CA2422882A1 - Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol, nef and modifications - Google Patents

Abstract

First generation adenoviral vectors and associated recombinant adenovirus-based HIV vaccines which show enhanced stability and growth properties and greater cellular-mediated immunity are described within this specification.
These adenoviral vectors are utilized to generate and produce through cell culture various adenoviral-based HIV-1 vaccines which contain HIV-1 gag, HIV-1 pol and/or HIV-1 nef polynucleotide pharmaceutical products, and biologically relevant modifications thereof. These adenovirus vaccines, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV1- Gag, Pol and/or Nef protein or biologically modification thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA
molecules encoding HIV-1 Gag, encoding codon optimized HIV-1 Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The adenoviral vaccines of the present invention, when administered alone or in a combined modality regime, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.

Description

TITLE OF THE INVENTION
ENHANCED FIRST GEIV~RATION ADENOVTRUS VACCINES EXPRESSING
CODON OPTMZED HIV1-GAG, POL, NEF AND MODIFICATIONS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit, under 35 U.S.C. ~119(e), of U.S.
provisional applications 60/233,180, 60/279,056, and Attorney Docket 20867PV2 (serial number unassigned), filed September 15, 2000, March 27, 2001, and September 7, 2001, respectively.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not Applicable REFERENCE TO MICROFTCHE APPENDIX
Not Applicable FIELD OF THE INVENTION
The present invention relates to recombinant, replication-deficient first generation adenovirus vaccines found to exhibit enhanced growth properties and greater cellular-mediated immunity as compared to other replication-deficient vectors.
The invention also relates to the associated first generation adenoviral vectors described herein, which, through the incorporation of additional 5' adenovirus sequence, enhance large scale production efficiency of the recombinant, replication-defective adenovirus described herein. Another aspect of the instant:
invention is the surprising discovery that the intron A portion of the human cytomegalovirus (hCMV) promoter constitutes a region of instability in adenoviral vector constructs.
Removal of this region from adenoviral expression constructs results in greatly improved vector stability. Therefore, 'improved vectors expressing a transgene under the control of an intron A-deleted CMV promoter constitute a further aspect of this invention.
These adenoviral vectors are useful for generating recombinant adenovirus vaccines against human immunodeficiency virus (HIV). In particular, the first generation adenovirus vectors disclosed herein are utilized to construct and generate adenovirus-based HIV-1 vaccines which contain HIV-1 Gag, HIV-1 Pol and/or HIV-1 Nef polynucleotide pharmaceutical products, and biologically active modifications thereof. Host administration of the recombinant, replication-deficient adenovirus vaccines described herein results in expression of HIV-1 Gag, HIV-1- Pol and/or Nef protein or immunologically relevant modifications thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Gag, HIV-Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef, and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The HIV adenovirus vaccines of the present invention, when administered alone or in a combined modality and/or prime/boost regimen, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
BACKGROUND OF THE INVENTION
Human Immunodeficiency Virus-1 (HIV-1) is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders. HIV-1 is an RNA virus of the Retroviridae family and exhibits the 5' LTR-gag pol-env-LTR 3' organization of all retroviruses. The integrated form of HIV-1, known as the provirus, is approximately 9.8 Kb in length. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Envy, the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).
The gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV
protease, a product of the pol gene. The mature p55 protein products are p17 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
The pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting. The viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, p15) activities.

The nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
The e~zv gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gp160) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gp120) and the transmembrane kDa envelope glycoprotein (gp41). Gp120 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
The tat gene encodes a long form and a short form of the Tat protein, a RNA
binding protein which is a transcriptional transactivator essential for HIV-1 replication.
The rev gene encodes the 13 kDa Rev protein, a RNA binding protein. The Rev protein binds to a region of the viral RNA termed the Rev response element (RRE). The Rev protein promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm. The Rev protein is required for HIV late gene expression and in turn, HIV replication.
Gp120 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules. X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a RS (T-cell line tropic) virus interacts with a CD4/CCRS receptor complex.
After gp120 binds to CD4, gp41 mediates the fusion event responsible for virus entry.
The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase. The viral DNA, known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles. Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS.
Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.

Destruction of CD4 helper T lymphocytes, which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection. The loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.
Effective treatment regimens for HIV-1 infected individuals have become available recently. However, these drugs will not have a significant impact on the disease in many parts of the world and they will have a nunimal impact in halting the spread of infection within the human population. As is true of many other infectious diseases, a significant epidemiologic impact on the spread of HIV-1 infection will only occur subsequent to the development and introduction of an effective vaccine.
There are a number of factors that have contributed to the lack of successful vaccine development to date. As noted above, it is now apparent that in a chronically infected person there exists constant virus production in spite of the presence of anti-humoral and cellular immune responses and destruction of virally infected cells. As in the case of other infectious diseases, the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response. Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection. A second factor is the considerable genetic variability of the virus. Although anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants. Given this latter observation, it would be useful to identify immunogens and related delivery technologies that are likely to elicit anti-HIV-1 cellular immune responses. It is known that in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (NIFiC) class I
proteins.
CD8+ T lymphocytes recognize antigen in association with class I MHC via the T
cell receptor (TCR) and the CD8 cell surface protein. Activation of naive CD8'" T
cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins.
Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4+ T lymphocytes which recognize antigen associated with MHC class II
molecules via TCR and CD4 engagement.
European Patent Applications 0 638 3I6 (Published February 15, 1995) and 0 586 076 (Published March 9, 1994), (both assigned to American Home Products Corporation) describe replicating adenovirus vectors carrying an HIV gene, including env or gag. Various treatment regimens were used with chimpanzees and dogs, some of which included booster adenovirus or protein plus alum treatments.
Replication-defective adenoviral vectors harboring deletions in the El region are known, and recent adenoviral vectors have incorporated the known packaging repeats into these vectors; e.g., see EP 0 707 071, disclosing, inter alia, an adenoviral vector deleted of El sequences from base pairs 459 to 3328; and U.S. Patent No.
6,033,908, disclosing, inter alia, an adenoviral vector deleted of base pairs 459-3510.
The packaging efficiency of adenovirus has been taught to depend on the number of incorporated individual A (packaging) repeats; see, e.g., Grable and Hearing, 1990 J.
Virol. 64(5):2047-2056; Grable and Hearing, 1992 J. Virol. 66(2):723-731.
Larder, et al., (1987, Nature 327: 716-717) and Larder, et al., (1989, Proc.
Natl. Acad. Sci. 86: 4803-4.807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.
Davies, et al. (1991, Science 252:, 88-95) disclose the crystal structure of the RNase H domain of HIV-1 Pol.
Schatz, et al. (1989, FEBS Left. 257: 311-314) disclose that mutations G1u478G1n and His539Phe in a complete HIV-1 RT/RNase H DNA fragment results in defective RNase activity without effecting RT activity.
Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.
Leavitt, et al. (1993, J. Biol. Claem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show.differing effect on HIV-1 integrase (IN) activity.
Wiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HIV-1 IN
and viral replication functions.

It would be of great import in the battle against AIDS to produce a prophylactic- and/or therapeutic-based HIV vaccine which generates a strong cellular immune response against an HIV infection. The present invention addresses and meets these needs by disclosing a class of adenovirus vaccines which, upon host administration, express codon optimized and modified versions of the HIV-1 genes, gag, pol and nef. These recombinant, replication-defective adenovirus vaccines may be administered to a host, such as a human, alone or as part of a combined niodality regimen and/or prime-boost vaccination regimen~with components of the present invention and/or a distinct viral HIV DNA vaccine, non-viral HIV DNA vaccine, HIV
subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIV
vaccine.
SUMMARY OF THE INVENTION
The present invention relates to enhanced replication-defective recombinant adenovirus vaccine vectors and associated recombinant, replication-deficient adenovirus vaccines which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of H1V-1 Gag, HIV-Pol and HIV-1 Nef. The adenovirus vaccines of the present invention express HIV
antigens and provide for improved cellular-mediated immune responses upon host administration. Potential vaccinees include but are not limited to primates and especially humans and non-human primates, and also include any non-human mammal of commercial or domestic veterinary importance. An effect of the improved recombinant adenovirus-based vaccines of the present invention should be a lower transmission rate to previously uninfected individuals (i.e., prophylactic applications) andlor reduction in the levels of the viral loads within an infected individual (i.e., therapeutic applications), so as to prolong the asymptomatic phase of HIV-1 infection. In particular, the present invention relates to adenoviral-based vaccines which encode various forms of codon optimized HIV-1 Gag (including but in no way limited to p55 versions of codon optimized full length (FL) Gag and tPA-Gag fusion proteins), HIV-1 Pol, HIV-1 Nef, and selected modifications of immunological relevance. The administration, intracellular delivery and expression of these adenovirus vaccines elicit a host CTL and Th response. The preferred replication-defective recombinant adenoviral vaccine vectors include but are not limited to synthetic DNA molecules which (1) encode codon optimized versions of wild type HIV-1 Gag; (2) encode codon optimized versions of HIV-1 Pol; (3) encode codon optimized versions of HIV-1 Pol fusion proteins; (4) encode codon optimized versions of modified HIV-1 Pol proteins and fusion proteins, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and 1N activity within the host cell; (5) encode codon optimized versions of wild type HIV-1 Nef; (6) codon optimized versions of HIV-1 Nef fusion proteins;
and/or (7) codon optimized versions of HIV-1 Nef derivatives, including but not limited to ~aef modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations. The Nef-based fusion and modified proteins, disclosed within this specification and expressed from an adenoviral-based vector vaccine this specification, may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response. Examples of HIV-1 Gag, Pol and/or Nef fusion proteins include but are not limited to fusion of a leader or signal peptide at the NHZ-teriminal portion of the viral antigen coding region. Such a leader peptide includes but is not limited to a tPA leader peptide.
The adenoviral vector utilized in construction of the HIV-1 Gag-, HIV-1 Pol-and/or HIV-1 Nef based vaccines of the present invention may comprise any replication-defective adenoviral vector which provides for enhanced genetic stability of the recombinant adenoviral genome through large scale production and purification of the recombinant virus. In other words, an HTV-1 Gag-, Pol- or Nef based adenovirus vaccine of the present invention is a purified recombinant, replication-defective adenovirus which is shown to be genetically stable through multiple passages in cell culture and remains so during large scale production and purification procedures. Such a recombinant adenovirus vector and harvested adenovirus vaccine lends itself to large scale dose filling and subsequent worldwide distribution procedures which will be demanded of an efficacious monovalent or multivalent HIV
vaccine. The present invention meets this basic requirement with description of a replication-defective adenoviral vector and vectors derived therefrom, at least partially deleted in E1, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome. A preferred embodiment of the instant invention comprises base pairs 1-450 of a wildtype adenovirus. In other preferred embodiments, the replication -defective adenoviral vector has, in addition thereto, a region 3' to the El-deleted region comprising base pairs 3511.-3523.
Basepairs 342-4.50 (more particularly, 400-450) constitute an extension of the 5'region of previously disclosed vectors carrying viral antigens, particularly HIV
antigens (see, e.g., PCT International Application PCTlCTS00/18332, published January 11, 2001 (WO 01/02067), which claims priority to U.S. Provisional Application Serial Nos. 60/142,631 and 60/148,981, filed 7/6/1999 and 8/13/1999, respectively; these documents herein incorporated by reference. Applicants have found that extending the 5' region further into the El gene into the disclosed vaccine vectors incorporated elements found to be important in optimizing the packaging of the virus.
As compared to previous vectors not comprising basepairs from about 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome, vectors comprising the above region exhibited enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, a more potent virus effect, allowing lower doses of virus to be used to generate equivalent immunity; and a greater cellular-mediated immune response than replication-deficient vectors not comprising this region (basepairs 1-450).
Even more important, adenoviral constructs derived therefrom are very stable genetically in large-scale production, particularly those comprising an expression cassette under the control of a hCMV promoter devoid of intron A. This is because Applicants have surprisingly found that the intron A portion of the hCMV promoter constituted a region of instability when employed in adenoviral vectors. Applicants have, therefore, identified an enhanced adenoviral vector which is particularly suited for use in gene therapy and nucleotide-based vaccine=vectors which, favorably, lends itself to large scale propagation.
A preferred embodiment of this invention is a replication-defective adenoviral vector in accordance with the above description wherein the gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.
In preferred embodiments, the E1 gene, other than that contained within basepairs 1-450 or, alternatively, that contained within base pairs 1-450 and 3523 has been deleted from the adenoviral vector, and the gene expression cassette has replaced the deleted El gene. In other preferred embodiments, the replication defective adenovirus genome does not have a functional E3 gene, or the E3 gene has been deleted. Most preferably, the E3 region is present within the adenoviral genome.
Further preferred embodiments are wherein the gene expression cassette is in an El anti-parallel (transcribed in a 3' to 5' direction relative to the vector backbone) s orientation or, more preferably, an El parallel (transcribed in a 5' to 3' direction relative to the vector backbone) orientation.
Further embodiments relate to a shuttle plasmid vector comprising: an adenoviral portion and a plasmid portion, wherein said adenovirus portion comprises:
a) a replication defective adenovirus genome, at least partially deleted in El, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair (preferably, 1-450) of the wildtype adenovirus genome and, preferably, in addition thereto, basepairs 3511-3523 of a wildtype adenovirus sequence; and b) a gene expression cassette comprising: (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a);and (c) a transcription terminator and/or a polyadenylation site.
Other aspects of this invention include a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and (b) harvesting the resultant adenoviral vectors.
To this end, the present invention particularly relates to harvested recombinant, replication defective virus derived from a host cell, such as but not limited to 293 cells or PER.C6~ cells, -including but not limited to harvested virus related to any of the MRKAdS vector backbones, with or without an accompanying transgene, including but not limited to the HIV-1 antigens described herein.
An HIV-1 vaccine is represented by any harvested, recombinant adenovirus material which expresses any one or more of the HIV-1 antigens disclosed herein. This harvested material may then be purified, formulated and stored prior to host administration.
Another aspect of this invention is a method of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising:
a) a recombinant, replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus cis-acting adenovirus packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) and, preferably in addition thereto, base pairs 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.
Tn view of the efficacious nature of the adenoviral and/or DNA plasmid vaccines described herein, the present invention relates to all methodology regarding administration of one or more of these adenoviral and/or DNA plasmid vaccines to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences. As discussed herein, such a treatment regimen may include a monovalent or multivalent composition, various combined modality applications, and/or a prime/boost regimen to as to optimize antigen expression and a concomitant cellular-mediated and/or humoral immune response upon inoculation into a living vertebrate tissue. Therefore, the present invention provides for methods of using the adenoviral and/or DNA plasmid vaccines disclosed herein within the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of the gag, pol and/or nef-based vaccines.
To this end, the present invention relates in part to methods of generating a cellular immune response in a vaccinee, preferably a human vaccinee, wherein the individual is given more than one administration of adenovirus vaccine vector, and it may be given in a regimen accompanied by the administration of a plasmid vaccine.
The plasmid vaccine (also referred to herein as a "DNA plasmid vaccine" or "vaccine plasmid" comprises a nucleic acid encoding a protein or an immunologically relevant portion thereof, a heterologous promoter operably linked to the nucleic acid sequence, and a transcription terminator or a polyadenylation signal (such as bGH or SPA, respectively). There may be a predetermined minimum amount of time separating the administrations. The individual can be given a first dose of plasmid vaccine, and then a second dose of plasmid vaccine. Alternatively, the individual may be given a first dose of adenovirus vaccine, and then a second dose of adenovirus vaccine. In other embodiments, the plasmid vaccine is administered first, followed after a time by administration of the adenovirus vaccine. Conversely, the adenovirus vaccine may be administered first, followed by administration of plasmid vaccine after a time. In these embodiments, an individual may be given multiple doses of the same adenovirus serotype in either viral vector or plasmid form, or the virus may be of to differing serotypes. In the alternative, a viral antigen of interest can be first delivered via a.viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and venezuelan equine encephilitis virus.
The present invention also relates to multivalent adenovirus vaccine compositions which comprise Gag, Pol and Nef components described herein; see, e.g., Example 29 and Table 25. Such compositions will provide for an enhanced cellular immune response subsequent to host administration, particularly given the genetic diversity of human MHCs and of circulating virus. Examples, but not limitations, include MRKA.dS-vector based multivalent vaccine compositions which provide for a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components) composition. Such a mutlivalent vaccine may be filled for a single dose or may consist of multiple inoculations of each individually filled component; and may in addition be part of a prime/boost regimen with viral or non-viral vector vaccines as introduced in the previous paragraph. To this end, preferred compositions are MRKAd5 adenovirus used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
The concept of a "combined modality" as disclosed herein also covers the alternative mode of administration whereby multiple HIV-1 viral antigens may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example, a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possibly a "2+1" divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAdS backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence.
Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES). Therefore, a multivalent vaccine delivered as a single, or possibly a second harvested recombinant, replication-deficient adenovirus is contemplated as part of the present invention.

Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly if pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine.
Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.
It is an object of the present invention to provide for enhanced replication-defective recombinant adenoviral vaccine vector backbones. These recombinant adenoviral backbones may accept one or more transgenes, which may be passaged through cell culture for growth, amplification and harvest.
It is a further object to provide for enhanced replication-defective recombinant adenoviral vaccine vectors which encode various transgenes.
It is also an object of the present invention to provide for a harvested recombinant, replication-deficient adenovirus which shows enhanced growth and amplification rates while in combination with increased virus stability after continuous passage in cell culture. Such a recombinant adenovirus is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.
To this end, it is an object of the present invention to provide for (1) enhanced replication-defective recombinant adenoviral vaccine vectors as described herein which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HIV-1 Pol and HIV-1 Nef, and (2) harvested, purified recombinant replication-deficient adenovirus generated by passage of the adenoviral vectors of (1) through one or multiple passages through cell culture, including but not limited to passage through 293 cells or PER.C6~
cells.

It is also an object of the present invention to provide for recombinant adenovirus harvested by one or multiple passages through cell culture. As relating to recombinant adenoviral vaccine vector, this recombinant virus is harvested and formulated for subsequent host administration.
It is also an object of the present invention to provide for replication-defective adenoviral vectors wherein at least one gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.
It is also an object of the present invention to provide for a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors;
vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and (b) harvesting the resultant adenoviral vectors.
It is a further object of the present invention to provide for methods of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising a) a replication defective adenoviral vector, at least partially deleted in EI, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about 450 (preferably, 1-4.50) and, preferably, 3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.
It is also an object of the present invention to provide various alternatives for vaccine administration regimes, namely administration of one or more adenoviral and/or DNA plasmid vaccines described herein to provide effective immunoprophylaxis for uninfected individuals or a therapeutic treatment for HIV
infected patients. Such processes include but are not limited to multivalent vaccine compositions, various combined modality regimes as well as various prime/boost alternatives. These methods of administration, relating to vaccine composition and/or scheduled administration, will increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

As used throughout the specification and claims, the following definitions and abbreviations are used:
"HAART" refers to -- highly active antiretroviral therapy --.
"first generation" vectors are characterized as being replication-defective.
They typically have a deleted or inactivated El gene region, and preferably have a deleted or inactivated E3 gene region as well.
"AEX" refers to Anion Exchange chromatography.
"QPA" refers to Quick PCR-based Potency Assay.
"bps" refers to basepairs.
"s" or "str" denotes that the transgene is in the E1 parallel or "straight"
orientation.
"PBMCs" refers to peripheral blood monocyte cells.
"FL" refers to full length.
"FLgag" refers to a full-length optimized gag gene, as shown in Figure 2.
"Ad5-Flgag" refers to an adenovirus serotype 5 replication deficient virus which carries an expression cassette which comprises a full length optimized gag gene under the control of a CMV promoter.
"Promoter" means a recognition site on a DNA strand to which an RNA
polymerase binds. The promoter forms an initiation complex with RNA polymerase to initiate and drive transcriptional activity. The complex can be modified by activating sequences such as enhancers or inhibiting sequences such as silencers.
"Leader" means a DNA sequence at the S' end of a structural gene which is transcribed along with the gene. This usually results a protein having an N-terminal peptide extension, often referred to as a pro-sequences.
"Intron" means a section of DNA occurring in the middle of a gene which does not code for an amino acid in the gene product. The precursor RNA of the intron is excised and is therefore not transcribed into mRNA not translated into protein.
"Immunologically relevant" or "biologically active" means (1) with regards to a viral protein, that the protein is capable, upon administration, of eliciting a measurable immune response within an individual sufficient to retard the propagation and/or spread of the virus and/or to reduce the viral load present within the individual;
or (2) with regards to a nucleotide sequence, that the sequence is capable of encoding for a protein capable of the above.
"Cassette" refers to a nucleic acid sequence which is to be expressed, along with its transcription and translational control sequences. By changing the cassette, a vector can express a different sequence.

"bGHpA" refers to the bovine growth hormone transcription terminator/polyadenylation sequence.
"tPAgag" refers to a fusion between the leader sequence of the tissue plasminogen activator leader sequence and an optimized HIV gag gene, as exemplified in Figure 30A-B, whether in a DNA or adenovirus-based vaccine vector.
Where utilized, "IA" or "inact" refers to an inactivated version of a gene (e.g.
IApol).
"MCS" is "multiple cloning site".
In general, adenoviral constructs, gene constructs are named by reference to the genes contained therein. For example:
"Ad5 HIV-1 gag", also referred to as the original HIV-1 gag adenoviral vector, is a vector containing a transgene cassette composed of a hCMV intron A
promoter, the full length version of the human codon-optimized HIV-1 gag gene, and the bovine growth hormone polyadenylation signal. The transgene was inserted in the El antiparallel orientation in an E1 and E3 deleted adenovector.
"MRK Ad5 HIV-1 gag" also referred to as "MRKA.dSgag" or "Ad5gag2" is an adenoviral vector taught herein which is deleted of El, comprises basepairs and 3511-3523, and has a human codon-optimized HIV-1 gene in an E1 parallel orientation under the control of a CMV promoter without intron A. The construct also comprises a bovine growth hormone polyadenylation signal.
"pV lJnsHIVgag", also referred to as "HIVFT..gagPR9901", is a plasmid comprising the CMV immediate-early (IE) promoter.and intron A, a full-length codon-optimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone.
"pVlJnsCMV(no intron)-FLgag-bGHpA" is a plasmid derived from pVlJnsHIVgag which is deleted of the intron A portion of CMV and which comprises the full length HIV gag gene. This plasmid is also referred to as "pVlJnsHIVgag-bGHpA", pVlJns-hCMV-FL-gag-bGHpA" and "pVlJnsCMV(no intron) + FLgag +
bGHpA".
"pVlJnsCMV(no intron)-FLgag-SPA" is a plasmid of the same composition as pVlJnsCMV(no intron)-FLgag-bGHpA except that the SPA termination sequence replaces that of bGHpA. This plasmid is also referred to as "pVIJns-HIVgag-SPA"
and pVIJns-hCMV-FLgab SPA".
"pdelElsplA" is a universal shuttle vector with no expression cassette (i.e., no promoter or polyA). The vector comprises wildtype adenovirus serotype 5 (Ad5) sequences from by 1 to by 341 and by 3524 to by 5798, and has a multiple cloning site between the Ad5 sequences ending 341 by and beginning 3524 bp. This plasmid is also referred to as the original Ad 5 shuttle vector.
"MRKpdelElsplA" or "MRKpdelEl(Pac/pIX/pack450)" or "MRKpdelEl(Pac/pIX/pack450)Clal" is a universal shuttle vector with no expression cassette (i.e. no promoter or polyA) comprising wildtype adenovirus serotype 5 (Ad5) sequences from bp1 to bp450 and by 3511 to by 5798. The vector has a multiple cloning site between the Ad5 sequence ending 450 by and beginning 3511 bp:
This shuttle vector may be used to insert the CMV promoter and the bGHpA fragments in both the straight ("str". or E1 parallel) orientation or in.the opposite (opp.
or E1 antiparallel) orientation) "MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.)" is still another shuttle vector which is the modified vector that contains the CMV promoter (no intronA) and the bGHpA fragments: The expression unit containing the hCMV
promoter (no intron A) and the bovine growth hormone polyadenylation signal has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BglII site will ensure the direction of transcription of the transgene will be Ad5 E1 parallel when inserted into the MRKpAdS(El/E3+)Cla1 pre-plasmid. This shuttle vector, as shown in Figures 22 and 23, was used to insert the respective IApol and G2A,LLAA nef genes directly into.
"MRKpdelEl-CMV(no intron)-FLgag-bGHpA" is a shuttle comprising Ad5 sequences from basepairs 1-4.50 and 3511-5798, with an expression cassette containing human CMV without intron A, the full-length human codon-optimized HIV gag gene and bovine growth hormone polyadenylation signal. This plasmid is also referred to as "MRKpdelEl shuttle +hCMV-FL-gag-BGHpA"
"MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA" is an adenoviral vector comprising all Ad5 sequences except those nucleotides encompassing the El region (from 451-3510), a human CMV promoter without intron A, a full-length human codon-optimized HIV gag gene, and a bovine growth hormone polyadenylation signal. This vector is also referred to as "MRKpAdHVE3 + hCMV-FL-gag-BGHpA", "MRKpAdSHIV-lgag", "MRKpAdSgag", "pMRKAdSgag" or "pAd5gag2'.'.
"pVlJns-H1V-pol inact(opt)" or "pVlJns-HIV IA pol (opt) is the inactivated Pol gene (contained within SEQ >I7 N0:3) cloned into the BglII site of VlJns (Figure 17A-C). As noted herein, various derivatives of HIV-1 pol may be cloned into a plasmid expression vector such as VlJns or VlJns-tPA, thus serving directly as DNA
vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.

