AU2001294562B2 - Enhanced First Generation Adenovirus Vaccines Expressing Codon Optimized HIV1-Gag, Pol, Nef and Modifications - Google Patents

Description

ENHANCED FIRST GENERATION ADENOVIRUS VACCINES EXPRESSING CODON OPTIMIZED HIV1-GAG, POL, NEF AND MODIFICATIONS FIELD OF THE INVENTION The present invention relates to recombinant, replication-deficient first generation adenovirus vaccines found to exhibit enhanced growth properties and greater cellular-mediated immunity as compared to other replication-deficient vectors. The invention also relates to the associated first generation adenoviral vectors described herein, which, through the incorporation of additional 5' adenovirus sequence, enhance large scale production efficiency of the recombinant, replication-defective adenovirus described herein. Another aspect of the instant invention is the surprising discovery that the intron A portion of the human cytomegalovirus (hCMV) promoter constitutes a region of instability in adenoviral vector constructs. Removal of this region from adenoviral expression constructs results in greatly improved vector stability. Therefore, improved vectors expressing a transgene under the control of an intron A-deleted CMV promoter constitute a further aspect of this invention. These adenoviral vectors are useful for generating recombinant adenovirus vaccines against human immunodeficiency virus (HIV). In particular, the first generation adenovirus vectors disclosed herein are utilized to construct and generate adenovirus-based HIV-1 vaccines which contain HIV-1 Gag, HIV-1 Pol and/or HIV-1 Nefpolynucleotide pharmaceutical products, and biologically active modifications thereof. Host administration of the recombinant, replicationdeficient adenovirus vaccines described herein results in expression of HIV-1 Gag, HIV- 1- Pol and/or Nefprotein or immunologically relevant modifications thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Gag, HIV-1 Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef, and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The HIV adenovirus vaccines of the present invention, when administered alone or in a combined modality and/or prime/boost regimen, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.

BACKGROUND OF THE INVENTION Human Immunodeficiency Virus-1 (HIV-1) is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders. HIV-1 is an RNA virus of the Retroviridae family and exhibits the 5' LTR-gag-pol-env-LTR 3' organization of all retroviruses. The integrated form of HIV-1, known as the provirus, is A627836speci approximately 9.8 Kb in length. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).

The gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene. The mature p55 protein products are p17 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.

The pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting. The viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, p 5) activities.

The nefgene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.

The env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gp160) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41-kDa envelope glycoprotein (gp41). Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.

The tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.

The rev gene encodes the 13 kDa Rev protein, a RNA binding protein. The Rev protein binds to a region of the viral RNA termed the Rev response element (RRE). The Rev protein promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm.

The Rev protein is required for HIV late gene expression and in turn, HIV replication.

binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules. X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a R5 (T-cell line tropic) virus interacts with a CD4/CCR5 receptor complex. After gpl20 binds to CD4, gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase. The viral DNA, known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and A627836speci late HIV viral proteins, and subsequently the production and cellular release of new virus particles. Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production -and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS. Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.

Destruction of CD4 helper T lymphocytes, which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection. The loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.

Effective treatment regimens for HIV-1 infected individuals have become available recently. However, these drugs will not have a significant impact on the disease in many parts of the world and they will have a minimal impact in halting the spread of infection within the human population. As is true of many other infectious diseases, a significant epidemiologic impact on the spread of HIV-1 infection will only occur subsequent to the development and introduction of an effective vaccine. There are a number of factors that have contributed to the lack of successful vaccine development to date. As noted above, it is now apparent that in a chronically infected person there exists constant virus production in spite of the presence of anti-HIV-1 humoral and cellular immune responses and destruction of virally infected cells. As in the case of other infectious diseases, the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response. Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection. A second factor is the considerable genetic variability of the virus. Although anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological "continuum" so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants. Given this latter observation, it would be useful to identify immunogens and related delivery technologies that are likely to elicit anti-HIV-1 cellular immune responses. It is known that in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with A62736speci major histocompatibility complex (MHC) class I proteins. CD8 T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein. Activation of naive CD8 T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins. Optimal induction of CTL responses usually requires "help" in the form of cytokines from CD4 T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.

European Patent Applications 0 638 316 (Published February 15, 1995) and 0 586 076 (Published March 9, 1994), (both assigned to American Home Products Corporation) describe replicating adenovirus vectors carrying an HIV gene, including env or gag.

Various treatment regimens were used with chimpanzees and dogs, some of which included booster adenovirus or protein plus alum treatments.

Replication-defective adenoviral vectors harboring deletions in the El region are known, and recent adenoviral vectors have incorporated the known packaging repeats into these vectors; see EP 0 707 071, disclosing, inter alia, an adenoviral vector deleted of El sequences from base pairs 459 to 3328; and U.S. Patent No. 6,033,908, disclosing, inter alia, an adenoviral vector deleted of base pairs 459-3510. The packaging efficiency of adenovirus has been taught to depend on the number of incorporated individual A (packaging) repeats; see, Grible and Hearing, 1990 J. Virol. 64(5):2047-2056; Grable and Hearing, 1992 J. Virol. 66(2):723-731.

Larder, et al., (1987, Nature 327: 716-717) and Larder, et al., (1989, Proc. Natl.

Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis ofHIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.

Davies, et al. (1991, Science 252:, 88-95) disclose the crystal structure of the RNase H domain of HIV-1 Pol.

Schatz, et al. (1989, FEBS Lett. 257: 311-314) disclose that mutations Glu478Gln and His539Phe in a complete HIV-1 RT/RNase H DNA fragment results in defective RNase activity without effecting RT activity.

Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.

Leavitt, et al. (1993, J. Biol. Chem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show differing effect on HIV-1 integrase (IN) activity.

A627836speci SWiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HIV-1 IN and viral replication functions.

It would be of great import in the battle against AIDS to produce a prophylactic- O 5 and/or therapeutic-based HIV vaccine which generates a strong cellular immune response against an HIV infection. The present invention addresses and meets these needs by disclosing a class of adenovirus vaccines which, upon host administration, express codon optimized and modified versions of the HIV-1 genes, gag, pol and nef These CN recombinant, replication-defective adenovirus vaccines may be administered to a host, such as a human, alone or as part of a combined modality regimen and/or prime-boost C1 vaccination regimen with components of the present invention and/or a distinct viral HIV DNA vaccine, non-viral HIV DNA vaccine, HIV subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIV vaccine.

SUMMARY OF THE INVENTION According to a first aspect of the present invention there is provided a recombinant adenoviral vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between from about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) at least one gene encoding an HIV protein selected from the group consisting of HIV gag, nef, pol, and immunologically relevant modifications thereof, wherein the at least one gene comprises codons optimized for expression in a human; and wherein the at least one gene is inserted into an El region in an El parallel orientation.

According to a second aspect of the present invention there is provided a cell comprising an adenoviral vector in accordance with the preceding aspect.

According to a third aspect of the present invention there is provided a recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of an adenoviral vector in accordance with the preceding aspects into a cell line which expresses adenovirus El protein at complementing levels.

According to a fourth aspect of the present invention there is provided a method of producing recombinant, replication defective adenovirus particles containing an adenoviral genome of an adenoviral vector in accordance with the preceding aspects 749193_1:LNB which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication-defective adenovirus.

According to a fifth aspect of the present invention there is provided a multivalent adenovirus vaccine composition which comprises recombinant, replication-defective adenovirus particles, harvested and purified from a cell line(s) transfected with a recombinant adenoviral vector(s) of claim 1; said cell line(s) expressing adenovirus El protein at complementing levels; said recombinant adenoviral vector(s) being at least partially deleted in El and devoid of El activity, and comprises: a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) a gene expression cassette or cassettes comprising nucleotide sequences encoding HIV proteins selected from the group consisting of: i) gag, pol, and nef, expressed independently from three individual vectors; ii) gag, pol, and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; iii) gag, pol, and nef, expressed via two vectors, one expressing a pol-nef fusion, and another expressing gag; iv) gag, pol, and nef, expressed via two vectors, one expressing a gag-pol fusion and another expressing nef; v) gag, pol and nef, expressed via two vectors, one expressing a nef-gag fusion and another expressing pol; vi) gag, pol, and nef, expressed via one vector expressing a gag-pol-nef fusion; vii) gag and pol, expressed independently from two individual vectors; viii) gag and pol, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; ix) pol and nef, expressed independently from two individual vectors; x) pol and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; xi) nef and gag, expressed independently from two individual vectors; 749193 :I.NB xii) nef and gag, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; xiii) gag and pol, expressed via one vector expressing a gag-pol fusion; xiv) pol and nef, expressed via one vector expressing a pol-nef fusion; and xv) nef and gag, expressed via one vector expressing a nef-gag fusion.

The present invention relates to enhanced replication-defective recombinant adenovirus vaccine vectors and associated recombinant, replication-deficient adenovirus vaccines which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HIV-1 Pol and HIV-1 Nef. The adenovirus vaccines of the present invention express HIV antigens and provide for improved cellular-mediated immune responses upon host administration. Potential vaccines include but are not limited to primates and especially humans and non-human primates, and also include any non-human mammal of commercial or domestic veterinary importance. An effect of the improved recombinant adenovirus-based vaccines of the present invention should be a lower transmission rate to previously uninfected individuals prophylactic applications) and/or reduction in the levels of the viral loads within an infected individual therapeutic applications), so as to prolong the asymptomatic phase of HIV-1 infection. In particular, the present invention relates to adenoviral-based vaccines which encode various forms of codon optimized HIV-1 Gag (including but in no way limited to p55 versions of codon optimized full length (FL) Gag and tPA-Gag fusion proteins), HIV-1 Pol, HIV-1 Nef, and selected modifications of immunological relevance.

The administration, intracellular delivery and expression of these adenovirus vaccines elicit a host CTL and Th response. The preferred replication-defective recombinant adenoviral vaccine vectors include but are not limited to synthetic DNA molecules which encode codon optimized versions of wild type HIV-1 Gag; encode codon optimized versions of HIV-1 Pol; encode codon optimized versions of HIV-1 Pol fusion proteins; encode codon optimized versions of modified HIV-1 Pol proteins and fusion proteins, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell; encode codon optimized versions of wild type HIV-1 Nef; codon optimized versions 749193 I:LNB of HIV-1 Nef fusion proteins; and/or codon optimized versions of HIV-1 Nef derivatives, including but not limited to nefmodifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations. The Nef-based fusion and modified proteins, disclosed within this specification and expressed from an adenoviral-based vector vaccine this specification, may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response. Examples of HIV-1 Gag, Pol and/or Nef fusion proteins include but are not limited to fusion of a leader or signal peptide at the NH 2 -teriminal portion of the viral antigen coding region. Such a leader peptide includes but is not limited to a tPA leader peptide.

The adenoviral vector utilized in construction of the HIV-1 Gag-, HIV-1 Poland/or HIV-1 Nef- based vaccines of the present invention may comprise any replication-defective adenoviral vector which provides for enhanced genetic stability of the recombinant adenoviral genome through large scale production and purification of the recombinant virus. In other words, an HIV-1 Gag-, Pol- or Nef-based adenovirus vaccine of the present invention is a purified recombinant, replication-defective adenovirus which is shown to be genetically stable through multiple passages in cell culture and remains so during large scale production and purification procedures. Such a recombinant adenovirus vector and harvested adenovirus vaccine lends itself to large scale dose filling and subsequent worldwide distribution procedures which will be demanded of an efficacious monovalent or multivalent HIV vaccine. The present invention meets this basic requirement with description of a replication-defective adenoviral vector and vectors derived therefrom, at least partially deleted in El, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome. A preferred embodiment of the instant invention comprises base pairs 1-450 of a wildtype adenovirus. In other preferred embodiments, the replication -defective adenoviral vector has, in addition thereto, a region 3' to the El-deleted region comprising base pairs 3511-3523. Basepairs 342-450 (more particularly, 400-450) constitute an extension of the 5'region of previously disclosed vectors carrying viral antigens, particularly HIV antigens (see, PCT International Application PCT/US00/18332, published January 11, 2001 (WO 01/02067), which claims priority to U.S. Provisional Application Serial Nos. 60/142,631 and 60/148,981, filed 7/6/1999 and 8/13/1999, respectively; these documents herein incorporated by reference. Applicants have found that extending the 5' region further into the El gene into the disclosed vaccine vectors incorporated elements found to be important in optimizing the packaging of the virus.

As compared to previous vectors not comprising basepairs from about 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the A627836speci wildtype adenovirus genome, vectors comprising the above region exhibited enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, a more potent virus effect, allowing lower doses of virus to be used to generate equivalent immunity; and a greater cellular-mediated immune response than replication-deficient vectors not comprising this region (basepairs 1-450). Even more important, adenoviral constructs derived therefrom are very stable genetically in large-scale production, particularly those comprising an expression cassette under the control of a hCMV promoter devoid ofintron A. This is because Applicants have surprisingly found that the intron A portion of the hCMV promoter constituted a region of instability when employed in adenoviral vectors. Applicants have, therefore, identified an enhanced adenoviral vector which is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.

A preferred embodiment of this invention is a replication-defective adenoviral vector in accordance with the above description wherein the gene is inserted in the form of a gene expression cassette comprising a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; a heterologous promoter operatively linked to the nucleic acid of part and, a transcription terminator.

In preferred embodiments, the El gene, other than that contained within basepairs 1-450 or, alternatively, that contained within base pairs 1-450 and 3511-3523 has been deleted from the adenoviral vector, and the gene expression cassette has replaced the deleted El gene. In other preferred embodiments, the replication defective adenovirus genome does not have a functional E3 gene, or the E3 gene has been deleted. Most preferably, the E3 region is present within the adenoviral genome. Further preferred embodiments are wherein the gene expression cassette is in an El anti-parallel (transcribed in a 3' to 5' direction relative to the vector backbone) orientation or, more preferably, an El parallel (transcribed in a 5' to 3' direction relative to the vector backbone) orientation.

Further embodiments relate to a shuttle plasmid vector comprising: an adenoviral portion and a plasmid portion, wherein said adenovirus portion comprises: a) a replication defective adenovirus genome, at least partially deleted in El, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) of the wildtype adenovirus genome and, preferably, in addition thereto, basepairs 3511-3523 of a wildtype adenovirus sequence; and b) a gene expression cassette comprising: a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; a heterologous promoter operatively linked to the nucleic acid of part a);and a transcription terminator and/or a polyadenylation site.

A627836speci Other aspects of this invention include a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant adenoviral vectors.

To this end, the present invention particularly relates to harvested recombinant, replication defective virus derived from a host cell, such as but not limited to 293 cells or PER.C6® cells, including but not limited to harvested virus related to any of the vector backbones, with or without an accompanying transgene, including but not limited to the HIV-1 antigens described herein. An HIV-1 vaccine is represented by any harvested, recombinant adenovirus material which expresses any one or more of the HIV- 1 antigens disclosed herein. This harvested material may then be purified, formulated and stored prior to host administration.

Another aspect of this invention is a method of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising: a) a recombinant, replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus cis-acting adenovirus packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) and, preferably in addition thereto, base pairs 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part and (iii) a transcription terminator and/or a polyadenylation site.

In view of the efficacious nature of the adenoviral and/or DNA plasmid vaccines described herein, the present invention relates to all methodology regarding administration of one or more of these adenoviral and/or DNA plasmid vaccines to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences. As discussed herein, such a treatment regimen may include a monovalent or multivalent composition, various combined modality applications, and/or a prime/boost regimen to as to optimize antigen expression and a concomitant cellular-mediated and/or humoral immune response upon inoculation into a living vertebrate tissue. Therefore, the present invention provides for methods of using the adenoviral and/or DNA plasmid vaccines disclosed herein within the various parameters disclosed herein as well as any additional parameters known in the art, which, A627836speci upon introduction into mammalian tissue induces intracellular expression of the gag, pol and/or nef-based vaccines.

To this end, the present invention relates in part to methods of generating a cellular immune response in a vaccinee, preferably a human vaccinee, wherein the individual is given more than one administration of adenovirus vaccine vector, and it may be given in a regimen accompanied by the administration of a plasmid vaccine. The plasmid vaccine (also referred to herein as a "DNA plasmid vaccine" or "vaccine plasmid" comprises a nucleic acid encoding a protein or an immunologically relevant portion thereof, a heterologous promoter operably linked to the nucleic acid sequence, and a transcription terminator or a polyadenylation signal (such as bGH or SPA, respectively).

There may be a predetermined minimum amount of time separating the administrations.

The individual can be given a first dose ofplasmid vaccine, and then a second dose of plasmid vaccine. Alternatively, the individual may be given a first dose of adenovirus vaccine, and then a second dose of adenovirus vaccine. In other embodiments, the plasmid vaccine is administered first, followed after a time by administration of the adenovirus vaccine. Conversely, the adenovirus vaccine may be administered first, followed by administration of plasmid vaccine after a time. In these embodiments, an individual may be given multiple doses of the same adenovirus serotype in either viral vector or plasmid form, or the virus may be of differing serotypes. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirusbased vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and venezuelan equine encephilitis virus.

The present invention also relates to multivalent adenovirus vaccine compositions which comprise Gag, Pol and Nef components described herein; see, Example 29 and Table 25. Such compositions will provide for an enhanced cellular immune response subsequent to host administration, particularly given the genetic diversity of human MHCs and of circulating virus. Examples, but not limitations, include based multivalent vaccine compositions which provide for a divalent gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine gag, pol and nef components) composition. Such a mutlivalent vaccine may be filled for a single dose or may consist of multiple inoculations of each individually filled component; and may in addition be part of a prime/boost regimen with viral or non-viral vector vaccines as introduced in the previous paragraph. To this end, preferred compositions are adenovirus used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

A627836spcci The concept of a "combined modality" as disclosed herein also covers the alternative mode of administration whereby multiple HIV-1 viral antigens may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example, a trivalent vector may comprise a gag-polnef fusion, in either a or background, preferably a E3 deleted backbone, or possibly a divalent vaccine, such as a gag-pol fusion codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES). Therefore, a multivalent vaccine delivered as a single, or possibly a second harvested recombinant, replication-deficient adenovirus is contemplated as part of the present invention.

Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen.

A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly if pre-existing anti-vector immune responses are present.

This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral: vaccine.

Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing antiadenovirus immune response.

It is an object of the present invention to provide for enhanced replication-defective recombinant adenoviral vaccine vector backbones. These recombinant adenoviral backbones may accept one or more transgenes, which may be passaged through cell culture for growth, amplification and harvest.

It is a further object to provide for enhanced replication-defective recombinant adenoviral vaccine vectors which encode various transgenes.

It is also an object of the present invention to provide for a harvested recombinant, replication-deficient adenovirus which shows enhanced growth and amplification rates while in combination with increased virus stability after continuous passage in cell culture. Such a recombinant adenovirus is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.

A627836speci 11 To this end, it is an object of the present invention to provide for enhanced replication-defective recombinant adenoviral vaccine vectors as described herein which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HIV-1 Pol and HIV-1 Nef, and harvested, purified recombinant replication-deficient adenovirus generated by passage of the adenoviral vectors of through one or multiple passages through cell culture, including but not limited to passage through 293 cells or PER.C6® cells.

It is also an object of the present invention to provide for recombinant adenovirus harvested by one or multiple passages through cell culture. As relating to recombinant adenoviral vaccine vector, this recombinant virus is harvested and formulated for subsequent host administration.

It is also an object of the present invention to provide for replication-defective adenoviral vectors wherein at least one gene is inserted in the form of a gene expression cassette comprising a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; a heterologous promoter operatively linked to the nucleic acid of part and, a transcription terminator.

It is also an object of the present invention to provide for a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and (b) harvesting the resultant adenoviral vectors.

It is a further object of the present invention to provide for methods of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising a) a replication defective adenoviral vector, at least partially deleted in El, comprising a wildtype adenovirus cisacting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about 450 (preferably, 1-450) and, preferably, 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part and (iii) a transcription terminator and/or a polyadenylation site.

It is also an object of the present invention to provide various alternatives for vaccine administration regimes, namely administration of one or more adenoviral and/or DNA plasmid vaccines described herein to provide effective immunoprophylaxis for uninfected individuals or a therapeutic treatment for HIV infected patients. Such processes include but are not limited to multivalent HIV-1 vaccine compositions, various combined modality regimes as well as various prime/boost alternatives. These methods of administration, relating to vaccine composition and/or scheduled administration, will A627836speci 12 increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

As used throughout the specification and claims, the following definitions and abbreviations are used: "HAART" refers to highly active antiretroviral therapy "first generation" vectors are characterized as being replication-defective. They typically have a deleted or inactivated El gene region, and preferably have a deleted or inactivated E3 gene region as well.

"AEX" refers to Anion Exchange chromatography.

"QPA" refers to Quick PCR-based Potency Assay.

"bps" refers to basepairs.

or "str" denotes that the transgene is in the El parallel or "straight" orientation.

"PBMCs" refers to peripheral blood monocyte cells.

"FL" refers to full length.

"FLgag" refers to a full-length optimized gag gene, as shown in Figure 2.

refers to an adenovirus serotype 5 replication deficient virus which carries an expression cassette which comprises a full length optimized gag gene under the control of a CMV promoter.

"Promoter" means a recognition site on a DNA strand to which an RNA polymerase binds. The promoter forms an initiation complex with RNA polymerase to initiate and drive transcriptional activity. The complex can be modified by activating sequences such as enhancers or inhibiting sequences such as silencers.

"Leader" means a DNA sequence at the 5' end of a structural gene which is transcribed along with the gene. This usually results a protein having an N-terminal peptide extension, often referred to as a pro-sequences.

"Intron" means a section of DNA occurring in the middle of a gene which does not code for an amino acid in the gene product. The precursor RNA of the intron is excised and is therefore not transcribed into mRNA not translated into protein.

"Immunologically relevant" or "biologically active" means with regards to a viral protein, that the protein is capable, upon administration, of eliciting a measurable immune response within an individual sufficient to retard the propagation and/or spread of the virus and/or to reduce the viral load present within the individual; or with regards to a nucleotide sequence, that the sequence is capable of encoding for a protein capable of the above.

"Cassette" refers to a nucleic acid sequence which is to be expressed, along with its transcription and translational control sequences. By changing the cassette, a vector can express a different sequence.

"bGHpA" refers to the bovine growth hormone transcription terminator/polyadenylation sequence.

A627836speci 13 "tPAgag" refers to a fusion between the leader sequence of the tissue plasminogen activator leader sequence and an optimized HIV gag gene, as exemplified in Figure 30A-1 to 30A-2, whether in a DNA or adenovirus-based vaccine vector.

Where utilized, "IA" or "inact" refers to an inactivated version of a gene (e.g.

IApol).

"MCS" is "multiple cloning site".

In general, adenoviral constructs, gene constructs are named by reference to the genes contained therein. For example: HIV-1 gag", also referred to as the original HIV-1 gag adenoviral vector, is a vector containing a transgene cassette composed of a hCMV intron A promoter, the full length version of the human codon-optimized HIV-1 gag gene, and the bovine growth hormone polyadenylation signal. The transgene was inserted in the El antiparallel orientation in an El and E3 deleted adenovector.

"MRK Ad5 HIV-1 gag" also referred to as "MRKAd5gag" or "Ad5gag2" is an adenoviral vector taught herein which is deleted of El, comprises basepairs 1-450 and 3511-3523, and has a human codon-optimized HIV-1 gene in an El parallel orientation under the control of a CMV promoter without intron A. The construct also comprises a bovine growth hormone polyadenylation signal.

"pV1JnsHIVgag", also referred to as "HIVFLgagPR9901", is a plasmid comprising the CMV immediate-early (IE) promoter and intron A, a full-length codonoptimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone.

"pV1JnsCMV(no intron)-FLgag-bGHpA" is a plasmid derived from pV1JnsHIVgag which is deleted of the intron A portion of CMV and which comprises the full length HIV gag gene. This plasmid is also referred to as "pV1JnsHIVgag-bGHpA", pV1Jns-hCMV-FL-gag-bGHpA" and "pV1JnsCMV(no intron) FLgag bGHpA".

"pV1JnsCMV(no intron)-FLgag-SPA" is a plasmid of the same composition as pV1JnsCMV(no intron)-FLgag-bGHpA except that the SPA termination sequence replaces that ofbGHpA. This plasmid is also referred to as "pV1Jns-HIVgag-SPA" and pV 1Jns-hCMV-FLgag-SPA".

"pdelElsplA" is a universal shuttle vector with no expression cassette no promoter or polyA). The vector comprises wildtype adenovirus serotype 5 sequences from bp 1 to bp 341 and bp 3524 to bp 5798, and has a multiple cloning site between the Ad5 sequences ending 341 bp and beginning 3524 bp. This plasmid is also referred to as the original Ad 5 shuttle vector.

"MRKpdelElsplA" or "MRKpdelE1(Pac/pIX/pack450)" or "MRKpdelE (Pac/pIX/pack450)Clal" is a universal shuttle vector with no expression cassette no promoter or polyA) comprising wildtype adenovirus serotype 5 sequences from bpl to bp450 and bp 3511 to bp 5798. The vector has a multiple cloning A627836speci site between the Ad5 sequence ending 450 bp and beginning 3511 bp. This shuttle vector may be used to insert the CMV promoter and the bGHpA fragments in both the straight or El parallel) orientation or in the opposite (opp. or El antiparallel) orientation) "MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.)" is still another shuttle vector which is the modified vector that contains the CMV promoter (no intronA) and the bGHpA fragments. The expression unit containing the hCMV promoter (no intron A) and the bovine growth hormone polyadenylation signal has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BglI site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(E1/E3+)Clal pre-plasmid. This shuttle vector, as shown in Figures 22 and 23, was used to insert the respective IApol and G2A,LLAA nef genes directly into.

"MRKpdelEl-CMV(no intron)-FLgag-bGHpA" is a shuttle comprising sequences from basepairs 1-450 and 3511-5798, with an expression cassette containing human CMV without intron A, the full-length human codon-optimized HIV gag gene and bovine growth hormone polyadenylation signal. This plasmid is also referred to as "MRKpdelEl shuttle +hCMV-FL-gag-BGHpA" "MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA" is an adenoviral vector comprising all Ad5 sequences except those nucleotides encompassing the El region (from 451-3510), a human CMV promoter without intron A, a full-length human codonoptimized HIV gag gene, and a bovine growth hormone polyadenylation signal. This vector is also referred to as "MRKpAdHVE3 hCMV-FL-gag-BGHpA", "MRKpAd5gag", "pMRKAd5gag" or "pAd5gag2".

"pV1Jns-HIV-pol inact(opt)" or "pV1Jns-HIV IA pol (opt) is the inactivated Pol gene (contained within SEQ ID NO:3) cloned into the BglII site of V1Jns (Figures 17A-1 to 17A-3). As noted herein, various derivatives of HIV-1 pol maybe cloned into a plasmid expression vector such as V1Jns or V1Jns-tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.

"MRKpdel+hCMVmin+FL-pol+bGHpA(s)" is the "MRKpdelEl (Pac/pIX/pack450)+CMVmin+BGHpA(str.)" shuttle mentioned above which contains the IA pol gene is the proper orientation. This shuttle vector is used in a bacterial recombination with MRKpAd(E1-/E3+)Clal.

"MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+", also referred to herein as is the pre-adenovirus plasmid which comprises a CMV-pol inact(opt)pGHpA construct. The construction of this pre-adenovirus plasmid is shown in Figure 22.

"pV1Jns/nef (G2A,LLAA)" or "V1Jns/opt nef (G2A,LLAA)" comprises codon optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu- 175 dileucine motif to Ala-174-Ala-175 (SEQ ID NO:13; which comprises an initiating A627836speci methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660- 662). This fragment is subcloned into the Bgl II site ofV1Jns and/orV1Jns-tPA (Figures 16A-B). As noted above for HIV-1 pol, HIV-1 nef constructs may be cloned into a plasmid expression vector such as V1Jns or V1Jns-tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.

"MRKpdelElhCMVminFL-nefBGHpA(s)", also referred to herein as is the pre-adenovirus plasmid which comprises a CMV-nef (G2A,LLAA) codon optimized sequence. The construction of this pre-adenovirus plasmid is shown in Figure 23.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the original HIV-1 gag adenovector (Ad5HIV-lgag). This vector is disclosed in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S. Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference.

Figure 2 shows the nucleic acid sequence (SEQ ID NO:27) of the optimized human HIV-1 gag open reading frame.

Figure 3 shows diagrammatically the new transgene constructs in comparison with the original gag transgene.

Figure 4 shows the modifications made to the original adenovector backbone in the generation of the novel vectors of the instant invention.

Figure 5 shows the virus mixing experiments that were carried out to determine the effects of the addition made to the packaging signal region (Expt. and the E3 gene on viral growth (Expt. The bars denote the region of modifications made to the El deletion.

Figures 6A-6B show an autoradiograph of viral DNA analysis following the viral mixing experiments described in Examples 6 and 7.

Figures 7A, 7B and 7C are as follows: Figure 7A shows the hCMV-FlgagbGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Both El parallel and El antiparallel transgene orientation are represented. Figure 7B shows the hCMV-Flgag-SPA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Again, both El parallel and El antiparallel transgene orientation are represented. Figure 7C shows the mCMV-FlgagbGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Once again, both El parallel and El antiparallel transgene orientation are represented.

Figure 8A shows the experiment designed to test the effect of transgene orientation.

A627836speci Figure 8B shows the experiments designed to test the effect ofpolyadenylation signal.

Figure 9 shows viral DNA from the four adenoviral vectors tested (Example 12) at following BstE11 digestion.

Figure 10 shows viral DNA analysis of passages 11 and 12 of MRKpAdHVE3, and MRKAd5HIV-lgagE3-.

Figure 11 shows viral DNA analysis (HindIII digestion) of passage 6 MRKpAdHVE3 and MRKAd5HIV-lgag used to initiate the viral competition study. The last two lanes are passage 11 analysis of duplicate passages of the competition study (each virus at MOI of 280 viral particles).

Figure 12 shows viral DNA analysis by Hind III digestion on high passage numbers for MRKAd5HIV- gag in serum-containing media with collections made at specified times. The first lane shows the 1kb DNA size marker. The other lanes represent pre-plasmid control (digested with Pacl and HindII), MRKAd5HIV-1gag at P16, P19, and P21.

Figure 13 shows serum anti-p24 levels at 3 wks post i.m. immunization ofbalb/c mice (n=10) with varying doses of several Adgag constructs: MRK Ad5 HIV-1 gag (through passage MRKAd5 hCMV-FLgag-bGHpA MRKAd5 hCMV- FLgag-SPA MRKAd5 mCMV-FLgag-bGHpA research lot (293 cell-derived) of Ad5HIV-1 gag; and clinical lot (Ad5gagFN0001) of Ad5HIV-1 gag.

Reported are the geometric mean titers (GMT) for each cohort along with the standard error bars.

Figure 14 shows a restriction map of the pMRKAd5HIV-lgag vector.

Figures 15A-1 to 15A-45 illustrate the nucleotide sequence of the 1gag vector (SEQ ID NO:25 [coding] and SEQ ID NO:26 [non-coding]).

Figures 16A-B shows a schematic representation of DNA vaccine expression vectors V1Jns and V1Jns-tPA which are utilized for HIV-1 gag, pol and nef constructs in various DNA/viral vector combined modality regimens as disclosed herein.

Figures 17A-1 to 17A-3 shows the nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.

Figure 18 shows codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-pol inact(opt) (contained within SEQ ID NOs: 7 and 8, respectively). The underlined portion represents the NH2-terminal region of IA-Pol.

Figures 19A-1 to 19A-2 show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef. The wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide. WT, wild type sequence (SEQ ID NO:19); opt, codon-optimized sequence (contained within SEQ ID NO:9). The Nef amino acid sequence is shown in one-letter code (SEQ ID A627836spcci Figures 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors V1Jns/nef (Figure V1Jns/nef(G2A,LLAA) (Figure 20B), V1Jns/tpanef (Figure 20C) and V1Jns/tpanef(LLAA) (Figure 20C, also). 5' and 3' flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. V1Jns/tpanef and V1Jns/tpanef(LLAA) have identical sequences at the junctions.

Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the putative leader peptide cleavage sites are indicated with and a exogenous serine residue introduced during the construction of the mutants is underlined.

Figure 22 shows diagrammatically the construction of the pre-adenovirus plasmid construct, Figure 23 shows diagrammatically the construction of the pre-adenovirus plasmid construct, Figure 24 shows a comparison of clade B vs. clade C anti-gag T cell responses in clade B HIV-infected subjects.

Figure 25 shows a comparison of clade B vs. clade C anti-nef T cell responses in clade B HIV-infected subjects.

Figures 26A-1 to 26A-46 illustrates the nucleotide sequence of the pMRKAd5HIV-lpol adenoviral vector (SEQ ID NO:28 [coding] and SEQ ID NO:29 [non-coding]), comprising the coding region of the inactivated pol gene (SEQ ID NO:3).

Figures 27A-1 to 27A-44 illustrates the nucleotide sequence of the pMRKAd5HIV-1 nef adenoviral vector (SEQ ID NO:30 [coding] and SEQ ID NO:31 [non-coding]), comprising the coding region of the inactivated nef gene (SEQ ID NO:13).

Figure 28 shows the stability of MRKAd5 vectors comprising various promoter fragments (hCMV or mCMV) and terminations signals (bGH or SPA) in or E3(-) backbones.

Figures 29A and B shows the anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi time points (Figure 29A) and the timcourse QPA supernatant titers (Figure 29B) for and Figures 30A-1 to 30A-2 show the nucleotide sequence (SEQ ID NO:32) and amino acid sequence (SEQ ID NO:33) comprising the open reading frame of a A627836speci 18 representative tPA-gag fusion for use in the DNA and/or adenoviral vaccine disclosed herein.

Figure 31 shows the intracellular yIFN staining of PBMCs collected at week (post DNA prime) and week 30 (post Ad boost). The cells were stimulated overnight in the presence or absence of the gag peptide pool. They were subsequently stained using fluorescence-tagged anti-CD3, anti-CD8, anti-CD4, and anti-yIFN monoclonal antibodies.

Each plot shows all CD3+ T cells which were segregated in terms of positive staining for surface CD8 and yIFN production. The numbers in the upper right and lower right quadrants of each plot are the percentages of CD3 cells that were CD8+yIFN and CD4+yIFN respectively.

Figure 32 shows a comparison of single-modality adenovirus immunization with DNA adjuvant prime/adenovirus boost immunization.

Figures 33A-1 to 33A-2 show the nucleotide sequence (SEQ ID NO:34) of the open reading frame for the gag-IApol fusion of Example 29.

Figures 34A-1 to 34A-2 show the protein sequence (SEQ ID NO:35) of the gag- IApol fusion frame.

DETAILED DESCRIPTION OF THE INVENTION A novel replication-defective, or "first generation," adenoviral vector suitable for use in gene therapy or nucleotide-based vaccine vectors is described. This vector is at least partially deleted in El and comprises a wildtype adenovirus cis-acting packaging region from about base pair 1 to between about base pair 342 (more preferably, 400) to about 458 (preferably, 1-450) and, preferably, 3511-3523 of a wild-type adenovirus sequence. It has been found that a vector of this description possesses enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, and is more potent allowing lower doses of virus to be used to generate equivalent immunity. The vector, furthermore, generates a harvested recombinant adenovirus which shows greater cellular-mediated immune responses than replication-deficient vectors not comprising this region (basepairs 342-450). Adenoviral constructs derived from these vectors are, further, very stable genetically, particularly those comprising a transgene under the control of a hCMV promoter devoid ofintron A. Viruses in accordance with this description were passaged continually and analyzed; see Example 12. Each virus analyzed maintained it correct genetic structure. Analysis was also carried out under propagation conditions similar to that performed in large scale production. Again, the vectors were found to possess enhanced genetic stability; see Figure 12. Following 21 passages, the viral DNA showed no evidence of rearrangement, and was highly reproducible from one production lot to the next. The outcome of all relevant tests indicate that the adenoviral vector is extremely well suited for large-scale production of recombinant, replication-deficient adenovirus, as shown herein with the data associated with Figure 28.

