu
Gin Lys Gin He Thr Lys He Gin Asn Phe Arg Val Tyr Tyr Arg Asp
Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val He Gin Asp Asn Ser Asp He Lys Val Val Pro
Arg Arg Lys Ala Lys He He Arg Asp Tyr Gly Lys Gin Met Ala Gly
Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO: 8) .
EXAMPLE 18 CODON OPTIMIZED HIV- 1 NEF AND CODON OPTIMIZED
HIV-1 NEF MODIFICATIONS Codon optimized version of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US 00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference. As disclosed within the above-mentioned documents, particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO: 10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH2-terminus of the HIV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 11, while the expressed open reading frame is disclosed herein as SEQ ID NO: 12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 13, while the expressed open reading frame is disclosed herein as SEQ ID NO: 14. An additional embodiment relates to a DNA molecule encoding optimized HTV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO: 16. As disclosed in the above-identified documents (U.S. Application Serial No.
09/738,782 and PCT International Application PCT/US00/34162) and reiterated herein, the following nef-based nucleotide and amino acid sequences which comprise the respective open reading frame are as follows:
1. The nucleotide sequence of the codon optimized version of HTV-1 jrfl nef gene is disclosed herein as SEQ ID NO:9, as shown herein:
GATCTGCCAC CATGGGCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC CTGCTGCACC CCATGTCCCA GCACGGCATC GAGGACCCCG AGAAGGAGGT GCTGGAGTGG AGGTTCGACT CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AGCTGCACCC CGAGTACTAC AAGGACTGCT AAAGCCCGGG C (SEQ ID NO : 9 ) .
Preferred codon usage is as follows: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Lie (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAG). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which is hereby incorporated by reference. See also Figure 19A-B for a comparion of wild type vs. codon optimized nucleotides comprising the open reading frame of HIV-Nef. The open reading frame for SEQ ID NO: 9 above comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662. The open reading frame of SEQ ID NO:9 provides for a 216 amino acid HIN-1 Νef protein expressed through utilization of a codon optimized DΝA vaccine vector. The 216 amino acid HTV-1 Νef (jfrl) protein is disclosed herein as SEQ ID NO: 10, and as follows:
Met Gly Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg
Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu
Lys His Gly Ala He Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp
Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp
Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu He His
Ser Gin Lys Arg Gin Asp He Leu Asp Leu Trp Val Tyr His Thr Gin
Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly He Arg
Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His
Pro Met Ser Gin His Gly He Glu Asp Pro Glu Lys Glu Val Leu Glu
Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu
His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID NO : 10 ) .
HIN-1 Nef is a 216 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2
(Franchini et al., 1986, Virology 155: 593-599). While not all possible Nef functions have been elucidated, it has become clear that correct trafficking of Nef to the inner plasma membrane promotes viral replication by altering the host intracellular environment to facilitate the early phase of the HIN-1 life cycle and by increasing the infectivity of progeny viral particles. In one aspect of the invention regarding codon-optimized, protein-modified polypeptides, the nef -encoding region of the adenovirus vector of the present invention is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide. The diversity of function that typifies eukaryotic cells depends upon the structural differentiation of their membrane boundaries. To generate and maintain these structures, proteins must be transported from their site of synthesis in the endoplasmic reticulum to predetermined destinations throughout the cell. This requires that the trafficking proteins display sorting signals that are recognized by the molecular machinery responsible for route selection located at the access points to the main trafficking pathways. Sorting decisions for most proteins need to be made only once as they traverse their biosynthetic pathways since their final destination, the cellular location at which they perform their function, becomes their permanent residence. Maintenance of intracellular integrity depends in part on the selective sorting and accurate transport of proteins to their correct destinations. Defined sequence motifs exist in proteins which can act as 'address labels'. A number of sorting signals have been found associated with the cytoplasmic domains of membrane proteins. An effective induction of CTL responses often required sustained, high level endogenous expression of an antigen. As membrane-association via myristylation is an essential requirement for most of Nef s function, mutants lacking myristylation, by glycine-to- alanine change, change of the dileucine motif and/or by substitution with a tpa leader sequence as described herein, will be functionally defective, and therefore will have improved safety profile compared to wild-type Nef for use as an HIN-1 vaccine component.
In another embodiment of this portion of the invention, either the DΝA vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific plasminogen activator (tPA) leader. As shown in Figure 16A-B, a DΝA vector may be modified by known recombinant DΝA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Νef protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DΝA vector housing the open reading frame for the Νef protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HTV-1 Νef protein of interest, including but not limited to a HTV-1 Νef protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 17).
It has been shown that myristylation of Gly-2 in conjunction with a dileucine motif in the carboxy region of the protein is essential for Nef-induced down regulation of CD4 (Aiken et al., 1994, Cell 76: 853-864) via endocytosis. It has also been shown that Nef expression promotes down regulation of MHCI (Schwartz et al., 1996, Nature Medicine 2(3): 338-342) via endocytosis. The present invention relates in part to DNA vaccines which encode modified Nef proteins altered in trafficking and/or functional properties. The modifications introduced into the adenoviral vector HIV vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell. Therefore, a central theme of the DNA molecules and recombinant adenoviral HIV vaccines of the present invention is (1) host administration and intracellular delivery of a codon optimized nef-based adenoviral HIV vaccine; (2) expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, (3) inhibiting or at least altering known early viral functions of Nef which have been shown to promote HTV-1 replication and load within an infected host. Therefore, the nef coding region may be altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues. Also, the nef coding region may be altered so as to result in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues. In addition, the adenoviral vector HTV vaccines of the present invention also relate to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, specific Nef-based constructs further include the following, as exemplification's and not limitations. For example, the present invention relates to an adenoviral vector vaccine which encodes modified forms of HIV-1, an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to amino acid residue 6-216 of HTV-1 Nef (jfrl) is referred to herein as opt tpanef. The nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ ID NO: 11, as shown below:
CATGGATGCA ATGAAGAGAG GGCTCTGCTG TGTGCTGCTG CTGTGTGGAG CAGTCTTCGT TTCGCCCAGC GAGATCTCCT CCAAGAGGTC CGTGCCCGGC TGGTCCACCG TGAGGGAGAG GATGAGGAGG GCCGAGCCCG CCGCCGACAG GGTGAGGAGG ACCGAGCCCG CCGCCGTGGG CGTGGGCGCC GTGTCCAGGG AGCTGGAGAA GCACGGCGCC ATCACCTCCT CCAACACCGC CGCCACCAAC GCCGACTGCG CCTGGCTGGA GGCCCAGGAG GACGAGGAGG TGGGCTTCCC CGTGAGGCCC CAGGTGCCCC TGAGGCCCAT GACCTACAAG GGCGCCGTGG ACCTGTCCCA CTTCCTGAAG GAGAAGGGCG GCCTGGAGGG CCTGATCCAC TCCCAGAAGA GGCAGGACAT CCTGGACCTG TGGGTGTACC ACACCCAGGG CTACTTCCCC GACTGGCAGA ACTACACCCC CGGCCCCGGC ATCAGGTTCC CCCTGACCTT CGGCTGGTGC TTCAAGCTGG- TGCCCGTGGA GCCCGAGAAG GTGGAGGAGG CCAACGAGGG CGAGAACAAC TGCCTGCTGC ACCCCATGTC CCAGCACGGC ATCGAGGACC CCGAGAAGGA GGTGCTGGAG TGGAGGTTCG ACTCCAAGCT GGCCTTCCAC CACGTGGCCA GGGAGCTGCA CCCCGAGTAC TACAAGGACT GCTAAAGCC (SEQ ID NO: 11) .