"MRKpdel+hCMVmin+FL-pol+bGHpA(s)" is the "MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.)" shuttle mentioned above which contains the IA pol gene is the proper orientation. This shuttle vector is used in a bacterial recombination with MRKpAd(E1-/E3+)Clal.
"MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+", also referred to herein as "pMRKAd5po1", is the pre-adenovirus plasmid which comprises a CMV-pol inact(opt)-pGHpA construct. The construction of this pre-adenovirus plasmid is shown in Figure 22.
"pVlJns/nef (G2A,LLAA)" or "VlJns/opt nef (G2A,LLAA)" comprises codon optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175 (SEQ ID N0:13; which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662). This fragment is subcloned into the Bgl II site of VlJns and/orVlJns-tPA (Figures 16A-B). As noted above for HIV-1 pol, HIV-1 nef constructs may be cloned into a plasmid expression vector such as VlJns or VlJns-tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.
"MRKpdelElhCMVminFL-nefBGHpA(s)", also referred to herein as "pMRKAdSnef', is the pre-adenovirus plasmid which comprises a CMV-nef (G2A,LLAA) codon optimized sequence. The construction of this pre-adenovirus plasmid is shown in Figure 23.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the original HIV-1 gag adenovector (AdSHIV-lgag). This vector is disclosed in PCT International Application No. PCT/LTS00/18332 (WO
01/02607) filed July 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S. Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference.
Figure 2 shows the nucleic acid sequence (SEQ ID NO: 29) of the optimized human HIV-1 gag open reading frame.
Figure 3 shows diagrammatically the new transgene constructs in comparison wLth the original gag transgene.
Figure 4 shows the modifications made to the original adenovector backbone in the generation of the novel vectors of the instant invention.

Figure 5 shows the virus mixing experiments that were~carried out to determine the effects of the addition made to the packaging signal region (Expt. #1) and the E3 gene on viral growth (Expt. #2). The bars denote the region of modifications made to the E1 deletion.
Figure 6 shows an autoradiograph of viral DNA analysis following the viral mixing experiments described in Examples 6 and 7.
Figures 7A, 7B and 7C are as follows: Figure 7A shows the hCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO
adenovector backbones. Both E1 parallel and El antiparallel transgene orientation are represented. Figure 7B shows the hCMV-Flgag-SPA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Again, both El parallel and E1 antiparallel transgene orientation are represented. Figure 7C
shows the mCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Once again, both El parallel and El antiparallel transgene orientation are represented.
Figure 8A shows the experiment designed to test the effect of transgene orientation.
Figure 8B shows the experiments designed to test the effect of polyadenylation signal.
Figure 9 shows viral DNA from the four adenoviral vectors tested (Example 12) at P5, following BstEll digestion.
Figure 10 shows viral DNA analysis of passages 11 and 12 of MRKpAdHVE3, MRKAdSHIV-lgag, and MRKAdSHIV-lgagE3-.
Figure 11 shows viral DNA analysis (HindIll digestion) of passage 6 MRKpAdHVE3 and MRKAdSHIV-lgag used to initiate the viral competition study.
The last two lanes are passage 11 analysis of duplicate passages of the competition study (each virus at MOI of 280 viral particles).
Figure 12 shows viral DNA analysis by Hi~ad III digestion on high passage numbers for MRKAdSHIV-lgag in serum-containing media with collections made at specified times. The first lane shows the lkb DNA size marker. The other lanes represent pre-plasmid control (digested with Pacl and Hi~adIII), MRKAdSHIV-lgag at P16, P19, and P21.
Figure 13 shows serum anti-p24 levels at 3 wks post i.m. immunization of balb/c mice (n=10) with varying doses of several Adgag constructs: (A) MRK Ad5 HIV-1 gag (through passage 5); (B) MRKAd5 hCMV-FLgag-bGHpA (E3-); (C) MRKAd5 hCMV-FLgag-SPA (E3+); (D) MRKAd5 mCMV-FLgag-bGHpA (E3+);
is (E) research lot (293 cell-derived) of AdSHIV-1 gag; and (F) clinical lot (AdSgagFN0001) of AdSHIV-1 gag. Reported are the geometric mean titers (GMT) for each cohort along with the standard error bars.
Figure 14 shows a restriction map of the pMRKAdSHIV-lgag vector.
Figures 15A-X illustrates the nucleotide sequence of the pMRKAdSHIV-lgag vector (SEQ m N0:27.[coding] and SEQ m N0:28 [non-coding]).
Figures 16A-B shows a schematic representation of DNA vaccine expression vectors VlJns (A) and VlJns-tPA (B), which are utilized for HIV-1 gag, pol and nef constructs in various DNA/viral vector combined modality regimens as disclosed herein.
Figures 17A-C shows the nucleotide (SEQ m N0:3) and amino acid sequence (SEQ ID N0:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.
Figure 18 shows codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-pol inact(opt) (contained within SEQ m NOs:

and 8, respectively). The underlined portion represents the NH2-terminal region of IA-Pol.
Figures 19A-B show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef. The wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide.
WT, wild type sequence (SEQ ll~ N0:19); opt, codon-optimized sequence (contained within SEQ ID NO:1). The Nef amino acid sequence is shown in one-letter code (SEQ m N0:2).
Figures 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors VlJns/nef (Figure 20A), V lJns/nef(G2A,LLAA) (Figure 20B), V lJns/tpanef (Figure 20C) and V lJns/tpanef(LLAA) (Figure 20C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters;
nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. VlJns/tpanef and VlJns/tpanef(LLAA) have identical sequences at the junctions.
Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucine174 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the. putative leader peptide cleavage sites are indicated with "*", and a exogenous serine residue introduced during the construction of the mutants is underlined.
Figure 22 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Pol.
Figure 23 snows diagrammatically the construction of the pre-adenovirus plasmid construct, MRK.AdSNef.
Figure 24 shows a comparison of Glade B vs. Glade C anti-gag T cell responses in Glade B HIV-infected subjects.
Figure 25 shows a comparison of Glade B vs. Glade C anti-nef T cell responses in Glade B HTV-infected subjects.
Figures 26A-AO illustrates the nucleotide sequence of the pMRKAd5HIV-lpol adenoviral vector (SEQ )D N0:32 [coding] and SEQ m N0:33 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ m N03).
Figures 27A-AM illustrates the nucleotide sequence of the pMRKAd5HIV-1 nef adenoviral vector (SEQ )D N0:34 [coding] and SEQ DJ N0:35 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ m N013).
Figure 28 shows the stability of MRKAdS vectors comprising various promoter fragments (hCMV or mCMV) and terminations signals (bGH or SPA) in E3(+) or E3(-) backbones.
Figures 29A and B shows the anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi time points (Figure 29A) and the timcourse QPA supernatant titers (Figure 29B) for MRKAdSgag, MRKAd5po1 and MRK.AdSnef.
Figure 30 shows the nucleotide sequence (SEQ DJ N0:36) and amino acid sequence (SEQ >D N0:37) comprising the open reading frame of a representative tPA-gag fusion for use in the DNA and/or adenoviral vaccine disclosed herein.
Figure 31 shows the intracellular yTFN staining of PBMCs collected at week 10 (post DNA prime) and week 30 (post Ad boost). The cells were stimulated overnight in the presence or absence of the gag peptide pool. They were subsequently stained using fluorescence-tagged anti-CD3, anti-CDB, anti-CD4, and anti-~yIFN
monoclonal antibodies. Each plot.shows all CD3+ T cells which were segregated in .
terms of positive staining for surface CD8 and ~yIFN production. The numbers in the upper right and lower right quadrants of each plot are the percentages of CD3+
cells that were CD8~~yIFN+ and CD4~yIFN+, respectively.
Figure 32 shows a comparison of single-modality adenovirus immunization with DNA + adjuvant prime/adenovirus boost immunization.

Figures 33A-B show the nucleotide sequence (SEQ ll~ NO: 38) of the open reading frame for the gag-IApol fusion of Example 29.
Figures 34A-B show the protein sequence (SEQ ID N0:39) of the gag-IApol fustion frame.
DETAILED DESCRIPTION OF THE INVENTION
A novel replication-defective, or "first generation," adenoviral vector suitable for use in gene therapy or nucleotide-based vaccine vectors is described. This vector is at least partially deleted in E1 and comprises a wildtype adenovirus cis-acting packaging region from about base pair 1 to between about base pair 342 (more preferably, 400) to about 458 (preferably, 1-450) and, preferably, 3511-3523 of a wild-type adenovirus sequence. It has been found that a vector of this description possesses enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, and is more potent allowing lower doses of virus to be used to generate equivalent immunity. The vector, furthermore, generates a harvested recombinant adenovirus which shows greater cellular-mediated immune responses than replication-deficient vectors not comprising this region (basepairs 342-450).
Adenoviral constructs derived from these vectors are, further, very stable genetically, particularly those comprising a transgene under the control of a hCMV promoter devoid of intron A. Viruses in accordance with this description were passaged continually and analyzed; see Example 12. Each virus analyzed maintained it correct genetic structure. Analysis was also carried out under propagation conditions similar to that performed in large scale production. Again, the vectors were found to possess enhanced genetic stability; see Figure 12. Following 21 passages, the viral DNA
showed no evidence of reaiTangement, and was highly reproducible from one production lot to the next. The outcome of all relevant tests indicate that the adenoviral vector is extremely well suited for large-scale production of recombinant, replication-deficient adenovirus, as shown herein with the data associated with Figure 28.
A preferred adenoviral vector in accordance with this description is a vector comprising basepairs 1-450, which is deleted in E3. This vector c.an accommodate up to approximately 7,500 base pairs of foreign DNA inserts (or exogenous genetic material). Another preferred vector is one retaining E3 which comprises basepairs 1-450. A preferred vector of this description is an E3+ vector comprising basepairs 1-450 and 3511-3523. This vector, when deleted of the region spanning basepairs 3510, can accommodate up to approximately, 4,850 base pairs of foreign DNA
inserts (or exogenous genetic material). The cloning capacities of the above vectors have been determined using 105% of the wildtype Ad5 sequence as the upper genome size limit.
Wildtype adenovirus serotype 5 is used as the basis for the specific basepair numbers provided throughout the specification. The wildtype adenovirus serotype 5 sequence is known and described in the art; see, Chroboczek et al., 1992 J.
Virology 186:280, which is hereby incorporated by reference. Accordingly, a particular embodiment of the instant invention is a vector based on the adenovirus serotype 5 sequence. One of skill in the art can readily identify the above regions in other adenovirus serotypes (e.g., serotypes 2, 4, 6, 12, 16, 17, 24, 31, 33, and 42), regions defined by basepairs corresponding to the above basepair positions given for adenovirus serotype 5. Accordingly, the instant invention encompasses all adenoviral vectors partially deleted in E1 comprising basepairs corresponding to 1-450 (particularly, 342-450) and, preferably, 3511-3523 of a wild-type adenovirus serotype 5 (Ad5) nucleic acid sequence. Particularly preferred embodiments of the instant invention are those derived from adenoviruses like Ad5 which are classified in subgroup C (e.g., Ad2).
Vectors in accordance with the instant invention are at least partially deleted in El. Preferably the E1 region is completely deleted or inactivated. Most preferably, the region deleted of El is within basepairs 451-3510. It is to be noted that the extended 5' and 3' regions of the disclosed vectors are believed to effectively reduce the size of the EI deletion of previous constructs without overlapping any part of the ElA/E1B gene present in the cell line used, i.e., the PER.C6° cell line transefected with base pairs 459-3510. Overlap of adenoviral sequences is avoided because of the possibility of recombination. One of ordinary skill in the art can certainly appreciate that the instant invention can, therefore, be modified if a different cell line transfected with a different segment of adenovirus DNA is utilized. For purposes of exemplification, a 5' region of base pairs 1 to up to 449 is more appropriate if a cell line is transfected with adenoviral sequence from base pairs 450-3510. This holds true as well in the consideration of segments 3' to the E1 deletion.
Preferred embodiments of the instant invention possess an intact E3 region .
(i.e., an E3 gene capable of encoding a functional E3). Alternate embodiments have a partially deleted E3, an inactivated E3 region, or a sequence completely deleted of E3.
Applicants have found, in accordance with the instant invention, that virus comprising the E3 gene were able to amplify more rapidly compared with virus not comprising an E3 gene; see Figure 6 wherein a diagnostic CsCI band corresponding to the E3+
virus tested (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 by corresponding to the E3- virus. These results were obtained following a virus competition study involving mixing equal MOI ratio (1:1) of adenovectors both comprising the E3 gene and not comprising the E3 gene. This increased amplification capacity of the E3+ adenovectors was subsequently confirmed with growth studies;
see Table 4A, wherein the E3+ virus exhibit amplification ratios of 470, 420 and 320 as compared with the 115 and 40-50 of the E3- constructs.
As stated above, vectors in accordance with the instant invention can accommodate up to approximately 4,850 base pairs of exogenous genetic material for an E3+ vector and approximately 7,500 base pairs for an E3- vector.
Preferably, the insert brings the adenoviral vector as close as possible to a wild-type genomic size (e.g., for AdS, 35,935 basepairs). It is well known that adenovirus amplifies best when they are close to their wild-type genomic size.
The genetic material can be inserted in an El-parallel or an E1 anti-parallel orientation, as such is illustrated in Figure 7A, 7B, 7C and Figure 8A.
Particularly preferred embodiments of the instant invention, have the insert in an E1-parallel orientation. Applicants have found, via competition experiments with plasmids containing transgenes in differing orientation (Figure 8A), that vector constructs with the foreign DNA insert in an El-parallel orientation amplify better and actually out-compete E1-antiparallel-oriented transgenes. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the E1 parallel orientation as compared with the E1 anti-parallel version.
By passage 10, the only viral species observed was the adenovector with the transgene in the El parallel orientation for both transgenes tested.
Adenoviral vectors in accordance with the instant invention are particularly well suited to effectuate expression of desired proteins, one example of which is an HIV protein, particularly an HIV full length gag protein. Exogenous genetic material encoding a protein of interest can exist in the form of an expression cassette. A gene expression cassette preferably comprises (a) a nucleic acid encoding a protein of interest; (b) a heterologous piomoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription terminator..
The transcriptional promoter is preferably recognized by an eukaryotic RNA
polymerase. In a preferred embodiment, the promoter is a "strong" or "efficient"
promoter. An example of a strong promoter is the immediate early human cytomegalovirus promoter (Chapman et al, 1991 Nucl. Acids Res19:3979-3986, which is incorporated by reference), preferably without intronic sequences. Most preferred for use within the instant adenoviral vector is a human CMV promoter without intronic seqeunces, like intron A. Applicants have found that intron A, a portion of the human cytomegalovirus promoter (hCMV), constitutes a region of instability for adenoviral vectors. CMV without intron A has been found to effectuate (Examples 1-3) comparable expression capabilities in vitro when driving HIV gag expression and, furthermore, behaved equivalently to intron A-containing constructs in Balb/c mice irz vivo with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested (20 ~.g and 200 wg). Those skilled in the art will appreciate that any of a number of other known promoters, such as the strong inununoglobulin, or other eukaryotic gene promoters may also be used, including the EFl alpha promoter, the marine CMV promoter, Rous sarcoma virus (RSV) promoter, SV~O earlyllate promoters and the beta-actin promoter.
In preferred embodiments, the promoter may also comprise a regulatable sequence such as the Tet operator sequence. This would be extremely useful, for example, in cases where the gene products are effecting a result other than that desired and repression is sought.
Preferred transcription termination sequences present within the gene expression cassette are the bovine growth hormone terminator/polyadenylation signal (bGHpA) and the short synthetic polyA signal (SPA) of 50 nucleotides in length, defined as follows: AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGT-TTTTTGTGTG (SEQ 1D N0:26).
The combination of the CMV promoter (devoid of the intron A region) with the BGH terminator is particularly preferred although other promoter/terminator combinations in the context of FG adenovirus may also be used.
Other embodiments incorporate a leader or signal peptide into the transgene.
A preferred leader is that from the tissue-specific plasminogen activator protein, tPA.
Examples include but are not limited to the various tPA-gag, tPA-pol and tPA-nef adenovirus-based vaccines disclosed throughout this specification.
In view of the improved adenovirus vectors described herein, an essential portion of the present invention are adenoviral-based HIV vaccines comprising said adenovirus backbones which may be administered to a mammalian host, preferably a human host, in either a prophylactic or therapeutic setting. The HIV vaccines of the present invention, whether administered alone or in combination regimens with other viral- or non-viral-based DNA vaccines, should elicit potent and broad cellular immune responses against HIV that will either lessen the likelihood of persistent virus infection and/or lead to the establishment of a clinically significant lowered virus load subject to HIV infection or in combination with HAART therapy, mitigate the effects of previously established HIV infection (antiviral immunotherapy(ARI)). While any HIV antigen (e.g., gag, pol, nef, gp160, gp4l, gp120, tat, rev, etc.) may be utilized in the herein described recombinant adenoviral vectors, preferred embodiments include the codon optimized p55 gag antigen (herein exemplified as MRKAdSgag), pol and nef. Sequences based on different Clades of HIV-1 are suitable for use in the instant invention, most preferred of which are Clade B and Clade C. Particularly preferred embodiments are those sequences (especially, codon-optimized sequences) based on concensus Clade B sequences. Preferred versions of the MRKAd5po1 and MRKAd5nef series of adenoviral vaccines will encode modified versions of pol or nef, as discussed herein. Preferred embodiments of the MRKAd5HIV-1 vectors carrying HIV envelope genes and modifications thereof comprise the HIV codon-optimized env sequences of PCT International Applications PCT/US97/02294 and PCT/US97/10517, published August 28, 1997 (WO 97/31115) and December 24, 1997, respectively; both documents of which are hereby incorporated by reference.
A most preferred aspect of the instant invention is the disclosed use of the adenoviral vector described above to effectuate expression of HIV gag.
Sequences for many genes of many HIV strains are publicly available in GENBANK and primary, field isolates of HIV are available from the National Institute of Allergy and Infectious Diseases (NIAID) which has contracted with Quality Biological (Gaithersburg, MD) to make these strains available. Strains are also available from the World Health Organization (WHO), Geneva Switzerland. It is preferred that the gag gene be from an HIV-1 strain (CAM-1; Myers et al, eds. "Human Retroviruses and AIDS: 1995, IIA3-IIA19, which is hereby incorporated by reference). This gene closely resembles the consensus amino acid sequence for the Glade B (North American/European) sequence. Therefore, it is within the purview of the skilled artisan to choose an appropriate nucleotide sequence which encodes a specific HIV
gag antigen, or immunologically relevant portion thereof. As shown in Example 25, a Glade B or Glade C based p55 gag antigen will potentially be useful on a global scale.
As noted herein, the transgene of choice for insertion in to a DNA or MRKAd-based adenoviral vector of the present invention is a codon optimized version of p55 gag.
Such a MRKAdSgag adenoviral vector is documented in Example 11 and is at least referred to herein as MRKA.dSHIV-lgag. Of course, additional versions are contemplated, including but not limited to modifications such as promoter (e.g., mCMV for hCMV) and/or pA-terminadons signal (SPA for bGH) switching, as well as generating MRK Ad5 backbones with or without deletion of the Ad5 E3 gene.