A627836speci 19 A preferred adenoviral vector in accordance with this description is a vector comprising basepairs 1-450, which is deleted in E3. This vector can accommodate up to approximately 7,500 base pairs of foreign DNA inserts (or exogenous genetic material).

Another preferred vector is one retaining E3 which comprises basepairs 1-450. A preferred vector of this description is an E3+ vector comprising basepairs 1-450 and 3511-3523. This vector, when deleted of the region spanning basepairs 451-3510, can accommodate up to approximately, 4,850 base pairs of foreign DNA inserts (or exogenous genetic material). The cloning capacities of the above vectors have been determined using 105% of the wildtype Ad5 sequence as the upper genome size limit.

Wildtype adenovirus serotype 5 is used as the basis for the specific basepair numbers provided throughout the specification. The wildtype adenovirus serotype sequence is known and described in the art; see, Chroboczek et al., 1992 J. Virology 186:280, which is hereby incorporated by reference. Accordingly, a particular embodiment of the instant invention is a vector based on the adenovirus serotype sequence. One of skill in the art can readily identify the above regions in other adenovirus serotypes serotypes 2, 4, 6, 12, 16, 17, 24, 31, 33, and 42), regions defined by basepairs corresponding to the above basepair positions given for adenovirus serotype 5. Accordingly, the instant invention encompasses all adenoviral vectors partially deleted in El comprising basepairs corresponding to 1-450 (particularly, 342- 450) and, preferably, 3511-3523 of a wild-type adenovirus serotype 5 (Ad5) nucleic acid sequence. Particularly preferred embodiments of the instant invention are those derived from adenoviruses like Ad5 which are classified in subgroup C Ad2).

Vectors in accordance with the instant invention are at least partially deleted in El. Preferably the El region is completely deleted or inactivated. Most preferably, the region deleted of El is within basepairs 451-3510. It is to be noted that the extended and 3' regions of the disclosed vectors are believed to effectively reduce the size of the El deletion of previous constructs without overlapping any part of the E1A/E1B gene present in the cell line used, the PER.C6® cell line transfected with base pairs 459-3510.

Overlap of adenoviral sequences is avoided because of the possibility of recombination.

One of ordinary skill in the art can certainly appreciate that the instant invention can, therefore, be modified if a different cell line transfected with a different segment of adenovirus DNA is utilized. For purposes of exemplification, a 5' region of base pairs 1 to up to 449 is more appropriate if a cell line is transfected with adenoviral sequence from base pairs 450-3510. This holds true as well in the consideration of segments 3' to the El deletion.

Preferred embodiments of the instant invention possess an intact E3 region an E3 gene capable of encoding a functional E3). Alternate embodiments have a partially deleted E3, an inactivated E3 region, or a sequence completely deleted of E3. Applicants have found, in accordance with the instant invention, that virus comprising the E3 gene A627836speci were able to amplify more rapidly compared with virus not comprising an E3 gene; see Figure 6 wherein a diagnostic CsCI band corresponding to the E3+ virus tested (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus. These results were obtained following a virus competition study involving mixing equal MOI ratio of adenovectors both comprising the E3 gene and not comprising the E3 gene. This increased amplification capacity of the E3+ adenovectors was subsequently confirmed with growth studies; see Table 4A, wherein the E3+ virus exhibit amplification ratios of 470, 420 and 320 as compared with the 115 and 40-50 of the E3- constructs.

As stated above, vectors in accordance with the instant invention can accommodate up to approximately 4,850 base pairs of exogenous genetic material for an E3+ vector and approximately 7,500 base pairs for an E3- vector. Preferably, the insert brings the adenoviral vector as close as possible to a wild-type genomic size for 35,935 basepairs). It is well known that adenovirus amplifies best when they are close to their wild-type genomic size.

The genetic material can be inserted in an El-parallel or an El anti-parallel orientation, as such is illustrated in Figure 7A, 7B, 7C and Figure 8A. Particularly preferred embodiments of the instant invention, have the insert in an El-parallel orientation. Applicants have found, via competition experiments with plasmids containing transgenes in differing orientation (Figure 8A), that vector constructs with the foreign DNA insert in an El-parallel orientation amplify better and actually out-compete El-antiparallel-oriented transgenes. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the El parallel orientation as compared with the El anti-parallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the El parallel orientation for both transgenes tested.

Adenoviral vectors in accordance with the instant invention are particularly well suited to effectuate expression of desired proteins, one example of which is an HIV protein, particularly an HIV full length gag protein. Exogenous genetic material encoding a protein of interest can exist in the form of an expression cassette. A gene expression cassette preferably comprises a nucleic acid encoding a protein of interest; a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription terminator.

The transcriptional promoter is preferably recognized by an eukaryotic RNA polymerase. In a preferred embodiment, the promoter is a "strong" or "efficient" promoter. An example of a strong promoter is the immediate early human cytomegalovirus promoter (Chapman et al, 1991 Nucl. Acids Resl9:3979-3986, which is incorporated by reference), preferably without intronic sequences. Most preferred for use within the instant adenoviral vector is a human CMV promoter without intronic A627836speci 21 sequences, like intron A. Applicants have found that intron A, a portion of the human cytomegalovirus promoter (hCMV), constitutes a region of instability for adenoviral vectors. CMV without intron A has been found to effectuate (Examples 1-3) comparable expression capabilities in vitro when driving HIV gag expression and, furthermore, behaved equivalently to intron A-containing constructs in Balb/c mice in vivo with respect to their antibody and T-cell responses at both dosages ofplasmid DNA tested pg and 200 itg). Those skilled in the art will appreciate that any of a number of other known promoters, such as the strong immunoglobulin, or other eukaryotic gene promoters may also be used, including the EF1 alpha promoter, the murine CMV promoter, Rous sarcoma virus (RSV) promoter, SV40 early/late promoters and the beta-actin promoter.

In preferred embodiments, the promoter may also comprise a regulatable sequence such as the Tet operator sequence. This would be extremely useful, for example, in cases where the gene products are effecting a result other than that desired and repression is sought.

Preferred transcription termination sequences present within the gene expression cassette are the bovine growth hormone terminator/polyadenylation signal (bGHpA) and the short synthetic polyA signal (SPA) of 50 nucleotides in length, defined as follows: AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGT-TTTTTGTGTG

(SEQ

ID NO:18).

The combination of the CMV promoter (devoid of the intron A region) with the BGH terminator is particularly preferred although other promoter/terminator combinations in the context ofFG adenovirus may also be used.

Other embodiments incorporate a leader or signal peptide into the transgene.

A preferred leader is that from the tissue-specific plasminogen activator protein, tPA.

Examples include but are not limited to the various tPA-gag, tPA-pol and tPA-nef adenovirus-based vaccines disclosed throughout this specification.

In view of the improved adenovirus vectors described herein, an essential portion of the present invention are adenoviral-based HIV vaccines comprising said adenovirus backbones which may be administered to a mammalian host, preferably a human host, in either a prophylactic or therapeutic setting. The HIV vaccines of the present invention, whether administered alone or in combination regimens with other viral- or non-viralbased DNA vaccines, should elicit potent and broad cellular immune responses against HIV that will either lessen the likelihood of persistent virus infection and/or lead to the establishment of a clinically significant lowered virus load subject to HIV infection or in combination with HAART therapy, mitigate the effects of previously established HIV infection (antiviral immunotherapy(ARI)). While any HIV antigen gag, pol, nef, gp41, gpl20, tat, rev, etc.) may be utilized in the herein described recombinant adenoviral vectors, preferred embodiments include the codon optimized p55 gag antigen (herein exemplified as MRKAd5gag), pol and nef. Sequences based on different Clades A627836speci 22 of HIV-1 are suitable for use in the instant invention, most preferred of which are Clade B and Clade C. Particularly preferred embodiments are those sequences (especially, codonoptimized sequences) based on concensus Clade B sequences. Preferred versions of the and MRKAd5nef series of adenoviral vaccines will encode modified versions ofpol or nef, as discussed herein. Preferred embodiments of the 1 vectors carrying HIV envelope genes and modifications thereof comprise the HIV codon-optimized env sequences of PCT International Applications PCT/US97/02294 and PCT/US97/10517, published August 28, 1997 (WO 97/31115) and December 24, 1997, respectively; both documents of which are hereby incorporated by reference.

A most preferred aspect of the instant invention is the disclosed use of the adenoviral vector described above to effectuate expression of HIV gag. Sequences for many genes of many HIV strains are publicly available in GENBANK and primary, field isolates of HIV are available from the National Institute of Allergy and Infectious Diseases (NIAID) which has contracted with Quality Biological (Gaithersburg, MD) to make these strains available. Strains are also available from the World Health Organization (WHO), Geneva Switzerland. It is preferred that the gag gene be from an HIV-1 strain (CAM-1; Myers et al, eds. "Human Retroviruses and AIDS: 1995, IIA3- IIA19, which is hereby incorporated by reference). This gene closely resembles the consensus amino acid sequence for the clade B (North American/European) sequence.

Therefore, it is within the purview of the skilled artisan to choose an appropriate nucleotide sequence which encodes a specific HIV gag antigen, or immunologically relevant portion thereof. As shown in Example 25, a clade B or clade C based p55 gag antigen will potentially be useful on a global scale. As noted herein, the transgene of choice for insertion in to a DNA or MRKAd-based adenoviral vector of the present invention is a codon optimized version of p55 gag. Such a MRKAd5gag adenoviral vector is documented in Example 11 and is at least referred to herein as 1gag. Of course, additional versions are contemplated, including but not limited to modifications such as promoter mCMV for hCMV) and/or pA-terminations signal (SPA for bGH) switching, as well as generating MRK Ad5 backbones with or without deletion of the Ad5 E3 gene.

The present invention also relates to a series of MRKAd5pol-based adenoviral vaccines which are shown herein to generate cellular immune responses subsequent to administration in mice and non-human primate studies. Several of the series are exemplified herein. One such adenoviral vector is referred to as MRKAd5hCMV-inact opt pol(E3+), which comprises the MRKAd5 backbone, the hCMV promoter (no intron an inactivated pol transgene, and contains the Ad5 E3 gene in the adenoviral backbone. A second exemplified pre-adenovirus plasmid and concomitant virus is referred to as MRKAd5hCMV-inact opt pol(E3-), which is identical to the former adenoviral vector except that the E3 is deleted. Both constructions contain a A627836speci 23 codon optimized, inactivated version of HIV-1 Pol, wherein at least the entire coding region is disclosed herein as SEQ ID NO:3 and the expressed protein is shown as SEQ ID NO:4 (Figures 17A-1 to 17A-3 and Table which show targeted deletion for inactivated pol. This and other preferred codon optimized versions ofHIV Pol as disclosed herein are essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference. As disclosed in the above-mentioned documents, the open reading frame for these codon-optimized HIV-1 Pol-based DNA vaccines are represented by codon optimized DNA molecules encoding codon optimized HIV-1 Pol SEQ ID NO:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence SEQ ID NO:6), and especially preferable, and exemplified by the MRKAd5-Pol construct in Example 19, biologically inactivated pol ("inact opt Pol"; SEQ ID NO:4) which is devoid of significant PR, RT, RNase or IN activity associated with wild type Pol. In addition, a construct related to SEQ ID NO:4 is contemplated which contains a leader peptide at the amino terminal region of the IA Pol protein. A specific construct is ligated within an appropriate DNA plasmid vector containing regulatory regions operatively linked to the respective HIV-1 Pol coding region, with or without a nucleotide sequence encoding a functional leader peptide. To this end, various HIV-1 Pol constructs disclosed herein relate to open reading frames for cloning to the enhanced first generation Ad vectors of the present invention (such a series of MRKAd5pol adenoviral vaccine vectors), including but not limited to wild type Pol (comprising the DNA molecule encoding WT opt Pol, as set forth in SEQ ID NO:2), tPA-opt WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), inact opt Pol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ ID NO:4), and tPA-inact opt Pol, (comprising the DNA molecule encoding tPA-inact opt Pol, as set forth in SEQ ID NO:8). The pol-based versions of enhanced first generation adenovirus vaccines elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans. As noted in the above, an effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.

The present invention further relates to a series of MRKAd5nef-based adenoviral vaccines which, similar to HIV gag and pol antigens, generate cellular immune responses subsequent to administration in mice and non-human primate studies. The series are exemplified herein by utilizing the improved MRK adenoviral backbone in combination with modified versions of HIV nef. These exemplified MRKAd5nef vectors are as follows: MRKAd5hCMV-nef(G2A,LLAA) which comprises the improved MRKAd5 backbone, a human CMV promoter an intact Ad5 E3 gene and a A627836spcei modified nef gene: MRKAd5mCMV-nef(G2A,LLAA) which is the same as (1) above but substituting a murine CMV promoter for a human CMV promoter; and MRKAd5mCMV-tpanef(LLAA) which is the same as except that the nef transgene is tpanef(LLAA). Codon optimized versions of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.

Particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO:10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HIV-1 Nefpolypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:11, while the expressed open reading frame is disclosed herein as SEQ ID NO:12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef(G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:13, while the expressed open reading frame is disclosed herein as SEQ ID NO:14. vectors MRKAd5hCMV-nef(G2A,LLAA) and nef(G2A,LLAA) contain this transgene. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide.

This DNA molecule, opt tpanef(LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala- 175, herein referred to as opt tpanef(LLAA) is disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO:16. The vector "MRKAd5mCMV-tpanef(LLAA) contains this transgene.

Along with the improved MRKAd5gag adenovirus vaccine vector described herein, generation of a MRKAd5pol and MRKAd5nef adenovirus vector provide for enhanced HIV vaccine capabilities. Namely, the generation of this trio of adenoviral vaccine vectors, all shown to generate effective cellular immune responses subsequent to host administration, provide for the ability to administer these vaccine candidates not only alone, but preferably as part of a divalent gag and nef, gag and pol, or pol and nef A627836speci 0 components) or a trivalent vaccine gag, pol and nef components). Therefore, a 1 preferred aspect of the present invention are vaccine formulations and associated methods 0^ of administration and concomitant generation of host cellular immune responses )associated with formulating three separate series of MRKAd5-based adenoviral vector r- 5 vaccines. Of course, this MRKAd5 vaccine series based on distinct HIV antigens promotes expanded opportunities for formulation of a divalent or trivalent vaccine, or possibly administration of separate formulations of one or more monovalent or divalent NO formulations within a reasonable window of time. It is also within the scope of the present invention to embark on combined modality regimes which include multiple but S 10 distinct components from a specific antigen. An example, but certainly not a limitation, would be separate MRKAd5pol vectors, with one vaccine vector expressing wild type Pol O(SEQ ID NO:2) and another MRKAd5pol vector expressing inactivated Pol (SEQ ID NO:6). Another example might be separate MRKAd5nef vectors, with one vaccine vector expressing the tPA/LLAA version of Nef (SEQ ID NO:16) and another MRKAd5nef vector expressing the G2A,LLAA modified version of Nef (SEQ ID NO:14). Therefore, the MRKAd5 adenoviral vectors of the present invention may be used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

The present invention also relates to application of a mono-, dual-, or tri-modality administration regime of the MRKAd5gag, pol and nef adenoviral vaccine series in a prime/boost vaccination schedule. This prime/boost schedule may include any reasonable combination of the MRKAd5gag, pol and nef adenoviral vaccine series disclosed herein.

In addition, a prime/boost regime may also involve other viral and/or non-viral DNA vaccines. A preferable addition to an adenoviral vaccine vector regime includes but is not limited to plasmid DNA vaccines, especially DNA plasmid vaccines that contain at least one of the codon optimized gag, pol and nef constructions, as disclosed herein.

Therefore, one aspect of this invention is the administration of the adenoviral vector containing the optimized gag gene in a prime/boost regiment in conjunction with a plasmid DNA encoding gag. To distinguish this plasmid from the adenoviral-containing shuttle plasmids used in the construction of an adenovirus vector, this plasmid will be referred to as a "vaccine plasmid" or "DNA plasmid vaccine". Preferred vaccine plasmids for use in this administration protocol are disclosed in pending U.S. patent application 09/017,981, filed February 3, 1998 and W098/34640, published August 13, 1998, both of which are hereby incorporated by reference. Briefly, the preferred vaccine plasmid is designated V1Jns-FLgag, which expresses the same codon-optimized gag gene as the A627836spcci 26 adenoviral vectors of this invention (see Figure 2 for the nucleotide sequence of the exemplified optimized codon version of full length p55 gag). The vaccine plasmid backbone, designated V1Jns contains the CMV immediate-early (IE) promoter and intron A, a bovine growth hormone-derived polyadenylation and transcription termination sequence as the gene expression regulatory elements, and a minimal pUC backbone; see Montgomery et al., 1993, DNA Cell Biol. 12:777-783. The pUC sequence permits high levels of plasmid production in E. coli and has a neomycin resistance gene in place of an ampicillin resistance gene to provide selected growth in the presence ofkanamycin.

Alternatively, a vaccine plasmid which has the CMV promoter deleted of intron A can be used. Those of skill in the art will recognize that alternative vaccine plasmid vectors may be easily substituted for these specific constructs, and this invention specifically envisions use of such alternative plasmid DNA vaccine vectors.

Another aspect of the present invention is a prime/boost regimen which includes a vaccine plasmid which encodes an HIV pol antigen, preferably a codon optimized form of pol and also preferably a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ ID NOs: 2, 4, 6 and 8. The variety of potential DNA plasmid vaccines which encode various biologically active forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DNA molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIV-1 Pol proteins. The HIV-1 pol open reading disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as delivered via a recombinant adenoviral vaccine, especially an enhanced first generation recombinant adenoviral vaccine as described herein. Several embodiments of this portion of the invention are provided in detail below, namely DNA molecules which comprise a HIV-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human. Again, these DNA sequences are positioned appropriately within a recombinant adenoviral vector, such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIV-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response. Again, these preferred, but in no way limiting, pol genes are as disclosed herein and essentially as described in U.S. Application Serial No. 09/745,221, filed December 21, 2000 and PCT International Application PCT/US00/34724, also filed December 21, 2000, both documents which are hereby incorporated by reference.