The open reading frame for SEQ ID NO: 11 comprises an initiating methionine residue at nucleotides 2-4 and a "TAA" stop codon from nucleotides 713-715. The open reading frame of SEQ ID NO:3 provides for a 237 amino acid HIN-1 Νef protein which comprises a tPA leader sequence fused to amino acids 6-216 of HIN-1 Νef, including the dileucine motif at amino acid residues 174 and 175. This 237 amino acid tPA/Νef (jfrl) fusion protein is disclosed herein as SEQ ID NO: 12, and is shown as follows:
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala He Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu He His Ser Gin Lys Arg Gin Asp He Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly He Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His Pro Met Ser Gin His Gly He Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His
Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys ( SEQ ID NO : 12 ) . Therefore, this exemplified Nef protein, Opt tPA-Nef, contains both a tPA leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIN-1 Νef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.
In another specific embodiment of the present invention, a DΝA molecule is disclosed which encodes optimized HTV-1 Νef wherein the open reading frame of a recombinant adenoviral HTV vaccine encodes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175. This open reading frame is herein described as opt nef (G2A,LLAA) and is disclosed as SEQ ID NO: 13, which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662. The nucleotide sequence of this codon optimized version of HIN-1 jrfl nef gene with the above mentioned modifications is disclosed herein as SEQ ID NO: 13, as follows: GATCTGCCAC CATGGCCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC GCCGCCCACC CCATGTCCCA GCACGGCATC GAGGACCCCG AGAAGGAGGT GCTGGAGTGG AGGTTCGACT CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AGCTGCACCC CGAGTACTAC AAGGACTGCT AAAGCCCGGG C (SEQ ID NO: 13) .
The open reading frame of SEQ ID NO: 13 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID NO: 14, as follows: Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala He Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu He His Ser Gin Lys Arg Gin Asp He Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly He Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His Pro Met Ser Gin His Gly He Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys Ser ( SEQ ID NO : 14) .
An additional embodiment of the present invention relates to another DNA molecule encoding optimized HTV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HTV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175 (Ala-195 and Ala-196 in this tPA-based fusion protein). The nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ ID NO:15, as shown below:
CATGGATGCA ATGAAGAGAG GGCTCTGCTG TGTGCTGCTG CTGTGTGGAG CAGTCTTCGT TTCGCCCAGC GAGATCTCCT CCAAGAGGTC CGTGCCCGGC TGGTCCACCG TGAGGGAGAG GATGAGGAGG GCCGAGCCCG CCGCCGACAG GGTGAGGAGG ACCGAGCCCG CCGCCGTGGG CGTGGGCGCC GTGTCCAGGG ACCTGGAGAA GCACGGCGCC ATCACCTCCT CCAACACCGC CGCCACCAAC GCCGACTGCG CCTGGCTGGA GGCCCAGGAG GACGAGGAGG TGGGCTTCCC CGTGAGGCCC CAGGTGCCCC TGAGGCCCAT GACCTACAAG GGCGCCGTGG ACCTGTCCCA CTTCCTGAAG GAGAAGGGCG GCCTGGAGGG CCTGATCCAC TCCCAGAAGA GGCAGGACAT CCTGGACCTG TGGGTGTACC ACACCCAGGG CTACTTCCCC GACTGGCAGA ACTACACCCC CGGCCCCGGC ATCAGGTTCC CCCTGACCTT CGGCTGGTGC TTCAAGCTGG TGCCCGTGGA GCCCGAGAAG GTGGAGGAGG CCAACGAGGG CGAGAACAAC TGCGCCGCCC ACCCCATGTC CCAGCACGGC ATCGAGGACC CCGAGAAGGA GGTGCTGGAG TGGAGGTTCG ACTCCAAGCT GGCCTTCCAC CACGTGGCCA GGGAGCTGCA CCCCGAGTAC TACAAGGACT GCTAAAGCCC (SEQ ID NO: 15) .
The open reading frame of SEQ ID NO:7 encoding tPA-Nef (LLAA), disclosed herein as SEQ ID NO: 16, is as follows:
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu He Ser Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala He Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gin Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu He His Ser Gin Lys Arg Gin Asp He Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly He Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His Pro Met Ser Gin His Gly He Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys ( SEQ ID NO : 16 ) . An adenoviral vector of the present invention may comprise a DNA sequence, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIN Νef which are shown to promote a substantial cellular immune response subsequent to host administration.
Figure 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors Vllns/nef (Figure 20A), VUns/nef(G2A,LLAA) (Figure 20B), Vllns/tpanef (Figure 20C) and Vllns/tpanef (LLAA) (Figure 20C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. Vllns/tpanef and VlJns/tpanef(LLAA) have identical sequences at the junctions.
Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Νef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively.
EXAMPLE 19
MRKAd5Pol Construction and Virus Rescue Construction of vector: shuttle plasmid and pre-adenovirus plasmid - Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5pol, is depicted in Figure 22. Briefly, the adenoviral shuttle vector for the full-length inactivated HIV-1 pol gene is as follows. The vector
MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is a derivative of the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. The vector contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bglll site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal (or MRKpAdHVE3) pre- plasmid. The vector, similar to the original shuttle vector contains the Pad site, extension to the packaging signal region, and extension to the pIX gene. The synthetic full-length codon-optimized HIN-l pol gene was isolated directly from the plasmid pNlIns-HTV-pol-inact(opt). Digestion of this plasmid with Bgl L releases the pol gene intact (comprising a codon optimized IA pol sequence as disclosed in SEQ ID NO:3). The pol fragment was gel purified and ligated into the MRKpdelEl (Pac/pIX/pack450)+CMVmin+BGHpA(str.) shuttle vector at the BgϊLL site. The clones were checked for the correct orientation of the gene by using restriction enzymes DraLLVNotl. A positive clone was isolated and named
MRKpdel+hCMVmin+FL-pol+bGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdel+hCMV-min+FL- pol+bGHpA(S) was digested with restriction enzymes Rαcl and R,stll07 I (or its isoschizomer, BstZLOl I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(El-/E3+)Clal. The resulting pre-plasmid originally named MRKpAd+hCMNmin+FL- pol+bGHpA(S)E3+ is now referred to as "pMRKAd5pol". The genetic structure of the resulting pMRKAd5pol was verified by PCR, restriction enzyme and DΝA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DΝA sequence analysis, and by expression of the pol transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-lpol adenoviral vector is shown in Figure 26 A-AO. Generation of research-grade recombinant adenovirus - The pre-adenovirus plasmid, pMRKAd5pol, was rescued as infectious virions in PER.C6® adherent monolayer cell culture. To rescue infectious virus, 12 μg of pMRKAd5pol was digested with restriction enzyme Rαcl (New England Biolabs) and 3.3 μg was transfected per 6 cm dish of PER.C6 cells using the calcium phosphate co- precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Pad digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6®cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at < -60°C. This pol containing recombinant adenovirus is referred to herein as "MRKAd5pol". This recombinant adenovirus expresses an inactivated HIV-1 Pol protein as shown in SEQ ID NO:6.
EXAMPLE 20 MRKAd5Nef Construction and Virus Rescue Construction of vector: shuttle plasmid and pre-adenovirus plasmid - Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5nef, is depicted in Figure 23. Briefly, as shown in Example 19 above, the vector