The present invention also relates a series of MRKAd5po1-based adenoviral vaccines which are shown herein to generate cellular immune responses subsequent to administration in mice and non-human primate studies. Several of the MRKAdSpol series are exemplified herein. One such adenoviral vector is referred to as NIRK.AdShCMV-inact opt pol(E3+), which comprises the MRKAdS backbone, the hCMV promoter (no intron A), an inactivated pol transgene, and contains the Ad5 E3 gene in the adenoviral backbone. A second exemplified pre-adenovirus plasmid and concomitant virus is referred to as MRKAdShCMV-inact opt pol(E3-), which is identical to the former adenoviral vector except that the E3 is deleted. Both constructions contain a codon optimized, inactivated version of HIV-1 Pol, wherein at least the entire coding region is disclosed herein as SEQ ID N0:3 and the expressed protein is shown as SEQ >D N0:4 (see also Figure 17A-C and Table 1, which show targeted deletion for inactivated pol. This and other preferred codon optimized versions of HIV Pol as disclosed herein are essentially as described in U.S.
Application Serial No. 09/745,221, filed December 21, 2000 and PCT
International Application PCT/US00134724, also filed December 21, 2000, both documents which are hereby incorporated by reference. As disclosed in the above-mentioned documents, the open reading frame for these codon-optimized HIV-1 Pol-based DNA
vaccines are represented by codon optimized DNA molecules encoding codon optimized HIV-1 Pol (e.g. SEQ 1D N0:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence (e.g. SEQ )D N0:6), and especially preferable, and exemplified by the MRKAdS-Pol construct in e.g., Example 19, biologically inactivated.pol ("inact opt Pol"; e.g., SEQ ID N0:4) which is devoid of significant PR, RT, RNase or IN activity associated with wild type Pol. In addition, a construct related to SEQ TD N0:4 is contemplated which contains a leader peptide at the amino terminal region of the IA Pol protein. A specific construct is ligated within an appropriate DNA plasmid vector containing regulatory regions operatively linked to the respective HIV-1 Pol coding region, with or without a nucleotide sequence encoding a functional leader peptide. To this end, various HIV-1 Pol constructs disclosed herein relate to open reading frames for cloning to the enhanced first generation Ad vectors of the present invention (such a series of MRKA.d5po1 adenoviral vaccine vectors), including but not limited to wild type Pol (comprising the DNA molecule encoding WT opt Pol, as set forth in SEQ ID N0:2), tPA-opt WTPoI, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID N0:6), inact opt Pol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ 1D
N0:4), and tPA-inact opt Pol, (comprising the DNA molecule encoding tPA-inact opt Pol, as set forth in SEQ ID N0:8). The pol-based versions of enhanced first generation adenovirus vaccines elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans. As noted in the above, an effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.
The present invention further relates to a series of MRKAdSnef-based adenoviral vaccines which, similar to HIV gag and pol antigens, generate cellular immune responses subsequent to administration in mice and non-human primate studies. The MRKAdSnef series are exemplified herein by utilizing the improved MRK adenoviral backbone in combination with modified versions of HIV nef.
These exemplified MRKAdSnef vectors are as follows: (1) MRKAdShCMV-nef(G2A,LLAA) (E3+), which comprises the improved MRKAdS backbone, a human CMV promoter an intact Ad5 E3 gene and a modified nef gene: (2) MRKAdSmCMV-nef(G2A,LLAA) (E3+), which is the same as (1) above but substituting a murine CMV promoter for a human CMV promoter; and (3) MRKAdSmCMV-tpanef(LLAA) (E3+), which is the same as (2) except that the nef transgene is tpanef(LLAA).
Codon optimized versions of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference. Particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ B7 N0:9, while the expressed open reading frame is disclosed. herein as SEQ ID NO:10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NHZ-terminus of the HIV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ DJ NO:11, while the expressed open reading frame is disclosed herein as SEQ
TD N0:12. Another modified Nef optimized coding region relates to a DNA
molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ DJ N0:13, while the expressed open reading frame is disclosed herein as SEQ 117 N0:14. MRKAdSnef vectors (1) MRKAdShCMV-nef(G2A,LLAA) (E3+) and (2) MRKAdSmCMV-nef(G2A,LLAA) (E3+) contain this transgene. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ m N0:15, while the expressed open reading frame is disclosed herein as SEQ ID N0:16. The MRKAdSnef vector "MRKAdSmCMV-tpanef(LLAA) (E3+)" contains this transgene.
Along with the improved MRKAdSgag adenovirus vaccine vector described herein, generation of a MRKAd5po1 and MRKAdSnef adenovirus vector provide for enhanced HIV vaccine capabilities. Namely, the generation of this trio of adenoviral vaccine vectors, all shown to generate effective cellular immune responses subsequent to host administration, provide for the ability to administer these vaccine candidates not only alone, but preferably as part of a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components).
Therefore, a preferred aspect of the present invention are vaccine formulations and associated methods of administration and concomitant generation of host cellular immune responses associated with formulating three separate series of MRKAdS-based adenoviral vector vaccines. Of course, this MRKAdS vaccine series based on distinct HIV antigens promotes expanded opportunities for formulation of a divalent or trivalent vaccine, or possibly administration of separate formulations of one or more monovalent or divalent formulations within a reasonable window of time.
It is also within the scope of the present invention to embark on combined modality regimes which include multiple but distinct components from a specific antigen. An example, but certainly not a limitation, would be separate MRKAd5po1 vectors, with one vaccine vector expressing wild type Pol (SEQ ll~ N0:2) and another MRKAdSpol vector expressing inactivated Pol (SEQ ll~ N0:6). Another example might be separate MRKAdSnef vectors, with one vaccine vector expressing the tPA/LLAA version of Nef (SEQ ID N0:16) and another MRKAdSnef vector expressing the G2A,LLAA modified version of Nef (SEQ ID N0:14). Therefore, the MRK.AdS adenoviral vectors of the present invention may be used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention.
The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.
The present invention also relates to application of a mono-, dual-, or tri-modality administration regime of the MRKAdSgag, pol and nef adenoviral vaccine series in a prime/boost vaccination schedule. This prime/boost schedule may include any reasonable combination of the MRKA.dSgag, pol and nef adenoviral vaccine series disclosed herein. In addition, a prime/boost regime may also involve other viral and/or non-viral DNA vaccines. A preferable addition to an adenoviral vaccine vector regime includes but is not limited to plasmid DNA vaccines, especially DNA
plasmid vaccines that contain at least one of the codon optimized gag, pol and nef constructions, as disclosed herein.
Therefore, one aspect of this invention is the administration of the adenoviral vector containing the optimized gag gene in a prime/boost regiment in conjunction with a plasmid DNA encoding gag. To distinguish this plasmid from the adenoviral-containing shuttle plasmids used in the construction of an adenovirus vector, this plasmid will be referred to as a "vaccine plasmid" or "DNA plasmid vaccine".
Preferred vaccine plasmids for-use in this administration protocol are disclosed in pending U.S. patent application 09/017,981, filed February 3, 1998 and W098/34640, published August 13, 1998, both of which are hereby incorporated by reference.
Briefly, the preferred vaccine plasmid is designated V lJns-FLgag, which expresses the same codon-optimized gag gene as the adenoviral vectors of this invention (see Figure 2 for the nucleotide sequence of the exemplified optimized codon version of full length p55 gag). The vaccine plasmidbackbone, designated VlJns contains the CMV immediate-early (1E) promoter and intron A, a bovine growth hormone-derived polyadenylation and transcription termination sequence as the gene expression regulatory elements, and a minimal pUC backbone; see Montgomery et al., 1993, DNA Cell Biol. 12:777-783. The pUC sequence permits high levels of plasmid production in E. coli and has a neomycin resistance gene in place of an ampicillin resistance gene to provide selected growth in the presence of kanamycin.
Alternatively, a vaccine plasmid which has the CMV promoter deleted of intron A can be used. Those of skill in the art will recognize that alternative vaccine plasmid vectors may be easily substituted for these specific constructs, and this invention specifically envisions use of such alternative plasmid DNA vaccine vectors.
Another aspect of the present invention is a prime/boost regimen which includes a vaccine plasmid which encodes an HIV pol antigen, preferably a codon optimized form of pol and also preferably a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ 117 NOs: 2, 4, 6 and 8. The variety of potential DNA
plasmid vaccines which encode various biologically active forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DNA
molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIV-1 Pol proteins. The HIV-1 pol open reading disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as delivered via a recombinant adenoviral vaccine, especially an enhanced first generation recombinant adenoviral vaccine as described herein. Several embodiments of this portion of the invention are provided in detail below, namely DNA molecules which comprise a HIV-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human. Again, these DNA sequences are positioned appropriately within a recombinant adenoviral vector, such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIV-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response.
Again, these preferred, but in no way limiting, pol genes are as disclosed herein and essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/LTS00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference.
A third series of vaccine plasmids which are useful in a combined modality and/or prime/boost regimen are vaccine plasmids which encode an HIV nef antigen or biologically and/or immunologically relevant modification thereof. As noted elsewhere, preferred vaccine plasmids contain a codon optimized form of nef and also preferably comprise a nucleotide sequence which encodes a Nef antigen selected from the group of Nef antigens as shown in SEQ ID NOs: 10, 12, 14 and 16. These preferred nef coding regions are disclosed herein, as well as being described in U.S.
Application Serial No. 09!738,782, filed December 15, 2000 and PCT
International Application PCTlUS00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.
Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly is pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine.
Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.
Furthermore and in the alternative, multiple HIV-1 viral antigens, such as the MRK.AdS adenoviral vaccines disclosed herein, may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(-) or E3(+) background, preferably a E3 deleted backbone, or possible a "2+1"
divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same N1RK.AdS
backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES), as disclosed in International Publication No. WO 95/24485, which is hereby incorporated by . . reference. Figure 9 shows that the use of multiple promoters and termination sequences provide for similar growth properties, while Figure 28 shows that these MRKAdSgag-based vectors are also stable at least through passage 21. In the absence of the use of IRES-based technology, it is preferred that a distinct promoter be used to support each respective open reading frame, so as to best preserve vector stability. As examples, and certainly not as limitations, potential multiple transgene vaccines may include a three transgene vector such as hCMV-gagpol-bGHpA + mCMV-nef-SPA in an E3 deleted backbone or hCMV-gagpol-bGHpA + mCMV-nef SPA(E3+).
Potential "2+1" divalent vaccines of the present invention might be a hCMV-gab bGHpA + mCMV-nef-SPA in an E3+ backbone (vector #1) in combination with hCMV-pol-bGHpA in an E3+ backbone (vector #2), with all transgenes in the E1 parallel orientation. Fusion constructs other than the gag-pol fusion described above are also suitable for use in various divalent vaccine strategies and can be composed of any two HIV antigens fused to one another (e.g." nef-pol and gag-nef). These adenoviral compositions are, as above, preferably delivered along with an adenoviral composition comprising an additional HIV antigen in order to diversify the immune response generated upon administration. Therefore, a multivalent vaccine delivered in a single, or possible second, adenoviral vector is certainly contemplated as part of the present invention. Again, this mode of administration is another example of whereby an efficaceous adenovirus-based HIV-1 vaccine may be administered via a combined modality regime. It is important to note, however, that in terms of deciding on an insert for the disclosed adenoviral vectors, due consideration must be dedicated to the effective packaging limitations of the adenovirus vehicle. Adenovirus has been shown to exhibit an upper cloning capacity limit of approximately 105% of the wildtype Ad5 sequence.
Regardless of the gene chosen for expression, it is preferred that the sequence be "optimized" for expression in a human cellular environment. A "triplet"
codon of four possible nucleotide bases can exist in 64 variant forms. That these forms provide the message for only 20 different amino acids (as well as transcription initiation and termination) means that some amino acids can be coded for by more than one codon.
Indeed, some amino acids have as many as six "redundant", alternative codons while some others have a single, required codon. For reasons not completely understood, alternative codons are not at all uniformly present in the endogenous DNA of differing types of cells and there appears to exist variable natural hierarchy or "preference" for certain codons in certain types of cells. As one example, the amino acid leucine is specified by any of six DNA codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mRNA codons, CUA, CUC, CUG, CW, WA and UUG). Exhaustive analysis of genome codon frequencies for microorganisms has revealed endogenous DNA of E. coli most commonly contains the CTG leucine-specifying codon, while the DNA of yeasts and slime molds most commonly includes a TTA leucine-specifying codon. Jn view of this hierarchy, it is generally held that the likelihood of obtaining high levels of expression of a leucine-rich polypeptide by an E. coli host will depend to some extent on the frequency of codon use. For example, a gene rich in TTA codons will in all probability be poorly expressed in E. coli, whereas a CTG rich gene will probably highly express the polypeptide. Similarly, when yeast cells are the projected transformation host cells for expression of a leucine-rich polypeptide, a preferred codon for use in an inserted DNA would be TTA.
The implications of codon preference phenomena on recombinant DNA
techniques are manifest, and the phenomenon may serve to explain many prior failures to achieve high expression levels of exogenous genes in successfully transformed host organisms--a less "preferred" codon may be repeatedly present in the inserted gene and the host cell machinery for expression may not operate as efficiently. This phenomenon suggests that synthetic genes which have been designed to include a projected host cell's preferred codons provide a preferred form of foreign genetic material for practice of recombinant DNA techniques. Thus, one aspect of this invention is an adenovirus vector or adenovirus vector in some combination with a vaccine plasmid where both specifically include a gene which is codon optimized for expression in a human cellular environment. As noted herein, a preferred gene for use in the instant invention is a codon-optimized HIV gene and, particularly, HIV
gag, pol or nef.
Adenoviral vectors in accordance with the instant invention can be constructed using known techniques, such as -those -reviewed-in Hitt et al, 1997 "Human Adenovirus Vectors for Gene Transfer into Mammalian Cells" Advances in Plaarmacology 40:137-206, which is hereby incorporated by reference.
In constructing the adenoviral vectors of this invention, it is often convenient to insert them into a plasmid or shuttle vector. These techniques are known and described in Hitt et al., supra. This invention specifically includes both the adenovirus and the adenovirus when inserted into a shuttle plasmid.
Preferred shuttle vectors contain an adenoviral portion and a plasmid portion.
The adenoviral portion is essentially the same as the adenovirus vector discussed supra, containing adenoviral sequences (with non-functional or deleted El and regions) and the gene expression cassette, flanked by convenient restriction sites. The plasmid portion of the shuttle vector often contains an antibiotic resistance marker under transcriptional control of a prokaryotic promoter so that expression of the antibiotic does not occur in eukaryotic cells. Ampicillin resistance genes, neomycin resistance genes and other pharmaceutically acceptable antibiotic resistance markers may be used. To aid in the high level production of the polynucleotide by fermentation in prokaryotic organisms, it is advantageous for the shuttle vector to contain a prokaryotic origin of replication and be of high copy number. A
number of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences. It is also desirable that the vectors not be able to replicate in eukaryotic cells. This minimizes the risk of integration of polynucleotide vaccine sequences into the recipients' genome. Tissue-specific promoters or enhancers may be used whenever it is desirable to limit expression of the polynucleotide to a particular tissue type.
In one embodiment of this invention, the pre-plasmids (e.g., pMRK.AdSpol, pMRKAdSnef and pMRKAdSgag were generated by homologous recombination using the MRI~IVE3 (and MRKHVO for the E3- version) backbones and the appropriate shuttle vector, as shown for pMRKAd5po1 in Figure 22 and for pMRKAdSnef in Figure 23. The plasmid in linear form is capable of replication after entering the PER.C6° cells and virus is produced. The infected cells and media were harvested after viral replication was complete.
Viral vectors can be propagated in various E1 complementing cell lines, including the known cell lines 293 and PER.C6°. Both these cell lines express the adenoviral E1 gene product. PER.C6° is described in WO 97/00326 (published January 3, 1997) and issued U.S. Patent No. 6,033,908, both of which are hereby incorporated by reference. It is a primary human rednoblast cell line transduced with an E1 gene segment that complements the production of replication deficient (FG) adenovirus, but is designed to prevent generation of replication competent adenovirus by homologous recombination. Cells of particular interest have been stably transformed with a transgene that encodes the ADSElA and E1B gene, like PER.C6°
from 459 by to 3510 by inclusive. 293 cells are described in Graham et al., 1977 J.
Gen. Virol 36:59-72, which is hereby incorporated by reference. As stated above, consideration must be given to the adenoviral sequences present in the complementing cell line used. It is important that the sequences not overlap with that present in the vector if the possibility of recombination is to be minimized.
It has been found that vectors generated in accordance with the above description are more effective in inducing an immune response and, thus, constitute very promising vaccine candidates. More particularly, it has been found that first generation adenoviral vectors in accordance with the above description carrying a codon-optimized HIV gag gene, regulated with a strong heterologous promoter can be used as human anti-HIV vaccines, and are capable of inducing immune responses.

Standard techniques of molecular biology for preparing and purifying DNA
constructs enable the preparation of the DNA immunogens of this invention.
A vaccine composition comprising an adenoviral vector in accordance with the instant invention may contain physiologically acceptable components, such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate. One preferred formulation has: 2.5-10 mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaCl, preferably about 75 mM NaCI; 2.5-10%
sucrose, preferably about 5% sucrose; 0.01 -2 mM MgCl2; and 0.001%-0.01%
polysorbate 80 (plant derived). The pH should range from about 7.0-9.0, preferably about 8Ø One skilled in the art will appreciate that other conventional vaccine excipients may also be used it make the formulation. The preferred formulation contains 5mM TRIS, 75 mM NaCI, 5% sucrose, 1mM MgCl2, 0.005% polysorbate 80 at pH 8.0 This has a pH and divalent cation composition which is near the optimum for Ad5 stability and minimizes the potential for adsorption of virus to a glass surface.
It does not cause tissue irritation upon intramuscular injection. It is preferably frozen until use.
The amount of adenoviral particles in the vaccine composition to be introduced into a vaccine recipient will depend on the strength of the transcriptional and translational promoters used and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of 1x10' to 1x1012 particles and preferably about 1x101 to 1x1011 particles is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided. Following vaccination with HIV adenoviral vector, boosting with a subsequent HIV adenoviral vector and/or plasmid may be desirable. Parenteral administration, such as intravenous, intramuscular, subcutaneous or other means of administration of interleukin-12 protein, concurrently with or subsequent to parenteral introduction of the vaccine compositions of this invention is also advantageous.
. The adenoviral vector and/or vaccine plasmids of this invention polynucleotide may be unassociated with any proteins, adjuvants or other agents which impact on the recipients' immune system. In this case, it is desirable for the vector to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the vector may be associated with an adjuvant known in the art to boost immune responses (i.e., a "biologically effective"

adjuvant), such as a protein or other carrier. Vaccine plasmids of this invention may, for instance, be delivered in saline (e.g., PBS) with or without an adjuvant.
Preferred adjuvants are Alum or CRL1005 Block Copolymer. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, may also be used to advantage. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable Garners. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention.
This invention also includes a prime and boost regimen wherein a first adenoviral vector is administered, then a booster dose is given. The booster dose may be repeated at selected time intervals. Alternatively, a preferred inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype. More preferably, the inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype, wherein the first and second adenovirus serotypes are classified within separate subgroups of adenoviruses. The above prime/boost schemes are particularly preferred in those situations where a preexisting immunity is identified to the adenoviral vector of choice. In this type of scheme, the individual or population of individuals is primed with an adenovirus of a serotype other than that to which the preexisting immunity is identified. This enables the first adenovirus to effectuate sufficient expression of the transgene while evading existing immunity to the second adenovirus (the boosting adenovirus) and, further, allows for the subsequent delivery of the transgene via the boosting adenovirus to be more effective. Adenovirus serotype 5 is one example of a virus to which such a scheme might be desirable. In accordance with this invention, therefore, one might decide to prime with a non-group C
adenovirus (e.g., Adl2, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus) to evade anti-Ad5 immunity and then boost with AdS, a group C adenovirus. Another preferred embodiment involves administration of a different adenovirus (including non-human adenovirus) vaccine followed by administration of the adenoviral vaccines disclosed. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and venezuelan equine encephilitis virus.
A large body of human and animal data supports the importance of cellular immune responses, especially CTL in controlling (or eliminating) HIV
infection. In humans, very high levels of CTL develop following primary infection and correlate with the control of viremia. Several small groups of individuals have been described who are repeatedly exposed to HIV by remain uninfected; CTL has been noted in several of these cohorts. In the SIV model of HIV infection, CTL similarly develops following primary infection, and it has been demonstrated that addition of anti-CD8 monoclonal antibody abrogated this control of infection and leads to disease progression. This invention uses adenoviral vaccines alone or in combination with plasmid vaccines to induce CTL.
The following non-limiting Examples are presented to better illustrate the invention.

Removal of the Intron A Portion of the hCMV Promoter GMP grade pVIJnsHIVgag was used as the starting material to amplify the hCMV .promoter. PVIJnsHIVgag is a plasmid comprising the CMV immediate-early (>E) promoter and intron A, a full-length codon-optimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone; see Montgomery et al., supra for a description of the plasmid backbone. The amplification was performed with primers suitably positioned to flank the hCMV promoter. A 5' primer was placed upstream of the Mscl site of the hCMV promoter and a 3' primer (designed to contain the BgIII recognition sequence) was placed 3' of the hCMV promoter. The resulting PCR product (using high fidelity Taq polymerase) which encompassed the entire hCMV promoter (minus intron A) was cloned into TOPO PCR blunt vector and then removed by double digestion with Mscl and BgZII. This fragment was then cloned back into the original GMP grade pVlJnsHIVgag plasmid from which the original promoter, intron A, and the gag gene were removed following Mscl and BgIII digestion. This ligation reaction resulted in the construction of a hCMV promoter (minus intron A) +
bGHpA
expression cassette within the original pVlJnsHIVgag vector backbone. This vector is designated pVIJnsCMV(no intron).
The FLgag gene was excised from pVlJnsHIVgag using BgZJI digestion and the 1,526 by gene was gel purified and cloned into pVlJnsCMV(no intron) at the BglII site. Colonies were screened using Snzal restriction enzymes to identify clones that carried the Flgag gene in the correct orientation. This plasmid, designated pVlJnsCMV(no intron)-FLgag-bGHpA, was fully sequenced to confirm sequence integrity.

Two additional transgenes were also constructed. The plasmid, pVlJnsCMV(no intron)-FLgag-SPA, is identical to pVlJnsCMV(no intron)-FLgag-bGHpA except that the bovine growth hormone polyadenylation signal has been replaced with a short synthetic polyA signal (SPA) of 50 nucleotides in length. The sequence of the SPA is as shown, with the essential components (poly(A) site, (GT)n, and (T)n; respectively) underlined:
AATAAAAGATCT"TTATTTTCATTAGATCTGTGTG TTGGGTGTG
(SEQ m N0:18).
The plasmid, pVlJns-mCMV-FLgag-bGHpA, is identical to the pV lJnsCMV(no intron)-FLgag-bGHpA except that the hCMV promoter has been removed and replaced with the marine CMV (mCMV) promoter.
Figure 3 diagrammatically shows the new transgene constructs in comparison with the original transgene.

Gag Expression Assay for Modified Gag Transgenes Gag Elisa was performed on culture supernatants obtained from transient tissue culture transfection experiments in which the two new hCMV-containing plasmid constructs, pVlJnsCMV(no intron)-FLgag-bGHpA and pVlJnsCMV(no intron)-FLgag-SPA, both devoid of intron A, were compared to pVlJnsHIVgag which, as noted above possesses the intron A as part of the hCMV promoter.
Table 2 below shows the iiz vitro gag expression data of the new gag plasmids compared with the GMP grade original plasmid. The results displayed in Table 2 show that both of the new hCMV gag plasmid constructs have expression capacities comparable to the original plasmid construct which contains the intron A portion of the hCMV
promoter.

Table 2: 1z vitro DNA transfection of original and new plasmid HIV-1 gag constructs.
Plasmid a /10e6 COS cells/5 DNA/48 hr HIVFL- a 89901$ 10.8 PVIJns-hCMV-FL a -bGH Ab 16.6 V lJns-hCMV-FL a -SPAb~' 12.0 a GMP grade pV lJns-hCMVintronA-FLgag-bGHpA.
b New plasmid constructions that have the intron A portion removed from the hCMV
promoter.
In this construct the bGH terminator has been replaced with the short synthetic polyadenylation signal (SPA) Rodent (Balb/c) Study for Modified gag Transgenes A rodent study was performed on the two new plasmid constructs described above - pV lJnsCMV(no intron)-FLgag-bGHpA and pVlJnsCMV(no intron)-FLgag-SPA - in order to compare them with the construct described above possessing the intron A portion of the CMV promoter, pVlJnsHIVgag. Gag antibody and Elispot responses (described in PCT International Application No.
PCT/LTS00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S.
Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S.
Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference) were measured. The results displayed in Table 3 below, show that the new plasmid constructs behaved equivalently to the original . construct in Balb/c mice with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested, 20 ~g and 200 fig.

Table 3: HIV191: Immunogenicity of VlJns-gag under different promoter and termination control elements.
DNAa Dose,Anti-p24 SFC/10~6 ugb Titers Cells 3 4 Wk Wk PD1 PD1 d ' Promoterlterminator GMT +SE -SE Media gag197-205p24 HIVFL-gagPR9901200 128004652 3412 2(2) 129(19) 30(11) (GMP grade) 20 5572 1574 1227 0 56(9) 25(6) pVlJns-hCMV- 200 111432831 2257 0 98(5) 12(6) FL-gag-bGHpA 20 7352 2808 2032 0 73(9) 11 (6) pVlJns-hCMV- 200 168905815 4326 1(1) 94(4) 26(7) FL-gag-SPA 20 5971 5361 2825 0 85(17) 38(10) Naive 0 123 50 36 0 0 0 "in PBS
bi.m. Injections into both quads, 50 itL per quad 'n=10;GMT, geometric mean titer; SE, standard. error dn=5, pooled spleens; mean of triplicate wells and standard. deviation. in parentheses;
Construction of the Modified Shuttle Vector --"MRKpdelEl Shuttle"
The modifications to the original Ad5 shuttle vector (pdelElsplA; a vector comprising Ad5 sequences from basepairs 1-341 and 3524-5798, with a multiple cloning region between nucleotides 341 and 3524 of AdS, included the following three manipulations carried out in sequential cloning steps as follows:
(1) The left ITR region was extended to include the Pacl site at the junction between the vector backbone and the adenovirus left ITR sequences. This allow for easier manipulations using the bacterial homologous recombination system.

(2) The packaging region was extended to include sequences of the wild-type (WT) adenovirus from 342 by to 450 by inclusive.