A third series of vaccine plasmids which are useful in a combined modality and/or prime/boost regimen are vaccine plasmids which encode an HIV nef antigen or biologically and/or immunologically relevant modification thereof. As noted elsewhere, A627836speci preferred vaccine plasmids contain a codon optimized form of nef and also preferably comprise a nucleotide sequence which encodes a Nef antigen selected from the group of Nef antigens as shown in SEQ ID NOs: 10, 12, 14 and 16. These preferred nef coding regions are disclosed herein, as well as being described in U.S. Application Serial No.

09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference.

Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen.

A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly is pre-existing anti-vector immune responses are present.

This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine.

Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing antiadenovirus immune response.

Furthermore and in the alternative, multiple HIV-1 viral antigens, such as the adenoviral vaccines disclosed herein, may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example a trivalent vector may comprise a gag-pol-nef fusion, in either a or background, preferably a E3 deleted backbone, or possible a "2+1" divalent vaccine, such as a gag-pol fusion codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES), as disclosed in International Publication No.

WO 95/24485, which is hereby incorporated by reference. Figure 9 shows that the use of multiple promoters and termination sequences provide for similar growth properties, while Figure 28 shows that these MRKAd5gag-based vectors are also stable at least through passage 21. In the absence of the use of IRES-based technology, it is preferred that a distinct promoter be used to support each respective open reading frame, so as to best preserve vector stability. As examples, and certainly not as limitations, potential A627836speci 28 multiple transgene vaccines may include a three transgene vector such as hCMV-gagpolbGHpA mCMV-nef-SPA in an E3 deleted backbone or hCMV-gagpol-bGHpA mCMV-nef-SPA(E3+). Potential divalent vaccines of the present invention might be a hCMV-gag-bGHpA mCMV-nef-SPA in an E3+ backbone (vector in combination with hCMV-pol-bGHpA in an E3+ backbone (vector with all transgenes in the El parallel orientation. Fusion constructs other than the gag-pol fusion described above are also suitable for use in various divalent vaccine strategies and can be composed of any two HIV antigens fused to one another nef-pol and gag-nef). These adenoviral compositions are, as above, preferably delivered along with an adenoviral composition comprising an additional HIV antigen in order to diversify the immune response generated upon administration. Therefore, a multivalent vaccine delivered in a single, or possible second, adenoviral vector is certainly contemplated as part of the present invention. Again, this mode of administration is another example of whereby an efficaceous adenovirus-based HIV-1 vaccine may be administered via a combined modality regime. It is important to note, however, that in terms of deciding on an insert for the disclosed adenoviral vectors, due consideration must be dedicated to the effective packaging limitations of the adenovirus vehicle. Adenovirus has been shown to exhibit an upper cloning capacity limit of approximately 105% of the wildtype Ad5 sequence.

Regardless of the gene chosen for expression, it is preferred that the sequence be "optimized" for expression in a human cellular environment. A "triplet" codon of four possible nucleotide bases can exist in 64 variant forms. That these forms provide the message for only 20 different amino acids (as well as transcription initiation and termination) means that some amino acids can be coded for by more than one codon.

Indeed, some amino acids have as many as six "redundant", alternative codons while some others have a single, required codon. For reasons not completely understood, alternative codons are not at all uniformly present in the endogenous DNA of differing types of cells and there appears to exist variable natural hierarchy or "preference" for certain codons in certain types of cells. As one example, the amino acid leucine is specified by any of six DNA codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mRNA codons, CUA, CUC, CUG, CUU, UUA and UUG). Exhaustive analysis of genome codon frequencies for microorganisms has revealed endogenous DNA ofE. coli most commonly contains the CTG leucinespecifying codon, while the DNA of yeasts and slime molds most commonly includes a TTA leucine-specifying codon. In view of this hierarchy, it is generally held that the likelihood of obtaining high levels of expression of a leucine-rich polypeptide by an E.

coli host will depend to some extent on the frequency of codon use. For example, a gene rich in TTA codons will in all probability be poorly expressed in E. coli, whereas a CTG rich gene will probably highly express the polypeptide. Similarly, when yeast cells are A627836speci 29 the projected transformation host cells for expression of a leucine-rich polypeptide, a preferred codon for use in an inserted DNA would be TTA.

The implications of codon preference phenomena on recombinant DNA techniques are manifest, and the phenomenon may serve to explain many prior failures to achieve high expression levels of exogenous genes in successfully transformed host organisms--a less "preferred" codon may be repeatedly present in the inserted gene and the host cell machinery for expression may not operate as efficiently. This phenomenon suggests that synthetic genes which have been designed to include a projected host cell's preferred codons provide a preferred form of foreign genetic material for practice of recombinant DNA techniques. Thus, one aspect of this invention is an adenovirus vector or adenovirus vector in some combination with a vaccine plasmid where both specifically include a gene which is codon optimized for expression in a human cellular environment.

As noted herein, a preferred gene for use in the instant invention is a codon-optimized HIV gene and, particularly, HIV gag, pol or nef.

Adenoviral vectors in accordance with the instant invention can be constructed using known techniques, such as those reviewed in Hitt et al, 1997 "Human Adenovirus Vectors for Gene Transfer into Mammalian Cells" Advances in Pharmacology 40:137-206, which is hereby incorporated by reference.

In constructing the adenoviral vectors of this invention, it is often convenient to insert them into a plasmid or shuttle vector. These techniques are known and described in Hitt et al., supra. This invention specifically includes both the adenovirus and the adenovirus when inserted into a shuttle plasmid.

Preferred shuttle vectors contain an adenoviral portion and a plasmid portion. The adenoviral portion is essentially the same as the adenovirus vector discussed supra, containing adenoviral sequences (with non-functional or deleted El and E3 regions) and the gene expression cassette, flanked by convenient restriction sites. The plasmid portion of the shuttle vector often contains an antibiotic resistance marker under transcriptional control of a prokaryotic promoter so that expression of the antibiotic does not occur in eukaryotic cells. Ampicillin resistance genes, neomycin resistance genes and other pharmaceutically acceptable antibiotic resistance markers may be used. To aid in the high level production of the polynucleotide by fermentation in prokaryotic organisms, it is advantageous for the shuttle vector to contain a prokaryotic origin of replication and be of high copy number. A number of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences. It is also desirable that the vectors not be able to replicate in eukaryotic cells. This minimizes the risk of integration of polynucleotide vaccine sequences into the recipients' genome.

Tissue-specific promoters or enhancers may be used whenever it is desirable to limit expression of the polynucleotide to a particular tissue type.

A627836speci In one embodiment of this invention, the pre-plasmids and pMRKAd5gag were generated by homologous recombination using the MRKHVE3 (and MRKHVO for the E3- version) backbones and the appropriate shuttle vector, as shown for pMRKAd5pol in Figure 22 and for pMRKAd5nef in Figure 23. The plasmid in linear form is capable of replication after entering the PER.C6® cells and virus is produced. The infected cells and media were harvested after viral replication was complete.

Viral vectors can be propagated in various El complementing cell lines, including the known cell lines 293 and PER.C6®. Both these cell lines express the adenoviral El gene product. PER.C6® is described in WO 97/00326 (published January 3, 1997) and issued U.S. Patent No. 6,033,908, both of which are hereby incorporated by reference. It is a primary human retinoblast cell line transduced with an El gene segment that complements the production of replication deficient (FG) adenovirus, but is designed to prevent generation of replication competent adenovirus by homologous recombination.

Cells of particular interest have been stably transformed with a transgene that encodes the AD5E1A and E1B gene, like PER.C6®, from 459 bp to 3510 bp inclusive. 293 cells are described in Graham et al., 1977 J. Gen. Virol 36:59-72, which is hereby incorporated by reference. As stated above, consideration must be given to the adenoviral sequences present in the complementing cell line used. It is important that the sequences not overlap with that present in the vector if the possibility of recombination is to be minimized.

It has been found that vectors generated in accordance with the above description are more effective in inducing an immune response and, thus, constitute very promising vaccine candidates. More particularly, it has been found that first generation adenoviral vectors in accordance with the above description carrying a codon-optimized HIV gag gene, regulated with a strong heterologous promoter can be used as human anti-HIV vaccines, and are capable of inducing immune responses.

Standard techniques of molecular biology for preparing and purifying DNA constructs enable the preparation of the DNA immunogens of this invention.

A vaccine composition comprising an adenoviral vector in accordance with the instant invention may contain physiologically acceptable components, such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate. One preferred formulation has: 2.5-10 mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaC1, preferably about 75 mM NaCI; 2.5-10% sucrose, preferably about sucrose; 0.01 -2 mM MgC1 2 and 0.001%-0.01% polysorbate 80 (plant derived). The pH should range from about 7.0-9.0, preferably about 8.0. One skilled in the art will appreciate that other conventional vaccine excipients may also be used it make the formulation. The preferred formulation contains 5mM TRIS, 75 mM NaCI, 5% sucrose, ImM MgCl 2 0.005% polysorbate 80 at pH 8.0 This has a pH and divalent cation composition which is near the optimum for Ad5 stability and minimizes the potential for A627836speci

I

31 adsorption of virus to a glass surface. It does not cause tissue irritation upon intramuscular injection. It is preferably frozen until use.

The amount of adenoviral particles in the vaccine composition to be introduced into a vaccine recipient will depend on the strength of the transcriptional and translational promoters used and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of xl10 7 to xl1012 particles and preferably about 1x10 1 0 to 1x10 11 particles is administered directly into muscle tissue.

Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided.

Following vaccination with HIV adenoviral vector, boosting with a subsequent HIV adenoviral vector and/or plasmid may be desirable. Parenteral administration, such as intravenous, intramuscular, subcutaneous or other means of administration ofinterleukin- 12 protein, concurrently with or subsequent to parenteral introduction of the vaccine compositions of this invention is also advantageous.

The adenoviral vector and/or vaccine plasmids of this invention polynucleotide may be unassociated with any proteins, adjuvants or other agents which impact on the recipients' immune system. In this case, it is desirable for the vector to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the vector may be associated with an adjuvant known in the art to boost immune responses a "biologically effective" adjuvant), such as a protein or other carrier. Vaccine plasmids of this invention may, for instance, be delivered in saline PBS) with or without an adjuvant. Preferred adjuvants are Alum or CRL1005 Block Copolymer. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, may also be used to advantage. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable carriers. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention.

This invention also includes a prime and boost regimen wherein a first adenoviral vector is administered, then a booster dose is given. The booster dose may be repeated at selected time intervals. Alternatively, a preferred inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype.

More preferably, the inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype, wherein the first and second adenovirus serotypes are classified within separate subgroups of adenoviruses.

The above prime/boost schemes are particularly preferred in those situations where a preexisting immunity is identified to the adenoviral vector of choice. In this type of scheme, the individual or population of individuals is primed with an adenovirus of a serotype other than that to which the preexisting immunity is identified. This enables the A627836speci 32 first adenovirus to effectuate sufficient expression of the transgene while evading existing immunity to the second adenovirus (the boosting adenovirus) and, further, allows for the subsequent delivery of the transgene via the boosting adenovirus to be more effective.

Adenovirus serotype 5 is one example of a virus to which such a scheme might be desirable. In accordance with this invention, therefore, one might decide to prime with a non-group C adenovirus Adl2, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus) to evade anti-Ad5 immunity and then boost with Ad5, a group C adenovirus. Another preferred embodiment involves administration of a different adenovirus (including non-human adenovirus) vaccine followed by administration of the adenoviral vaccines disclosed. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and venezuelan equine encephilitis virus.

A large body of human and animal data supports the importance of cellular immune responses, especially CTL in controlling (or eliminating) HIV infection. In humans, very high levels of CTL develop following primary infection and correlate with the control ofviremia. Several small groups of individuals have been described who are repeatedly exposed to HIV by remain uninfected; CTL has been noted in several of these cohorts. In the SIV model of HIV infection, CTL similarly develops following primary infection, and it has been demonstrated that addition of anti-CD8 monoclonal antibody abrogated this control of infection and leads to disease progression. This invention uses adenoviral vaccines alone or in combination with plasmid vaccines to induce CTL.

The following non-limiting Examples are presented to better illustrate the invention.

EXAMPLE 1 Removal of the Intron A Portion of the hCMV Promoter GMP grade pVUnsHIVgag was used as the starting material to amplify the hCMV promoter. PVIJnsHIVgag is a plasmid comprising the CMV immediate-early (IE) promoter and intron A, a full-length codon-optimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone; see Montgomery et al., supra for a description of the plasmid backbone. The amplification was performed with primers suitably positioned to flank the hCMV promoter. A 5' primer was placed upstream of the Mscl site of the hCMV promoter and a 3' primer (designed to contain the BgII recognition sequence) was placed 3' of the hCMV promoter. The resulting PCR product (using high fidelity Taq polymerase) which encompassed the entire hCMV promoter (minus intron A) was cloned into TOPO PCR blunt vector and then removed by double digestion with Mscl and BglII.

This fragment was then cloned back into the original GMP grade pV1JnsHIVgag plasmid from which the original promoter, intron A, and the gag gene were removed following A627836speci 33 Mscl and BglI digestion. This ligation reaction resulted in the construction of a hCMV promoter (minus intron A) bGHpA expression cassette within the original pV1JnsHIVgag vector backbone. This vector is designated pVUnsCMV(no intron).

The FLgag gene was excised from pV1JnsHIVgag using BglI digestion and the 1,526 bp gene was gel purified and cloned into pV1JnsCMV(no intron) at the BglI site.

Colonies were screened using Smal restriction enzymes to identify clones that carried the Flgag gene in the correct orientation. This plasmid, designated pV1JnsCMV(no intron)- FLgag-bGHpA, was fully sequenced to confirm sequence integrity.

Two additional transgenes were also constructed. The plasmid, pV1JnsCMV(no intron)-FLgag-SPA, is identical to pVlJnsCMV(no intron)-FLgagbGHpA except that the bovine growth hormone polyadenylation signal has been replaced with a short synthetic polyA signal (SPA) of 50 nucleotides in length. The sequence of the SPA is as shown, with the essential components (poly(A) site, and respectively) underlined: AATAAAAGATCTTTATTTTCATTAGATCTGTGTG TTGGTTTTTTGTGTG (SEQ ID NO:18).

The plasmid, pV Jns-mCMV-FLgag-bGHpA, is identical to the pV1JnsCMV(no intron)-FLgag-bGHpA except that the hCMV promoter has been removed and replaced with the murine CMV (mCMV) promoter.

Figure 3 diagrammatically shows the new transgene constructs in comparison with the original transgene.

EXAMPLE 2 Gag Expression Assay for Modified Gag Transgenes Gag Elisa was performed on culture supematants obtained from transient tissue culture transfection experiments in which the two new hCMV-containing plasmid constructs, pV1JnsCMV(no intron)-FLgag-bGHpA and pV1JnsCMV(no intron)-FLgag- SPA, both devoid of intron A, were compared to pV1JnsHIVgag which, as noted above possesses the intron A as part of the hCMV promoter. Table 2 below shows the in vitro gag expression data of the new gag plasmids compared with the GMP grade original plasmid. The results displayed in Table 2 show that both of the new hCMV gag plasmid constructs have expression capacities comparable to the original plasmid construct which contains the intron A portion of the hCMV promoter.

Table 2: In vitro DNA transfection of original and new plasmid HIV-1 gag constructs.

Plasmid I g gag/10e6 COS cells/5tg DNA/48 hr HIVFL-gagPR9901 a 10.8 PVIJns-hCMV-FLgag-bGHpAb 16.6 pV1Jns-hCMV-FLgag-SPAbc 12.0 A627836speci 34 a GMP grade pV1Jns-hCMVintronA-FLgag-bGHpA.

b New plasmid constructions that have the intron A portion removed from the hCMV promoter.

c In this construct the bGH terminator has been replaced with the short synthetic polyadenylation signal (SPA) EXAMPLE 3 Rodent (Balb/c) Study for Modified gag Transgenes A rodent study was performed on the two new plasmid constructs described above pV1JnsCMV(no intron)-FLgag-bGHpA and pV1JnsCMV(no intron)- FLgag-SPA in order to compare them with the construct described above possessing the intron A portion of the CMV promoter, pV1JnsHIVgag. Gag antibody and Elispot responses (described in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed July 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed July 6, 1999 and U.S. Application Serial No. 60/148,981, filed August 13, 1999, all three applications which are hereby incorporated by reference) were measured. The results displayed in Table 3 below, show that the new plasmid constructs behaved equivalently to the original construct in Balb/c mice with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested, 20 [pg and 200 jig.

Table 3: HIV191: Immunogenicity of V1Jns-gag under different promoter and termination control elements.

DNAa Dose, Anti-p24 Titers SFC/10^6 Cells ugb (3 Wk PD1)c (4 Wk PD1) Promoter/terminator GMT +SE -SE Media gag197-205 p24 HIVFL-gagPR9901 200 12800 4652 3412 2(2) 129(19) 30(11) (GMP grade) 20 5572 1574 1227 0 56(9) 25(6) pV1Jns-hCMV- 200 11143 2831 2257 0 98(5) 12(6) FL-gag-bGHpA 20 7352 2808 2032 0 73(9) 11(6) pV1Jns-hCMV- 200 16890 5815 4326 1(1) 94(4) 26(7) FL-gag-SPA 20 5971 5361 2825 0 85(17) 38(10) Nafve 0 123 50 36 0 0 0 ain PBS bi.m. Injections into both quads, 50 gL per quad geometric mean titer; SE, standard. error dn= 5 pooled spleens; mean of triplicate wells and standard. deviation, in parentheses; EXAMPLE 4 Construction of the Modified Shuttle Vector -"MRKpdelEl Shuttle" The modifications to the original Ad5 shuttle vector (pdelElsplA; a vector comprising Ad5 sequences from basepairs 1-341 and 3524-5798, with a multiple cloning A627836spcci region between nucleotides 341 and 3524 of Ad5, included the following three manipulations carried out in sequential cloning steps as follows: The left ITR region was extended to include the Pad site at the junction between the vector backbone and the adenovirus left ITR sequences. This allow for easier manipulations using the bacterial homologous recombination system.