MRKpdelEl (Pac/pIX/pack450)+CMNmin+BGHpA(str.) is the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. It has been modified to contain the Pαcl site, extension to the packaging signal region, and extension to the pIX gene. It contains an expression cassette with the hCMN promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bgll 1 site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal pre-plasmid. The synthetic full-length codon-optimized HQN-l nef gene was isolated directly from the plasmid pVlIns/nef (G2A,LLAA). Digestion of this plasmid with Bgll 1 releases the pol gene intact, which comprises the nucleotide sequence as disclosed in SEQ ID NO: 13. The nef fragment was gel purified and ligated into the MRKpdelEl+CMVmin+BGHpA(str.) shuttle vector at the Bgll 1 site. The clones were checked for correction orientation of the gene by using restriction enzyme Seal. A positive clone was isolated and named MRKpdelEl hCMVminFL-nefBGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdelElhCMVminFL-nefBGHpA(s) was digested with restriction enzymes Rαcl and R-ytll07 I (or its isoschizomer, BstZlOl I) and then co-transformed into E. coli strain BI5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(Εl/Ε3+)Clal. The resulting pre-plasmid originally named MRKpdelElhCMVminFL-nefBGHpA(s) is now referred to as "pMRKAd5nef '. The genetic structure of the resulting pMRKAd5nef was verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the nef transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-lnef adenoviral vector is shown in Figure 27A-AM.
Generation of research-grade recombinant adenovirus - The pre-adenovirus plasmid, pMRKAd5nef, was rescued as infectious virions in PER.C6® adherent monolayer cell culture. To rescue infectious virus, 12 μg of pMRKAdnef was digested with restriction enzyme Rαcl (New England Biolabs) and 3.3 μg was transfected per 6 cm dish of PER.C6® cells using the calcium phosphate co- precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Eαcl digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6®cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at < -60°C. This nef containing recombinant adenovirus is now referred to as "MRKAd5nef '.
EXAMPLE 21
Construction of Murine CMV Promoter Containing Shuttle Vectors for Inactivated Pol and Nef/G2A,LLAA The murine CMV (mCMV) was amplified from the plasmid pMH4 (supplied by Frank Graham, McMaster University) using the primer set: mCMV (Not I) Forward: 5'-ATA AGA ATG CGG CCG CCA TAT ACT GAG TCA TTA GG-3' (SEQ ID NO: 20); mCMV (Bgl II)Reverse: 5'-AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C-3' (SEQ ID NO:21). The underlined nucleotides represent the Not I and the Bgl II sites respectively for each primer. This PCR amplicon was used for the construction of the mCMV shuttle vector containing the transgene in the El parallel orientation. The hCMV promoter was removed from the original shuttle vector (containing the hCMV-gag-bGHpA transgene in the El parallel orientation) by digestion with Not I and Bgl II. The mCMN promoter (Not L/Bgl II digested PCR product) was inserted into the shuttle vector in a directional manner. The shuttle vector was then digested with Bgl LL and the gag reporter gene (Bgl II fragment) was re-inserted back into the shuttle vector. Several clones were screened for correct orientation of the reporter gene. For the construction of the mCMN-gag in the El antiparallel orientation, the mCMN promoter was amplified from the plasmid pMH4 using the following primer set: mCMN (Asc I) Forward: 5'- ATA AGA ATG GCG CGC CAT ATA CTG AGT CAT TAG G (SEQ ID ΝO:22); mCMV (Bgl II) Reverse: 5' AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C (SEQ ID NO:23). The underlined nucleotides represent the Asc I and Bgl LL sites, respectively for each primer. The shuttle vector containing the hCMV-gag transgene in the El antiparallel orientation was digested with Ascl and Bgll 1 to remove the hCMV-gag portion of the transgene. The mCMV promoter (AscllBglll digested PCR product) was inserted into the shuttle vector in a directional manner. The vector was then digested with Rg/11 and the gag reporter gene (RgZll fragment) was re-inserted. Several clones were screened for correct orientation of the reporter gene. For each of the full length IA pol and full length nef/G2A,LLAA genes, cloning was performed using the unique Bgl LL site within the mCMN-bGHpA shuttle vector. The pol and nef genes were excised from their respective pVlIns plasmids by Bgl LL digestion.
EXAMPLE 22 Construction of mCMV Full Length Inactivated Pol and
Full Length nef/G2A.LLAA Adenovectors Each of these transgenes of Example 21 were inserted into the modified shuttle vector in both the El parallel and El anti-parallel orientations. Rαcl and RstZllOI digestion of each shuttle vector was performed and each specific transgene fragment containing the flanking Ad5 sequences was isolated and co-transformed with Cla I digested MRKpAd5(E3+) or MRKpAd5(E3-) adenovector plasmids via bacterial homologous recombination in BI5183 E. coli cells. Recombinant pre- plasmid adenovectors containing the various transgenes in both the E3- and E3+ versions (and in the El parallel and El antiparallel orientations) were subsequently prepared in large scale following transformation into XL-1 Blue E. coli cells and analyzed by restriction analysis and sequencing.
EXAMPLE 23 Construction of hCMV-tpa-nef (LLAA) Adenovector The tpa-nef gene was amplified out from GMP grade pVlJns-tpanef (LLAA) vector using the primer sets: Tpanef (BamHI) F 5 -ATT GGA TCC ATG GAT GCA ATG AAG AGA GGG (SEQ ID 24); Tpanef (BamHI) R 5'-ATA GGA TCC TTA GCA GTC CTT GTA GTA CTC G (SEQ ID ΝO:25). The resulting PCR product was digested with BωnΕH, gel purified and cloned into the Bgl II site of MRKAd5CMV- bGHpA shuttle vector (Bgl II digested and calf intestinal phosphatase treated).
Clones containing the tpanef (LLAA) gene (see SEQ ID NO: 15 for complet coding region) in the correct orientation with respect to the hCMV promoter were selected following Sea I digestion. The resulting MRKAd5tpanef shuttle vector was digested with Pac I and Bst Zl 101 and cloned into the E3+ MRKAd5 adenovector via bacterial homologous recombination techniques.
EXAMPLE 24 Immunogenicity of MRKAd5pol and MRKAd5nef Vaccine Materials and Methods - Rodent Immunization - Groups of N=10 BALB/c mice were immunized i.m. with the following vectors: (1) MRKAd5hCMN-IApol (E3+) at either 10Λ7 vp and 10Λ9 vp; and (2) MRKAd5hCMN-IApol (E3-) at either 10Λ7 vp and 10Λ9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELIS A and IFNg ELIspot analyses, respectively. For all rodent immunizations, the Ad5 vectors were diluted in 5 mM Tris, 5% sucrose, 75 m-M NaCl, 1 mM MgC12, 0.005% polysorbate 80, pH 8.0. The total dose was injected to both quadricep muscles in 50 μL aliquots using a 0.3-mL insulin syringe with 28-1/2G needles (Becton-Dickinson, Franklin Lakes, Nl).
Groups of N=10 C57/BL6 mice were immunized i.m. with the following vectors: (1) MRKAd5hCMV-nef(G2A,LLAA) (E3+) at either 10Λ7 vp and 10Λ9 vp; (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10Λ7 vp and 10Λ9 vp; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10Λ7 vp and 10Λ9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively.
Non-human Primate immunization - Cohorts of 3 rhesus macaques (2-3 kg) were vaccinated with the following Ad vectors: (1) MRKAd5hCMV-IApol (E3+) at either 10Λ9 vp and 10Λ11 vp dose; and (2) MRKAd5hCMV-IApol (E3-) at either 10Λ9 vp and 10Λ11 vp; (3) MRKAd5hCMV-nef(G2A,LLAA) (E3+) at either 10Λ9 vp and 10Λ11 vp; and (4) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10Λ9 vp and 10Λ11 vp. The vaccine was administered to chemically restrained monkeys (10 mg/kg ketamine) by needle injection of two 0.5 mL aliquots of the Ad vectors (in 5 mM Tris, 5% sucrose, 75 mM NaCl, 1 mM MgCl2, 0.005% polysorbate 80, pH 8.0) into both deltoid muscles. The animals were immunized twice at a 4 week interval (T=0, 4 weeks).
Murine anti-RT and anti-nef ELISA - Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, NY) were coated by overnight incubation with 100 μL of 1 μg /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, MD) in PBS. For anti-nef ELISA, 100 uL of 1 ug/mL HIV-1 nef (Advanced Biotechnologies, Columbia, MD) was used to coat the plates. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, AL) and incubated for 2 h with 200 μL/well of blocking solution (PBS/0.05% tween/1% BSA). An initial serum dilution of 100-fold was performed followed by 4-fold serial dilution. 100-μL aliquots of serially diluted samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 μL of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, CA) were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 μL 1,2-phenylenediamine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for 15 min. The reaction was quenched by adding 100 μL of 0.5M H2SO4 per well. OD492 readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD 92 (2.5 times the background value).