(3) The area downstream of pIX was extended 13 nucleotides (i.e., nucleotides 3523 inclusive).
These modifications (Figure 4) effectively reduced the size of the E1 deletion without overlapping with any part of the ElA/E1B gene present in the transformed PER.C6~
cell line. . All manipulations were performed by modifying the Ad shuttle vector pdelElsplA.
Once the modifications were made to the shuttle vector, the changes were incorporated into the original Ad5 adenovector backbones (pAdHVO and pAdHVE3) by bacterial homologous recombination using E. coli BJ5183 chemically competent cells.
ao Construction of Modified Adenovector Backbones (B3+ and E3-7 The original adenovectors pAdHVO (comprising all Ad5 sequences except those nucleotides encompassing the E1 and E3 regions ) and pADHVE3 (comprising all Ad5 sequences except those nucleotides encompassing the E1 region), were each reconstructed so that they contained the modifications to the E1 region. This was accomplished by digesting the newly modified shuttle vector (MRKpdelEl shuttle) with Pacl and BstZ1101 and isolating the 2,734 by fragment which corresponds to the adenovirus sequence. This fragment was co-transformed with DNA from either Clal linearized pAdHVO (E3- adenovector) or Clal linearized pAdHVE3 (E3+adenovector) into E. coli BJ5183 competent cells. At least two colonies from each transformation were selected and grown in TerrificTM broth for 6-8 hours until turbidity was reached. DNA was extracted from each cell pellet and then transformed into E. coli XL1 competent cells. One colony from each transformation was selected and grown for plasmid DNA purification. The plasmid was analyzed by restriction digestions to identify correct clones. The modified adenovectors were designated MRKpAdHVO (E3- plasmid) and MRKpAdHVE3 (E3+ plasmid). Virus from these new adenovectors (N>ItKHVO and MRI~iVE3, respectively) as well as the old version of the adenovectors were generated in the PER.C6° cell lines to accommodate the following series of viral competition experiments. In addition, the multiple cloning site of the original shuttle vector contained CIaI , BamHI, Xho I, EcoRV, HindI>T, Sal I, and Bgl II sites. This MCS was replaced with a new MCS
containing Not I, Cla I, EcoRV and Asc I sites. This new MCS has been transferred to the MRKpAdHVO and MRKpAdHVE3 pre-plasmids along with the modification made to the packaging region and pIX gene.

Analysis of the Effect of the Packa~,~ng Signal Extension To study the effects of the modifications made to the El deletion region, the viruses obtained from the original backbone (pAdHVE3) and the new backbone (MRKpAdHVE3) were mixed together in equal MOI ratios (1:1 and 5:5) and passaged through several rounds; see Figure 5, Expt.#1. Both of the viruses in the experiment contained the E3 gene intact and did not contain a transgene. The only difference between the two viruses was within the region of the El deletion.
Following the coinfecdon of the viruses at P1 (passage 1), the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the virus extracted and purified by CsCI banding. The viral DNA was extracted and digested with HindIll and the digestion products were then radioactively labeled.
For the controls, the respective pre-plasmids (pAdHVE3 ("OLD E3+");
MRKpAdHVE3 ("NEW E3+")) were also digested with HiszdiII (and Pacl to remove the vector backbone) and subsequently labeled with [33P]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure clearly shows that the new adenovirus which has the addition made to the packaging signal region has a growth advantage compared with the original adenovirus. In the experiments performed (at either ratio tested), only the digestion bands pertaining to the newly modified virus were present. The diagnostic band of size 3,206 (from the new virus) was clearly present. However, there was no evidence of the diagnostic band of size 2,737 by expected from the original virus.

Analysis of the Effect of the E3 Gene The second set of the virus competition study involved mixing equal MOI
ratio (1:1) of the newly modified viruses, that obtained from MRKpAdHVO and MRKpAdHVE3 (Figure 5, Expt. #2). In this set, both viruses had the new modifications made to the E1 deletion. The first virus (that from MRKpAdHVO) does not contain an E3 gene. The second virus (that from MRKpAdHVE3) does contain the E3 gene. Neither of the viruses contain a transgene. Following co-infection of the viruses, the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the total virus extracted and purified by CsCI~ banding. The viral DNA was extracted and digested with Hi~zdlll and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids MRKpAdHVO ("NEW E3-"); MRKpAdHVE3 ("NEW
E3+") were also digested with HindIll (and Pacl to remove the vector backbone) and then labeled with [33p~dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure 6 shows the results of the viral DNA analysis of the E3+ virus and E3- virus mixing experiment. The diagnostic band corresponding to the E3+ virus (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 by corresponding to the E3- virus.
This indicates that the virus that contains the E3 gene is able to amplify more rapidly compared with the virus that does not contain an E3 gene. This increased amplification capacity has been confirmed by growth studies; see Table 4 below.

Construction of the new shuttle vector containing modified ga tg ransgene "MRKpdelEl-CMV(no intron)-FL,gaa-bGHpA"
The modified plasmid pVlJnsCMV(no intron)-FLgag-bGHpA was digested with Mscl overnight and then digested with Sfil for 2 hours at 50°C.
The DNA was then treated with Mungbean nuclease for 30 rains at 30°C. The DNA
mixture was desalted using the Qiaex II kit and then Klenow treated for 30 rains at 37°C to fully blunt the ends of the transgene fragment. The 2,559 by transgene fragment was then gel purified. The modified shuttle vector (MRKpdelEl shuttle) was linearized by digestion with EcoRV, treated with calf intestinal phosphatase and the resulting 6,479 by fragment was then gel purified. The two purified fragments were then ligated together and several dozen clones were screened to check for insertion of the transgene within the shuttle vector. Diagnostic restriction digestion was performed to identify those clones carrying the transgene in the E1 parallel and El anti-parallel orientation. This strategy was followed to clone in the other gag transgenes in the MRKpdelEl shuttle vector.
_ . EXAMPLE 9 Construction of the MRK FG Adenovectors The shuttle vector containing the HIV-1 gag transgene in the El parallel orientation, MRKpdelEl-CMV(no intron)-FLgag-bGHpA, was digested with Pacl.
The reaction mixture was digested with BsfZ171. The 5,291 by fragment was purified by gel extraction. The MRKpAdHVE3 plasmid was digested with Clal overnight at 37°C and gel purified. About 100 ng of the 5,290 by shuttle +transgene fragment and 100 ng of linearized MR.KpAdHVE3 DNA were co-transformed into E. coli BJ5183 chemically competent cells. Several clones were selected and grown in 2 ml TerrificTM broth for 6-8 hours, until turbidity was reached: The total DNA
from the cell pellet was purified using Qiagen alkaline lysis and phenol chloroform method.
The DNA was precipitated with isopropanol and resuspended in 20 w1 dH20. A 2 w1 aliquot of this DNA was transformed into E. coli XL-1 competent cells. A
single colony from each separate transformation was selected and grown overnight in 3 ml LB +100 pg/ml ampicillin. The DNA was isolated using Qiagen columns. A
positive clone was identified by digestion with the restriction enzyme BstEH which cleaves within the gag gene as well as the plasmid backbone. The pre-plasmid clone is designated MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA and is 37,498 by in size.
This strategy was followed to generate E3- and E3+ versions of each of the other gag transgene constructions in both El parallel and E1 anti-parallel versions.
Figures 7A, 7B and 7C show the various combinations of adenovectors constructed.

Plasmid Competition Studies A series of plasmid competition studies was carried out. Briefly, the screening of the various combinations of new constructs was performed by mixing equal amounts of each of two competing plasmids. In the experiment shown in Figure 8A, plasmids containing the same transgene but in different orientations were mixed together to create a "competition" between the two plasmids. The aim was to look at the effects of transgene orientation. In the experiment shown in Figure 8B, plasmids containing different polyadenylation signals (but in the same orientation) were mixed together in equal amounts. The aim was to assess effects of polyA signals.
Following the initial transfection, the virus was passaged through ten rounds and the viral DNA
analyzed by radioactive restriction analysis.
Analysis of the viral species from the plasmid mixing experiment (Figure 8A) showed that adenovectors which had the transgene inserted in the E1 parallel orientation amplified better and were able to out-compete the adenovirus which had the transgene inserted in the E1 anti-parallel orientation. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the E1 parallel orientation compared with the El antiparallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the E1 parallel orientation for both transgenes tested (hCMV(no intron)-FLgag-bGHpA and hCMV(no intron)-FLgag-SPA).
Analysis of the viral species from the plasmid mixing experiment #2 (Figure 8B) at passages 3 and 6 showed that the polyadenylation signals tested (bGHpA
and SPA) did not have an effect on the growth of the virus. Even at passage 10 the two viral species in the mixture were still present in equal amounts.
as Virus generation of an enhanced adenoviral construct - "MRK Ad5 HIV-1 ~a~"
The results obtained from the competition study allowed us to make the following conclusions: (1) The packaging signal extension is beneficial; (2) Presence of E3 does enhance viral growth; (3) El parallel orientation is recommended;
and (4) PolyA signals have no effect on the growth of the adenovirus.
MRK Ad5 HIV-1 gag exhibited the most desirable results. This construct contains the hCMV(no intron)-FLgag-bGHpA transgene inserted into the new E3+
adenovector backbone, MRKpAdHVE3, in the El parallel orientation. We have designated this adenovector NlRK Ad5 HIV-1 gag. This construct was prepared as outlined below:
The pre-plasmid MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA was digested was Pacl to release the vector backbone and 3.3 ~,g was transfected by calcium phosphate method (Amersham Pharmacia Biotech.) in a 6 cm dish containing PER.C6° cells at ~60% confluence. Once CPE was reached (7-10 days), the culture was freeze/thawed three times and the cell debris pelleted. 1 ml of this cell lysate was used to infect into a 6 cm dish containing PER.C6° cells at 80-90%
confluence. Once CPE was reached, the culture was freeze/thawed three times and the cell debris pelleted. The cell lysate was then used to infect a 15 cm dish containing PER.C6°
cells at 80-90% confluence. This infection procedure was continued and expanded at passage 6. The virus was then extracted from the cell pellet by CsCI method.
Two bandings were performed (3-gradient CsCI followed by a continuous CsCI
gradient).
Following the second banding, the virus was dialyzed in A105 buffer. Viral DNA
was extracted using pronase treatment followed by phenol chloroform. The viral DNA was then digested with HindlB and radioactively labeled with [33P]dATP.
Following gel electrophoresis to separate the digestion products the gel was dried down on Whatman paper and then subjected to autoradiography. The digestion products were compared with the digestion products from the pre-plasmid (that had been digested with PacllHifadI>I prior to labeling). The expected sizes were observed, indicating that the virus had been successfully rescued. This strategy was used to rescue virus from each of the various adenovector plasmid constructs prepared.

Stability Analyses To determine whether the various adenovector constructs (e.g., MRK Ad5 HIV-1 gag) show genetic stability, the viruses were each passaged continually.
The viral DNA was analyzed at passages 3, 6 and 10. Each virus maintained its correct genetic structure. In addition, the stability of the MRK Ad5 HIV-1 gag was analyzed under propagation conditions similar to that performed in large scale production. For this analysis, the transfections of MRK Ad5 HIV-1 gag as well as three other adenoviral vectors were repeated and the virus was purified at P3. The three other adenovectors were as follows: (1) that comprising hCMV(no intron)-Flgag with a bGHpA terminator in an E3- adenovector backbone; (2) that comprising hCMV(no intron)-Flgag with a SPA termination signal in an E3+ adenovector backbone, and that comprising a mCMV-Flgag with a bGHpA terminator in an E3+ adenovector backbone. All of the vectors have the transgene inserted in the E1 parallel orientation.
Viral DNA was analyzed by radioactive restriction analysis to confirm that it was correct before being delivered to fermentation cell culture for continued passaging in serum-free media. At P5 each of the four viruses were purified and the viral DNA
extracted for analysis by the restriction digestion and radiolabeling procedure. This virus has subsequently been used in a series of studies (iii vitro gag expressiori in COS
cells, rodent study and rhesus monkey study) as will be described below. The viruses -from PS are shown in Figure 9.
The passaging under serum-free conditions was continued for the MRK~iVE3 (transgene-less, obtained from MRKpAdHVE3 pre-plasmid) and the MRKAdSHIV-lgag (obtained from MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA pre-plasmid) viruses. Figure 10 shows viral DNA analysis by radioactive restriction digestion at passage 11 for MRIGiVE3, MRKAd5HIV-1 gagE3-, and passage 11 and 12 for MRKAdSHIV-lgag. Aside from the first lane which is the DNA marker lane, the next three lanes are virus from the pre-plasmid controls (controls based on the original virus) - MRKpAdHVE3 (also referred to as "pMRKIiVE3"), MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA, and pMRKAdSgag(E3-), respectively. As seen in Figure 10, each of the viral DNA
samples show the expected bands with no extraneous bands showing. This signifies that there are no major variant adenovirus species present that can be detected by autoradiography.
Figure 11 shows the results of viral competition study between MRKHVE3 and MRKAd5HIV-lgag. These viruses were mixed together at equal MOI (140 viral particles each; 280 vp total) at passage 6 and continued to be passaged until P11.
Aside from the first lane which is the DNA marker lane, the next two lanes are the pre-plasmid controls obtained from MRKpAdHVE3 and MRKpAdHVE3+CMV(no intxon)-FLgag-bGHpA. The next two lanes are the viral DNA from the starting viral material at passage six. The last two lanes are the competition studies performed in duplicate. The data in Figure 11 shows the effect the gag transgene in culture.
Growth of a MRKAdSgag virus was compared with growth of a "transgene-less"
MRKI~VE3. These two viruses were infected at the same MOI (i.e. 140 vp each) at passage 6 and then passaged through to passage 11 and the viral pool was analyzed by radioactive restriction analysis. The data shows that one virus did not out compete the other. Therefore, the gag transgene did not show obvious signs of toxicity to the adenovirus.
Analysis by HifadIll digestion shows that each virus specie is present in approximately equal amounts. As above, there does not appear to be signs of any extraneous bands. Figure 12 shows higher passage numbers for MRK.Ad5HIV-lgag grown under serum-containing conditions. The genome integrity again has been maintained and there is no evidence of rearrangements, even at the highest passage level (P21 ).
Each of the four vectors shown in Figure 9 were analyzed for amplification capacity. Table 4 below shows the QPA analysis used in the estimation of viral amplification ratios at P4. The determination of the amplification ratio for the original HIV-1 gag construct is based on the clinical lot at P12. It has been shown that amplification rates increases with higher passage number for the original virus.
The reason for this observation is due to the emergence of variants which exhibit increased growth rates compared to the intact adenovector. With continued passaging of the original Ad gag vector, the level of variants increases and hence amplification rates increase also.
The MRK Ad5 HIV-1 gag virus has also been continually passaged under process conditions (i.e., serum-free media). Viral DNA extracted from passages and 12 show no evidence of rearrangement.

Table 4:
Amplification Ratios Based on AEX and QPA Analysis of Virus Amplification from Passage 3 to Passage 4.
Ad gag construct Am lification Ratio MRKAdS a 470 HCMV-Fl a -bGH A [E3-] 115 HCMV-Fl a -SPA [E3+] 320 mCMV FL a -bGH A [E3+] 420 Original construct * 40 - 50 * This estimation is based on the clinical lot growth characteristics at Passage 12.

Analytical Evaluation of the enhanced Ad5 Constructs To study the effects of the transgene and the E3 gene on virus amplification, the enhanced adenoviral vector, MRK Ad5 HIV-1 gag, along with its transgene-less version (MRKpAdHVE3) and its E3- version (MRK Ad5 HIV-1 gag E3-), was studied for several passages under serum-free conditions. Table 5A shows the amplification ratios determined for passages P3 to P8 for MRK Ad5 HIV-1 gag.
Within a certain MOI range, it has been determined that the virus output is directly proportional to the virus input. Therefore, the greater the number of virus particles per cell at infection, the greater the virus amount produced. Viral amplification ratios, on the other hand, are inversely proportional to the virus input. The lower the virus input, the greater the amplification ratio.
Table 5B shows the amplification rates of the new E3+ vector backbone MRKpAdHVE3. It has a significantly lower rate of amplification compared with the gag transgene containing version. This may be contributed to the larger size MRK
Ad5 HIV-1 gag since it contains the transgene. This inclusion of the transgene brings the size of the adenovirus closer to the size of a wild type Ad5 virus. It is well known that adenoviruses amplify best when they are at close to their wild type genomic size.
~8 Wild type Ad5 is 35,935 bp. The MRKpAdHVE3 is 32, 905 by in length. The enhanced adenovector MRK Ad5 HIV-1 gag is 35,453bp (See Figure 14 for vector map; see also Figure 15A-X show the complete pre-adenoviral vector sequence, which includes an additional 2,021 by of the vector backbone):
Table 5C shows the amplification rates of the new E3- gag containing virus MRK Ad5 HIV-1 gag E3-. Once again, this virus shows lower growth rate than the enhanced adenoviral vector. This may be attributed to the decreased sized of this virus (due to the E3 gene deletion) compared with wild type AdS. The MRK Ad5 HIV-1 gag E3- virus is 32,810 by in length. This can be compared with the wild type Ad5 which is 35,935 by and MRK Ad5 HIV-1 gag which is 35,453 by in length.

Table 5A: Amplification ratios determined by AEX and QPA for MRKAdSgag over several continuous passaging in serum free media. Following P5, two replicate samples were taken (rep-1 and rep-2) and analyzed.
MRI~~Sg~cg reel Xv HarvestTlmeCell Tiler TilerOPA RatioAmp90caMafADC
(10 h.p.LPassage10'vprmlCUtture10'vp~ceA10TCID~mIAEX:C7pARatb IntemalCpntd cellslmp, Number Viabllily (%) InlecOon Harvest P4 1.49, O.SB,44 46 8.7 5.9 1.72 b0 d70 81% 50% M01=125 P5 1.38, 0.66,48 49 6.7 49 138 49 170 93% 47%

p8 1.04, 0.88,47 48 5.8 5.6 1.42 41 200 94% 77%

P7 1.50,84%0.96,61%49.5 50 3.9 1.4 0.97 40 60 P7 1.09, 0.76,50 52 52 4.7 1.70 91 170 97% 69 %

PB 1.03, 0.66,47.5 54 9.0 8.7 1.1D 82 310 94% B4%

p9 0.&9. (1.99,47.5 58 4.4 4.9 1.03 43 175 3.12 95% 73% 2.84 P101.09, 1.06,47.5 68 9.0 28 1.16 28 100 270 91% 86% 260 P111.19, 0.88,47 60 3.6 3.0 1.15 91 110 270 88% 65% 270 P120.98, O.BS,47.5 47 5.4 5.5 1.20 45 20D 266 91% 63% 260 P191.0D, 0.70,49 48 5.8 5.8 1.11 52 210 3.18 88% 67% 3.18 P141.94, O.BB,46 53 B.6 4.4 160 32B
92% 67% 3 7 P150.97, 0.64,47 47 6.9 7.1 250 3.12 96% 66% 291 Table 5B: Amplification ratios determined by AEX and QPA for MRKHVE3 over several continuous passaging in serum free media. MRKHVE3 is the new vector backbone which does NOT carry a transgene.

Xv HarvestCe5 TBer TiteraPA RatioAmp89calionADC
(10 Time Passage ~IL4mq, VlabOty (%) InfeeDon h.p.l.Number10' 10'vpJCdl10 AEX.~OPARatb Contrd Harvest vplml TCID~mI
collars P4 1.10. 128, 49 54 4.1 3b 1.70 25 300 9T% 79%

1=1 P5 0.82, 1.18,d7 46 4.9 4.7 124 35 170 89% 77%

P6 1.55, 128, 49.5 50 12 0.8 0.56 21 3D
88'.e 76m P6 1.09, 1.11,49 52 4.0 3.6 1.18 94 130 87% 81 %

P7 1.17, 122, 47.8 54 3.7 32 0.50 74 110 91% 91%

p8 0.98, 1.41,48 56 21 21 0.47 45 75 3.12 B8% 83%

P9 1.20, 126, 47.5 66 0.8 0.7 0.29 28 25 270 89% 51 %

P100.99, 1.65,47 60 29 23 0.43 53 80 270 82% 86'%

P111.07,86%125,639648 47 27 25 0.41 66 90 286 2.80 P120.80, 1.14,49.5 49' S5 7.4 0.48 123 280 3.18 91% 8096 3.18 P131.96, 1.14,45.6 53 5.8 3.0 110 328 95% 86%

P110.97, 1.03,4&5 47 8.4 9.7 350 3.12 96% 98%

2.91 P18O.B7, 0.97,49.5 48 5.3 6.1 218 278 99% 69%

Table 5C. Amplification ratios determined by AEX and QPA for MRKAdSgag(E3-) over several continuous passaging in serum free media. This construct is identical to the MRIG4d5gag construct except that this version is DELETED of the E3 gene.
MRI~AdSgag(E3-) Xv p, HarvestCe0 Titer TiterOPA RatioAmpUUCaUOnAEX
(10 viabilityTme Passage cells/m(%) IMectionHarvesth.p.l.Number10'vp/ml~lbira10'vprcell10'TCID~/mlAEX:ppAf18U0 IntemalComrol P4 1.62, 1.12.47.5 48 20 12 0.92 20 100 77 62k %

MOI=125 P5 1.16, 0.62.49 49 3.3 29 0.99 34 1 DO
92 43%
%

P6 1.71.86'Y~0.20.10.~49 SO 4.7 2.7 1.70 28 100 P6 1.09. 0.63,49.5 52 5.4 5.0 1.76 31 160 % %

P7 1.17, o.se,47.so s4 7.1 s.1 o.s7 1as z2o s1% 7z%

P8 098, 0.77,48 56 3.1 32 0.66 47 115 3.12 B8 48%
%

P9 120, 1.03.72%48 58 1.B 1.5 0.57 32 55 2.70 89%

2.60 P70 0.99, 0.80.48.5 60 32 32 0.68 47 115 270 82% 62%

P11 1.07, 0.98,48.5 47 5.9 5.5 0.68 87 200 286 96 70%
%

P12 O.BO, 0.67,50 49 6.1 6.4 0.72 71 230 3.18 % %

9.18 P13 1.96. 0.91,45.5 53 7.4 3.8 135 328 95% 59%

P14 0.97, 0.81,4B 47 6.8 7.0 250 3.12 96% 74%

P15 0.87, 0.84,49 49 4.8 5.5 196 2.78 99% 56%

2.52 Gag Expression Analysis of the Novel Constructs In vitro gag analysis of the MRK Ad5 HIV-1 gag and the original HIV-gag vectors (research and clinical lot) show comparable gag expression. The clinical lot shows only a slightly reduced gag expression level. The most noticeable difference is with the mCMV vector. This vector shows roughly 3 fold lower expression levels compared with the other vectors tested (which all contain hCMV promoters). The mCMV-FLgag with bGHpA assay was performed three times using different propagation and purification lots and it consistently exhibited weaker gag expression.

Evaluation of MRK Ad5 HIV-1 gag and Other gag-Containing Adenovectors in Balb/c Mice Cohorts of 10 balb/c mice were vaccinated intramuscularly with escalating doses of MRK Ad5 HIV-1 gag, and the research and clinical lots of original AdSHIV-lgag. Serum samples were collected 3 weeks post dose 1 and analyzed by anti-p24 sandwich ELISA.