The packaging region was extended to include sequences of the wild-type (WT) adenovirus from 342 bp to 450 bp inclusive.

The area downstream ofpIX was extended 13 nucleotides nucleotides 3511-3523 inclusive).

These modifications (Figure 4) effectively reduced the size of the El deletion without overlapping with any part of the E1A/E1B gene present in the transformed PER.C6® cell line. All manipulations were performed by modifying the Ad shuttle vector pdelElsplA.

Once the modifications were made to the shuttle vector, the changes were incorporated into the original Ad5 adenovector backbones (pAdHVO and pAdHVE3) by bacterial homologous recombination using E. coli BJ5183 chemically competent cells.

EXAMPLE Construction of Modified Adenovector Backbones (E3+ and E3-) The original adenovectors pAdHVO (comprising all Ad5 sequences except those nucleotides encompassing the El and E3 regions) and pADHVE3 (comprising all sequences except those nucleotides encompassing the El region), were each reconstructed so that they contained the modifications to the El region. This was accomplished by digesting the newly modified shuttle vector (MRKpdelEl shuttle) with Pad and BstZ1101 and isolating the 2,734 bp fragment which corresponds to the adenovirus sequence. This fragment was co-transformed with DNA from either Clal linearized pAdHVO (E3- adenovector) or Clal linearized pAdHVE3 (E3+adenovector) into E. coli BJ5183 competent cells. At least two colonies from each transformationwere selected and grown in TerrificTM broth for 6-8 hours until turbidity was reached. DNA was extracted from each cell pellet and then transformed into E. coli XL1 competent cells.

One colony from each transformation was selected and grown for plasmid DNA purification. The plasmid was analyzed by restriction digestions to identify correct clones. The modified adenovectors were designated MRKpAdHVO (E3- plasmid) and MRKpAdHVE3 (E3+ plasmid). Virus from these new adenovectors (MRKHVO and MRKHVE3, respectively) as well as the old version of the adenovectors were generated in the PER.C6® cell lines to accommodate the following series of viral competition experiments. In addition, the multiple cloning site of the original shuttle vector contained Clal, BamHI, Xho I, EcoRV, HindIII, Sal I, and Bgl II sites. This MCS was replaced with a new MCS containing Not I, Cla I, EcoRV and Asc I sites. This new MCS has been transferred to the MRKpAdHVO and MRKpAdHVE3 pre-plasmids along with the modification made to the packaging region and pIX gene.

A627836speci 36 EXAMPLE 6 Analysis of the Effect of the Packaging Signal Extension To study the effects of the modifications made to the El deletion region, the viruses obtained from the original backbone (pAdHVE3) and the new backbone (MRKpAdHVE3) were mixed together in equal MOI ratios (1:1 and 5:5) and passaged through several rounds; see Figure 5, Expt.#l. Both of the viruses in the experiment contained the E3 gene intact and did not contain a transgene. The only difference between the two viruses was within the region of the El deletion. Following the coinfection of the viruses at P1 (passage the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindlII and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids (pAdHVE3 ("OLD MRKpAdHVE3 ("NEW were also digested with HindlII (and Pad to remove the vector backbone) and subsequently labeled with [33P]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure 6 clearly shows that the new adenovirus which has the addition made to the packaging signal region has a growth advantage compared with the original adenovirus. In the experiments performed (at either ratio tested), only the digestion bands pertaining to the newly modified virus were present. The diagnostic band of size 3,206 (from the new virus) was clearly present. However, there was no evidence of the diagnostic band of size 2,737 bp expected from the original virus.

EXAMPLE 7 Analysis of the Effect of the E3 Gene The second set of the virus competition study involved mixing equal MOI ratio of the newly modified viruses, that obtained from MRKpAdHVO and MRKpAdHVE3 (Figure 5, Expt. In this set, both viruses had the new modifications made to the El deletion. The first virus (that from MRKpAdHVO) does not contain an E3 gene. The second virus (that from MRKpAdHVE3) does contain the E3 gene.

Neither of the viruses contain a transgene. Following co-infection of the viruses, the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the total virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindII and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids MRKpAdHVO ("NEW MRKpAdHVE3 ("NEW were also digested with HindIII (and Pad to remove the vector backbone) and then labeled with 3 3 P]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. Figure 6 shows the results of the A627836speci 37 viral DNA analysis of the E3+ virus and E3- virus mixing experiment. The diagnostic band corresponding to the E3+ virus (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3- virus. This indicates that the virus that contains the E3 gene is able to amplify more rapidly compared with the virus that does not contain an E3 gene. This increased amplification capacity has been confirmed by growth studies; see Table 4 below.

EXAMPLE 8 Construction of the new shuttle vector containing modified gag transgene "MRKpdelEl-CMV(no intron)-FLgag-bGHpA" The modified plasmid pV1JnsCMV(no intron)-FLgag-bGHpA was digested with Mscl overnight and then digested with Sfil for 2 hours at 50 0 C. The DNA was then treated with Mungbean nuclease for 30 mins at 30 0 C. The DNA mixture was desalted using the Qiaex II kit and then Klenow treated for 30 mins at 37 0 C to fully blunt the ends of the transgene fragment. The 2,559 bp transgene fragment was then gel purified. The modified shuttle vector (MRKpdelEl shuttle) was linearized by digestion with EcoRV, treated with calf intestinal phosphatase and the resulting 6,479 bp fragment was then gel purified. The two purified fragments were then ligated together and several dozen clones were screened to check for insertion of the transgene within the shuttle vector. Diagnostic restriction digestion was performed to identify those clones carrying the transgene in the El parallel and El anti-parallel orientation. This strategy was followed to clone in the other gag transgenes in the MRKpdelEl shuttle vector.

EXAMPLE 9 Construction of the MRK FG Adenovectors The shuttle vector containing the HIV-1 gag transgene in the El parallel orientation, MRKpdelEl-CMV(no intron)-FLgag-bGHpA, was digested with Pad. The reaction mixture was digested with BsZL171. The 5,291 bp fragment was purified by gel extraction. The MRKpAdHVE3 plasmid was digested with Clal overnight at 37 0 C and gel purified. About 100 ng of the 5,290 bp shuttle +transgene fragment and -100 ng of linearized MRKpAdHVE3 DNA were co-transformed into E. coli BJ5183 chemically competent cells. Several clones were selected and grown in 2 ml TerrificTM broth for 6-8 hours, until turbidity was reached. The total DNA from the cell pellet was purified using Qiagen alkaline lysis and phenol chloroform method. The DNA was precipitated with isopropanol and resuspended in 20 pl dH 2 0. A 2 pl aliquot of this DNA was transformed into E. coli XL-1 competent cells. A single colony from each separate transformation was selected and grown overnight in 3 ml LB +100 pg/ml ampicillin. The DNA was isolated using Qiagen columns. A positive clone was identified by digestion with the restriction enzyme BstEII which cleaves within the gag gene as well as the plasmid backbone. The pre-plasmid clone is designated MRKpAdHVE3+CMV(no intron)- A627836spcci 38 FLgag-bGHpA and is 37,498 bp in size. This strategy was followed to generate E3- and E3+ versions of each of the other gag transgene constructions in both El parallel and El anti-parallel versions. Figures 7A, 7B and 7C show the various combinations of adenovectors constructed.

EXAMPLE Plasmid Competition Studies A series ofplasmid competition studies was carried out. Briefly, the screening of the various combinations of new constructs was performed by mixing equal amounts of each of two competing plasmids. In the experiment shown in Figure 8A, plasmids containing the same transgene but in different orientations were mixed together to create a "competition" between the two plasmids. The aim was to look at the effects of transgene orientation. In the experiment shown in Figure 8B, plasmids containing different polyadenylation signals (but in the same orientation) were mixed together in equal amounts. The aim was to assess effects of polyA signals. Following the initial transfection, the virus was passaged through ten rounds and the viral DNA analyzed by radioactive restriction analysis.

Analysis of the viral species from the plasmid mixing experiment (Figure 8A) showed that adenovectors which had the transgene inserted in the El parallel orientation amplified better and were able to out-compete the adenovirus which had the transgene inserted in the El anti-parallel orientation. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the El parallel orientation compared with the El antiparallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the El parallel orientation for both transgenes tested (hCMV(no intron)-FLgag-bGHpA and hCMV(no intron)-FLgag-SPA).

Analysis of the viral species from the plasmid mixing experiment #2 (Figure 8B) at passages 3 and 6 showed that the polyadenylation signals tested (bGHpA and SPA) did not have an effect on the growth of the virus. Even at passage 10 the two viral species in the mixture were still present in equal amounts.

EXAMPLE 11 Virus generation of an enhanced adenoviral construct "MRK Ad5 HIV-lgag" The results obtained from the competition study allowed us to make the following conclusions: The packaging signal extension is beneficial; Presence of E3 does enhance viral growth; El parallel orientation is recommended; and PolyA signals have no effect on the growth of the adenovirus.

MRK Ad5 HIV-1 gag exhibited the most desirable results. This construct contains the hCMV(no intron)-FLgag-bGHpA transgene inserted into the new E3+ adenovector backbone, MRKpAdHVE3, in the El parallel orientation. We have A627836speci 39 designated this adenovector MRK Ad5 HIV-1 gag. This construct was prepared as outlined below: The pre-plasmid MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA was digested was Pad to release the vector backbone and 3.3 jtg was transfected by calcium phosphate method (Amersham Pharmacia Biotech.) in a 6 cm dish containing PER.C6® cells at confluence. Once CPE was reached (7-10 days), the culture was freeze/thawed three times and the cell debris pelleted. 1 ml of this cell lysate was used to infect into a 6 cm dish containing PER.C6® cells at 80-90% confluence. Once CPE was reached, the culture was freeze/thawed three times and the cell debris pelleted. The cell lysate was then used to infect a 15 cm dish containing PER.C6® cells at 80-90% confluence. This infection procedure was continued and expanded at passage 6. The virus was then extracted from the cell pellet by CsC1 method. Two bandings were performed (3-gradient CsCl followed by a continuous CsCl gradient). Following the second banding, the virus was dialyzed in A105 buffer. Viral DNA was extracted using pronase treatment followed by phenol chloroform. The viral DNA was then digested with HindII and radioactively labeled with [3 3 P]dATP. Following gel electrophoresis to separate the digestion products the gel was dried down on Whatman paper and then subjected to autoradiography. The digestion products were compared with the digestion products from the pre-plasmid (that had been digested with Pacl/HindII prior to labeling). The expected sizes were observed, indicating that the virus had been successfully rescued. This strategy was used to rescue virus from each of the various adenovector plasmid constructs prepared.

EXAMPLE 12 Stability Analyses To determine whether the various adenovector constructs MRK Ad5 HIV-1 gag) show genetic stability, the viruses were each passaged continually. The viral DNA was analyzed at passages 3, 6 and 10. Each virus maintained its correct genetic structure.

In addition, the stability of the MRK Ad5 HIV-1 gag was analyzed under propagation conditions similar to that performed in large scale production. For this analysis, the transfections of MRK Ad5 HIV-1 gag as well as three other adenoviral vectors were repeated and the virus was purified at P3. The three other adenovectors were as follows: that comprising hCMV(no intron)-Flgag with a bGHpA terminator in an E3adenovector backbone; that comprising hCMV(no intron)-Flgag with a SPA termination signal in an E3+ adenovector backbone, and that comprising a mCMV-Flgag with a bGHpA terminator in an E3+ adenovector backbone. All of the vectors have the transgene inserted in the El parallel orientation. Viral DNA was analyzed by radioactive restriction analysis to confirm that it was correct before being delivered to fermentation cell culture for continued passaging in serum-free media. At P5 each of the four viruses were purified and the viral DNA extracted for analysis by the restriction digestion and radiolabeling procedure. This virus has subsequently been used in a series of studies (in A627836spcci

I

vitro gag expression in COS cells, rodent study and rhesus monkey study) as will be described below. The viruses from P5 are shown in Figure 9.

The passaging under serum-free conditions was continued for the MRKHVE3 (transgene-less, obtained from MRKpAdHVE3 pre-plasmid) and the MRKAd5HIV-1gag (obtained from MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA pre-plasmid) viruses. Figure 10 shows viral DNA analysis by radioactive restriction digestion at passage 11 for MRKHVE3, MRKAd5HIV-lgagE3-, and passage 11 and 12 for MRKAd5HIV-lgag. Aside from the first lane which is the DNA marker lane, the next three lanes are virus from the pre-plasmid controls (controls based on the original virus) MRKpAdHVE3 (also referred to as "pMRKHVE3"), MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA, and pMRKAd5gag(E3-), respectively. As seen in Figure 10, each of the viral DNA samples show the expected bands with no extraneous bands showing.

This signifies that there are no major variant adenovirus species present that can be detected by autoradiography.

Figure 11 shows the results of viral competition study between MRKHVE3 and MRKAd5HIV-1gag. These viruses were mixed together at equal MOI (140 viral particles each; 280 vp total) at passage 6 and continued to be passaged until P11. Aside from the first lane which is the DNA marker lane, the next two lanes are the pre-plasmid controls obtained from MRKpAdHVE3 and MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA.

The next two lanes are the viral DNA from the starting viral material at passage six. The last two lanes are the competition studies performed in duplicate. The data in Figure 11 shows the effect the gag transgene in culture. Growth of a MRKAd5gag virus was compared with growth of a "transgene-less" MRKHVE3. These two viruses were infected at the same MOI 140 vp each) at passage 6 and then passaged through to passage 11 and the viral pool was analyzed by radioactive restriction analysis. The data shows that one virus did not out compete the other. Therefore, the gag transgene did not show obvious signs of toxicity to the adenovirus.

Analysis by HindII digestion shows that each virus specie is present in approximately equal amounts. As above, there does not appear to be signs of any extraneous bands. Figure 12 shows higher passage numbers for grown under serum-containing conditions. The genome integrity again has been maintained and there is no evidence of rearrangements, even at the highest passage level (P21).

Each of the four vectors shown in Figure 9 were analyzed for amplification capacity. Table 4 below shows the QPA analysis used in the estimation of viral amplification ratios at P4. The determination of the amplification ratio for the original HIV-1 gag construct is based on the clinical lot at P12. It has been shown that amplification rates increases with higher passage number for the original virus. The reason for this observation is due to the emergence of variants which exhibit increased A627836speci growth rates compared to the intact adenovector. With continued passaging of the original Ad gag vector, the level of variants increases and hence amplification rates increase also.

The MRK Ad5 HIV-1 gag virus has also been continually passaged under process conditions serum-free media). Viral DNA extracted from passages 11 and 12 show no evidence of rearrangement.

Table 4: Amplification Ratios Based on AEX and QPA Analysis of Virus Amplification from Passage 3 to Passage 4.

Ad gag construct Amplification Ratio 470 HCMV-Flgag-bGHpA 115 HCMV-Flgag-SPA 320 mCMV-FLgag-bGHpA 420 Original construct 140 This estimation is based on the clinical lot growth characteristics at Passage 12.

EXAMPLE 13 Analytical Evaluation of the enhanced Ad5 Constructs To study the effects of the transgene and the E3 gene on virus amplification, the enhanced adenoviral vector, MRK Ad5 HIV-1 gag, along with its transgene-less version (MRKpAdHVE3) and its E3- version (MRK Ad5 HIV-1 gag was studied for several passages under serum-free conditions. Table 5A shows the amplification ratios determined for passages P3 to P8 for MRK Ad5 HIV-1 gag. Within a certain MOI range, it has been determined that the virus output is directly proportional to the virus input.

Therefore, the greater the number of virus particles per cell at infection, the greater the virus amount produced. Viral amplification ratios, on the other hand, are inversely proportional to the virus input. The lower the virus input, the greater the amplification ratio.

Table 5B shows the amplification rates of the new E3+ vector backbone MRKpAdHVE3. It has a significantly lower rate of amplification compared with the gag transgene containing version. This may be contributed to the larger size MRK HIV-1 gag since it contains the transgene. This inclusion of the transgene brings the size of the adenovirus closer to the size of a wild type Ad5 virus. It is well known that adenoviruses amplify best when they are at close to their wild type genomic size.

Wild type Ad5 is 35,935 bp. The MRKpAdHVE3 is 32, 905 bp in length. The enhanced adenovector MRK Ad5 HIV-1 gag is 35,453bp (See Figure 14 for vector map; see also Figures 15A-1 to 15A-45 show the complete pre-adenoviral vector sequence, which includes an additional 2,021 bp of the vector backbone).

A627836speci 42 Table 5C shows the amplification rates of the new E3- gag containing virus IVIRK HIV-1 gag E3-. Once again, this virus shows lower growth rate than the enhanced adenoviral vector. This may be attributed to the decreased sized of this virus (due to the E3 gene deletion) compared with wild type Ad5. The MRK Ad5 HLV-1 gag E3- virus is 32,810 bp in length. This can be compared with the wild type Ad5 which is 35,935 bp and MRK Ad5 HIV-1 gag which is 35,453 bp in length.

Table 5A: Amplification ratios determined by AEX and QPA for MRKAd5gag over several continuous passaging in serum free media. Following P5, two replicate samples were taken (rep- 1 and rep-2) and analyzed.

MRKAdSgag repi Titer Titer QPA RaVe P6 P7 P7

PB

P19 P12 Pt4 Xv (I cells/mi). Viability Harvest Time Infecion Harvest h.p.I.