Non-human primate and murine ELIspot assays - The enzyme-linked immuno-spot (ELISpot) assay was utilized to enumerate antigen-specific INFγ- secreting cells from mouse spleens (Miyahira, et al.1995, J. Immunol. Methods 181:45-54) or macaque PBMCs. Mouse spleens were pooled from 5 mice/cohort and single cell suspensions were prepared at 5xl06/mL in complete RPMI media (RPMI1640, 10% FBS, 2mM L-glutamine, lOOU/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM β-ME). Rhesus PBMCs were prepared from 8- 15 mL of heparinized blood following standard Ficoll gradient separation (Coligan, et al, 1998, Current Protocols in Immunology. lohn Wiley & Sons, Inc.). Multiscreen opaque plates (Millipore, France) were coated with 100 μL/well of either 5 μg/mL purified rat anti-mouse IFN-γ IgGl, clone R4-6A2 (Pharmingen, San Diego, CA), or 15 ug/mL mouse anti-human IFN-γ IgG2a (Cat. No. 1598-00, R&D Systems, Minneapolis, MN) in PBS at 4°C overnight for murine or monkey assays, respectively. The plates were washed with PBS/penicillin/streptomycin and blocked with 200 μL/well of complete RPMI media for 37 °C for at least 2 h.
To each well, 50 μL of cell samples (4-5xl05 cells per well) and 50 μL of the antigen solution were added. To the control well, 50 μL of the media containing
DMSO were added; for specific responses, either selected peptides or peptide pools (4 ug/mL per peptide final concentration) were added. For B ALB/c mice immunized with the pol constructs, stimulation was conducted using a pool of CD4+-epitope containing 20-mer peptides (aa21-40, aa411-430, aa641-660, aa731-750, aa771-790) or a pool of CD8+-epitope containing peptides (aa201-220, aa311-330, aa781-800). For C57/BL6 mice immunized with the nef construct, either aa51-70 (CD8+ T cell epitope) or aa81-100 (CD4+) peptide derived from the nef sequence was added for specific stimulation. In monkeys, the responses against pol were evaluated using two pools (L and R) of 20-aa peptides that encompass the entire pol sequence and overlap by 10 amino acids. In monkeys vaccinated with the nef constructs, a single pool containing 20-mer peptides covering the entire HIV-1 nef sequence and overlapping by 10 aa was used. Each sample/antigen mixture was performed in triplicate wells for murine samples or in duplicate wells for rhesus PBMCs. Plates were incubated at 37°C, 5% CO2, 90% humidity for 20-24 h. The plates were washed with PBS/0.05% Tween 20 and incubated with 100 μL/well of either 1.25 μg/mL biotin-conjugated rat anti-mouse IFN-γ mAb, clone XMGl .2 (Pharmingen) or of 0.1 ug/mL biotinylated anti-human IFN-gamma goat polyclonal antibody (R&D Systems) at 4°C overnight. The plates were washed and incubated with 100 μL/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37 °C. Spots were developed by incubating with 100 μL/well 1- step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 106 cell input.
Non-human Primate anti-RT ELISA - The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (#97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN3) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature. Similar mixtures are prepared using serially diluted samples of a standard and a negative control which defines maximum RT binding. 200 uL/well of each sample and standard were added to the washed plate and the plate incubated 16- 24 h at room temperature. Bound RT is quantified following the procedures described in Coulter p24 assay kit and reported in milliMerck units per mL arbitrarily defined by the chosen standard.
Results - Rodent Studies - B ALB/c mice (n=5 mice/cohort) were immunized once or twice with varying doses of MRKAd5hCMV-IApol(E3+) and MRKAd5hCMV-IApol(E3-). At 3 weeks after the second dose, Anti-pol IgG levels were determined by an ELISA assay using RT as a surrogate antigen. Cellular response were quantified via TFNγ ELISpot assay against pools of pol-epitope containing peptides. The results of these assays are summarized in Table 10. The results indicate that the mouse vaccinees exhibited detectable anti-RT IgGs with an adenovector dose as low as 10Λ7 vp. The humoral responses are highly dose- dependent and are boostable with a second immunization. One or two doses of either pol vectors elicit high frequencies of antigen-specific CD4+ and CD8+ T cells; the responses are weakly dose-dependent but are boostable with a second immunization.
GMT, geometric mean tlter of the cohort of 5 mice, SE, standard error of the gemetπc mean "Near or at the upper limit of the serial dilution, hence, could be greater than this value °No of Spot-forming Cells per million splecnoytes, mean values of triplicates are reported along with standard errors in parenthesis
C57/BL6 mice were immunized once or twice with varying doses of MRKAd5hCMV-nef(G2A,LLAA) (E3+), MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10Λ7 vp and(3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10Λ7 vp and 10Λ9 vp. The immune response were analyzed using similar protocols and the results are listed in Table 11. While anti-nef IgG responses could not be detected in this model system with any of the constructs, there are strong indications of a cellular immunity generated against nef using the ELIspot assay.
"GMT, geometric mean titer of the cohort of 5 mice, SE, standard error of the gemetπc mean
"No of spot-forming cells per million splecnoytes, mean values of triplicates are reported along with standard errors in parenthesis
Monkey Studies - Cohorts of 3 rhesus macaques were immunized with 2 doses of MRKAd5hCMV-IApol(E3+) and MRKAd5hCMV-IApol(E3-). The number of antigen-specific T cells (per million PBMCs) were enumerated using one of two peptide pools (L and R) that cover the entire pol sequence; the results are listed in Table 12. Moderate-to-strong T cell responses were detected in the vaccinees using either constructs even at a low dose of 10Λ9 vp. Longitudinal analyses of the anti-RT antibody titers in the animals suggest that the pol transgene product is expressed efficiently to elicit a humoral response (Table 13). It would appear that generally higher immune responses were observed in animals that received the E3- construct compared to the E3+ virus.
Table 12. Pol-specific T Cell Responses in MRKAd5pol Immunized Rhesus
nd, not determined
Reported are SFG per million PBMCs; mean of duplicate wells.
When rhesus macaques were immunized i.m. with two doses of MRKAd5nef constructs, vigorous T cell responses ranging from 100 to as high as 1100 per million were observed in 8 of 12 vaccinees (Table 14). The efficacies of the mCMV- and hCMV- driven nef constructs are comparable on the basis of the data generated thus far.
EXAMPLE 25 Comparison of Clade B vs. Clade C T Cell Responses in HTV-Infected Subjects
PBMC samples collected from two dozens of patients infected with HTV-1 in US were tested in ELISPOT assays with peptide pools of 20-mer peptides overlapping by 10 amino acids. Four different peptide pools were tested for cross-clade recognition, and they were either derived from a clade B-based isolate (gag H-b; nef- b) or a clade C-based isolate (gag H-c, nef-c). Data in Table 15 shows that T cells from these patients presumably infected with clade B HIV-1 could recognize clade C gag and nef antigens in ELISPOT assay. Correlation analysis further demonstrated that these T cell responses against clade C gag peptide pool were about 60% of the clade B counterpart (Figure 24), while the T cell responses against clade C nef were about 85% of the clade B counterpart (Figure 25). These results suggest that cellular immune responses generated in patients infected with clade B HTV-1 can recognize gag and nef antigens derived from clade C HIN-1. These data show that a HIN vaccine, such as a DΝA or MRKAd5-based adenoviral vaccine expressing a clade B gag and/or nef antigen will potentially have the ability to provide a prophylactic and/or therapetic advantage on a global scale.
Table 15 Responses Shown as the Number of gTFN-Secreting T Cells per Million PBMCs
EXAMPLE 26
Characterization and Production of MRKAd5pol and MRKAd5nef
Vectors in Roller Bottles
Expansion of nef and pol Adenovectors - Nef and pol CsCl purified MRKAd5 seeds were used to infect roller bottles to produce P4 virus to be used as a seed for further experiments. P4 MRKAd5 pol and nef vectors were used to infect roller bottles at an MOI 280 vp/cell, except for hCMN-tpa-nef [E3+] which was infected at an MOI of 125 due to low titers of seed obtained at P4.
Table 16 Viral particle concentrations for P5 nef and pol adenovectors