Anti-p24 titers in mice that received MRK Ad5 HIV-1 gag (10~ and 109 vp(viral particle) doses) were comparable (Figure 13) to those of the research lot of Ad5HIV-1 gag, for which much of the early rhesus data were generated on. These titers were also comparable when E3 is deleted (MRKAdShCMVgagbGHpA(E3-)) or SPA is substituted for bGHpA terminator (MRKAdS hCMV-gag-SPA (E3+)) or murine CMV promoter is used in place of hCMV (MRKAdS mCMV-gag-bGHpA
(E3+)) in the MRKAdS backbone.
The results shown in Table 7 indicate that the three other vectors ( in addition to the preferred vector, MRK Ad5 HIV-1 gag, are also capable of inducing strong anti-gag antibody responses in mice. Interestingly enough, while the mCMV-FLgag construct containing bGHpA and E3+ in an El parallel orientation showed lowest gag expression in the COS cell in vitro infection (Table 6) in comparison with the other vectors tested, it generated the greatest anti-gag antibody response this in vivo Balb/c study. Table 7 also shows a dose response in anti-gag antibody production in both the research and the clinical lot. As expected, the clinical lot shows reduced anti-gag antibody induction at each dosage level compared to the same dosage used for the research lot.
Table 6: In vitro analysis for gag expression in COS cells by Elisa assay.

Viral Vectorsa a 4.8x10e5 COS/10e8 arts/48hr MRKA.dS a b 1.40 Clinical lot Ad5 a 1.28 Research lot Ad5 a d 1.32 MCMVFL- a bGH A' 0.42 8 A.z6o~, absorbance readings taken for viral particle determinations.
b MRKAdSgag was produced in serum free conditions and purified at P5.
Clinical lot# AdSgagFN0001 d Research AdSFLgag lot# 6399 mCMVFL-gagbGHpA was produced in serum free -conditions and purified at P5.

Table 7: mHIV020 Anti-p24 Ab Titers in Balb/c mice (n=10) vaccinated with various Adgag constructs and lots (3 week post doses).
GroupVaccine Dose GMT SE upperSE lower ID v 1 aMRKAdSgag 10~7 25600 5877 4780 2 " 10~9 40960094028 76473 3 hCMV FL-gag bGHpA [E3-] ~ 10~7 7352 2077 1620 4 " 10~9 23525359767 47659 hCMV FL-gag SPA [E3+] -+ 10~7 12800 9905 236 6 " 10~9 31041999181 75165 7 bmCMV FL-gag bGHpA [E3+] -> 10~7 44572 23504 15389 g " 10~9 941014239068 190636 9 'hCMV FL-gag bGHpA [E3-] ~ 10~7 3676 934 745 " 10~9 11762717491 15227 11 research lot hCMV intronA 10~6 528 262 175 FL-gag bGHpA [E3-] <-i2 " 10~7 14703 5274 3882 13 " 10~8 58813 14942 11915 14 " 10~9 20480053232 42250 clinical lot hCMVintronA FL-gag10~6 230 82 61 bGHpA [E3-] <-16 " 10~7 4222 3405 1138 17 " 10~8 19401 3939 3274 18 " 10~9 89144 25187 19639 19 Naive none 93 7 6 '2x50 ~L 1.m. (quad) injections/animal P.Ls: Youil, Chen, Casimiro Vaccination: T. Toner, Q. Su Assay: M. Chen aThe structure of MRKAdSgag is: hCMVFL-gagbGHpA [E3+] -~ The same o of MRKAdSgag used in this rodent study was used in the Rhesus monkey study (Tables 7 and 8).
eThe same lot of mCMVFL-gagbGHpA[E3+] used in the in vitro study (Table 6) ws used here.
'This construct was designed by Volker Sandig. It contains a shorter version of the hCMV
promoter than that used in the MRK constructs. The adenovector backbone is identical to the original backbone used in the original Adgag vector. Expression at 10e7 dose from this vector is 7 fold lower then the same dose of the MRKAdSgag and 4 fold lower than the research lot.

Comparison of Humoral and Cellular Responses Towards the Original Ad-gag Construct with the New MRK Ad5 HIV-1 gag in Rhesus Monkeys 5 Cohorts of 3 rhesus monkeys were vaccinated intramuscularly with MRK Ad5 HIV-1 gag or the clinical AdSgag bulk at two doses, 1011 vp and 109 vp.
Immunizations were conducted at week 0, 4, and 25. Serum and PBMC samples were collected at selected time points. The serum sample were assayed for anti-p24 Ab titers (using competitive based assay) and the PBMCs for antigen-specific 1FN-10 gamma secretion following overnight stimulation with gag 20-mer peptide pool (via ELISpot assay).
The results shown in Table 8 indicate comparable responses with respect to the generation of anti-gag antibodies. The frequencies of gag-specific T cells in peripheral blood assummarized in Table 9 demonstrate a strong cellular immune response generated after a single dose with the new construct MRK Ad5 HIV-1 gag.
The responses are also boostable with second dose of the same vector. The vector is also able .to induce CD8+ T cell responses (as evident by remaining spot counts after CD4+ depletion of PBMCs) which are responsible for cytotoxic activity.
Table 8 Anti-p24 antibody titers (in mMU/mL) in rhesus macaques immunized with gaa-exnressin~ adenovectors (Protocol HIV203).
Vaccine Pre Wk4 Wk8 Wk Wk Wk20 Wk25 Wk28 l2 l6 MRKAd5 a~ 10~11 v 97N010 <10 118 5528 11523 7062 21997ND 51593 97N116 <10 62 772 1447 1562 2174 ND 20029 98X007 <10 66~ 3353 6156 6845 3719 ND 24031 MR KAdSga 10"9 v 97N120 <10 51 204 318 366 482 ND 6550 97N144 <10 18 118 274 706 888 ND 7136 98X008 <10 15 444 386 996 1072 ND 12851 Ad5 Clinicd Lot 10~11 v 97X001 <10 87 2579 4718 7174 7250 ND 69226 97N146 <10 72 3604 7380 7526 18906ND 60283 98X009 <10 78 4183 3945 3124 6956 ND 26226 Ad5 a Clinicd Lot 10~9 v 97N020 <10 <10 143 371 390 1821 ND 17177 97X003 <10 <10 39 93 156 596 ND 2053 98X012 <10 81 342 717 956 1558 ND 11861 N12 KP~d5 hCNN, bGH E 3+

ori nd Ac5 vector CMVAntron A, bGH
E3- , IcA#F N0001 ND nat c~termlned Table 9. Number of gag-specific T cells per million peripheral blood mononuclear cells (PBMCs) in rhesus monkeys immunized with gag-expressing adenovectors.
Also included are those frequencies in PBMCs depleted of CD4~ T cells.
Vacdndlon MonkeylD = W =b = T-_2 m2 b T=0 4 25 wks Mec6oH MediaH MedoH Media Meda MediaH' 1 M2KAC6g~ 97N010 6 89 0 3950 10580 11743 775 4 1074 10~llvp 97N010(CD4-) 4 38 3 993 0 76 0 594 97N116 1 396 t 6090 534 4 3951 261 0 408 97N116(CD4-) 11 676 0 593 0 184 0 666 98X007(CD4-) 20 965 0 2675 0 16560 1278 2 MtKAc6g~ 97N120 5 275 1 2494 141 4 1199 206 4 219 10r9 vp 97N120(CO4-) 11 170 0 85 0 75 1 219 97N144(CD4-) 6 148 0 285 ND ND 0 625 98X008(CD4-) 14 696 0 1175 0 391 4 848 3 Ad g~ diNcd Iot 0 261 1 4950 817 0 1220b1 894 0 1858 10~1l vp 97X001(CD4-)10 283 ' 3 996 0 10100 1123 97N146(CD4-) 6 133 0 370 0 654 0 971 98X009(CD4-) 0 73 0 333 0 225 0 644 4 AdSp~dINo~lot 97N0203 30 1 1010 66 0 36 0 26 0 41 l Or9 vp 97N020(CD4-)10 29 0 15 0 1 0 16 97X003(CD4-) 9 40 0 6 0 4 0 19 98X012(CD4-) 11 70 0 11 0 8 0 41 Naive 968041 6 8 1 t 0 0 0 0 0 0 1 0 Q53F 14 18 5 16,20 14 19 15 10 15 24 9 Basedm elthx:r 4x10~5 a 2x10~5 arils per v.Hl (~pertdng on spot d~ulty) ND, not chtemined ~Odc or no pedlde mnhd °Pad of 20-0o PePticps werlcTdnn br l o m and enoarpcssnK7lhe cXi7 set The adenovectors described herein and, particularly, MRK Ad5 HIV-1 gag, represent very promising HIV-gag adenovectors with respect to their enhanced growth characteristics in both serum and, more importantly, in serum-free media i0 conditions. In comparison with the current HIV-1 gag adenovector construct, MRK
Ad5 HIV-1 gag shows a 5-10 fold increased amplification rate. . We have shown that it is genetically stable at passage 21. This construct is able to generate significant cellular immune responses in vivo even at a relatively low dose of 10~9 vp.
The potency of the MRKAdSgag construct is comparable to, if not better than the original HIV-lgag vector as shown in this rhesus monkey study.

The open reading frames for the various synthetic poi genes disclosed herein comprise coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN). The protein sequence is based ss on that of Hxb2r, a clonal isolate of IIIB; this sequence has been shown to be closest to the consensus Glade B sequence with only 16 nonidentical residues out of (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico). The skilled artisan will understand after S review of this specification that any available HIV-1 or HIV-2 strain provides a potential template for the generation of HIV pol DNA vaccine constructs disclosed herein. It is further noted that the protease gene is excluded from the DNA
vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation. The design of the gene sequences for both wild-type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred ("humanized") codons for each amino acid residue in the sequence in order to maximize i~a vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12).
As can~be discerned by inspecting the codon usage in SEQ ID NOs: 1, 3, 5 and 7, the following codon usage for mammalian optimization is preferred: Met (ATG), Gly 1S (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/LTS97/02294), which, as noted elsewhere in this specification, is hereby incorporated by reference. It is intended that the skilled artisan may use alternative versions of codon optimization or may omit this step when generating HIV pol vaccine constructs within the scope of the present invention. Therefore, the present invention also relates to non-codon optimized versions of DNA molecules and associated recombinant adenoviral HIV
vaccines which encode the various wild type and modified forms of the HIV Pol 2S protein disclosed herein. However, codon optimization of these constructs is a preferred embodiment of this invention.
A particular embodiment of this portion of the invention comprisies codon optimized nucleotide sequences which encode wt-pol DNA constructs (herein, "wt-pol" or "wt-pol (codon optimized))" wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized."wild type" sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity. A
DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:1, the open reading frame being contained from an initiating Met residue at nucleotides 10-12 to a termination codon from nucleotides 2560-2562. SEQ ID NO:1 is as follows:

ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG

GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC
TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG
GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC
CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGATGTGGG GGATGCCTAC
S TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC
AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC TGCCCCAGGG CTGGAAGGGC
TCCCCTGCCA TCTTCCAGTC CTCCATGACC AAGATCCTGG AGCCCTTCAG GAAGCAGAAC
CCTGACATTG TGATCTACCA GTACATGGAT GACCTGTATG TGGGCTCTGA CCTGGAGATT
GGGCAGCACA GGACCAAGAT TGAGGAGCTG AGGCAGCACC TGCTGAGGTG GGGCCTGACC
IO ACCCCTGACA AGAAGCACCA GAAGGAGCCC CCCTTCCTGT GGATGGGCTA TGAGCTGCAC
CCCGACAAGT GGACTGTGCA GCCCATTGTG CTGCCTGAGA AGGACTCCTG GACTGTGAAT
GACATCCAGA AGCTGGTGGG CAAGCTGAAC TGGGCCTCCC AAATCTACCC TGGCATCAAG
GTGAGGCAGC TGTGCAAGCT GCTGAGGGGC ACCAAGGCCC TGACTGAGGT GATCCCCCTG
ACTGAGGAGG CTGAGCTGGA GCTGGCTGAG AACAGGGAGA TCCTGAAGGA GCCTGTGCAT
IS GGGGTGTACT ATGACCCCTC CAAGGACCTG ATTGCTGAGA TCCAGAAGCA GGGCCAGGGC
CAGTGGACCT ACCAAATCTA CCAGGAGCCC TTCAAGAACC TGAAGACTGG CAAGTATGCC
AGGATGAGGG GGGCCCACAC CAATGATGTG AAGCAGCTGA CTGAGGCTGT GCAGAAGATC
ACCACTGAGT CCATTGTGAT CTGGGGCAAG ACCCCCAAGT TCAAGCTGCC CATCCAGAAG
GAGACCTGGG AGACCTGGTG GACTGAGTAC TGGCAGGCCA CCTGGATCCC TGAGTGGGAG

GGGGCTGAGA CCTTCTATGT GGATGGGGCT GCCAACAGGG AGACCAAGCT GGGCAAGGCT
GGCTATGTGA CCAACAGGGG CAGGCAGAAG GTGGTGACCC TGACTGACAC CACCAACCAG
AAGACTGAGC TCCAGGCCAT CTACCTGGCC CTCCAGGACT CTGGCCTGGA GGTGAACATT
GTGACTGACT CCCAGTATGC CCTGGGCATC ATCCAGGCCC AGCCTGATCA GTCTGAGTCT
ZS GAGCTGGTGA ACCAGATCAT TGAGCAGCTG ATCAAGAAGG AGAAGGTGTA CCTGGCCTGG
GTGCCTGCCC ACAAGGGCAT TGGGGGCAAT GAGCAGGTGG ACAAGCTGGT GTCTGCTGGC
ATCAGGAAGG TGCTGTTCCT GGATGGCATT GACAAGGCCC AGGATGAGCA TGAGAAGTAC
CACTCCAACT GGAGGGCTAT GGCCTCTGAC TTCAACCTGC CCCCTGTGGT GGCTAAGGAG
ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC

~GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG
GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT
GACAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC
AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGA GTCCATGAAC

GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC
~7 GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG
CAGATCACCA AGATCCAGAA CTTCAGGGTG TACTACAGGG ACTCCAGGAA CCCCCTGTGG
AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG.GAGGGGGCTG TGGTGATCCA GGACAACTCT
GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG
S GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT (SEQ
ID N0:1).
The open reading frame of the wild type pol construct disclosed as SEQ m NO:1 contains 8S0 amino acids, disclosed herein as SEQ 1D N0:2, as follows:
Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile 1S Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser~Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val 2S Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys- Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp 3S Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Glu Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Asp Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Asp Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val 1$ Lys Thr Ile His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro~Gln Ser Gln Gly Val Val G1u Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser A1a Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp 2$ Tyr Gly Lys G1n Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp (SEQ ID N0:2).
The present invention especially relates to an adenoviral vector vaccine which comprises a codon optimized HIV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIV-1 pol (RT-RH-IN) activity of the expressed protein. Therefore, the present invention preferably relates to an adenoviral HIV-1 DNA pol-based vaccine wherein the construct is devoid of DNA sequences encoding any PR activity, as well as containing a mutadon(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity. One type of HIV-1 pol mutant which is part and parcel of an adenoviral vector vaccine may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN
regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. To this end, an especially preferred DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID N0:4, Figure 17A-C) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains.
Therefore, an especially preferred exemplification is an adenoviral vaccine which comprises, in an appropriate fashion, a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1. An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol.
Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.
Table 1 wt as as residue mutant as enzXme function Asp 112 Ala RT

Asp 187 Ala RT

Asp 188 Ala RT

Asp . 445 . Ala - RNase H

Glu 480 Ala RNase H

Asp 500 Ala RNase H

Asp 626 Ala IN

Asp 678 Ala IN

Glu 714 Ala IN

It is preferred that point mutations be incorporated into the IApol mutant adenoviral vaccines of the present invention so as to lessen the possibility of altering epitopes in and around ) of HIV-1 Pol.
the active sites To this which codes end, SEQ for ID N0:3 discloses the nucleotide sequence S a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as "IApol":

AGATCTACCATGGCCCCCATCTCCCCCATT GAGACTGTGCCTGTGAAGCTGAAGCCTGGC

ATGGATGGCCCCAAGGTGAAGCAGTGGCCC CTGACTGAGGAGAAGATCAAGGCCCTGGTG

GAAATCTGCACTGAGATGGAGAAGGAGGGC AAAATCTCCAAGATTGGCCCCGAGAACCCC

GACTTCAGGGAGCTGAACAAGAGGACCCAG GACTTCTGGGAGGTGCAGCTGGGCATCCCC

CACCCCGCTGGCCTGAAGAAGAAGAAGTCT GTGACTGTGCTGGCTGTGGGGGATGCCTAC

TTCTCTGTGCCCCTGGATGAGGACTTCAGG AAGTACACTGCCTTCACCATCCCCTCCATC

AACAATGAGACCCCTGGCATCAGGTACCAG TACAATGTGCTGCCCCAGGGCTGGAAGGGC

IS TCCCCTGCCATCTTCCAGTCCTCCATGACC AAGATCCTGGAGCCCTTCAGGAAGCAGAAC

CCTGACATTGTGATCTACCAGTACATGGCT GCCCTGTATGTGGGCTCTGACCTGGAGATT

GGGCAGCACAGGACCAAGATTGAGGAGCTG AGGCAGCACCTGCTGAGGTGGGGCCTGACC

ACCCCTGACAAGAAGCACCAGAAGGAGCCC CCCTTCCTGTGGATGGGCTATGAGCTGCAC

CCCGACAAGTGGACTGTGCAGCCCATTGTG CTGCCTGAGAAGGACTCCTGGACTGTGAAT

ZO GACATCCAGAAGCTGGTGGGCAAGCTGAAC TGGGCCTCCCAAATCTACCCTGGCATCAAG

GTGAGGCAGCTGTGCAAGCTGCTGAGGGGC ACCAAGGCCCTGACTGAGGTGATCCCCCTG

ACTGAGGAGGCTGAGCTGGAGCTGGCTGAG AACAGGGAGATCCTGAAGGAGCCTGTGCAT

GGGGTGTACTATGACCCCTCCAAGGACCTG ATTGCTGAGATCCAGAAGCAGGGCCAGGGC

CAGTGGACCTACCAAATCTA,CCAGGAGCCC TTCAAGAACCTGAAGACTGGCAAGTATGCC

ACCACTGAGTCCATTGTGATCTGGGGCAAG ACCCCCAAGTTCAAGCTGCCCATCCAGAAG

GAGACCTGGGAGACCTGGTGGACTGAGTAC TGGCAGGCCACCTGGATCCCTGAGTGGGAG

TTTGTGAACACCCCCCCCCTGGTGAAGCTG TGGTACCAGCTGGAGAAGGAGCCCATTGTG

GGGGCTGAGACCTTCTATGTGGCTGGGGCT GCCAACAGGGAGACCAAGCTGGGCAAGGCT

AAGACTGCCCTCCAGGCCAT.CTACCTGGCC CTCCAGGACTCTGGCCTGGAGGTGAACATT

GTGACTGCCTCCCAGTATGCCCTGGGCATC ATCCAGGCCCAGCCTGATCAGTCTGAGTCT

GAGCTGGTGAACCAGATCATTGAGCAGCTG ATCAAGAAGGAGAAGGTGTACCTGGCCTGG

GTGCCTGCCCACAAGGGCATTGGGGGCAAT GAGCAGGTGGACAAGCTGGTGTCTGCTGGC

CACTCCAACTGGAGGGCTATGGCCTCTGAC TTCAACCTGCCCCCTGTGGTGGCTAAGGAG

ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC
TGCTCCCCTG GCATCTGGCA GCTGGCCTGC ACCCACCTGG AGGGCAAGGT GATCCTGGTG
GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG
GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT
GCCAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC
AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGC CTCCATGAAC
AAGGAGCTGA AGAAGATCAT TGGGCAGGTG AGGGACCAGG CTGAGCACCT GAAGACAGCT
GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC
GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG

AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG GAGGGGGCTG TGGTGATCCA GGACAACTCT
GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG
GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT (SEQ ID
N0:3) .
In order to produce the IA-pol-based adenoviral vaccines of the present invention, inactivation of the enzymatic functions was achieved by replacing a total of nine active site residues from the enzyme subunits with alanine side-chains.
As shown in Table 1, all residues that comprise the catalytic triad of the polymerase, namely Asp112, Asp187, and Aspl88, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989, Proc. Natl.
Acad. Sci.
1989; 86: 4803-4807). Three additional mutations were introduced at Asp445, G1u480 and Asp500 to abolish RNase H activity (Asp551 was left unchanged in this IA PoI construct), with each residue being substituted for an Ala residue, respectively (Davies, et al., 1991, Science 252:, 88-95; Schatz, et al., 1989, FEBS Lett.
257: 311-314; Mizrahi, et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353). HIV pol integrase function was abolished through three mutations at Asp626, Asp678 and G1u714.
Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, J. Virol. 69: 376-386; Leavitt, et al., 1993, J. Biol. Chem.
268: 2113-2119). Amino acid residue Pro3 of SEQ ID N0:4 marks the start of the RT gene.
The complete amino acid sequence of IA-Pol is disclosed herein as SEQ ID N0:4 and Figure 17A-C, as follows:
Met A1a Pro Tle Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg .Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu.Lys Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu Pro Gln G1y Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu 1~ Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu I1e Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Ala Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Ala Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn Gly Sex Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly Val Val Ala Ser Met Asn Lys Glu Leu $ Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr.Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro 1~ Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met P.la Gly Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp (SEQ ID N0:4).
As noted above, it will be understood that any combination of the mutations 15 disclosed above may be suitable and therefore be utilized as an IA-pol-based adenoviral HIV vaccine of the present invention, either when administered alone or in a combined modality regime andlor a prime-boost regimen. For example, it may be possible to mutate anly 2 of the 3 residues within the respective reverse transcriptase, RNase-H, and integrase coding regions while still abolishing these enzymatic 20 activities. However, the IA-pol construct described above and disclosed as SEQ ID
N0:3, as well as the expressed protein (SEQ ID N0:4;) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.
Another aspect of this portion of the invention are codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal 25 peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy.
However, a preferred embodiment of the present invention, as with HIV-1 Nef constructs shown herein, is to provide for a HIV-1 Pol mutant adenoviral vaccine construction wherein 30 the pol coding region or a portion thereof is operatively linked to a leader peptide, preferably a leader peptide from human tPA. In other words, a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID N0:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. As noted in 35 Figure 16A-B, a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Pol protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified Pol protein of interest, including but not limited to a HIV-1 Pol protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ 1D N0:17).
Therefore, another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA. To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region.
A DNA molecule which encodes this protein is disclosed herein as SEQ ID N0:5, the open reading frame disclosed herein as SEQ ID N0:6.
To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5' end of the coding region ( herein, "tPA-wt-pol"). A DNA-molecule which encodes this protein is disclosed herein as SEQ 117 NO:S, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635. SEQ ID
NO:S is as follows:

CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA
GCTGAAGCCT GGCATGGATG GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT
CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG
CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG

GCTGGGCATC CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGATGT
GGGGGATGCC TACTTCTCTG TGCCCCTGGA TGAGGACTTC AGGAAGTACA CTGCCTTCAC
CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA
GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT

TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG

GTGGGGCCTG ACCACCCCTGACAAGAAGCACCAGAAGGAGCCCCCCTTCCTGTGGATGGG

CTATGAGCTG CACCCCGACAAGTGGACTGTGCAGCCCATTGTGCTGCCTGAGAAGGACTC

CTGGACTGTG AATGACATCCAGAAGCTGGTGGGCAAGCTGAACTGGGCCTCCCAAATCTA

CCCTGGCATC AAGGTGAGGCAGCTGTGCAAGCTGCTGAGGGGCACCAAGGCCCTGACTGA

S GGTGATCCCC CTGACTGAGGAGGCTGAGCTGGAGCTGGCTGAGAACAGGGAGATCCTGAA

GGAGCCTGTG CATGGGGTGTACTATGACCCCTCCAAGGACCTGATTGCTGAGATCCAGAA

GCAGGGCCAG GGCCAGTGGACCTACCAAATCTACCAGGAGCCCTTCAAGAACCTGAAGAC

TGGCAAGTAT GCCAGGATGAGGGGGGCCCACACCAATGATGTGAAGCAGCTGACTGAGGC

TGTGCAGAAG ATCACCACTGAGTCCATTGTGATCTGGGGCAAGACCCCCAAGTTCAAGCT

CCCTGAGTGG GAGTTTGTGAACACCCCCCCCCTGGTGAAGCTGTGGTACCAGCTGGAGAA

GGAGCCCATT GTGGGGGCTGAGACCTTCTATGTGGATGGGGCTGCCAACAGGGAGACCAA

GCTGGGCAAG GCTGGCTATGTGACCAACAGGGGCAGGCAGAAGGTGGTGACCCTGACTGA

CACCACCAAC CAGAAGACTGAGCTCCAGGCCATCTACCTGGCCCTCCAGGACTCTGGCCT

TCAGTCTGAG TCTGAGCTGGTGAACCAGATCATTGAGCAGCTGATCAAGAAGGAGAAGGT

GTACCTGGCC TGGGTGCCTGCCCACAAGGGCATTGGGGGCAATGAGCAGGTGGACAAGCT

GGTGTCTGCT GGCATCAGGAAGGTGCTGTTCCTGGATGGCATTGACAAGGCCCAGGATGA

GCATGAGAAG TACCACTCCAACTGGAGGGCTATGGCCTCTGACTTCAACCTGCCCCCTGT

ZOGGTGGCTAAG GAGATTGTGGCCTCCTGTGACAAGTGCCAGCTGAAGGGGGAGGCCATGCA

TGGGCAGGTG GACTGCTCCCCTGGCATCTGGCAGCTGGACTGCACCCACCTGGAGGGCAA

GGTGATCCTG GTGGCTGTGCATGTGGCCTCCGGCTACATTGAGGCTGAGGTGATCCCTGC

TGAGACAGGC CAGGAGACTGCCTACTTCCTGCTGAAGCTGGCTGGCAGGTGGCCTGTGAA

GACCATCCAC ACTGACAATGGCTCCAACTTCACTGGGGCCACAGTGAGGGCTGCCTGCTG

ZSGTGGGCTGGC ATCAAGCAGGAGTTTGGCATCCCCTACAACCCCCAGTCCCAGGGGGTGGT

GGAGTCCATG AACAAGGAGCTGAAGAAGATCATTGGGCAGGTGAGGGACCAGGCTGAGCA

CCTGAAGACA GCTGTGCAGATGGCTGTGTTCATCCACAACTTCAAGAGGAAGGGGGGCAT

CGGGGGCTAC~TCCGCTGGGGAGAGGATTGTGGACATCATTGCCACAGACATCCAGACCAA

GGAGCTCCAG AAGCAGATCACCAAGATCCAGAACTTCAGGGTGTACTACAGGGACTCCAG

CCAGGACAAC TCTGACATCAAGGTGGTGCGCAGGAGGAAGGCCAAGATCATCAGGGACTA

TGGCAAGCAG ATGGCTGGGGATGACTGTGTGGCCTCCAGGCAGGATGAGGACTAAAGCCC

GGGCAGATCT (SEQ ID :5).