1.49,81% 0.68.0% 44 -1.368,93% 0.66.47% 48 1.04 94% 0.68,77% 47 1M,864% 0.66, 61%Y. 46.3 1-.06, 697% -0.76.56% 60 1.03, 94% 0.66.64% 47.5 0.86,965% 0.99,73% 47.5 1.06, 91% 1.06. 66% 47.5 1.16.,86% 0.66.65% 47 0.66.61% 0.85.63% 47.6 1.00.868% 0.70,67% 46 1.64,62% 0.86.67% 46 0.97. 66% 0.64,66% 47 Cell Passage Number 46 46 48 50 52 54 5W 56 60 47 46 53 47 10'" vp/mt culture 6.7 6.7 5.8 3.6 5.2 4.4 3.0 3.6 5.4 5.6 t0r vp/cell 56 46 5.6 .4 87 100 TCl1ou/ml 1.72 t 38 t142 0.07 1.70 1.10 1.03 1.16 1.15 120 AEX:I2PA 50 46 41 40 31 62 43 31 45 52 Amplificaton AEX Ratio snternal Cntrol 470 (MOI 125) 170 200 170 310 175 3.12 2.6 100 2.70 2.60 110 2.70 2.70 200 2.6 2.60 210 3.18 3.16 160 3.26 3.27 2.61 Table 513: Amplification ratios determined by AEX and QPA for MRKHVE3 over several continuous passaging in serum free media. MRKHVE3 is the new vector backbone which does NOT carry a transgene.

P4

PC,

P6 P12 Xv (10, cells/m) Viability infection Harvest 1.10.67% 1.28,79% 0.569.88% 1.18, 7 7% 1.5.6% 126,76% 1. 09.67% 1-1.81% 1.17. 691% 1.T22.691 0.68. 88% 1.41.863% [1.20. 89% 1.26,81% 0.66.82% 1.55.86% 1.07.96% 1.25,683% 0.80, 6t% 1.14.80% -1.66,965% 1.14,-4 -85% 0.67, 6% 1.f03. 898% 0F87.669% 0.67, 59% Harvest Time tip.t.

49 47 485 47.5 475 48 46.5 455 MRKIIVE3 Cell Passage Titer Titer Number 101v vp/mt culture 100r vp/cell 4 41 3.6 48 4.3 4.

50 1.2 0.8 52 4.0 3.6 54 3.7 3.2 56 2.1 2.1 58 0.8 0.7 60 2.3 2.3 47 2.7 2.5 4 5.6 74 53 5.8 3.0 47 64 9.7 46 5.3 8.1

QPA

10'TC0 50 /ml 1.70 0.50 0.47 0.26 0.43 0.41 0.48 Ratie

AEX:QPA

25 35 21 34 74 45 28 53 123 Amplificaion AEX Ratio Internal Contro 300 (MOI 125) 178 136 116 75 3.12 2.64 25 2.70 2.60 80 2.70 2.70 go 2.86 2.60 260 3.18 3.18 110 3.28 3.27 350 3.12 2.61 218 2.78 2.52 48.5 j 46.5 A62783tiapeci 43 Table 5C. Amplification ratios determined by AEX and QPA for MRKAd5gag(E3-) over several continuous passaging in serum free media. This construct is identical to the MRKAd5gag construct except that this version is DELETED of the E3 gene.

MRKAd5gag(E3-) Xv (10 cells/ml), Viability Harvest Time Cell Passage Titer Titer QPA Ratio Amplification AEX Infection I Harvest h.p.I. Number 10 vp/ml culture 10 vp/cell 10' TCID/ml AEX:QPA Ratio Internal Control P4 1.62,77% 1.12,62% 47.5 46 2.0 1.2 0.92 20 100 (MOI=125) 1.16, 92% 0.62,43% 49 49 3.3 2.9 0.99 34 100 P6 1.71, 86% 0.20, 10% 49 50 47 2.7 1.70 28 100 P6 1.09.97% 0.63, 54% 49.5 52 5.4 5.0 1.76 31 180 P7 1.17, 91% 0.98. 72% 47.50 54 7.1 6.1 0.67 106 220 P8 0.98, 88% 0.77, 48% 48 56 3.1 3.2 0.66 47 115 3.12 2.84 P9 1.20, 89% 1.03, 72% 48 58 1.8 1.5 0.57 32 55 2.70 2.60 0.99. 82% 0.80, 62% 46.5 60 3.2 3.2 0 68 47 115 2.7 2.70 P11 1.07, 96% 0.98,70% 48.5 47 5.0 5.5 068 87 200 2.86 2.60 P12 0.80, 91% 0.67,59% 50 49 5.1 6.4 0.72 71 230 3.18 3.18 P13 1.96, 95% 0.91,59% 45.5 53 7.4 3.8 135 3.28 P14 0.97, 96% 0.81,74% 48 47 6.6 7.0 250 3.12 2.91 0.87, 99% 0.84. 56% 49 49 4.8 5.5 196 2.78 R I 1 2.52 EXAMPLE 14 Gag Expression Analysis of the Novel Constructs In vitro gag analysis of the MRK Ad5 HIV-1 gag and the original HIV-gag vectors (research and clinical lot) show comparable gag expression. The clinical lot shows only a slightly reduced gag expression level. The most noticeable difference is with the mCMV vector. This vector shows roughly 3 fold lower expression levels compared with the other vectors tested (which all contain hCMV promoters). The mCMV-FLgag with bGHpA assay was performed three times using different propagation and purification lots and it consistently exhibited weaker gag expression.

EXAMPLE Evaluation of MRK Ad5 HIV-1 gag and Other gag-Containing Adenovectors in Balb/c Mice Cohorts of 10 balb/c mice were vaccinated intramuscularly with escalating doses of MRK Ad5 HIV-1 gag, and the research and clinical lots of original Ad5HIV-1gag.

Serum samples were collected 3 weeks post dose 1 and analyzed by anti-p24 sandwich

ELISA.

Anti-p24 titers in mice that received MRK Ad5 HIV-1 gag (107 and 109 vp(viral particle) doses) were comparable (Figure 13) to those of the research lot of Ad5HIV-1 gag, for which much of the early rhesus data were generated on. These titers were also comparable when E3 is deleted (MRKAd5hCMVgagbGHpA(E3-)) or SPA is substituted for bGHpA terminator (MRKAd5 hCMV-gag-SPA or murine CMV promoter is A627836speci 44 used in place of hCMV (MRKAd5 mCMV-gag-bGHpA in the backbone.

The results shown in Table 7 indicate that the three other vectors in addition to the preferred vector, MRK Ad5 HIV-1 gag, are also capable of inducing strong anti-gag antibody responses in mice. Interestingly enough, while the mCMV-FLgag construct containing bGHpA and E3+ in an El parallel orientation showed lowest gag expression in the COS cell in vitro infection (Table 6) in comparison with the other vectors tested, it generated the greatest anti-gag antibody response this in vivo Balb/c study. Table 7 also shows a dose response in anti-gag antibody production in both the research and the clinical lot. As expected, the clinical lot shows reduced anti-gag antibody induction at each dosage level compared to the same dosage used for the research lot.

Table 6: In vitro analysis for gag expression in COS cells by Elisa assay.

Viral Vectorsa ug gag/4.8x10e5 COS/10e8 parts/48hr 1.40 Clinical lot Ad5gagc _1.28 Research lot Ad5gagd 1.32 MCMVFL-gagbGHpAe 0.42 a A 2 6 onm absorbance readings taken for viral particle determinations.

b MRKAd5gag was produced in serum free conditions and purified at c Clinical lot# Ad5gagFN0001 d Research Ad5FLgag lot# 6399 e mCMVFL-gagbGHpA was produced in serum free conditions and purified at A627836speci Table 7: mHIV020 Anti-p24 Ab Titers in Balb/c mice (n=10) vaccinated with various Adgag constructs and lots (3 week post dosel).

Group Vaccine Dose GMT SE upper SE lower ID (VP) 1 aMRKAd5gag 10^7 25600 5877 4780 2 10A9 409600 94028 76473 3 hCMV FL-gag bGHpA 10^7 7352 2077 1620 4 10^9 235253 59767 47659 hCMV FL-gag SPA 10^7 12800 9905 236 6 10^9 310419 99181 75165 7 bmCMV FL-gag bGHpA 10^7 44572 23504 15389 8 109 941014 239068 190636 9 ChCMV FL-gag bGHpA 10^7 3676 934 745 109 117627 17491 15227 11 research lot hCMV intronA FL-gag bGHpA 10^6 528 262 175 12 107 14703 5274 3882 13 108 58813 14942 11915 14 109 204800 53232 42250 clinical lot hCMVintronA FL-gag bGHpA 10^6 230 82 61 16 107 4222 3405 1138 17 "108 19401 3939 3274 18 109 89144 25187 19639 19 Naive none 93 7 6 *2x50 pL i.m. (quad) injections/animal P.l.s: Youil, Chen, Casimiro Vaccination: T. Toner, Q. Su Assay: M. Chen aThe structure of MRKAd5gag is: hCMVFL-gagbGHpA The same lot of used in this rodent study was used in the Rhesus monkey study (Tables 7 and 8).

bThe same lot of mCMVFL-gagbGHpA[E3+] used in the in vitro study (Table 6) ws used here.

CThis construct was designed by Volker Sandig. It contains a shorter version of the hCMV promoter than that used in the MRK constructs. The adenovector backbone is identical to the original backbone used in the original Adgag vector. Expression at 10e7 dose from this vector is 7 fold lower then the same dose of the MRKAd5gag and 4 fold lower than the research lot.

EXAMPLE 16 Comparison of Humoral and Cellular Responses Towards the Original Ad-gag Construct with the New MRK Ad5 HIV-1 gag in Rhesus Monkeys Cohorts of 3 rhesus monkeys were vaccinated intramuscularly with MRK HIV-1 gag or the clinical Ad5gag bulk at two doses, 1011 vp and 109 vp. Immunizations were conducted at week 0, 4, and 25. Serum and PBMC samples were collected at selected time points. The serum sample were assayed for anti-p24 Ab titers (using competitive based assay) and the PBMCs for antigen-specific IFN-gamma secretion following overnight stimulation with gag 20-mer peptide pool (via ELISpot assay).

The results shown in Table 8 indicate comparable responses with respect to the generation of anti-gag antibodies. The frequencies of gag-specific T cells in peripheral blood assummarized in Table 9 demonstrate a strong cellular immune response generated A627836speci 46 after a single dose with the new construct MIRK Ad5 HLV-1 gag. The responses are also boostable with second dose of the same vector. The vector is also able to induce CD8+ T cell responses (as evident by remaining spot counts after CD4+ depletion of PBMCs) which are responsible for cytotoxic activity.

Table 8 Anti-p24 antibody titers (in ntMU/mL) in rhesus macaques immunized with gagexpressing adenovectors (protocol HTV203) (NlVaccine. Pro Wk4 WkS Wkl12 Wk 16 Wk 20 Wk 25 Wk 28 10A11 vp 97N010 <10 118 5528 11523 7062 21997 ND 51593 97N1 16 <10 62 772 1447 1562 2174 ND 20029 98X007 <10 66 3353 6156 6845 3719 ND 24031 M RKAd5gag, IOA9 vp__ 97N120 <10 51 204 318 366 482 ND 6550 97N144 <10 18 118 274 706 888 ND 7136 98X008 <10 15 444 386 996 1072 ND 12851 Clinical Lot, IOAI I VP 97X001 <10 87 2579 4718 7174 7250 ND 69226 97N146 <10 72 3604 7380 7526 18906 ND 60283 98X009 <10 78 4183 3946 3124 6956 ND 26226 Clinical Lot, 10A9 97NO20 <10 <10 143 371 390 1821 ND 17177 97XO03 <10 <10 39 93 156 596 ND 2053 98XO12 <10 8 342 717 956 1558 IND 11861 (hCMV, bGHpA, E3+) b original Adsgag vector (hCMV/Intron A, bGHpA, Iot#FNOO01 IND, not determined Table 9. Number of gag-specific T cells per million peripheral blood mononuclear cells (PBMCs) in rhesus monkeys immunized with gag-expressing adenovectors. Also included are those frequencies in PBMCs depleted of CD4+ T cells. Grp 9 Vaccination Monkey ID 4W I T=6 Wkt I T=1I Wk 1 FIS Wk 1 T=0,4,25 wits IMda Gag H'I MedialI Gag H I Media IGag H IMedia IGag H __Me S1 -G H 1 MRKAd5gag lOAi 1 Vp 97N010 97N010(CD4-) 97N 116 97N1 16(CD4-) 98XO07 98X007(CD4-) 2 MRKAd5gag 97N,120 6 275 11 249 4 141 4 119 9 206 4 219 10"e Vp 97N120(CD4-) 11 170 0 85 0 75 1 219 97NI44 3 236 6 438 1 318 3 256 1 98 5 373 97N144(0D4-) 6 148 0 285 NED ND 0 625 98XO08 4 368 1 1090 3 891 4 673.3 473 5 735 QBX008(CD4-) 14 696 0 1175 0 391 4 84 3 Adsgag clinical lot 97X001 0 261 1 485 0 817 0 1220b 1 894 0 15858 lOAv I p 97X001(CD4-) 10 283 3 996 0 i010 a 1123 97N146 3 150 1 465 0 339 I 1272 3 1238 3 1785 97N146(CD4-) 6 133 0 370 0 854 0 971 98X009 0 93 3 339 3 559 0 896 1 384 0 1748 98X009(CD4-) 0 73 0 333 0 225 0 644 4 Ad5gag clinical lot 97N020 3 30 1 101 0 66 0 36 0 26 0 41 10^9 VP 97N020(CD4-) 10 29 0 15 0 1 0 16 97XO03 4 68 5 134 0 18 1 38 4 38 6 81 97X003(CD4-) 9 40 0 6 a 4 0 19 98X012 5 95 3 54 1 34 0 18 0 20 1 121 98X012(CD4-) 11 70 0 11 0 8 0 41 Naive 96R041 6e 1 0 0 0 0 0 0 1 0 053F 18 5 116 20 14 19 15 10 I5 24 9 Based on either 4xl0^5 or 2x1 0^5 cells per well (depending ont spot density) NED, not determined 'mock or no peptide control Pool of 20-aa peptides overlapping by 10 aa and encompassing the gag sequence A627836speci 47 The adenovectors described herein and, particularly, MRK Ad5 HIV-1 gag, represent very promising HIV-gag adenovectors with respect to their enhanced growth characteristics in both serum and, more importantly, in serum-free media conditions. In comparison with the current HIV-1 gag adenovector construct, MRK Ad5 HIV-1 gag shows a 5-10 fold increased amplification rate. We have shown that it is genetically stable at passage 21. This construct is able to generate significant cellular immune responses in vivo even at a relatively low dose of 1 0 9 vp. The potency of the construct is comparable to, if not better than the original HIV-lgag vector as shown in this rhesus monkey study.

EXAMPLE 17 CODON OPTIMIZED HIV-1 POL AND CODON OPTIMZED HIV-1 POL MODIFICATIONS The open reading frames for the various synthetic pol genes disclosed herein comprise coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase The protein sequence is based on that of Hxb2r, a clonal isolate of IIIB; this sequence has been shown to be closest to the consensus clade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico). The skilled artisan will understand after review of this specification that any available HIV-1 or HIV-2 strain provides a potential template for the generation of HIV pol DNA vaccine constructs disclosed herein. It is further noted that the protease gene is excluded from the DNA vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation. The design of the gene sequences for both wild-type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred ("humanized") codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12). As can be discerned by inspecting the codon usage in SEQ ID NOs: 1, 3, 5 and 7, the following codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which, as noted elsewhere in this specification, is hereby incorporated by reference. It is intended that the skilled artisan may use alternative versions of codon optimization or may omit this step when generating HIV pol vaccine constructs within the scope of the present invention. Therefore, the present invention also relates to non-codon optimized versions of DNA molecules and associated recombinant adenoviral HIV vaccines which encode the various wild type and modified forms of the A627836speci 48 HIV Pol protein disclosed herein. However, codon optimization of these constructs is a preferred embodiment of this invention.

A particular embodiment of this portion of the invention comprises codon optimized nucleotide sequences which encode wt-pol DNA constructs (herein, "wt-pol" or "wt-pol (codon optimized))" wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized "wild type" sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO: 1, the open reading frame being contained from an initiating Met residue at nucleotides 10-12 .to a termination codon from nucleotides 2560-2562. SEQ ID NO:1I is as follows:

AGATCTACCA

ATGGATGGCC

GAAATCTGCA

TACAACACCC

GACTTCAGGG

CACCCCGCTG

TTCTCTGTGC

AACAATGAGA

TCCCCTGCCA

CCTGACATTG

GGGCAGCACA

ACCCCTGACA

CCCGACAAGT

GACATCCAGA

GTGAGGCAGC

ACTGAGGAGG

GGGGTGTACT

CAGTGGACCT

AGGATGAGGG

ACCACTGAGT

GAGACCTGGG

TTTGTGAACA

GGGGCTGAGA

GGCTATGTGA

AAGACTGAGC

GTGACTGACT

GAGCTGGTGA

GTGCCTGCCC

ATCAGGAAGG

TGGCCCCCAT

CCATAGGTGAA

CTGAGATGGA

CTGTGTTTGC

AGCTGAACAA

GCCTGAAGAA

CCCTGGATGA

CCCCTGGCAT

TCTTCCAGTC

TGATCTACCA

GGACCAAGAT

AGAAGCACCA

GGACTGTGCA

AGCTGGTGGG

TGTGCAAGCT

CTGAGCTGGA

ATGACCCCTC

ACCAAATCTA

GGGCCCACAC

CCATTGTGAT

AGACCTGGTG

CCCCCCCCCT

CCTTCTATGT

CCAACAGGGG

TCCAGGCCAT

CCCAGTATGC

ACCAGATCAT

ACAAGGGCAT

TGCTGTTCCT

CTCCCCCATT GAGACTGTGC

GCAGTGGCCC

GAAGGAGGGC

CATCAAGAAG

GAGGACCCAG

GAAGAAGTCT

GGACTTCAGG

CAGGTACCAG

CTCCATGACC

GTACATGGAT

TGAGGAGCTG

GAAGGAGCCC

GCCCATTGTG

CAAGCTGAAC

GCTGAGGGGC

GCTGGCTGAG

CAAGGACCTG

CCAGGAGCCC

CAATGATGTG

CTGGGGCAAG

GACTGAGTAC

GGTGAAGCTG

GGATGGGGCT

CAGGCAGAAG

CTACCTGGCC

CCTGGGCATC

TGAGCAGCTG

TGGGGGCAAT

GGATGGCATT

CTGACTGAGG

AAAATCTCCA

AAGGACTCCA

GACTTCTGGG

GTGACTGTGC

AAGTACACTG

TACAATGTGC

AAGATCCTGG

GACCTGTATG

AGGCAGCACC

CCCTTCCTGT

CTGCCTGAGA

TGGGCCTCCC

ACCAAGGCCC

AACAGGGAGA

ATTGCTGAGA

TTCAAGAACC

AAGCAGCTGA

ACCCCCAAGT

TGGCAGGCCP

TGGTACCAGC

GCCAACAGGC

GTGGTGACCC

CTCCAGGACI

ATCCAGGCCC

ATCAAGAAGC

GAGCAGGTGC

GACAAGGCC(

CTGTGAAGCT

AGAAGATCAA

AGATTGGCCC

CCAAGTGGAG

AGGTGCAGCT

TGGATGTGGG

CCTTCACCAT

TGCCCCAGGG

AGCCCTTCAG

TGGGCTCTGA

TGCTGAGGTG

GGATGGGCTA

AGGACTCCTG

AAATCTACCC

TGACTGAGGT

TCCTGAAGGA

TCCAGAAGCA

TGAAGACTGG

CTGAGGCTGT

TCAAGCTGCC

CCTGGATCCC

TGGAGAAGGA

1 AGACCAAGCT

TGACTGACAC

CTGGCCTGGP.