Roller Bottle Passaging - Passaging of the pol and He/constructs continued through passage seven. Cell-associated (freeze/thaw lysis) and whole broth (triton- lysis) titers obtained in all passages were very consistent. In general, MRKAd5pol is ca. 70% as productive as MRKAd5gag while MRKAd5nef is ca. 25% as productive as MRKAd5gag. Samples of P7 virus for both constructs were analyzed by V&CB by
10 restnction digest analysis and did not show any rearrangements.
MRKAd5nef and MRKAdδpol Viral Production Kinetics - A timecourse experiment was carried out in roller bottles to determine if the viral production kinetics of the MRKAd5pol and MRKAd5nef vectors were similar to those of
20 MRKAd5gag. PER.C6® cells in roller bottle cultures were infected at an MOI of 280 vp/cells with P5 MRKAd5pol, P5 MRKAd5nef and P7 MRKAd5gag; for each adenovector, two infected bottles were sampled at 24, 36, 48, and 60 hours post infection. In addition, two bottles were left unsampled until 48 hpi when they were harvested under the Phase I process conditions. The anion-exchange HPLC viral
25 particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi timepoints are shown in Figure 29A-B. The QPA titers show a similar trend (data not shown).
Comparison ofhCMV- and mCMV-FL-nef - As the titers obtained with the MRKAd5nef construct (hCMV-FL-nef) were lower than those obtained with MRKAd5gag or MRKAd5pol, a viral productivity comparison experiment was performed with mCMV-FL-nef . For each of the two adenovectors (hCMV- and mCMV-FL-nef), two roller bottles were infected at an MOI of 280 vp/cell with passage five clarified lysate. The macroscopic and microscopic observations of the
10 four roller bottles were identical at the time of harvest. Analysis of the clarified lysate produced indicated a higher viral particle concentration in the bottles infected with mCMV-FL-nef, as shown in Table 19. It is stipulated that the higher productivity with mCMV promoter driven nef vector is due to lower nef expression levels in PER.C6® cells- experiments are underway at V&CB to measure nef expression levels.
15
Table 19. Passage Six Viral Productivity Comparison of hCMV- and mCMV-FL-nef
20 EXAMPLE 27
Characterization and Large Scale Production of MRKAd5nef Virus in Bioreactors Materials and Methods - The experiment of the present example was run twice under the following conditions: 36.5°C, DO 30%, pH 7.30, 150rpm agitation rate, 25 no sparging, Life Technologies (Gibco, Invitrogen) 293 SFM II (with 6mM L- glutamine), 0.5M NaOH as base for pH control. During the first run (B20010115), two 10L stirred vessel bioreactors were inoculated with PER.C6® cells at a concentration of 0.2xl06 cells/ml. Cells were grown until they reached a cell concentration of approximately lxlO6 cells/ml. The cells were infected with uncloned 30 MRKAd5nef (G2A,LLAA) at a MOI of 280 virus particles (vp)/cell. For the second batch (B 20010202), the same procedure as the first run was used, except the cells were infected with cloned MRAd5nef. During both runs, the bioreactors were harvested 48 hours post-infection. Samples were taken and virus concentrations were determined from whole broth (with triton lysis), supernatant, and cell pellets (3 X freeze/thaw) with the AEX and QPA assays. Metabolites were measured with BioProfile 250 throughout the process.
Table 21: Virus source used for experiments.
Results - Table 22 and 23 show an the ability to scale up production of MRKAd5nef by growth in a bioreactor.
Table 22: Virus Concentration as measured by the AEX assay
Table 23: Virus Titers as measured by the QPA assay
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
EXAMPLE 28 MRKAd5HIN- 1 gag Boosting of DΝA-Primed Animals
Groups of 3-5 rhesus macaques were immunized with (a) 5 mgs of VlJns- Flgag (pVIJnsCMN(no intron)-FL-gag-bGHpA), (b) 5 mgs of NlJns-Flgag formulated with 45 mgs of a non-ionic block copolymer CRL1005, or (c) 5 mgs of VI Jns-Flgag formulated with 7.5 mgs of CRL1005 and 0.6 mM benzalkonium chloride at weeks 0, 4, and 8. All animals received a single dose of 10e7 viral particles (vp) of the MRKAd5HIN-lgag at week 26. Note: 10e7 is too low to prime or boost effectively when used as a single modality (dose is selected to mimic preexposure to adenovirus); see Figure 32. Blood samples were collected from all animals at several time points and peripheral blood mononuclear cells (PBMCs) were prepared using standard Ficoll method. The PBMCs were counted and analyzed for gamma-interferon secretion using the ELISpot assay (Table 24). For each monkey, the PBMCs were incubated overnight either in the absence (medium) or presence of a pool (called "gag H") of 50 20-aa long peptides that encompass the entire HIN-1 gag sequence.
The results indicate that MRKAd5HIV-lgag was very effective in boosting the T cell immune responses in these monkeys. At week 28 or 2 weeks after the viral boost, the number of gag-specific T cells per million PBMCs increased 2-48 fold compared to the levels observed at week 24 or 2 weeks prior to the boost. The PBMCs were also analyzed by intracellular gamma-interferon staining prior to (at week 10) and after the MRKAd5gag boost (at week 30). The results for select animals are shown on Figure 31. The results indicate that (a) immunization with DΝA/adjuvant formulation elicited T cell responses which can either be balanced, CD4+-biased or CD8+-biased, and (b) boosting with the MRKAd5gag construct produced in all cases a strongly CD8+-biased response. These results suggest that boosting with MRKAd5HIV-lgag construct is able to improve the levels of antigen-specific CD8+ T cells. Table 24. Boosting of DNA/AdJuvant-Primed Rhesus Monkeys with MRKAdSgag Number of SFC mllUon PBMCs
NA, nol available
KB
EXAMPLE 29 Construction of gagpol fusion for MRKAd5gagpol fusion constructs
The open reading frames for the codon-optimized HIN-1 gag gene was fused directly to the open reading frame of the IA pol gene (consisting of RT, RΝAseH and integrase domains) by stepwise PCR. Because the gene (SEQ ID NO: 38) does not include the protease gene and the frameshift sequence, it encodes a single polypeptide of the combined size of p55, RT, RNAse H and integrase (1350 amino acids; SEQ ID NO: 39). The fragment that extends from the BstEII site within the gag gene to the last non-stop codon was ligated via PCR to a fragment that extends from the start codon of the IApol to a unique BamH-Z site. This fragment was digested with BstER and BamHE Construction of gag-IApol fusion was achieved via three-fragment ligation involving the PstEBstΕU gag digestion fragment, the BstΕZZ/BamHZ digested PCR product and long PstEBamH/ VlR-FLpol backbone fragment.
The MRKAd5-gagpol adenovirus vector was constructed using the BgliZ fragment of the NlR-gagpol containing the entire ORF of gag-IApol fusion gene.
EXAMPLE 30 Immunogenicity Studies in Non-Human Primates
Cohorts of three (3) macaques were immunized with 10e8 or lOelO viral particles (vp) of one of the following MRKAd5 HIN-1 vaccines: (1) MR Ad5gag; (2) MRKAd5pol; (3) MRKAd5nef; (4) a mixture containing equal amounts of MRKAd5gag, MRKAd5pol, and MRKAd5nef, or (5) a mixture of equal amounts of MRKAd5gagpol and MRKAd5nef. The vaccines were administered at weeks 0 and 4.
The T cell responses against each of the HIN-1 antigens were assayed by IFΝ- gamma ELISpot assay using pools of 20-aa peptides that encompass the entire protein sequence of each antigen. The results (Table 25) are expressed as the number of spot- forming cells (sfc) per million peripheral blood mononuclear cells (PBMC) that respond to each of the peptide pools.
Results indicate the following observations: (1) each of the single gene constructs (MRKAd5gag, MRKAd5pol, or MRKAd5nef) is able to elicit high levels of antigen-specific T cells in monkeys; (2) the single-gene MRKAd5 constructs can be mixed as a multi-cocktail formulation capable of eliciting very broad T cell responses against gag, pol, and nef; (3) the MRKAd5 vector expressing the fusion protein of gag plus IA pol is capable of inducing strong T cell responses to both gag and pol.
Indicated are numbers of spot-forming cells per million PBMCS against the peptide pools. Mock, no peptides; gag H, fifty 20-aa peptides encompassing p55 sequence; pol-1, 20-aa peptides representing Ν-terminal half of IA pol; pol-2, 20-aa peptides representing the carboxy-terminal half of IA pol; nef, 20-aa peptides encompassing the entire wild-type nef sequence. Responses to the antigens prior to the first immunization did not exceed 40 sfc/10Λ6 PBMC.