The open reading frame of the wild type tPA-pol construct disclosed as SEQ

351D NO:S
contains 875 amino acids, disclosed herein as SEQ
m N0:6, as follows:

Met Asp Leu Leu Ala Met Leu Cys Lys Arg Gly Gly Leu Cys Cys Val Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu $ Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly 1$ Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu I1e Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln 2$ Lys Ile Thr Thr Glu Sex Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr.Glu Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Asp Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu Va1 Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu 3$ Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Asp Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys fihr Ile His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val G1n Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp (SEQ ID N0:6).
The present invention also relates to a codon optimized HIV-1 Pol mutant contained within a recombinant adenoviral vector such as IA-Pol (SEQ ID N0:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence; immunogenicity of the expressed protein within the host cell. Any such adenoviral-based HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence.
Therefore, any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H
and/or IN
functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a . . leader peptide/HIV--1 DNA pol construct contains a mutation or-mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. A.n especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ m N0:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in Figure 18. The complete amino acid sequence of the expressed protein is set forth in SEQ )D N0:8. To this end, SEQ )D N0:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, "tPA-opt-IApol"). The open reading frame begins with the initiating Met (nucleotides 8-10) and terminates with a "TAA" codon at nucleotides 2633-2635. The nucleotide sequence encoding tPA-rAPol is also disclosed as follows:
GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT
CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA

CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG
CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG
GAGGAAGCTG GTGGAC'~TCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA
GCTGGGCATC CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGCTGT

CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA
GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT
CAGGAAGCAG AACCCTGACA TTGTGATCTA CCAGTACATG GCTGCCCTGT ATGTGGGCTC
TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG
25 GTGGGGCCTG ACCACCCCTG ACAAGAAGCA CCAGAAGGAG CCCCCCTTCC ,TGTGGATGGG
CTATGAGCTG CACCCCGACA AGTGGACTGT GCAGCCCATT GTGCTGCCTG AGAAGGACTC
CTGGACTGTG AATGACATCC AGAAGCTGGT GGGCAAGCTG AACTGGGCCT CCCAAATCTA
CCCTGGCATC AAGGTGAGGC AGCTGTGCAA GCTGCTGAGG GGCACCAAGG CCCTGACTGA
GGTGATCCCC CTGACTGAGG AGGCTGAGCT GGAGCTGGCT GAGAACAGGG AGATCCTGAA

-GCAGGGCCAG GGCCAGTGGA CCTACCAAAT CTACCAGGAG CCCTTCAAGA ACCTGAAGAC .
TGGCAAGTAT GCCAGGATGA GGGGGGCCCA CACCAATGAT GTGAAGCAGC TGACTGAGGC
TGTGCAGAAG ATCACCACTG AGTCCATTGT GATCTGGGGC AAGACCCCCA AGTTCAAGCT
GCCCATCCAG AAGGAGACCT GGGAGACCTG GTGGACTGAG TACTGGCAGG CCACCTGGAT

GGAGCCCATT GTGGGGGCTG AGACCTTCTA TGTGGCTGGG GCTGCCAACA GGGAGACCAA

GCTGGGCAAG GCTGGCTATG TGACCAACAGGGGCAGGCAG
AAGGTGGTGA
CCCTGACTGA

CACCACCAAC CAGAAGACTG CCCTCCAGGCCATCTACCTGGCCCTCCAGG ACTCTGGCCT

GGAGGTGAAC ATTGTGACTG CCTCCCAGTATGCCCTGGGC
ATCATCCAGG
CCCAGCCTGA

TCAGTCTGAG TCTGAGCTGG TGAACCAGATCATTGAGCAGCTGATCAAGA AGGAGAAGGT

S GTACCTGGCC TGGGTGCCTG CCCACAAGGGCATTGGGGGCAATGAGCAGG TGGACAAGCT

GGTGTCTGCT GGCATCAGGA AGGTGCTGTTCCTGGATGGCATTGACAAGG CCCAGGATGA

GCATGAGAAG TACCACTCCA ACTGGAGGGCTATGGCCTCTGACTTCAACC TGCCCCCTGT

GGTGGCTAAG GAGATTGTGG CCTCCTGTGACAAGTGCCAGCTGAAGGGGG AGGCCATGCA

TGGGCAGGTG GACTGCTCCC CTGGCATCTGGCAGCTGGCCTGCACCCACC TGGAGGGCAA

IO GGTGATCCTG GTGGCTGTGC ATGTGGCCTCCGGCTACATTGAGGCTGAGG TGATCCCTGC

TGAGACAGGC CAGGAGACTG CCTACTTCCTGCTGAAGCTGGCTGGCAGGT GGCCTGTGAA

GACCATCCAC ACTGCCAATG GCTCCAACTTCACTGGGGCCACAGTGAGGG CTGCCTGCTG

GTGGGCTGGC ATCAAGCAGG AGTTTGGCATCCCCTACAACCCCCAGTCCC AGGGGGTGGT

GGCCTCCATG AACAAGGAGC TGAAGAAGATCATTGGGCAGGTGAGGGACC AGGCTGAGCA

IS CCTGAAGACA GCTGTGCAGA TGGCTGTGTTCATCCACAACTTCAAGAGGA AGGGGGGCAT

CGGGGGCTAC TCCGCTGGGG AGAGGATTGTGGACATCATTGCCACAGACA TCCAGACCAA

GGAGCTCCAG AAGCAGATCA CCAAGATCCAGAACTTCAGGGTGTACTACA GGGACTCCAG

GAACCCCCTG TGGAAGGGCC CTGCCAAGCTGCTGTGGAAGGGGGAGGGGG CTGTGGTGAT

CCAGGACAAC TCTGACATCA AGGTGGTGCCCAGGAGGAAGGCCAAGATCA TCAGGGACTA

GGGCAGATCT (SEQ ID N0:7).

The open reading frame of the tPA-rA-pol construct disclosed as SEQ ID

N0:7 contains 87S amino acids, disclosed herein as tPA-IA-Pol and SEQ 1D N0:8, as follows:

ZS Met Asp Ala Met Lys Arg Gly Cys Cys Leu Leu Leu Cys Gly Leu Val Ala Val Phe Val Ser Pro Ser Ile Ser Pro Ile Ser Pro Ile Glu Ala Glu Thr Val Pro Val Lys Leu Pro Gly Asp Gly Pro Lys Val Lys Met Lys Gln Trp Pro Leu Thr Glu Lys Ile Ala Leu Val Glu Ile Glu Lys Cys Thr Glu Met Glu Lys Glu Lys Ile Lys Ile Gly Pro Glu Gly Ser 3O Asn Pro Tyr Asn Thr Pro Val Ala Ile Lys Lys Asp Ser Thr Phe Lys Lys Trp Arg Lys Leu Val Asp Arg Glu Asn Lys Arg Thr Gln Phe Leu Asp Phe Trp Glu Val Gln Leu Ile Pro Pro Ala Gly Leu Lys Gly His Lys Lys Lys Ser Val Thr Val Ala Val Asp Ala Tyr Phe Ser Leu Gly Val Pro Leu Asp Glu Asp Phe Lys Tyr Ala Phe Thr Ile Pro Arg Thr 3S Ser Ile Asn Asn Glu Thr Pro Ile Arg Gln Tyr Asn Val Leu Gly Tyr Pro Gln Gly Trp Lys Gly Ser Ala Ile Gln Ser Ser Met Thr Pro Phe Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile 1~ Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe 15 Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu 20 Thr Asp Thr Thr Asn Gln Lys Thr Ala Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Ala Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp 2S Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala G1u Val Ile Pro Ala.Glu fihr Gly Gln Glu Thr Ala Tyr Phe_Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly 3$ Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp (SEQ ID N0:8).

CODON OPTfMIZED HIV-1 NEF AND CODON OPTI1VIIZED

Codon optimized version of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.
As disclosed within the above-mentioned documents, particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID N0:9, while the expressed open reading frame is disclosed herein as SEQ 1D NO:10. Another embodiment of Nef based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH2-terminus of the HIV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:11, while the expressed open reading frame is disclosed herein as SEQ
ID N0:12. Another modified Nef optimized coding region relates to a DNA
molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID N0:13, while the expressed open reading frame is disclosed herein as SEQ 1D N0:14. An additional embodiment relates to a DNA
molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a.tPA leader peptide.
This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID
NO:1S, while the expressed open reading frame is disclosed herein as SEQ ID
N0:16.
As disclosed in the above-identified documents (LT.S. Application Serial No.
09/738,782 and PCT International Application PCT/LTS00/34162) and reiterated herein, the following nef based nucleotide and amino acid sequences which comprise the respective open reading frame are as follows:
1. The nucleotide sequence of the codon optimized version of HIV-1 jrfl nef gene is disclosed herein as SEQ ID N0:9, as shown herein:
GATCTGCCAC CATGGGCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA
GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG
CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA
ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG
ZS GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC
TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC
AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT
ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC
CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC CTGCTGCACC

CCAAGCTGGC CTTCCACCAC GTGGCCAGGG~AGCTGCACCC CGAGTACTAC AAGGACTGCT
AAAGCCCGGG C (SEQ ID N0:9).
Preferred codon usage is as follows: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG);
25 Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe ('1 TC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which is hereby incorporated by reference. See also Figure 19A-B for a comparion of wild type vs.
codon optimized nucleotides comprising the open reading frame of HIV-Nef.
30 The open reading frame for SEQ 117 N0:9 above comprises an initiating methionine-residue at nucleotides 12-14 and a "T?~,A" stop codon from nucleotides 660-662. The open reading frame of SEQ ID N0:9 provides for a 216 amino acid HIV-1 Nef protein expressed through utilization of a codon optimized DNA
vaccine vector. The 216 amino acid HIV-1 Nef (jfrl) protein is disclosed herein as SEQ
m 35 ~ NO:10, and as follows:
Met Gly Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys G1y Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Va1 Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID N0:10).
HIV-1 Nef is a 216 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2 (Franchini et al., 1986, Virology 155: 593-599). While not all possible Nef functions have been elucidated, it has become clear that correct trafficking of Nef to the inner plasma membrane promotes viral replication by altering the host intracellular environment to facilitate the early phase of the HIV-1 life cycle and by increasing the infectivity of progeny viral particles. In one aspect of the invention regarding codon-optimized, protein-modified polypeptides, the nef-encoding region of the adenovirus vector of the present invention is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide. The diversity of function that typifies eukaryotic cells depends upon the structural differentiation of their membrane boundaries. To generate and maintain these structures, proteins must be transported from their site of synthesis in the endoplasmic reticulum to predetermined destinations throughout the cell. This requires that the trafficking proteins display sorting signals that are recognized by the molecular machinery responsible for route selection located at the access points to the main trafficking pathways. Sorting decisions for most proteins need to be made only once as they traverse their biosynthetic pathways since their final destination, the cellular location at which they perform their function, becomes their permanent residence.
Maintenance of intracellular integrity depends in part on the selective sorting and accurate transport of proteins to their cozTect destinations. Defined sequence motifs exist in proteins which can act as 'address labels'. A number of sorting signals have been found associated with the cytoplasmic domains of membrane proteins. An effective induction of CTL responses often required sustained, high level endogenous expression of an antigen. As membrane-association via myristylation is an essential requirement for most of Nef's function, mutants lacking myristylation, by glycine-to-alanine change, change of the dileucine motif and/or by substitution with a tpa leader sequence as described herein, will be functionally defective, and therefore will have improved safety profile compared to wild-type Nef for use as an HIV-1 vaccine component.
In another embodiment of this portion of the invention, either the DNA vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific plasminogen activator (tPA) leader. As shown in Figure 16A-B, a DNA vector may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Nef protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Nef protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified Nef protein of interest, including but not limited to a HIV-1 Nef protein which contains a~leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ DJ N0:17).
It has been shown that myristylation of Gly-2 in conjunction with a dileucine motif in the carboxy region of the protein is essential for Nef-induced down regulation of CD4 (Aiken et al., 1994, Cell 76: 853-864) via endocytosis. It has also been shown that Nef expression promotes down regulation of MHCI (Schwartz et al., 1996, Nature Medici~ze 2(3): 338-342) via endocytosis. The present invention relates in part to DNA vaccines which encode modified Nef proteins altered in trafficking and/or functional properties. The modifications introduced into the adenoviral vector HIV vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell. Therefore, a central theme of the DNA
molecules and recombinant adenoviral HIV vaccines of the present invention is (1) host administration and intracellular delivery of a codon optimized nef based adenoviral HIV vaccine; (2) expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, (3) inhibiting or at least altering known early viral functions of Nef which have been shown to promote HIV-1 replication and load within an infected host. Therefore, the nef coding region may be altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues. Also, the nef coding region may be altered so as to result in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues. In addition, the adenoviral vector HIV vaccines of the present invention also relate to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence.
Therefore, specific Nef based constructs further include the following, as exemplification's and not limitations. For example, the present invention relates to an adenoviral vector vaccine which encodes modified forms of HIV-1, an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl) is referred to herein as opt tpanef. The nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ m NO:11, as shown below:
CATGGATGCA ATGAAGAGAG GGCTCTGCTG TGTGCTGCTG CTGTGTGGAG CAGTCTTCGT
TTCGCCCAGC GAGATCTCCT CCAAGAGGTC CGTGCCCGGC TGGTCCACCG TGAGGGAGAG

CGTGGGCGCC GTGTCCAGGG ACCTGGAGAA GCACGGCGCC ATCACCTCCT CCAACACCGC
CGCCACCAAC GCCGACTGCG CCTGGCTGGA GGCCCAGGAG GACGAGGAGG TGGGCTTCCC
CGTGAGGCCC CAGGTGCCCC TGAGGCCCAT GACCTACAAG GGCGCCGTGG ACCTGTCCCA
CTTCCTGAAG GAGAAGGGCG GCCTGGAGGG CCTGATCCAC TCCCAGAAGA GGCAGGACAT

CGGCCCCGGC ATCAGGTTCC CCCTGACCTT CGGCTGGTGC TTCAAGCTGG~TGCCCGTGGA
GCCCGAGAAG GTGGAGGAGG CCAACGAGGG CGAGAACAAC TGCCTGCTGC ACCCCATGTC
CCAGCACGGC ATCGAGGACC CCGAGAAGGA GGTGCTGGAG TGGAGGTTCG ACTCCAAGCT
GGCCTTCCAC CACGTGGCCA GGGAGCTGCA CCCCGAGTAC TACAAGGACT GCTAAAGCC
3$ (SEQ ID N0:11).
The open reading frame for SEQ ID NO:11 comprises an initiating methionine residue at nucleotides 2-4 and a "TAA" stop codon from nucleotides 713-715.
The open reading frame of SEQ ll~ N0:3 provides for a 237 amino acid HIV-1 Nef protein which comprises a tPA leader sequence fused to amino acids 6-216 of Nef, including the dileucine motif at amino acid residues 174 and I7S. This S amino acid tPA/Nef (jfrl) fusion protein is disclosed herein as SEQ )D
N0:12, and is shown as follows:
Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gln Val,Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu 1S Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu-Tyr Tyr Lys Asp Cys (SEQ ID No:l2).
Therefore, this exemplified Nef protein, Opt tPA-Nef, contains both a tPA
leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for 2S expression in a mammalian system such as a human.
In another specific embodiment of the present invention, a DNA molecule is disclosed which encodes optimized HIV-1 Nef wherein the open reading frame of a recombinant adenoviral HIV vaccine encodes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-17S
dileucine motif to Ala-174-Ala-175. This open reading frame is herein described as opt nef (G2A,LLAA) and is disclosed as SEQ )D N0:13, which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662. The nucleotide sequence of this codon optimized version of HIV-1 jrfl nef gene with the above mentioned modifications is disclosed herein as SEQ ID
N0:13, 3S as follows:

GATCTGCCAC CATGGCCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA
GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG
CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA
ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG
S GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC
TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC
AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT
ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC
CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC GCCGCCCACC

CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AGCTGCACCC CGAGTACTAC AAGGACTGCT
AAAGCCCGGG C (SEQ ID N0:13).
The open reading frame of SEQ )D N0:13 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID N0:14, as follows:
15 Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val 20 Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro 2S Glu Lys Val Glu Glu Ala Asn G1u Gly Glu Asn Asn Cys Ala Ala His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys Ser (SEQ ID N0:14).
An additional embodiment of the present invention relates to another DNA
30 molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been. deleted, .as well as comprising a tPA
leader peptide.
This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 35 and Ala-175 (Ala-195 and Ala-196 in this tPA-based fusion protein). The nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ m N0:15, as shown below:

CATGGATGCA ATGAAGAGAG GGCTCTGCTGTGTGCTGCTGCTGTGTGGAG CAGTCTTCGT

TTCGCCCAGC GAGATCTCCT CCAAGAGGTCCGTGCCCGGCTGGTCCACCG TGAGGGAGAG

GATGAGGAGG GCCGAGCCCG CCGCCGACAGGGTGAGGAGGACCGAGCCCG CCGCCGTGGG

CGTGGGCGCC GTGTCCAGGG ACCTGGAGAAGCACGGCGCCATCACCTCCT CCAACACCGC

CGCCACCAAC GCCGACTGCG CCTGGCTGGAGGCCCAGGAGGACGAGGAGG TGGGCTTCCC

CGTGAGGCCC CAGGTGCCCC TGAGGCCCATGACCTACAAGGGCGCCGTGG ACCTGTCCCA

CTTCCTGAAG GAGAAGGGCG GCCTGGAGGGCCTGATCCACTCCCAGAAGA GGCAGGACAT

CGGCCCCGGC ATCAGGTTCC CCCTGACCTTCGGCTGGTGCTTCAAGCTGG TGCCCGTGGA

GCCCGAGAAG GTGGAGGAGG CCAACGAGGGCGAGAACAACTGCGCCGCCC ACCCCATGTC

CCAGCACGGC ATCGAGGACC CCGAGAAGGAGGTGCTGGAGTGGAGGTTCG ACTCCAAGCT

GGCCTTCCAC CACGTGGCCA GGGAGCTGCACCCCGAGTACTACAAGGACT GCTAAAGCCC

(SEQ ID N0:15).

The open reading frame of ff~ N0:7 SEQ encoding tPA-Nef (LLAA), disclosed herein as SEQ m N0:16, is as follows:

Met Asp Ala Met Lys Arg Gly Cys Cys Leu Leu Leu Cys Gly Leu Val Ala Val Phe Val Ser Pro Ser Ile Ser Lys Arg Ser Val Pro Glu Ser 2O'Gly Trp Ser Thr Val Arg Glu Met Arg Ala Glu Pro Ala Ala Arg Arg Asp Arg Val Arg Arg Thr Glu Ala Ala Gly Va1 Gly Ala Val Pro Val Ser Arg Asp Leu Glu Lys His Ala Ile Ser Ser Asn Thr Ala Gly Thr Ala Thr Asn Ala Asp Cys Ala Leu Glu Gln Glu Asp Glu Glu Trp Ala Val Gly Phe Pro Val Arg Pro Val Pro Arg Pro Met Thr Tyr Gln Leu Lys Gly Ala Val Asp Leu Ser Phe Leu Glu Lys Gly Gly Leu His Lys Glu Gly Leu Ile His Ser Gln Arg Gln Ile Leu Asp Leu Trp Lys Asp Val Tyr His Thr Gln Gly Tyr Pro Asp Gln Asn Tyr Thr Pro Phe Trp Gly Pro Gly Ile Arg Phe Pro Thr Phe Trp Cys Phe Lys Leu Leu Gly Val Pro Val Glu Pro Glu Lys Glu Glu Asn Glu Gly Glu Asn Val Ala 3O Asn Cys Ala Ala His Pro Met Gln His Ile Glu Asp Pro Glu Ser Gly Lys Glu Val Leu Glu Trp Arg Asp Ser Leu Ala Phe His His Phe Lys Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID N0:16).
An adenoviral vector of the present invention may comprise a DNA sequence, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize "non-codon optimized" versions of the constructs disclosed herein, especially modified versions of HIV Nef which are shown to promote a substantial cellular immune response subsequent to host administration.
Figure 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors VlJns/nef (Figure 20A), VlJns/nef(G2A,LLAA) (Figure 20B), VlJns/tpanef (Figure 20C) and VlJnsltpanef(LLAA) (Figure 20C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters;
nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. VlJns/tpanef and VlJns/tpanef(LLAA) have identical sequences at the junctions.
Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucine174 and 175 are the sites involved in myristylation and dileucine motif, respectively.