AGCCTGATCP

SAGAAGGTGTT

ACAAGCTGG I AGGATGAGC7

GAAGCCTGGC

GGCCCTGGTG

CGAGAACCCC

GAAGCTGGTG

GGGCATCCCC

GGATGCCTAC

CCCCTCCATC

CTGGAAGGGC

GAAGCAGAAC

CCTGGAGATT

GGGCCTGACC

TGAGCTGCAC

GACTGTGAAT

TGGCATCAAG

GATCCCCCTG

GCCTGTGCAT

GGGCCAGGGC

CAAGTATGCC

GCAGAAGATC

CATCCAGAAG

TGAGTGGGAG

GCCCATTGTG

GGGCAAGGCT

CACCAACCAG

GGTGAACATT

LGTCTGAGTCT

LCCTGGCCTGG

GTCTGCTGGC

STGAGAAGTAC

A627836speci

CACTCCAACT

ATTGTGGCCT

TGCTCCCCTG

GCTGTGCATG

GAGACTGCCT

GACAATGGCT

AAGCAGGAGT

AAGGAGCTGA

GTGCAGATGG

GCTGGGGAGA

CAGATCACCA

AAGGGCCCTG

GACATCAAGG

GCTGGGGATG

NO:l).

GGAGGGCTAT

CCTGTGACAA.

GCATCTGGCA

TGGCCTCCGG

ACTTCCTGCT

CCAACTTCAC

TTGGCATCCC

AGAAGATCAT

CTGTGTTCAT

GGATTGTGGA

AGATCCAGAA

CCAAGCTGCT

TGGTGCCCAG

ACTGTGTGGC

GGCCTCTGAC

GTGCCAGCTG

GCTGGACTGC

CTACATTGAG

GAAGCTGGCT

TGGGGCCACA

CTACAACCCC

TGGGCAGGTG

CCACAACTTC

CATCATTGCC

CTTCAGGGTG

GTGGAAGGGG

GAGGAAGGCC

CTCCAGGCAG

49

TTCAACCTGC

AAGGGGGAGG

ACCCACCTGG

GCTGAGGTGA

GGCAGGTGGC

GTGAGGGCTG

CAGTCCCAGG

AGGGACCAGG

AAGAGGAAGG

ACAGACATCC

TACTACAGGG

GAGGGGGCTG

AAGATCATCA

GATGAGGACT

CCCCTGTGGT

CCATGCATGG

AGGGCAAGGT

TCCCTGCTGA

CTGTGAAGAC

CCTGCTGGTG

GGGTGGTGGA

CTGAGCACCT

GGGGCATCGG

AGACCAAGGA

ACTCCAGGAA

TGGTGATCCA

GGGACTATGG

AAAGCCCGGG

GGCTAAGGAG

GCAGGTGGAC

GATCCTGGTG

GACAGGCCAG

CATCCACACT

GGCTGGCATC

GTCCATGAAC

GAAGACAGCT

GGGCTACTCC

GCTCCAGAAG

CCCCCTGTGG

GGACAACTCT

CAAGCAGATG

CAGATCT (SEQ ID The open reading frame of the wild type poi construct disclosed as SEQ ID NO:1I contains 850 amino acids, disclosed herein as SEQ lID NO:2, as follows: Met Gly Ilie Ile Ile Giu Pro V'al Tyr Arg Ilie Asn Ser Gin Lys Trp Asn Tyr Lys Leu Tyr Ala Met Lys Ser Lys Leu His Gly Thr Tyr Phe Pro Asp His Giu Thr Asp Pro Ala Ala Asp Pro Ile Ser Pro Asp Ala Lys Lys Asn Pro Asp Ala Gin Gin Asp Leu Leu Pro Val Ile Gly Leu Giu Pro Gly Leu Ile Lys Lys Ala Ala Phe Tyr Ser Ile Giu Leu Pro Gin Gin Ile Thr Asn Ser Pro Vai Gly Asp Arg Gly Tyr Thr Asn Ser Vai Ile Arg Phe Pro Lys Lys Giu Arg Lys Lys Giu Pro Ser Thr Leu Phe Ile Val Met Ile Gly Trp Leu Ile Leu Vali Val Glu Asp Ile Vai Ile Giu Thr Gin Lys Ser Pro Leu Thr Tyr Gin Giy Trp Val Vai Arg Ile Ile Leu Giu Lys Cys Asn Lys Asp Lys Val Ser Pro Lys Gin His Leu Met Leu Giy Gin Pro Leu Ile Thr Gin Thr Pro Trp Phe Lys Pro Ile Gin Ile Tyr Arg Thr Giy Pro Lys Leu Leu Lys Ala Vai Trp Glu Tyr Arg Trp Lys Leu Asn Gly Leu Met Thr Thr Tyr Giu Leu Cys Thr Giu Glu Pro Pro Met Asn Lys Giu Ser Asp Asn Trp Giu Asp Lys Pro Giu Lys Asn Lys Giu Pro Ile Val Leu Giu Thr Leu Val Val Giu Giu Lys Pro Asp Ile Asp Leu Asp Trp Leu Giu Val Gin Lys Thr Lys Pro Vai Gin Thr Asp Thr Gly Phe Leu Giu Lys His Ser Ala Leu Al a His Lys Leu Giu Giu Val1 Asp Leu Val Phe Pro Ser Arg Tyr Giu Lys Pro Trp Ser Arg Giu Gly Gin Lys Giu Gly Phe Phe Giy Leu Arg Giy Pro Lys Vai Leu His Asp Thr Gin Gly Leu Val Gly Pro Lys Lys Ala Arg Ile Asp Lys Ile Al a Gin Giy Arg Gin Lys Val Ile Thr Giu Tyr Gin Giy Gin Trp Thr Tyr Gin Ile Tyr Gin Giu Pro Phe Lys Asn Leu Lys A627836spei Thr Gly Lys Tyr Ala Arg Met Arg Gly Gin Trp Glu Glu Lys Asn Arg Leu lie Asp Lys Gly Val Tyr Val Gly Leu Val Gin Lys Arg Tyr Lys Ala Ile Asp Phe Ala Ser Tyr Leu Gly Thr Phe Glu Arg Gln Gin Val Gin Lys Gly Leu His Val Glu Asp Ala Glu Thr Ala Asn Lys Val Gly Ile Arg Lys Asp Gly Thr Lys Trp Val Pro Glu Lys Ala Thr Ser Glu Asn Phe Ser Ala Ala Cys Ser Thr Ile Ala Pro Ile Gin Gly Gin Val Leu Ile Lys Glu Ala Thr Pro Trp Thr Asn Thr Ile Val Thr Lys Val Val Ile Tyr Asp Ser Glu Ser Lys Val Glu Gin Leu Asp Asn Trp Lys Glu Met His Thr His Gly Tyr Ala Tyr His Thr Cys Trp Gin Ser Ile Gly Met Ala Tyr Ser Thr Lys Tyr Tyr Leu Trp Lys Val Gin Met Val Lys Glu Pro Gly Leu Thr Leu Gin Glu Tyr Val Gly Arg Ile Gly Leu Ile Phe Asp Trp Gin Gin Val Ala Glu Arg Lys Val Ala Gin Phe Tyr Pro Ala Gly Leu Ala Tyr Leu Leu Asp Ile Ala Val Gin Glu Glu Leu Asn Ala Gly Val Phe Gly Leu Asp Gly Pro Gly Lys Lys Trp Leu Glu Lys Thr Leu Ala Val Ala Lys Asp Met Ala Val Gly Ala Leu Gly Gly Val Arg Ile Glu Gin Ser Glu Arg Asp Ile Leu Gin Val Thr Ala Asp Gin Leu Asn Trp Leu Lys Ala Ser Asp Lys Glu Lys Ser Ile Val Asp His Arg Lys Arg Gly Arg Asp Ala Thr Pro Ala Lys Phe Gly Thr Asp Gly Gin Val Val Ala Ser Cys .Cys Val Val Leu Asn Lys Glu Gin Asn Ile Gin Asn Ala Lys Cys His Thr Ile Thr Leu Tyr Tyr Thr Ser Ile Ile Pro Ser Gin Asp Asp Ser Ile Ile Ala Phe Gin Ser Ala Phe Val Ile Pro Val Ala Val Thr Glu Gin Trp Trp Val Val Asn Gly Ile Ile Ala Ala Asp Phe Lys Pro Leu Pro Gly Thr Glu Met Glu Lys Asp Thr Leu Val Lys Ala Asn Ser Lys Ile Tyr Asp Thr Gin Leu Gin Glu His Gly Glu Asn Cys Gly Val Ala Arg Gly Phe Asn His Arg Ile Lys Trp Ile Ile Ser Asp Ile Glu Pro Gin Gly Asn Lys Glu Ala Gin Lys Ile His Leu Gin Ile Ala Glu Trp Ala Gly Lys Leu Lys Ile Ile Lys Gln Ile Arg Val Val Thr Glu Leu Ala Arg Thr Val Gin Leu Gly Arg Glu Pro Leu Trp Val Thr Pro Thr Ile Glu Lys Gly Ala Gin Gly Asp Arg Gin Lys Ile Trp Trp Glu Ala Gly Glu Asn Pro Ile Ile Lys Lys Pro Lys Gin His Gly Val Val Pro Leu Thr Gly Thr Asn Pro Asn Asp Asp Glu Asp (SEQ ID NO:2).

The present invention especially relates to an adenoviral vector vaccine which comprises a codon optimized HIV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIV-1 pol (RT-RH- IN) activity of the expressed protein. Therefore, the present invention preferably relates to an adenoviral HIV-1 DNA pol-based vaccine wherein the construct is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least A627836speci partially, and preferably substantially, abolishes RT, RNase and/or IN activity. One type of HIV-1 pol mutant which is part and parcel of an adenoviral vector vaccine may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. To this end, an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4, Figures 17A-1 to 17A-3) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains. Therefore, an especially preferred exemplification is an adenoviral vaccine which comprises, in an appropriate fashion, a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1. An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol. Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.

Table 1 wt aa aa residue mutant aa enzyme function Asp 112 Ala RT Asp 187 Ala RT Asp 188 Ala RT Asp 445 Ala RNase H Glu 480 Ala RNase H Asp 500 Ala RNase H Asp 626 Ala IN Asp 678 Ala IN Glu 714 Ala IN A627836speci 52 It is preferred that point mutations be incorporated into the J.Apoi mutant adenoviral vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV- 1 Pol.

To this end, SEQ lID NO: 3 discloses the nucleotide sequence which codes for a codon optimized poi in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as "LApol":

AGATCTACCA

ATGGATGGCC

GAAATCTGCA

TACAACACCC

GACTTCAGGG

CACCCCGCTG

TTCTCTGTGC

AACAATGAGA

TCCCCTGCCA

CCTGACATTG

GGGCAGCACA

ACCCCTGACA

CCCGACAAGT

GACATCCAGA

TGGCCCCCAT CTCCCCCATT GAGACTGTGC

CCAAGGTGAA

CTGAGATGGA

CTGTGTTTGC

AGCTGAACAA

GCCTGAAGAA

CCCTGGATGA

CCC CTGGCAT

TCTTCCAGTC

TGATCTACCA

GGACCAAGAT

AGAAGCACCA

GGACTGTGCA

AGCTGGTGGG

GTGAGGCAGC TGTGCAAGCT ACTGACGAGG CTGAGCTGGA GGGGTGTACT ATGACCCCTC CAGTGGACCT ACCAAATCTA AGGATGAGGG GGGCCCACAC ACCACTGAGT CCATTGTGAT GAGACCTGGG AGACCTGGTG TTTGTGAACA CCCCCCCCCT GGGGCTGAGA CCTTCTATGT GGCTATGTGA CCAACAGGGG AAGACTGCCC TCCAGGCCAT GTGACTGCCT CCCAGTATGC GAGCTGGTGA ACCAGATCAT GTGCCTGCCC ACAAGGGCAT ATCAGGAAGG TGCTGTTCCT CACTCCAACT GGAGGGCTAT ATTGTGGCCT CCTGTGACAA TGCTCCCCTG GCATCTGGCA GCTGTGCATG TGGCCTCCGG 3CAGTGGCCC

GAAGGAGGGC

CATCAAGAAG

GAGGACCCAG

GAAGAAGTCT

GGACTTCAGG

CAGGTACCAG

CTCCATGACC

GTACATGGCT

TGAGGAGCTG

GAPGGAGCCC

GCCCATTGTG

CAAGCTGAAC

GCTGAGGGGC

GCTGGCTGAG

CAAGGACCTG

CCAGGAGCCC

CAATGATGTG

CTGGGGCAAG

GACTGAGTAC

GGTGAAGCTG

GGCTGGGGCT

CAGGCAGAAG

CTACCTGGCC

CCTGGGCATC

TGAGCAGCTG

TGGGGGCAAT

GGATGGCATT

GGCCTCTGAC

GTGCCAGCTG

GCTGGCCTGC

CTACATTGAG

CTGACTGAGG

AAAATCTCCA

A.AGGACTCCA

GACTTCTGGG

GTGACTGTGC

AAGTACACTG

TACAATGTGC

AAGATCCTGG

GCCCTGTATG

AGGCAGCACC

CCCTTCCTGT

CTGCCTGAGA

TGGGCCTCCC

ACCAAGGCCC

AACAGGGAGA

ATTGCTGAGA

TTCAAGAACC

AAGCAGCTGA

ACCCCCAAGT

TGGCAGGCCA

TGGTACCAGC

GCCAACAGGG

GTGGTGACCC

CTCCAGGACT

ATCCAGGCCC

ATCAAGAAGG

GAGCAGGTGG

GACAAGGCCC

TTCAACCTGC

AAGGGGGAGG

ACCCACCTGG

GCTGAGGTGA

CTGTGAAGCT(

k.GAAGATCAAC

AGATTGGCCC

CCAAGTGGAGC

PGGTGCAGCT

TGGCTGTGGG

CCTTCACCAT

TGCCCCAGGG

AGCCCTTCAG

TGGGCTCTGA

TGCTGAGGTG

GGATGGGCTA

AGGACTCCTG

AAATCTACCC

TGACTGAGGT

TCCTGAAGGA

TCCAGAAGCA

TGAAGACTGG

CTGAGGCTGT

TCAAGCTGCC

CCTGGATCCC

TGGAGAAGGA

AGACCAAGCT

TGACTGACAC

CTGGCCTGGA

AGCCTGATCA

AGAAGGTGTA

ACAAGCTGGT

AGGATGAGCA

CCCCTGTGGT

CCATGCATGG

AGGGCAAGGT

TCCCTGCTGA

3AAGCCTGGC

'GCCCTGGTG

CGAGAACCCC

GAAGCTGGTG

GGGCATCCCC

GGATGCCTAC

CCCCTCCATC

CTGGAAGGGC

GAAGCAGAAC

CCTGGAGATT

GGGCCTGACC

TGAGCTGCAC

GACTGTGAAT

TGGCATCAAG

GATCCCCCTG

GCCTGTGCAT

GGGCCAGGGC

CAAGTATGCC

GCAGAAGATC

CATCCAGAAG

TGAGTGGGAG

GCCCATTGTG

GGGCAAGGCT

CACCAACCAG

GGTGAACATT

GTCTGAGTCT

CCTGGCCTGG

GTCTGCTGGC

TGAGAAGTAC

GGCTAAGGAG

GCAGGTGGAC

GATCCTGGTG

GACAGGCCAG

A627836speci

GAGACTGCCT

GCCAATGGCT

AAGCAGGAGT

AAGGAGCTGA

GTGCAGATGG

GCTGGGGAGA

CAGATCACCA

AAGGGCCCTG

GACATCAAGG

GCTGGGGATG

NO:3).