Claims

WHAT IS CLAIMED IS
1. A recombinant adenoviral vaccine vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus cz'-s-acting packaging region corresponding to from about base pair 1 to between from about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) a gene encoding an HIV protein or immunologically relevant modification thereof.
2. A vector in accordance with claim 1 comprising a packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome.
3. A vector in accordance with claim 1 further comprising nucleotides corresponding to between from about base pair 3511 to about 3524 to about base pair
5798 of a wildtype adenovirus genome.
4. A vector in accordance with claim 3 comprising base pairs corresponding to 1-450 and 3511-5798 of a wildtype adenovirus genome.
5. A vector in accordance with claim 4 which is deleted of base pairs 451-3510.
6. A vector in accordance with claim 1 which is at least partially deleted in E3.
7. A vector in accordance with claim 6 wherein the E3 deleted region is from base pairs 28,133-30,818.
8. A vector in accordance with claim 1 wherein the gene encoding the HIN protein or modification thereof comprises codons optimized for expression in a human.
9. A vector in accordance with claim 1 wherein the vector comprises a gene expression cassette comprising: a) a nucleic acid encoding a protein; b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and
(c) a transcription termination sequence.
10. A vector in accordance with claim 9 wherein the gene expression cassette is inserted into the El region.
11. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an El parallel orientation
12. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an El antiparallel orientation.
13. An adenoviral vector in accordance with claim 9 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.
14. An adenoviral vector in accordance with claim 13 wherein the promoter is an immediate early human cytomegalovirus promoter.
15. An adenoviral vector in accordance with claim 9 wherein the promoter is a murine cytomegalovirus promoter.
16. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.
17. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a synthetic polyadenylation signal (SPA).
18. A cell comprising the adenoviral vector of claim 1.
19. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 1 into a cell line which expresses adenovirus El protein at complementing levels.
20. An HIN vaccine composition comprising purified adenovirus particles of claim 19.
21. An HIN vaccine composition of claim 20 which comprises a physiologically acceptable carrier.
22. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 1 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication-defective adenovirus.
23. A method according to claim 22 wherein the cell is a PER.C6®
cell.
24. A method of generating a cellular-mediated immune response against HIN in an individual comprising administering to the individual a vaccine of claim 21.
25. A method according to claim 24 which further comprises administration to the individual a DΝA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.
26. A method according to claim 25 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.
27. A method according to claim 24 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.
28. A method according to claim 24 which comprises administering and readministering the adenovirus vaccine vector to the individual.
29. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV gag or an immunologically relevant modification thereof.
30. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIN gag protein or immunologically relevant modification thereof.
31. A recombinant adenoviral vaccine vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus cz'-s-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair 3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) SEQ ID NO: 29; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.
32. An adenoviral vector in accordance with claim 31 wherein the gene expression cassette is in an El parallel orientation.
33 An adenoviral vector in accordance with claim 31 wherein the gene expression cassette is in an El antiparallel orientation.
34. An adenoviral vector in accordance with claim 31 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.
35. An adenoviral vector in accordance with claim 31 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.
36. An adenoviral vector in accordance with claim 31 which is at least partially deleted in E3.
37. A cell comprising the adenoviral vector of claim 30.
38. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 30 into a cell line which expresses adenovirus El protein at complementing levels.
39. An HEN vaccine composition comprising purified adenovirus particles of claim 38.
40. An HIN vaccine composition of claim 39 which comprises a physiologically acceptable carrier.
41. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 30 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication-defective adenovirus.
42. A method according to claim 41 wherein the cell is a PER.C6® cell.
43. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine of claim 21.
44. A method according to claim 43 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.
45. A method according to claim 44 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.
46. A method according to claim 43 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.
47. A method according to claim 43 which comprises administering and readministering the adenovirus vaccine vector to the individual.
48. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV pol or an immunologically relevant modification thereof.
49. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV pol protein or immunologically relevant modification thereof.
50. A recombinant adenoviral vaccine vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus cz'-y-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair 3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of
SEQ ID NO: 1, SEQ ID NO: 5 and SEQ ID NO: 7; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.
51. An adenoviral vector in accordance with claim 50 wherein the gene expression cassette is in an El parallel orientation.
52. An adenoviral vector in accordance with claim 50 wherein the gene expression cassette is in an El antiparallel orientation.
53. An adenoviral vector in accordance with claim 50 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.
54. An adenoviral vector in accordance with claim 50 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.
55. An adenoviral vector in accordance with claim 50 which is at least partially deleted in E3.
56. A cell comprising the adenoviral vector of claim 49.
57. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 49 into a cell line which expresses adenovirus El protein at complementing levels.
58. An HIV vaccine composition comprising purified adenovirus particles of claim 57.
59. An HIN vaccine composition of claim 58 which comprises a physiologically acceptable carrier.
60. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 49 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication-defective adenovirus.
61. A method according to claim 60 wherein the cell is a PER.C6®
cell.
62. A method of generating a cellular-mediated immune response against HIN in an individual comprising administering to the individual a vaccine of claim 59.
63. A method according to claim 62 which further comprises administration to the individual a DΝA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.
64. A method according to claim 63 wherein the DΝA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.
65. A method according to claim 62 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.
66. A method according to claim 62 which comprises administering and readministering the adenovirus vaccine vector to the individual.
67. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV nef or an immunologically relevant modification thereof.
68. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV nef protein or immunologically relevant modification thereof.
69. A recombinant adenoviral vaccine vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus -s-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair
3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of
SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 15; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.
70. An adenoviral vector in accordance with claim 69 wherein the gene expression cassette is in an El parallel orientation.
71. An adenoviral vector in accordance with claim 69 wherein the gene expression cassette is in an El antiparallel orientation.
72. An adenoviral vector in accordance with claim 69 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.
73. An adenoviral vector in accordance with claim 69 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.
74. An adenoviral vector in accordance with claim 69 which is at least partially deleted in E3.
75. A cell comprising the adenoviral vector of claim 68.
76. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 68 into a cell line which expresses adenovirus El protein at complementing levels.
77. An HIV vaccine composition comprising purified adenovirus particles of claim 76.
78. An HIN vaccine composition of claim 77 which comprises a physiologically acceptable carrier.
79. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 68 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication-de ective adenovirus .
80. A method according to claim 79 wherein the cell is a PER.C6®
cell.
81. A method of generating a cellular-mediated immune response against HIN in an individual comprising administering to the individual a vaccine of claim 78.
82. A method according to claim 81 which further comprises administration to the individual a DΝA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.
83. A method according to claim 82 wherein the DΝA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.
84. A method according to claim 81 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.
85. A method according to claim 81 which comprises administering and readministering the adenovirus vaccine vector to the individual.
86. A multivalent adenovirus vaccine composition comprising recombinant, replication-defective adenovirus particles, wherein the adenovirus particles are harvested and purified from a cell line expressing adenovirus El protein, and wherein the particles are harvested subsequent to transfection of the cells with an adenoviral vector or vectors in accordance with claim 9; said vector(s) comprising a gene expression cassette or cassettes comprising nucleotide sequences encoding HIN proteins selected from the group consisting of: a) gag, pol, and nef, expressed independently from three individual vectors; b) gag, pol, and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; c) gag, pol, and nef, expressed via two vectors, one expressing a pol- nef fusion, and another expressing gag; d) gag, pol, and nef, expressed via two vectors, one expressing a gag- pol fusion and another expressing nef; e) gag, pol and nef, expressed via two vectors, one expressing a nef- gag fusion and another expressing pol; f) gag, pol, and nef, expressed via one vector expressing a gag-pol- nef fusion; g) gag and pol, expressed independently from two individual vectors; h) gag and pol, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; i) pol and nef, expressed independently from two individual vectors; j) pol and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; k) nef and gag, expressed independently from two individual vectors;
1) nef and gag, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; m) gag and pol, expressed via one vector expressing a gag-pol fusion; n) pol and nef, expressed via one vector expressing a pol-nef fusion; and o) nef and gag, expressed via one vector expressing a nef -gag fusion.
87. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the gag-pol fusion consists of SEQ ID NO: 39.
88. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences.
89. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to a single promoter; and the encoding nucleic acid sequences operatively linked by an internal ribosome entry sequence ("IRES").
ill
EP01975214A 2000-09-15 2001-09-14 ADVANCED FIRST-GENE ADENOVIRAL VACCINES EXPRESSING CODON OPTIMIZATION OF THE GAG, POL AND NEF PROTEINS OF HIV-1 AND CHANGES THEREOF Withdrawn EP1320621A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US23318000P 2000-09-15 2000-09-15
US233180P 2000-09-15
PCT/US2001/028861 WO2002022080A2 (en) 2000-09-15 2001-09-14 Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications

Publications (2)

Publication Number Publication Date
EP1320621A2 true EP1320621A2 (en) 2003-06-25
EP1320621A4 EP1320621A4 (en) 2005-11-23

Family

ID=22876220

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01975214A Withdrawn EP1320621A4 (en) 2000-09-15 2001-09-14 ADVANCED FIRST-GENE ADENOVIRAL VACCINES EXPRESSING CODON OPTIMIZATION OF THE GAG, POL AND NEF PROTEINS OF HIV-1 AND CHANGES THEREOF

Country Status (5)

Country Link
EP (1) EP1320621A4 (en)
JP (1) JP2004508064A (en)
AU (2) AU2001294562B2 (en)
CA (1) CA2422882A1 (en)
WO (1) WO2002022080A2 (en)

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2393861A1 (en) * 1999-12-17 2001-06-21 Merck & Co., Inc. Polynucleotide vaccines expressing codon optimized hiv-1 nef and modified hiv-1 nef
ATE467680T1 (en) 2001-10-11 2010-05-15 Merck Sharp & Dohme HEPATITIS C VIRUS VACCINE
AU2002363189A1 (en) 2001-10-31 2003-05-12 The South African Medical Research Council Hiv-1 subtype isolate regulatory/accessory genes, and modifications and derivatives thereof
US20060165664A1 (en) * 2002-03-13 2006-07-27 Emini Emilio A Method of inducing an enhanced immune response against hiv
WO2003085138A1 (en) 2002-03-29 2003-10-16 Merck & Co., Inc. Methods of virus production
ATE360683T1 (en) 2002-05-14 2007-05-15 Merck & Co Inc METHOD FOR PURIFYING ADENOVIRUS
CN1490056A (en) * 2002-10-18 2004-04-21 ��¡���ɵ°��̲��о����� Immunization methods and compositions against HIV-1
US20080153083A1 (en) 2003-10-23 2008-06-26 Crucell Holland B.V. Settings for recombinant adenoviral-based vaccines
WO2004037294A2 (en) 2002-10-23 2004-05-06 Crucell Holland B.V. New settings for recombinant adenoviral-based vaccines
WO2004055187A1 (en) 2002-12-17 2004-07-01 Crucell Holland B.V. Recombinant viral-based malaria vaccines
EP1583833A1 (en) 2003-01-03 2005-10-12 Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. Rhesus her2/neu, nucleotides encoding same, and uses thereof
CN100558894C (en) 2003-07-21 2009-11-11 P.安杰莱蒂分子生物学研究所 Synthetic gene encoding human epidermal growth factor 2/NEU antigen and use thereof
GB2406336A (en) * 2003-09-24 2005-03-30 Oxxon Pharmaccines Ltd HIV Pharmaccines
ES2387850T3 (en) 2004-02-11 2012-10-02 Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.R.L. Carcinoembryonic antigen fusion protein and its uses
ES2329607T3 (en) 2004-02-23 2009-11-27 Crucell Holland B.V. VIRUS PURIFICATION METHODS
JP2007532656A (en) * 2004-04-12 2007-11-15 アメリカ合衆国 Methods for inducing immune responses using adenoviral vectors
GB0417494D0 (en) 2004-08-05 2004-09-08 Glaxosmithkline Biolog Sa Vaccine
BRPI0516048A (en) 2004-10-13 2008-08-19 Crucell Holland B V E Beth Isr batch of a replicating defective recombinant adenovirus based on a subgroup c serotype
US8574595B2 (en) 2005-04-11 2013-11-05 Crucell Holland B.V. Virus purification using ultrafiltration
EA200702190A1 (en) * 2005-05-12 2008-04-28 Глаксо Груп Лимитед VACCINE COMPOSITION
AU2012201827B2 (en) * 2005-05-12 2014-09-04 Glaxo Group Limited Vaccine composition
WO2007042169A2 (en) 2005-10-07 2007-04-19 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Matrix metalloproteinase 11 vaccine
CA2679410C (en) * 2007-03-02 2017-01-17 Glaxosmithkline Biologicals S.A. Novel method and compositions
US9717788B2 (en) 2007-03-02 2017-08-01 Glaxosmithkline Biologicals Sa Method of inducing an immune response against HIV employing HIV immunogens, adenoviral vectors encoding said immunogens, and adjuvant
CA2695433C (en) 2007-08-03 2025-05-06 Institut Pasteur Lentiviral gene transfer vectors and their medicinal applications
EP2047861B1 (en) * 2007-10-12 2019-07-31 Institut Pasteur Lentiviral gene transfer vectors suitable for iterative administration and their medicinal applications
WO2009022236A2 (en) 2007-08-16 2009-02-19 Tripep Ab Immunogen platform
NZ593598A (en) * 2008-11-18 2013-02-22 Beth Israel Hospital Optimized antiviral vaccines with improved cellular immunogenicity
DK2694101T3 (en) 2011-04-06 2017-01-09 Biovaxim Ltd Pharmaceutical compositions for the prevention and / or treatment of HIV disease in humans
US8932607B2 (en) 2012-03-12 2015-01-13 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
SI2825640T1 (en) 2012-03-12 2016-08-31 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
ES3040856T3 (en) 2012-11-16 2025-11-05 Beth Israel Deaconess Medical Ct Inc Recombinant adenoviruses and use thereof
WO2016146844A1 (en) 2015-03-18 2016-09-22 Janssen Vaccines & Prevention B.V. Assays for recombinant expression systems
CA2981841A1 (en) 2015-04-14 2016-10-20 Janssen Vaccines & Prevention B.V. Recombinant adenovirus expressing two transgenes with a bidirectional promoter
CN109312362B (en) 2016-06-20 2022-06-28 扬森疫苗与预防公司 Efficient and balanced bidirectional promoter
EP3704139A1 (en) 2017-10-31 2020-09-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
SG11202003200VA (en) 2017-10-31 2020-05-28 Janssen Vaccines & Prevention Bv Adenovirus and uses thereof
EP3704256A1 (en) 2017-10-31 2020-09-09 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
JP7366014B2 (en) 2017-10-31 2023-10-20 ヤンセン ファッシンズ アンド プリベンション ベーフェー Adenovirus and its uses
EP3723771A4 (en) 2017-12-11 2022-04-06 Beth Israel Deaconess Medical Center, Inc. RECOMBINANT ADENOVIRUS AND USES THEREOF
CN111057716B (en) * 2019-07-27 2022-04-15 中国人民解放军军事科学院军事医学研究院 Single plasmid vector system for packaging recombinant human adenovirus type 4 and application thereof
JP7711050B2 (en) 2019-10-03 2025-07-22 ヤンセン ファッシンズ アンド プリベンション ベーフェー Adenoviral Vectors and Uses Thereof
CN112522276B (en) * 2020-12-15 2022-07-15 武汉纽福斯生物科技有限公司 A kind of EMC1 nucleotide sequence and its application
WO2025242657A1 (en) 2024-05-21 2025-11-27 Shape Biopharmaceuticals Ag Lipopeptide building blocks and aggregates
CN120158438B (en) * 2024-10-14 2026-01-06 南京诺唯赞生物科技股份有限公司 RNA polymerase variants and their applications