MRKAd5Po1 Construction and Virus Rescue Construction of vector: slzuttle plasmid and pre-adenovirzss plasmid - Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5pol, is depicted in Figure 22. Briefly, the adenoviral shuttle vector for the full-length inactivated HIV-1 pol gene is as follows. The vector MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is a derivative of the shuttle vector used in the construction of the MRKAdSgag adenoviral pre-plasmid. The vector contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BgIII site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAdS(El-/E3+)Clal (or MRKpAdHVE3) pre-plasmid. The vector, similar to the original shuttle vector contains the Pacl site, extension to the packaging signal region, and extension to the pIX gene. The synthetic full-length codon-optimized HIV-1 pol gene was isolated directly from the plasmid pV lJns-HIV-pol-inact(opt). Digestion of this plasmid with Bgl II releases the pol gene intact (comprising a codon optimized IA pol sequence as disclosed in SEQ
ID
N0:3). The pol fragment was gel purified and ligated into the MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) shuttle vector at the BgIII
site. The clones were checked for the correct orientation of the gene by using restriction enzymes DraBIlNotl. A positive clone was isolated and named MRKpdel+hCMVmin+FL-pol+bGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdel+hCMVmin+FL-pol+bGHpA(S) was digested with restriction enzymes Pacl and Bst1107 I (or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(El-/E3+)Clal.
The resulting pre-plasmid originally named MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+ is now referred to as "pMRKAdSpol". The genetic structure of the resulting pMRK.Ad5po1 was verified by PCR, restriction enzyme and DNA
sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the pol transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAdSHIV-lpol adenoviral vector is shown in Figure 26 A-AO.
Generatioia of research-grade recombinant adenovirus - The pre-adenovirus plasmid, pMRKAdSpol, was rescued as infectious virions in PER.C6°
adherent monolayer cell culture. To rescue infectious virus, 12 ~g of pMRKAdSpol was digested with restriction enzyme Pacl (New England Biolabs) and 3.3 wg was transfected per 6 cm dish of PER.C6° cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). PacI digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6°cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at <_ -60°C. This pol containing recombinant adenovirus is referred to herein as "MRKAdSpol". This recombinant adenovirus expresses an inactivated HIV-1 Pol protein as shown in SEQ m N0:6.

MRKAdSNef Construction and Virus Rescue Construction of vector: shuttle plasmid arad pre-adenovirus plasmid - Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAdSnef, is depicted in Figure 23. Briefly, as shown in Example 19 above, the vector MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is the shuttle vector used in the construction of the MRKAdSgag adenoviral pre-plasmid. It has been modified to contain the Pac1 site, extension to the packaging signal region, and extension to the pIX gene. It contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bgll l site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal pre-plasmid. The synthetic full-length codon-optimized HIV-1 nef gene was isolated directly from the plasmid pVlJns/nef (G2A,LLAA). Digestion of this plasmid with Bglll releases the pol gene intact, which comprises the nucleotide sequence as disclosed in SEQ ll~ N0:13.
The nef fragment was gel purified and ligated into the MRKpdelEl+CMVmin+BGHpA(str.) shuttle vector at the Bgll l site. The clones were checked for correction orientation of the gene by using restriction enzyme Scal.
A positive clone was isolated and named MRKpdelElhCMVminFL-nefBGHpA(s).
The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdelElhCMVminFL-nefBGHpA(s) was digested with restriction enzymes Pacl and Bst1107 I (or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(E1/E3+)Clal. The resulting pre-plasmid originally named MRKpdelElhCMVminFL-nefBGHpA(s) is now referred to as "pMRKAdSnef'. The genetic structure of the resulting pMRKAdSnef was verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E.
coli XL,-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the nef transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAdSHIV-lnef adenoviral vector is shown in Figure 27A-AM.
Generation of research-grade recombinant adenovirus - The pre-adenovirus plasmid, pMRK.AdSnef, was rescued as infectious virions in PER.C6~ adherent monolayer cell culture. To rescue infectious virus, 12 ~g of pMRKAdnef was digested with restriction enzyme Pacl (New England Biolabs) and 3.3 ~g was transfected per 6 cm dish of PER.C6~ cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Pacl digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6°cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at <_ -60°C. This nef containing recombinant adenovirus is now referred to as "MRKAdSnef'.

Construction of Murine CMV Promoter Containing Shuttle Vectors for Inactivated Pol and Nef/G2A,LLAA
The murine CMV (mCMV) was amplified from the plasmid pMH4 (supplied by Frank Graham, McMaster University) using the primer set: mCMV (Not 1) Forward: 5'-ATA AGA ATG CGG CCG CCA TAT ACT GAG TCA TTA GG-3' (SEQ ID NO: 20); mCMV (Bgl I)7Reverse: 5'-AAG GAA GAT CTA CCG ACG
CTG GTC GCG CCT C-3' (SEQ 117 N0:21). The underlined nucleotides represent the Not I and the Bgl II sites respectively for each primer. This PCR amplicon was used for the construction of the mCMV shuttle vector containing the transgene in the El parallel orientation. The hCMV promoter was removed from the original shuttle vector (containing the hCMV-gag-bGHpA transgene in the E1 parallel orientation) by digestion with Not I and Bgl II. The mCMV promoter (Not IlBgl II digested PCR
product) was inserted into the shuttle vector in a directional manner. The shuttle vector was then digested with Bgl II and the gag reporter gene (Bgl II
fragment) was re-inserted back into the shuttle vector. Several clones were screened for correct orientation of the reporter gene. For the construction of the mCMV-gag in the antiparallel orientation, the mCMV promoter was amplified from the plasmid pMH4 using the following primer set: mCMV (Asc I) Forward: 5'- ATA AGA ATG GCG
CGC CAT ATA CTG AGT CAT TAG G (SEQ ID N0:22); mCMV (Bgl IIJ Reverse:
5' AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C (SEQ ID N0:23). The underlined nucleotides represent the Asc I and Bgl II sites, respectively for each primer. The shuttle vector containing the hCMV-gag transgene in the E1 antiparallel orientation was digested with Ascl and Bgll l to remove the hCMV-gag portion of the transgene. The mCMV promoter (AscllBgll l digested PCR product) was inserted into the shuttle vector in a directional manner. The vector was then digested with Bgll l and the gag reporter gene (Bgll l fragment) was re-inserted. Several clones were screened for correct orientation of the reporter gene. For each of the full length IA pol and full length nef/G2A,LLAA genes, cloning was performed using the unique Bgl II site within the mCMV-bGHpA shuttle vector. The pol and nef genes were excised from their respective pV lJns plasmids by Bgl II digestion.

Construction of mCMV Full Length Inactivated Pol and Full Length nef/G2A.LLAA Adenovectors Each of these transgenes of Example 21 were inserted into the modified shuttle vector in both the El parallel and E1 anti-parallel orientations. Pacl and BstZ110I digestion of each shuttle vector was performed and each specific transgene fragment containing the flanking Ad5 sequences was isolated and co-transformed with Cla I digested MRKpAdS(E3+) or MRKpAd5(E3-) aderiovector plasmids via bacterial homologous recombination in BJ5183 E. coli cells. Recombinant pre-plasmid adenovectors containing the various transgenes in both the E3- and E3+
versions (and in the El parallel and El antiparallel orientations) were subsequently prepared in large scale following transformation into XL-1 Blue E. coli cells and analyzed by restriction analysis and sequencing.

Construction of hCMV-tpa-nef (LLAA) Adenovector The tpa-nef gene was amplified out from GMP grade pV lJns-tpanef (LLAA) vector using the primer sets: Tpanef (BamHI) F 5'-ATT GGA TCC ATG GAT GCA ATG
AAG AGA GGG (SEQ ID 24); Tpanef (BamHI) R 5'-ATA GGA TCC TTA GCA
GTC CTT GTA GTA CTC G (SEQ ID N0:25). The resulting PCR product was digested with BamHI, gel purified and cloned into the Bgl II site of MRK.AdSCMV-bGHpA shuttle vector (Bgl II digested and calf intestinal phosphatase treated).
Clones containing the tpanef (LLAA) gene (see SEQ ID N0:15 for complet coding region) in the correct orientation with respect to the hCMV promoter were selected following Sca I digestion. The resulting MRKAdStpanef shuttle vector was digested with Pac I and Bst 21101 and cloned into the E3+ MRKAdS adenovector via bacterial homologous recombination techniques.

Immunogenicity of MRKAd5po1 and MRKAdSnef Vaccine Materials and Methods - Rodent hnmunization - Groups of N=10 BALB/c mice were immunized i.m. with the following vectors: (1) MRKAdShCMV-IApol (E3+) at either 10~7 vp and 10~9 vp; and (2) NIRKAdShCMV-IApol (E3-) at either 8:~

10~7 vp and 10~9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and TFNg ELIspot analyses, respectively. For all rodent immunizations, the Ad5 vectors were diluted in 5 mM Tris, 5% sucrose, 75 mM NaCl, 1 mM MgCl2, 0.005% polysorbate 80, pH 8Ø The total dose was injected to both quadricep muscles in 50 ~I, aliquots using a 0.3-mL insulin syringe with 28-1/2G needles (Becton-Dickinson, Franklin Lakes, NJ).
Groups of N=10 C57/BL6 mice were immunized i.m. with the following vectors: (1) MRKAdShCMV-nef(G2A,LLAA) (E3+) at either 10~7 vp and 10~9 vp;
(2) MRKAdSmCMV-nef(G2A,LLAA) (E3+) at either 10~7 vp and 10~9 vp; and (3) MItKAd5mCMV-tpanef(LLAA) (E3+) at either 10~7 vp and 10~9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IENg ELIspot analyses, respectively.
No~z-human Primate imnzuizizatiofz - Cohorts of 3 rhesus macaques (2-3 kg) were vaccinated with the following Ad vectors: (1) MRKAdShCMV-IApol (E3+) at either 10~9 vp and 10~11 vp dose; and (2) MRKAdShCMV-IApol (E3-) at either 10~9 vp and 10~11 vp; (3) MRKAdShCMV-nef(G2A,LLAA) (E3+) at either 10~9 vp and 10~1l vp; and (4) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10~9 vp and 10~11 vp. The vaccine was administered to chemically restrained monkeys (10 mg/kg ketamine) by needle injection of two 0.5 mL aliquots of the Ad vectors (in 5 mM Tris, 5% sucrose, 75 mM NaCI, 1 mM MgCl2, 0.005% polysorbate 80, pH 8.0) into both deltoid muscles. The animals were immunized twice at a 4 week interval (T=0, 4 weeks).
MuriTZe avti-RT a~zd anti-nef ELISA - Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester; N~
were coated by overnight incubation with 100 wL, of 1 ~g /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, MD) in PBS. For anti-nef ELISA, 100 uL of ug/mL HIV-1 nef (Advanced Biotechnologies, Columbia, MD) was used to coat the plates. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP
instrument (Hunstville, AL) and incubated for 2 h with 200 ~.~IJwell of blocking solution (PBS/0.05% tween/1% BSA). An initial serum dilution of 100-fold was performed followed by 4-fold serial dilution. 100-p.I. aliquots of serially diluted samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 p,L of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, CA) were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 ~I.1,2-phenylenediaxnine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for 15 min. The reaction was quenched by adding 100 ~I. of O.SM HZS04 per well. OD49z readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD49a (2.5 times the background value).
Nora-human primate and marine ELlspot assays - The enzyme-linked immuno-spot (ELISpot) assay was utilized to enumerate antigen-specific INFy-secreting cells from mouse spleens (Miyahira, et a1.1995, J. Immunol. Methods 181:45-54) or macaque PBMCs. Mouse spleens were pooled from 5 mice/cohort and single cell suspensions were prepared at 5x106/mL in complete RPMI media (RPMI1640, 10% FBS, 2mM L-glutamine, 100U/mL Penicillin, 100 u/mL
streptomycin, 10 mM Hepes, 50 uM (3-ME). Rhesus PBMCs were prepared from 8-15 mL of heparinized blood following standard Ficoll gradient separation (Coligan, et al, 1998, Currefit Protocols in Immunology. John Wiley & Sons, Inc.).
Multiscreen opaque plates (Millipore, France) were coated with 100 E.iL/well of either 5 ~g/mL
purified rat anti-mouse IFN-y IgGl, clone R4-6A2 (Pharmingen, San Diego, CA), or 15 ug/mL mouse anti-human IFN-'y IgG2a (Cat. No. 1598-00, R&D Systems, Minneapolis, MN) in PBS at 4°C overnight for marine or monkey assays, respectively. The plates were washed with PBS/penicillin/streptomycin and blocked with 200 ~Llwell of complete RPMI media for 37 °C for at least 2 h.
To each well, 50 p,I, of cell samples (4-5x105 cells per well) and 50 NT. of the antigen solution were added. To the control well, 50 ~,I, of the media containing DMSO were added; for specific responses, either selected peptides or peptide pools (4 ug/mL per peptide final concentration) were added. For BALB/c mice immunized with the pol constructs, stimulation was conducted using a pool of CD4+-epitope containing 20-mer peptides (aa21-40, aa411-430, aa641-660, aa731-750, aa771-790) or a pool of CD8+-epitope containing peptides (aa201-220, aa311-330, aa781-800).
For C57BL6 mice immunized with the nef construct, either aa51-70 (CD8+ T cell epitope) or aa81-100 (CD4~ peptide derived from the nef sequence was added for specific stimulation. In monkeys, the responses against pol were evaluated using two pools (L and R) of 20-as peptides that encompass the entire pol sequence and overlap by 10 amino acids. In monkeys vaccinated with the nef constructs, a single pool containing 20-mer peptides covering the entire HIV-1 nef sequence and overlapping by 10 as was used. Each sample/antigen mixture was performed in triplicate wells for murine samples or in duplicate wells for rhesus PBMCs. Plates were incubated at 37°C, 5% C02, 90% humidity for 20-24 h. The plates were washed with PBS/0.05%
Tween 20 and incubated with 100 ~L/well of either 1.25 ~g/mL biotin-conjugated rat anti-mouse IFN-y mAb, clone XMG1.2 (Pharmingen) or of 0.1 ug/mL biotinylated anti-human IFN-gamma goat polyclonal antibody (R&D Systems) at 4°C
overnight.
The plates were washed and incubated with 100 p,L/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5%
FBS for 30 min at 37 °C. Spots were developed by incubating with 100 I,vIJwell 1-step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 106 cell input.
Nosz-human Primate anti-RT ELISA - The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (#97111234). 250 uL of each sample is incubated with 15 uL
of 266 ng/mL RT recombinant protein (in RCM 563, 1 % BSA, 0.1 % tween, 0.1 %
NaN3) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature. Similar mixtures are prepared using serially diluted samples of a standard and a negative control which defines maximum RT binding. 200 uL/well of each sample and standard were added to the washed plate and the plate incubated 16-24 h at room temperature. Bound RT is quantified following the procedures described in Coulter p24 assay kit and reported in milliMerck units per. mL arbitrarily defined by the chosen standard.
Results - Rodefat Studies - BALB/c mice (n=5 mice/cohort) were immunized once or twice with varying doses of MRKAdShCMV-IApol(E3+) and MRKAdShCMV-IApol(E3-). At 3 weeks after the second dose, Anti-pol IgG levels were determined by an ELISA assay using RT as a surrogate antigen. Cellular response were quantified via IFN'y ELISpot assay against pools of pol-epitope containing peptides. The results of these assays are summarized.in Table 10.
The .
results indicate that the mouse vaccinees exhibited detectable anti-RT IgGs with an adenovector dose as low as 10~7 vp. The humoral responses are highly dose-dependent and are boostable with a second immunization. One or two doses of either pol vectors elicit high frequencies of antigen-specific CD4+ and CD8+ T cells;
the responses are weakly dose-dependent but are boostable with a second immunization.
s'7 T A T T
Table of cxaaoof 10. lvlt vectors ImmunoQenici m xsr-Ltrr~~c mice.

Anti-RT SFCllO~b I cells G
T(ters' CD4+ CD8+

Group No.
Vaccine Dose of GMT +SE -SE Mediumpeptidepeptide poses of ool 1 MRKAdShCMVFLpoI(E3+)10~7vp2 3104193017851530201(1) 75(4)2313(87) 1 919 372 265 1(1) 72(9)533(41) 2 MRKAdShCMVFLpoI10~9 2 183840D0 0 2(2) 114(9)2083(182) (E3+) vp 1 7131555285203035551(1) 48(7)733(89) 3 MRKAd5hCMVFLpoI10~7 2 3104193862181720970(0) 223(7)2607(27) (E3-) vp 1 6400 140134393 10(8) 141(21)409(28) 4 MRKAdShCMVFLpo1(E3-)10~9vp2 18304000 0 1(1) 180(13)2365(11) 1 12416753967253006810(0) 39(13)833(83) Naive none none 57 9 7 9 2 11 10 °GMT, geometric mean titer of the cohort of 5 mice; SE, standard error of the gemetric mean °Near or at the upper limit of the serial dilution; hence, could be greater than this value °No. of Spot-formtng CeOs per milifon spiecnoytes; mean values of triplicates are reported along with standard errors in parenthesis.
C57/BL6 mice were immunized once or twice with varying doses of MRKAdShCMV-nef(G2A,LLAA) (E3+), MRKAdSmCMV-nef(G2A,LLAA) (E3+) at either 10~7 vp and(3) MRKAdSmCMV-tpanef(LLAA) (E3+) at either 10~7 vp and 10~9 vp. The immune response were analyzed using similar protocols and the results are listed in Table 11. While anti-nef IgG responses could not be detected in this model system with any of the constructs, there are strong indications of a cellular immunity generated against nef using the ELIspot assay.
_ r,~n mr t Table xx~aonei 11. vectors lmmuno m.~
enlcit ~~.t3LO
of m~cc.
m An tinefrs- S FC/10~6 IgG eells Tfte No. MT SE -SE 0 ~p~
of aC 0 GroupVaecine Dose DosesG + MediumDB+

1 MRKAd5hCMVFLnef10~7vp2 174 70 50 1(1) 23(1)1(1) (E3+) 1 132 42 32 0(0) 0(0) 0(0) 2 MRKAdShCMVFLnef10~8vp2 174 70 50 0(0) 61(7)4(2) (E3+) 1 132 42 32 1(1) 62(7)3(1) 3 MRKAd5mCMVFLnef10~7vp2 132 42 32 3(1) 15(5)5(2) (E3+) 1 115 48 33 3(2) 3(2) 4(2) 4 MRKAdSmCMVFLnef(E3+)10~9vp2 132 42 32 4(2) 83(13)b(1) 1 132 42 32 2(1) 29(2)4(0) 5 MRKHd5mCMVtpanef(E3+)10~7 2 132 42 32 3(2) 14(2)b(1) vp 1 100 0 0 3(1) 13(4)10(3) 6 MRKAd5mCMVipanef(E3+)10~9vp2 230 170 98 3(2) 145(29)4(0) 1 115 46 33 7(1) 151(14)10(0) 7 Naive none none 152 78 52 21 ~ 28 ~ 2 15 3 'GMT, geometric mean titer of the cohort of 5 mice; SE, stanearo error or the gememc mean °No. of spot-forming ceits per militon spteatoytes; mean values of triplicates are reported along with standard errors in parenfheala.
Monkey Studies - Cohorts of 3 rhesus macaques were immunized with 2 doses of MRKAdShCMV-IApol(E3+) and MRKAdShCMV-IApol(E3-). The number of antigen-specific T cells (per million PBMCs) were enumerated using one of two ss peptide pools (L and R) that cover the entire pol sequence; the results are listed in Table 12. Moderate-to-strong T cell responses were detected in the vaccinees using either constructs even at a low dose of 10~9 vp. Longitudinal analyses of the anti-RT
antibody titers in the animals suggest that the pol transgene product is expressed efficiently to elicit a humoral response (Table 13). It would appear that generally higher immune responses were observed in animals that received the E3-construct compared to the E3+ virus.
Table 12. Pol-specific T Cell Responses in MRKAd5po1 Immunized Rhesus Maca ues.

Vaccine (T-_0,4 Prebieed T-_4 T=7 T~16 wks Monk H

MockPolPal Moek Moek Mock L R Pol Pol Pol L L L
Pol Pol Pol R R R

MRKAdShCMV-IApd(E3+)1 0 D 1 38 31 0 52 1460 49 715 10~t1 vp 990215 1 2 2 10 98 249 1 109 30522 88 250 NQtKAdShCNN-IApd(E3+)0 2 0 4 331114 0 58 14 0 6 6 1p9 vp 99D180 0 4 2 0 19 192 4 36 1565 38 108 t~tKp~c$hCMV-IApd(E3-)5 2 2 20 82 172 1 68 1149 21 40 10~ll vp 990166 4 12 6 S 120421 2 271 4891A 875530 NPtKAdShCMV-IApd(E3-)10 10 B 12 724745 4 322 3784 188176 1 ON vp CDl G 2 0 1 5 474468 0 232 2120 101121 083D nd nd nd nd nd nd 4 2 2 1 2 no, rroi oecerm~eo ae~onaa are sFC ~r mmron PeMCs: mean m m~W~e wens.
Table 13. Anti-RT IQ Levels in MRKAd5po1 Immunized macaques.
tT ANTIBODYASSAYTITERS INmMllllnl Jaca ne/Mon ke T a~c T =4 T =7 T =12_ T =16 JIRKAdShCMV-I of E3+ 10~11 v ~9C100 6l 1999 5928 4768 1ARKAdShCMV-I I(E3+ 10~9v ~9D212 10 40 49 68 ~9D180 <10 36 79 93 1 <10 37 71 76 MR KAdShCMV-I I E 3- 10~
11 v ~9D239 44 460 1234 1015 ~9C186 21 233 480 345 MR KAdShCMV-I I E3- 10~9 v Cell ~ 15 ~ 112 149 237 When rhesus macaques were immunized i.m. with two doses of MRKAdSnef constructs, vigorous T cell responses ranging from 100 to as high as 1100 per million were observed in 8 of 12 vaccinees (Table 14). The efficacies of the mCMV- and hCMV- driven nef constructs are comparable on the basis of the data generated thus far.
N f if' T 11 R MRKAdS f Imm d Rh Table 14. a -spec is ce espouses m ne umze esus Maca ues.