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643579A (en) * 1984-11-01 1997-07-01 American Home Products Corporation Oral vaccines
FR2705686B1 (en) * 1993-05-28 1995-08-18 Transgene Sa New defective adenoviruses and corresponding complementation lines.
WO1996009399A2 (en) * 1994-09-23 1996-03-28 Somatix Therapy Corporation Chimeric adenovirus for gene delivery
US5872005A (en) * 1994-11-03 1999-02-16 Cell Genesys Inc. Packaging cell lines for adeno-associated viral vectors
AU6261696A (en) * 1995-06-05 1996-12-24 Trustees Of The University Of Pennsylvania, The A replication-defective adenovirus human type 5 recombinant as a vaccine carrier
WO1996039178A1 (en) * 1995-06-05 1996-12-12 The Wistar Institute Of Anatomy And Biology A replication-defective adenovirus human type 5 recombinant as a vaccine carrier
JP2001509375A (en) * 1997-07-10 2001-07-24 ヘパヴェック アーゲー フュール ゲンテルアピエ Cloning vectors for generating minimal adenovirus vectors
GB9803351D0 (en) * 1998-02-17 1998-04-15 Oxford Biomedica Ltd Anti-viral vectors
US6670188B1 (en) * 1998-04-24 2003-12-30 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
AU6139699A (en) * 1998-09-11 2000-04-03 Children's Medical Center Corporation Packaging cell lines for hiv-derived retroviral vector particles
EP1980617A1 (en) * 1998-12-31 2008-10-15 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
GB9906177D0 (en) * 1999-03-17 1999-05-12 Oxford Biomedica Ltd Anti-viral vectors
GB9912965D0 (en) * 1999-06-03 1999-08-04 Oxford Biomedica Ltd In vivo selection method
CA2395429A1 (en) * 1999-12-22 2001-06-28 Merck & Co., Inc. Polynucleotide vaccines expressing codon optimized hiv-1 pol and modified hiv-1 pol
EP1156112B1 (en) * 2000-05-18 2006-03-01 Geneart GmbH Synthetic gagpol genes and their uses
CA2419822C (en) * 2000-08-14 2011-02-08 Gary J. Nabel Modifications of hiv env, gag, and pol enhance immunogenicity for genetic immunization

Also Published As

Publication number Publication date
CA2422882A1 (en) 2002-03-21
WO2002022080A3 (en) 2002-05-02
WO2002022080A9 (en) 2003-03-06
AU2001294562B2 (en) 2007-05-24
JP2004508064A (en) 2004-03-18
EP1320621A4 (en) 2005-11-23
AU2001294562B8 (en) 2002-03-26
WO2002022080A8 (en) 2003-01-16
AU9456201A (en) 2002-03-26
WO2002022080A2 (en) 2002-03-21

Similar Documents

Publication Publication Date Title
AU2001294562B2 (en) Enhanced First Generation Adenovirus Vaccines Expressing Codon Optimized HIV1-Gag, Pol, Nef and Modifications
US20050070017A1 (en) Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-Gag, Pol, Nef and modifications
AU2001294562A1 (en) Enhanced First Generation Adenovirus Vaccines Expressing Codon Optimized HIV1-Gag, Pol, Nef and Modifications
EP2163260B1 (en) Chimpanzee adenovirus vaccine carriers
CN1913919A (en) HIV vaccines based on env of multiple clades of hiv
US20080254059A1 (en) Adenovirus Serotype 26 Vectors, Nucleic Acid and Viruses Produced Thereby
US20070054395A1 (en) Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-Gag, Pol, Nef and modifications
US20080063656A1 (en) Adenoviral Vector Compositions
AU2003262790A1 (en) Adenovirus serotype 24 vectors, nucleic acids and virus produced thereby
CA2519207A1 (en) Adenovirus serotype 34 vectors, nucleic acids and virus produced thereby
CN1972958B (en) Method of using adenoviral vectors to induce an immune response
US20070077257A1 (en) Enhanced first generation adenovirus vaccines expressing condon optimized HIV1-Gag, Pol, Nef and modifications
US20060165664A1 (en) Method of inducing an enhanced immune response against hiv
WO2006086357A2 (en) Adenovirus serotype 36 vectors, nucleic acid and viruses produced thereby
US20050106123A1 (en) Method of inducing an enhanced immune response against hiv

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030415

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: CASIMIRO, DANILO, R.

Inventor name: TONER, TIMOTHY, J.

Inventor name: SHIVER, JOHN, W.

Inventor name: KASLOW, DAVID, C.

Inventor name: CHEN, LING

Inventor name: BETT, ANDREW, J.

Inventor name: YOUIL, RIMA

Inventor name: EMINI, EMILIO, A.

A4 Supplementary search report drawn up and despatched

Effective date: 20051007

17Q First examination report despatched

Effective date: 20061017

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080805