Vaccine (T=0,4 wks) Monk P re T=4 T=7 T= 16 #

Mock Nef MockNef MockNet MockNef MRKAdShCMV-nef(G2A,LLAA) 0 4 31 440 4 368 1 251 (E3+) CD2D

10~11 vp CC7B 0 0 2 521 0 178 1 1522 MRKAdShCMV-nef(G2A,LLAA) 9 9 6 52 0 3b 0 15 (E3+) CC2K

10~9 vp CD15 b 4 30 998 2 586 0 434 CDi6 6 1 6 11460 369 1 212 MRKAd5mCMV~ef(G2A,LLAA) 1 5 4 614 0 298 2 419 (E3+) _ 99D191 10~11 vp 99D144 4 6 5 434 0 1100 2 932 MRKAdSmCMV-nef(G2A,LLAA) 1 11 14 231 1 126 0 70 (E3+) 99D224 10'9 vp 99D250 8 9 4 108 0 54 0 5 Naive 083Q nd nd 18 22 4 5 2 1 Comparison of Clade B vs. Clade C T Cell Responses in HIV-Infected Subjects PBMC samples collected from two dozens of patients infected with HIV-1 in US were tested in ELISPOT assays with peptide pools of 20-mer peptides overlapping by 10 amino acids. Four different peptide pools were tested for cross-Glade recognition, and they were either derived from a Glade B-based isolate (gag H-b; nef b) or a Glade C-based isolate (gag H-c, nef-c). Data in Table 15 shows that T
cells from these patients presumably infected with Glade B HIV-1 could recognize Glade C
gag and nef antigens in ELISPOT assay. Correlation analysis further demonstrated that these T cell responses against Glade C gag peptide pool were about 60% of the Glade B counterpart (Figure 24), while the T cell responses against Glade C
nef were about 85% of the Glade B counterpart (Figure 25). These results suggest that cellular immune responses generated in patients infected with Glade B HIV-1 can recognize gag and nef antigens derived from Glade C HIV-1. These data show that a HIV
vaccine, such as a DNA or MRKAdS-based adenoviral vaccine expressing a Glade B

gag and/or nef antigen will potentially have the ability to provide a prophylactic and/or therapetic advantage on a global scale.
Table 15 Responses Shown as the Number of gIFN-Secreting T Cells per Million PBMCs sub bleed gag epito gag H-b gages-c nef-b nef-c ect date ~e #
mock from mapping #100 i9-.lul-9912 10 3950 1385 1295 1300 #101 25-Jul-993 15 3885 1280 na 1020 #t02 25-.lul-994 15 1740 850 1255 1785 #10.4 7-.lun-992 5 1355 1185 na 1060 #107 t i-Oct-992 25 3305 2795 670 870 #405 1 t 2 15 4575 3180 1700 1500 -Jul-99 #501 t9-,lul-992 15 1100 570 3365 3460 #505 18-Jul-995 10 2145 1725 1235 na #5o6 28-Feb-992 25 150 45 400 610 #701 28-Mar-995 30 7620 4775 3320 2780 #709 t 7-May-993 15 2785 1945 1090 1630 #710 24-May-994 5 1055 1080 2210 2140 Characterization and Production of MRKAdSpol and MRKAdSnef Vectors in Roller Bottles Expaftsiora of rtef a~zd poi Adenovectors - Nef and poi CsCl purified MRKAdS
seeds were used to infect roller bottles to produce P4 virus to be used as a seed for further experiments. P4 MRKAdS poi and nef vectors were used to infect roller bottles at an MOI 280 vp/cell, except for hCMV-tpa-nef [E3+] which was infected at an MOI of 125 due to low titers of seed obtained at P4.
Table 16 Viral parkicle concentrations for P5 nef and poi adenovectors Adenovector AEX Titer AEX Titer Amplification (101 v /ml culture(104 v /cell) Ratio hCMV-FL-nef [E3+]1.1 0.9 30 mCMV-FL-nef [E3+]2.2 2.1 75 hCMV- a-nef 3+] 0.07 0.1 5 mCMV- a-nef [E3+]1.3 0.9 35 hCMV-FL- of [E3+J2.7 2.1 75 hCMV-FL- of [E3-1.9 1.3 45 Roller Bottle Passaging - Passaging of the pol and nef constructs continued through passage seven. Cell-associated (freeze/thaw lysis) and whole broth (triton-lysis) titers obtained in all passages were very consistent. In general, MRKAdSpol is ca. 70% as productive as MRKAdSgag while MRKAdSnef is ca. 25% as productive as MRK.Ad5gag. Samples of P7 virus for both constructs were analyzed by V&CB
by restriction digest analysis and did not show any rearrangements.
Table 17. tivit KtLAU~
Passage Six for 01 ana Viral Produc M Nltct~acner Xviable Cell AEX TiterTiter AmplificationTriton Lysis (1D Passage Titer cellslml), Viability (Cell (%) Assotiated) Infection Number 10' vplml10' Ratio 10' vplml Harvest culture vp/cell culture hCMV-Firnef 1.22, 62 0.8 0.7 25 1.6 [H3+] pool 8590 1 0.99.
62h 2 1.10, hCMV-1~Lr.pol1.42, 62 4.5 3.2 1 L5 7.0 [E3+] pool 89Yo I 1.22, 709b 2 1.42, 74%

Table 18. Passa vuct~aaneil a Seven Viral Productivi for MlusAdS
of ana l Xviable Cell AF.X Titer AmplificationTriton (10 PassageTiter Lysis ce0s/ml), Titer Viability (Cell (9) Associated) Infection Number10' vp/atl10'vplce(IRatio IO' vphnl Harvest culture culture hCMV-FL-acf 133, 66 1.0 0.8 29 2.1 [E3+] Pool 909b 1 0.96, 2 1.18, 73~

hCMV-FL-pol 0.90*, 56 42 4.7 168 65 [E3+] Pool 90g'o 1 1.18, 2 1.04, 1 80.6 MRKAdSnef and MRKAdSpol Viral Production Kinetics - A timecourse experiment was carned out in roller bottles to determine if the viral production kinetics of the NlRKAd5po1 and MRKAdSnef vectors were sin>ilar to those of MRI~AdSgag. PER.C6~ cells in roller bottle cultures were infected at an MUI of vp/cells with PS MRKAdSpol, PS MRKAdSnef and P7 MRKA.dSgag; for each adenovector, two infected bottles were sampled at 24, 36, 48, and 60 hours post infection. In addition, two bottles were left unsampled until 48 hpi when they were harvested under the Phase I process conditions. The anion-exchange HPLC viral panicle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, _92_ 48, and 60 hpi timepoints are shown in Figure 29A-B. The QPA titers show a similar trend (data not shown).
Comparison of hCMV- and mCMV FL-llef - As the titers obtained with the MRKAdSnef construct (hCMV-FL-nefj were lower than those obtained with MRhAdSgag or MRKAd5pol, a viral productivity comparison experiment was performed with mCMV-FL-nef. Fox each of the two adenovectors (hCMV- and mCMV-FL-nef), two roller bottles were infected at an MOI of 280 vp/cell with passage five clarified lysate. The macroscopic and microscopic observations of the four roller bottles were identical at the time of harvest. Analysis of the clarified lysate produced indicated a higher viral particle concentration in the bottles infected with mCMV-FL-nef, as shown in Table 19. It is stipulated that the higher productivity with mCMV promoter driven nef vector is due to lower nef expression levels in PER.C6~
cells- experiments are underway at V&CB to measure nef expression levels.
Table 19. Passage Six Viral Productivity Comparison of hCMV- and mCMV-Flrnef Xv (106 Cell AEX TiterTier AmplificationTriton cells/ml), Passage10' vp/ml10 vplcellRatio Lysis Viability Number culture Titer (96) 10' vplml Infection culture Harvest Pool1.11, 60 1.5 1.4 50 2.8 91%

1 1.23, 1.34, 749'n Pool1.11, 60 2.3 2.1 75 4.6 1 1.49, 84~
1.18, Characterization and Large Scale Production of MRKAdSnef Virus in Bioreactors Materials and Methods - The experiment of the present example was run twice under the following conditions: 36.5°C, DO 30%, pH 7.30, 150rpm agitation rate, no sparging, Life Technologies (Gibco, Invitrogen) 293 SFM II (with 6mM Ir glutamine), 0.5M NaOH as base for pH control. During the first run (B20010115), two lOL stirred vessel bioreactors were inoculated with PER.C6~ cells at a concentration of 0.2x106 cells/ml. Cells were grown until they reached a cell concentration of approximately 1x106 cells/ml. The cells were infected with uncloned MRKAdSnef (G2A,LLAA) at a MOI of 280 virus particles (vp)/cell. For the second batch (820010202), the same procedure as the first run was used, except the cells were infected with cloned MRA.dSnef. During both runs, the bioreactors were harvested 48 hours post-infection. Samples were taken and virus concentrations were determined from whole broth (with triton lysis), supernatant, and cell pellets (3 X
freeze/thaw) with the AEX and QPA assays. Metabolites were measured with BioProftle 250 throughout the process.
Table20: Ex erimentalConditions Tem erature 36.5 C

DO
30%

PH
7.30 A itation 150 m Sp~g~g ~ None Table 21: Virus source used for experiments.

Run Batch ID Cloned/UnclonedMOI
MRKAdSnef /cells #1 B20010115-1Uncloned 280 B20010115-2Uncloned 280 #2 B20010202-1Cloned 280 ~ I B20010202-2Cloned ~ 280 Results - Table 22 and 23 show an the ability to scale up production of MRKAdSnef by growth in a bioreactor.
Table 22: Virus Concentration as measured by the AEX assay Run Batch Cloned/Uncloned Virus Concentration@ v /L) ID 48h i 1x10"

MRKAdSnef Su ernatantClarified Total Triton L sate L sate #1 B20010115-1Uncloned 0.72 3.26 3.98 5.76 B20010115-2Uncloned 0.38 1.67 2.05 2.46 #2 B20010202-1Cloned 0.80 6.00 6.80 8.88 B20010202-2Cloned 0.50 6.00 6.50 8.47 Table 23: Virus Titers as measured by the QPA assay Run Batch Cloned/UnclonedVirus ID Concentration ~ 48h i (1x10"
IU/L) MRKAd5nef Whole SupernatantClarifiedTotal Triton Broth L sate L sate #1 B20010115-1Uncloned 0.13 1.12 1.76 2.88 11.28 B20010115-2Uncloned 0.14 0.73 1.54 2.27 5.86 #2 B20010202-1Cloned 0.14 0.97 1.62 2.69 11.89 B20010202-2Cloned 0.14 1.17 1.70 2.97 12.47 The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

MRKAdSHIV-lgag Boosting of DNA-Primed Animals Groups of 3-5 rhesus macaques were immunized with (a) 5 mgs of VlJns-Flgag (pVIJnsCMV(no intron)-FL-gag-bGHpA), (b) 5 mgs of VlJns-Flgag formulated with 45 mgs of a non-ionic block copolymer CRL1005, or (c) 5 mgs of VlJns-Flgag formulated with 7.5 mgs of CRL1005 and 0.6 mM benzalkonium chloride at weeks 0, 4, and 8. All animals received a single dose of 10e7 viral particles (vp) of the MRKA.dSHIV-lgag at week 26. Note: 10e7 is too low to prime or boost effectively when used as a single modality (dose is selected to mimic preexposure to adenovirus); see Figure 32.
Blood samples were collected from all animals at several time points and peripheral blood mononuclear cells (PBMCs) were prepared using standard Ficoll method. The PBMCs were counted and analyzed for gamma-interferon secretion using the ELISpot assay (Table 24). For each monkey, the PBMCs were incubated overnight either in the absence (medium) or presence of a pool (called "gag H") of 50 20-as long peptides that encompass the entire HIV-1 gag sequence.
The results indicate that MRKAdSHIV-lgag was very effective in boosting the T cell immune responses in these monkeys. At week 28 or 2 weeks after the viral boost, the number of gag-specific T cells per million PBMCs increased 2-48 fold compared to the levels observed at week 24 or 2 weeks prior to the boost.
The PBMCs were also analyzed by intracellular gamma-interferon staining prior to (at week 10) and after the MRK.AdSgag boost (at week 30). The results for select animals are shown on Figure 31. The results indicate that (a) immunization with DNA/adjuvant formulation elicited T cell responses which can either be balanced, CD4+-biased or CD8+-biased, and (b) boosting with the MRKAdSgag construct produced in all cases a strongly CD8+-biased response. These results suggest that boosting with MRKAdSHIV-lgag construct is able to improve the levels of antigen-specific CD8+ T cells.

~owo ~~ ~°~ ommmpg P7n~ N f~~~
Or0 ~rm~N m~~-.-a ~~ QbIr~~N ~~~b~
~Pf ~ e00~mc [~~OhO
N~5 m I~ b ~ m 0!
m(ND ~1N9 Nl'7 N~NN~
tD O m ~m O b 0~ D ~m r r ~ r moN ~amm~o ~~obmob b <
IN~~~e I~~~~~
O~ IbOYOO ~~rO~Or b ~np am0~ (t~eb~JQn m i~ ~NnNr Nr,r.Qy O Pl ~O O a O ~ ~M .- p7 ~- O
t0 ~c~ ~~oo~~ ~~~m t~700 ~rr.-OO ~~1~000 o,~. Ivomz~ Ivo~o~o ~ zou~ovoizmrmcr a Q x tX~ UX~~m ~2 ~~Q ~~Q~~ ~,~,O
QU~~U

t ~

m C

D a m illr r r i T

r a m +~ ~o z c~g~S
o a o a o ~

U

e~

N

H ~
x Construction of gagpol fusion for NIRKAdSgagpol fusion constructs The open reading frames for the codon-optimized HIV-1 gag gene was fused directly to the open reading frame of the IA pol gene (consisting of RT, RNAseH and integrase domains) by stepwise PCR. Because the gene (SEQ lD NO: 38) does not include the protease gene and the frameshift sequence, it encodes a single polypeptide of the combined size of p55, RT, RNAse H and integrase (1350 amino acids; SEQ
ID
NO: 39).
The fragment that extends from the BstEII site within the gag gene to the last non-stop codon was ligated via PCR to a fragment that extends from the start codon of the IApol to a unique BamHl site. This fragment was digested with BstEll and BamHI. Construction of gag-TApol fusion was achieved via three-fragment ligation involving the Pstl BstEIl gag digestion fragment, the BstElIBamHl digested PCR
product and long Pstl/BamHI V1R-FLpol backbone fragment.
The MRK.AdS-gagpol adenovirus vector was constructed using the Bglll fragment of the V1R-gagpol containing the entire ORF of gag-IApol fusion gene.

hnmunogenicity Studies in Non-Human Primates Cohorts of three (3) macaques were immunized with 10e8 or 10e10 viral particles (vp) of one of the following MRK.AdS HIV-1 vaccines: (1) MRKAdSgag;
(2) MRKAd5pol; (3) MRK.AdSnef; (4) a mixture containing equal amounts of MRKAdSgag, MRKAd5pol, and MRK.AdSnef, or (5) a mixture of equal amounts of MRKAdSgagpol and MRKAdSnef. The vaccines were administered at weeks 0 and 4.
The T cell responses against each of the HIV-1 antigens were assayed by IFN-gamma ELISpot assay using pools of 20-as peptides that encompass the entire protein sequence of each antigen. The results (Table 25) are expressed as the number of spot forming cells (sfc) per million peripheral blood mononuclear cells (PBMC) that respond to each of the peptide pools.
Results indicate the following observations: (1) each of the single gene constructs (MRI~AdSgag, MRKAdSpol, or MRKAdSnef) is able to elicit high levels of antigen-specific T cells in monkeys; (2) the single-gene MRKAd5 constructs can be mixed as a multi-cocktail formulation capable of eliciting very broad T
cell responses against gag, pol, and nef; (3) the MRK.Ad5 vector expressing the fusion protein of gag plus IA pol is capable of inducing strong T cell responses to both gag and pol.
HIV1 a, , , Grp Vaccine Monk T=6 # # wks T=0, 4 wks Mock Gag Poi Pol Nef 1 MRKAd5 gag CB9V 0 15 - - -10~10 vp CD19 0 374 - - -2 MRKAd5 gag 99D1301 948 - - -10~8 vp W277 16 324 - - -3 MRKAd5 pol CC1X 4 - 46 256 10~10 vp AW3W 3 - 463 550 -4 MRKAd5 poi AW38 1 - 19 30 -10~8 vp CCBK 0 - 50 995 -CC21 1 - 33 ' -5 MRKAd5 nef 076Q 9 - - - 1204 10~10 vp 091 4 - - -Q

6 MRKAd5 nef OOC0291 - - - 114 10~8 vp 98D0226 - - - 170 7 MRKAdSgag+MRKAdSpol+MRKAdSnef99D2513 206 15 193 120 10~10 vp each 05H 3 135 21 9 638 8 MRKAdSgag+MRKAd5pol+MRKAdSnef99D2151 171 18 193 240 10~8 vp each 81H 5 73 6 14 243 9 MRKAdSgagpol +MRKAdS 99D2110 83 56 838 725 nef 10~10 vp each 22H 4 385 119 1194 1915 MRKAdSgagpol +MRKAd5 34H 3 78 19 5 75 nef 10~8 vp each 48H 1 65 105 46 43 Indicated are numbers of spot-forming cells per million PBMCS against the peptide pools. mocx, no pepades; gag H, fifty 20-as peptides encompassing pS5 sequence; pol-1, 20-as peptides representing N-terminal half of IA pol;
pol-2, 20-as peptides representing the carboxy-terminal half of IA pol; nef, 20-as peptides encompassing the entire 10 wild-type nef sequence. Responses to the antigens prior to the first immunization did not exceed 40 sfc/10~6 PBMC.
Table 25. Evaluation of Mixtures of MRKAdS vectors expressing humanized of a of nef in rhesus maca ues

Claims (89)

WHAT IS CLAIMED IS

1. A recombinant adenoviral vaccine vector at least partially deleted in E1 and devoid of E1 activity, comprising:
a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between from about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) a gene encoding an HIV protein or immunologically relevant modification thereof.

2. A vector in accordance with claim 1 comprising a packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome.

3. A vector in accordance with claim 1 further comprising nucleotides corresponding to between from about base pair 3511 to about 3524 to about base pair 5798 of a wildtype adenovirus genome.

4. A vector in accordance with claim 3 comprising base pairs corresponding to 1-450 and 3511-5798 of a wildtype adenovirus genome.

5. A vector in accordance with claim 4 which is deleted of base pairs 451-3510.

6. A vector in accordance with claim 1 which is at least partially deleted in E3.

7. A vector in accordance with claim 6 wherein the E3 deleted region is from base pairs 28,133-30,818.

8. A vector in accordance with claim 1 wherein the gene encoding the HIV protein or modification thereof comprises codons optimized for expression in a human.

9. A vector in accordance with claim 1 wherein the vector comprises a gene expression cassette comprising:
a) a nucleic acid encoding a protein;
b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription termination sequence.

10. A vector in accordance with claim 9 wherein the gene expression cassette is inserted into the E1 region.

11. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an E1 parallel orientation

12. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an E1 antiparallel orientation.

13. An adenoviral vector in accordance with claim 9 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

14. An adenoviral vector in accordance with claim 13 wherein the promoter is an immediate early human cytomegalovirus promoter.

15. An adenoviral vector in accordance with claim 9 wherein the promoter is a marine cytomegalovirus promoter.

16. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

17. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a synthetic polyadenylation signal (SPA).

18. A cell comprising the adenoviral vector of claim 1.

19. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 1 into a cell line which expresses adenovirus E1 protein at complementing levels.

20. An HIV vaccine composition comprising purified adenovirus particles of claim 19.

21. An HIV vaccine composition of claim 20 which comprises a physiologically acceptable carrier.

22. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 1 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

23. A method according to claim 22 wherein the cell is a PER.C6®
cell.

24. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine of claim 21.

25. A method according to claim 24 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.

26. A method according to claim 25 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.

27. A method according to claim 24 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.

28. A method according to claim 24 which comprises administering and readministering the adenovirus vaccine vector to the individual.

29. An adenoviral vector in accordance with claim 1 wherein the HIV
protein is HIV gag or an immunologically relevant modification thereof.

30. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV gag protein or immunologically relevant modification thereof.

31. A recombinant adenoviral vaccine vector at least partially deleted in E1 and devoid of E1 activity, comprising:
a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair 3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) SEQ ID NO: 29;
ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.

32. An adenoviral vector in accordance with claim 31 wherein the gene expression cassette is in an E1 parallel orientation.

33 An adenoviral vector in accordance with claim 31 wherein the gene expression cassette is in an E1 antiparallel orientation.

34. An adenoviral vector in accordance with claim 31 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

35. An adenoviral vector in accordance with claim 31 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

36. An adenoviral vector in accordance with claim 31 which is at least partially deleted in E3.

37. A cell comprising the adenoviral vector of claim 30.

38. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 30 into a cell line which expresses adenovirus E1 protein at complementing levels.

39. An HIV vaccine composition comprising purified adenovirus particles of claim 38.

40. An HIV vaccine composition of claim 39 which comprises a physiologically acceptable carrier.

41. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 30 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

42. A method according to claim 41 wherein the cell is a PER.C6®
cell.

43. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine of claim 21.

44. A method according to claim 43 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.

45. A method according to claim 44 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.

46. A method according to claim 43 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.

47. A method according to claim 43 which comprises administering and readministering the adenovirus vaccine vector to the individual.

48. An adenoviral vector in accordance with claim 1 wherein the HIV
protein is HIV pol or an immunologically relevant modification thereof.

49. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV pol protein or immunologically relevant modification thereof.

50. A recombinant adenoviral vaccine vector at least partially deleted in E1 and devoid of E1 activity, comprising:

a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair 3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of SEQ ID NO: 1, SEQ ID NO: 5 and SEQ ID NO: 7;
ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.

51. An adenoviral vector in accordance with claim 50 wherein the gene expression cassette is in an E1 parallel orientation.

52. An adenoviral vector in accordance with claim 50 wherein the gene expression cassette is in an E1 antiparallel orientation.

53. An adenoviral vector in accordance with claim 50 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

54. An adenoviral vector in accordance with claim 50 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

55. An adenoviral vector in accordance with claim 50 which is at least partially deleted in E3.

56. A cell comprising the adenoviral vector of claim 49.

57. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 49 into a cell line which expresses adenovirus El protein at complementing levels.

58. An HIV vaccine composition comprising purified adenovirus particles of claim 57.

59. An HIV vaccine composition of claim 58 which comprises a physiologically acceptable carrier.

60. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 49 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

61. A method according to claim 60 wherein the cell is a PER.C6®
cell.

62. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine of claim 59.

63. A method according to claim 62 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.

64. A method according to claim 63 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.

65. A method according to claim 62 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.

66. A method according to claim 62 which comprises administering and readministering the adenovirus vaccine vector to the individual.

67. An adenoviral vector in accordance with claim 1 wherein the HIV
protein is HIV nef or an immunologically relevant modification thereof.

68. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV nef protein or immunologically relevant modification thereof.

69. A recombinant adenoviral vaccine vector at least partially deleted in E1 and devoid of E1 activity, comprising:

a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 and from about 3511 to about 5798 of a wildtype adenovirus genome, and deleted for base pairs corresponding to from about base pair 451 to from about base pair 3510 of a wildtype adenovirus genome; and b) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 15;

ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence.

70. An adenoviral vector in accordance with claim 69 wherein the gene expression cassette is in an E1 parallel orientation.

71. An adenoviral vector in accordance with claim 69 wherein the gene expression cassette is in an E1 antiparallel orientation.

72. An adenoviral vector in accordance with claim 69 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

73. An adenoviral vector in accordance with claim 69 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

74. An adenoviral vector in accordance with claim 69 which is at least partially deleted in E3.

75. A cell comprising the adenoviral vector of claim 68.

76. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 68 into a cell line which expresses adenovirus E1 protein at complementing levels.

77. An HIV vaccine composition comprising purified adenovirus particles of claim 76.

78. An HIV vaccine composition of claim 77 which comprises a physiologically acceptable carrier.

79. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 68 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral-E1 protein, arid harvesting the resultant recombinant, replication-defective adenovirus.

80. A method according to claim 79 wherein the cell is a PER.C6®
cell.

81. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine of claim 78.

82. A method according to claim 81 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.

83. A method according to claim 82 wherein the DNA plasmid vaccine is administered to the individual prior to administration of an adenovirus vaccine.

84. A method according to claim 81 wherein the adenovirus vaccine is preceded by an adenovirus vaccine of a different serotype.

85. A method according to claim 81 which comprises administering and readministering the adenovirus vaccine vector to the individual.

86. A multivalent adenovirus vaccine composition comprising recombinant, replication-defective adenovirus particles, wherein the adenovirus particles are harvested and purified from a cell line expressing adenovirus El protein, and wherein the particles are harvested subsequent to transfection of the cells with an adenoviral vector or vectors in accordance with claim 9; said vector(s) comprising a gene expression cassette or cassettes comprising nucleotide sequences encoding HIV
proteins selected from the group consisting of:

a) gag, pol, and nef, expressed independently from three individual vectors;

b) gag, pol, and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences;

c) gag, pol, and nef, expressed via two vectors, one expressing a pol-nef fusion, and another expressing gag;

d) gag, pol, and nef, expressed via two vectors, one expressing a gag-pol fusion and another expressing nef;

e) gag, pol and nef, expressed via two vectors, one expressing a nef-gag fusion and another expressing pol;

f) gag, pol, and nef, expressed via one vector expressing a gag-pol-nef fusion;

g) gag and pol, expressed independently from two individual vectors;

h) gag and pol, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences;

i) pol and nef, expressed independently from two individual vectors;

j) pol and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences;

k) nef and gag, expressed independently from two individual vectors;

l) nef and gag; expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences;

m) gag and pol, expressed via one vector expressing a gag-pol fusion;

n) pol and nef, expressed via one vector expressing a pol-nef fusion;
and o) nef and gag, expressed via one vector expressing a nef gag fusion.

87. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the gag-pol fusion consists of SEQ ID NO: 39.

88. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences.

89. A multivalent adenovirus vaccine composition in accordance with claim 86 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to a single promoter; and the encoding nucleic acid sequences operatively linked by an internal ribosome entry sequence ("IRES").