ACTTCCTGCT

CCAACTTCAC

TTGGCATCCC

AGAAGATCAT

CTGTGTTCAT

GGATTGTGGA

AGATCCAGAA

CCAAGCTGCT

TGGTGCCCAG

ACTGTGTGGC

GAAGCTGGCT

TGGGGCCACA

CTACAACCCC

TGGGCAGGTG

CCACAACTTC

CATCATTGCC

CTTCAGGGTG

GTGGAAGGGG

GAGGAAGGCC

CTCCAGGCAG

53

GGCAGGTGGC

GTGAGGGCTG

CAGTCCCAGG

AGGGACCAGG

AAGAGGAAGG

ACAGACATCC

TACTACAGGG

GAGGGGGCTG

AAGATCATCA

GATGAGGACT

CTGTGAAGAC

CCTGCTGGTG

GGGTGGTGGC

CTGAGCACCT

GGGGCATCGG

AGACCAAGGA

ACTCCAGGAA

TGGTGATCCA

GGGACTATGG

AAAGCCCGGG

CATCCACACT

GGCTGGCATC

CTCCATGAAC

GAAGACAGCT

GGGCTACTCC

GCTCCAGAAG

CCCCCTGTGG

GGACAACTCT

CAAGCAGATG

CAGATCT (SEQ ID In order to produce the JA-pol-based adenoviral vaccines of the present invention, inactivation of the enzymatic functions was achieved by replacing a total of nine active site residues from the enzyme subunits with alanine side-chains. As shown in Table 1, all residues that comprise the catalytic triad of the polymerase, namely Asp 112, Aspl187, and Aspi 188, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989, Proc. Nati. Acad. Sci. 1989, 86: 4803-4807). Three additional mutations were introduced at Asp445, Glu480 and Asp500 to abolish RNase H activity (Asp55 1 was left unchanged in this 1A Pol construct), with each residue being substituted for an Ala residue, respectively (Davies, et al., 1991, Science 252:, 88-95; Schatz, et al., 1989, FEBS Lett. 257: 311-314; Mizrahi, et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353). HIV po1 integrase function was abolished through three mutations at Asp626, Asp678 and Glu7 14. Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, J. Virol. 69: 376-386; Leavitt, et al., 1993, J. Biol.

Chem. 268: 2113-2119). Amino acid residue Pro3 of SEQ ID NO:4 marks the start of the RT gene. The complete amino acid sequence of JA-Pol is disclosed herein as SEQ ID NO:4 and Figures 17A-1 to 17A-3, as follows: Met Gly Ile Ile Ile Giu Pro Val Tyr Arg Ile Ala Pro Met Asp Lys Ala Ser Lys Lys Lys Leu Asn His Pro Gly Asp Thr Ala Tyr Gin Phe Gin Ile Gly Leu Ile Lys Lys Ala Aia Phe Tyr Ser Ser Pro Val Gly Asp Arg Gly Tyr Thr Asn Ser Pro Lys Giu Pro Ser Thr Leu Phe Ile Val Met Ile Val Ile Giu Thr Gin Lys Ser Pro Leu Thr Giu Lys Cys Asn Lys Asp Lys Vai Ser Pro Lys Thr Gin Thr Pro Trp Phe Lys Pro Ile Gin Ile Vai Trp Giu Tyr Arg Trp Lys Leu Asn Giy Leu Pro Pro Met Asn Lys Giu Ser Asp Asn Trp Glu Vai Leu Giu Thr Leu Val Vai Giu Giu Lys Pro Lys Thr Lys Pro Val Gin Thr Asp Thr Gly Phe Leu Giu Giu Val Asp Leu Val Phe Pro Ser Arg Lys Giu Gly Phe Phe Giy *Leu Arg Gly Pro Lys Pro Lys Lys Aia Arg Ile Ala Lys Ile Aia Gin Gly Aen Pro Asp Ile Vai Ile Tyr Gin Tyr Met Ala Ala Leu Tyr Vai A627S36speci Ser Gin Lys Trp Asn Tyr Lys Leu Tyr Gly Thr Gin Trp Glu Glu Lys Asn Arg Leu Ile Asp Lys Gly Val Tyr Val Gly Leu Val Gin Lys Arg Tyr Lys Ala Ile Asp Phe Ala Asp His Giu Thr Asp Pro Ala Ala Asp Gin Gly Leu Gly Thr Phe Giu Arg Gin Gin Val1 Gin Lys Gly Leu His Val Giu Ala Ala Giu Thr Al a Asn Lys Val Gly Ile Arg Lys Leu Leu Pro Val Ile Gly Leu Giu Pro Trp Lys Thr Lys Trp Val Pro Giu Lys Ala Thr Ser Giu Asn Phe Ser Al a Al a Cys Ser Thr Ile Ala Pro Ile Gin Gly Gin Val1 Leu Giu Leu Pro Gin Gin Ile Thr Asn Ser Thr Tyr Glu Thr Trp Asn Ile Thr Val Ile Ala Giu Lys Giu Leu Asn Lys Met Thr Gly Ala His Cys Gin Ile Met Tyr Thr Tyr Leu Ile Arg Phe Pro Lys Lys Giu Arg Lys Tyr Ala Ala Pro Thr Thr Val Lys Val Tyr Ser Ser Val1 Gin Asp Trp Giu His His Tyr Tyr Thr Trp Ser Gly Al a Ser Lys Tyr Trp Gly Trp Leu Ile Leu Val Val1 Giu Asp Gin Arg Val Lys Giu Pro Gly Leu Thr Leu Gin Giu Tyr Val Gly Arg Ile Gly Leu Ile Phe Al a Trp Gin Gin Val Al a Giu Arg Lys Gin Gly Trp Val Val Arg Ile Ile Leu Ile Met Gin Phe Tyr Pro Ala Gly Leu Ala Tyr Leu Leu Asp Ile Ala Val Gin Giu Giu Leu Asn Al a Gly Val Phe Gly Leu Asp Gly His Leu Met Leu Gly Gin Pro Leu Ile Tyr Arg Lys Lys Trp Leu Giu Lys Thr Leu Al a Val Ala Lys Asp Met Ala Val Giy Ala Leu Gly Gly Val Arg Ile Giu Gin Ser Giu Arg Thr Gly Pro Lys Leu Leu Lys Ala Gin Gly Ile Leu Gin Val Thr Ala Asp Gin Leu Asn Trp Leu Lys Ala Ser Asp Lys Giu Lys Ser Ile Val Asp His Arg Lys Arg Gly Thr Lys Thr Pro Tyr Giu Giu Lys Leu Asn Cys Lys Thr Giu Giu Pro Giu Ile Giu Pro Ala His Thr Thr Pro Ile Ala Thr Lys Leu Phe Tyr Gly Tyr Thr Thr Asp Ser Gly Ile Gin Ile Val Pro Val Ser Ala Gin Ser Asp Cys Asp Cys Ser Val Ile Val Ile Leu Ala Asn Phe Lys Gin Ala Ser Gin Ala Asn Phe Ile Val Gin Ile Asn Pro Ala Val Ile Asp Leu Asp Trp Leu Giu Val Gin Phe Thr Giu Gin Trp Trp Val Val Asn Gly Ile Ile Ala Ala Asp Phe Lys Pro Leu Pro Gly Thr Giu Met Giu Lys Asp Thr Leu Val1 Giu Lys His Ser Al a Leu Ala His Lys Lys Asn Ser Lys Ile Tyr Al a Thr Gin Leu Gin Giu His Gly Giu Asn Cys Gly Val Ala Arg Gly Phe Asn His Arg Ile Lys Trp Ile Giu Leu Lys His Pro Asp Trp Thr Ser Gin Arg Gly Giu Leu Gly Val Gin Gly Asn Leu Asp Val Ile Val Giu Thr Pro Giu Gin Leu Gly Ala Asn Arg Lys Thr Giu Val Ala Gin Gin Leu Lys Gly Ile Arg His Giu Leu Pro Gin Leu Ile Trp Ala Val Giu Thr Trp Pro Ala Thr Gly Ile Lys Giu Leu Lys Lys Gly Ile Ala Ile Gin Lys Gly Gin Asp Arg Gin Lys Val1 Ile Thr Giu Tyr Gin Lys Lys Ile Trp Trp Giu Ala Gly Ala Asn Pro Ile Ile Lys Lys Pro Lys Gin His Gly Val Val Pro Leu Thr Gly Thr Asn Pro Asn A627836speci Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO:4).

As noted above, it will be understood that any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based adenoviral HIV vaccine of the present invention, either when administered alone or in a combined modality regime and/or a prime-boost regimen. For example, it may be possible to mutate only 2 of the 3 residues within the respective reverse transcriptase, RNase H, and integrase coding regions while still abolishing these enzymatic activities. However, the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4;) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.

Another aspect of this portion of the invention are codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides.

Any functional leader peptide may be tested for efficacy. However, a preferred embodiment of the present invention, as with HIV-1 Nef constructs shown herein, is to provide for a HIV-1 Pol mutant adenoviral vaccine construction wherein the pol coding region or a portion thereof is operatively linked to a leader peptide, preferably a leader peptide from human tPA. In other words, a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. As noted in Figure 16A-B, a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Pol protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Pol protein of interest, including but not limited to a HIV-1 Pol protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO: 17). Therefore, another aspect of the present invention is to generate HIV-1 Polbased vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA. To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted A627836speci 56 and a human tPA leader sequence is fused to the 5' end of the coding region. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ lID NO:6.

To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fuised to the 5' end of the coding region herein, "tPA-wtpo1"). A DNA molecule which encodes this protein is disclosed herein as SEQ ID the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635. SEQ ID NO:5 is as follows: GATCACCATG GATGCAATGA CTTCGTTTCG CCCAGCGAGA GCTGAAGCCT GGCATGGATG CAAGGCCCTG GTGGAAATCT CCCCGAGAAC CCCTACAACA GAGGAAGCTG GTGGACTTCA GCTGGGCATC CCCCACCCCG GGGGGATGCC TACTTCTCTG CATCCCCTCC ATCAACAATG GGGCTGGAAG GGCTCCCCTG CAGGAAGCAG AACCCTGACA TGACCTGGAG ATTGGGCAGC GTGGGGCCTG ACCACCCCTG CTATGAGCTG CACCCCGACA CTGGACTGTG AATGACATCC CCCTGGCATC AAGGTGAGGC GGTGATCCCC CTGACTGAGG GGAGCCTGTG CATGGGGTGT GCAGGGCCAG GGCCAGTGGA TGGCAAGTAT GCCAGGATGA TGTGCAGAAG ATCACCACTG GCCCATCCAG AAGGAGACCT CCCTGAGTGG GAGTTTGTGA GGAGCCCATT GTGGGGGCTG GCTGGGCAAG GCTGGCTATG CACCACCAAC CAGAAGACTG GGAGGTGAAC ATTGTGACTG TCAGTCTGAG TCTGAGCTGG GTACCTGGCC TGGGTGCCTG

AGAGAGGGCT

TCTCCGCCCC

GCCCCAAGGT

GCACTGAGAT

CCCCTGTGTT

GGGAGCTGAA

CTGGCCTGAA

TGCCCCTGGA

AGACCCCTGG

CCATCTTCCA

TTGTGATCTA

ACAGGACCAA

ACAAGAAGCA

AGTGGACTGT

AGAAGCTGGT

AGCTGTGCAA

AGGCTGAGCT

ACTATGACCC

CCTACCAAAT

GGGGGGCCCA

AGTCCATTGT

GGGAGACCTG

ACACCCCCCC

AGACCTTCTA

TGACCAACAG

AGCTCCAGGC

ACTCCCAGTA

TGAACCAGAT

CCCACAAGGG

CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT

CATCTCCCCC

GAAGCAGTGG

GGAGAAGGAG

TGCCATCAAG

CAAGAGGACC

GAAGAAGAAG

TGAGGACTTC

CATCAGGTAC

GTCCTCCATG

CCAGTACATG

GATTGAGGAG

CCAGAAGGAG

GCAGCCCATT

GGGCAAGCTG

GCTGCTGAGG

GGAGCTGGCT

CTCCAAGGAC

CTACCAGGAG

CACCAATGAT

GATCTGGGGC

GTGGACTGAG

CCTGGTGAAG

TGTGGATGGG

GGGCAGGCAG

CATCTACCTG

TGCCCTGGGC

CATTGAGCAG

CATTGGGGGC

ATTGAGACTG

CCCCTGACTG

GGCAAAATCT

AAGAAGGACT

CAGGACTTCT

TCTGTGACTG

AGGAAGTACA

CAGTACAATG

ACCAAGATCC

GATGACCTGT

CTGAGGCAGC

CCCCCCTTCC

GTGCTGCCTG

AACTGGGCCT

GGCACCAAGG

GAGAACAGGG

CTGATTGCTG

CCCTTCAAGA

GTGAAGCAGC

AAGACCCCCA

TACTGGCAGG

CTGTGGTACC

GCTGCCAACA

AAGGTGGTGA

GCCCTCCAGG

ATCATCCAGG

CTGATCAAGA

AATGAGCAGG

TGCCTGTGAA

PkGGAGAAGAT

CCAAGATTGG

CCACCAAGTG

GGGAGGTGCA

TGCTGGATGT

CTGCCTTCAC

TGCTGCCCCA

TGGAGCCCTT

ATGTGGGCTC

ACCTGCTGAG

TGTGGATGGG

AGAAGGACTC

CCCAAATCTA

CCCTGACTGA

AGATCCTGAA

AGATCCAGAA

ACCTGAAGAC

TGACTGAGGC

AGTTCAAGCT

CCACCTGGAT

AGCTGGAGAA

GGGAGACCAA

CCCTGACTGA

ACTCTGGCCT

CCCAGCCTGA

AGGAGAAGGT

TGGACAAGCT

GGTGTCTGCT GGCATCAGGA AGGTGCTGTT CCTGGATGGC ATTGACAAGG CCCAGGATGA A627836speci

GCATGAGAAG

GGTGGCTAAG

TGGGCAGGTG

GGTGATCCTG

TGAGACAGGC

GACCATCCAC

GTGGGCTGGC

GGAGTCCATG

CCTGAAGACA

CGGGGGCTAC

GGAGCTCCAG

GAACCCCCTG

CCAGGACAAC

TGGCAAGCAG

TACCACTCCA

GAGATTGTGG

GACTGCTCCC

GTGGCTGTGC

CAGGAGACTG

ACTGACAATG

ATCAAGCAGG

AACAAGGAGC

GCTGTGCAGA

TCCGCTGGGG

AAGCAGATCA

TGGAAGGGCC

TCTGACATCA

ATGGCTGGGG

ACTGGAGGGC

CCTCCTGTGA

CTGGCATCTG

ATGTGGCCTC

CCTACTTCCT

GCTCCAACTT

AGTTTGGCAT

TGAAGAAGAT

TGGCTGTGTT

AGAGGATTGT

CCAAGATCCA

CTGCCAAGCT

AGGTGGTGCC

ATGACTGTGT

57

TATGGCCTCT

CAAGTGCCAG

GCAGCTGGAC

CGGCTACATT

GCTGAAGCTG

CACTGGGGCC

CCCCTACAAC

CATTGGGCAG

CATCCACAAC

GGACATCATT

GAACTTCAGG

GCTGTGGAAG

CAGGAGGAAG

GGCCTCCAGG

GACTTCAACC TGCCCCCTGT

CTGAAGGGGG

TGCACCCACC

GAGGCTGAGG

GCTGGCAGGT

ACAGTGAGGG

CCCCAGTCCC

GTGAGGGACC

TTCAAGAGGA

GCCACAGACA

GTGTACTACA

GGGGAGGGGG

GCCAAGATCA

CAGGATGAGG

AGGCCATGCA

TGGAGGGCAA

TGATCCCTGC

GGCCTGTGAA

CTGCCTGCTG

AGGGGGTGGT

AGGCTGAGCA

AGGGGGGCAT

T CCAGACCAA

GGGACTCCAG

CTGTGGTGAT

TCAGGGACTA

ACTAAAGCCC

GGGCAGATCT (SEQ ID The open reading frame of the wild type tPA-pol construct disclosed as SEQ ID contains 875 amino acids, disclosed herein as SEQ ED NO:6, as follows: Met Ala Giu Lys Cys Asn Lys Asp Lys Val1 Ser Pro Lys Gin His Leu Met Leu Giy Gin Pro Leu Asp Ala Met Val Phe Val Thr Val Pro Gin Trp Pro Thr Giu Met Pro Tyr Asn Trp Arg Lys Phe Trp Giu Lys Lys Ser Pro Leu Asp Ile Asn Asn Gin Gly Trp Ile Leu Giu Tyr Met Asp Arg Thr Lys Thr Thr Pro Gly Tyr Glu Pro Giu Lys Lys Leu Asn Leu Cys Lys Leu Thr Giu Lys Giu Pro Lays Ser Val Leu Giu Thr Leu Val Vai Giu Giu Lys Pro Asp Ile Asp Leu Asp Trp Leu Giu Val Arg Pro Lys Thr Lys Pro Val Gin Thr Asp Thr Giy Phe Leu Giu Lys His Ser Al a Leu Al a His Gly Ser Leu Giu Giu Val Asp Leu Val Phe Pro Ser Arg Tyr Giu Lys Pro Trp Ser Arg Giu Gly Leu Giu Lys Giu Gly Phe Phe Giy Leu Arg Giy Pro Lys Val Leu His Asp Thr Gin Gly Leu Val Cys Ile Pro Lys Lys Al a Arg Ile Asp Lys Ile Ala Gin Gly Arg Gin Lys Val Ile *Thr *Giu Tyr Cys Ser Gly Ile Ile Ile Giu Pro Val Tyr Arg Ile Asn Ser Gin Lys Trp Asn Tyr Lys Leu Tyr Val Leu Leu Al a Met Lys Ser Lys Leu His Gly Thr Tyr Phe Pro Asp His Giu Thr Asp Pro Al a Ala Asp Pro Asp Al a Lys Lys Asn Pro Asp Ala Gin Gin Asp Leu Leu Pro Val Ile Gly Leu Giu Pro Ile Gly Leu Ile Lys Lys Ala Ala Phe Tyr Ser Ile Giu Leu Pro Gin Gin Ile Thr Asn Sezt Leu Ser Pro Val Gly Asp Arg Gly Tyr Thr Asn Ser Val Ile *Arg Phe *Pro Lys Lys *Giu Arg Lys Cys Pro Lys Giu Pro Ser Thr Leu Phe Ile Val Met Ile Gly Trp Leu Ile Leu Val Val Giu Asp Gly Ile Val Ile Giu Thr Gin Lys Ser Pro Leu Thr Tyr Gin Gly Trp Val Val Arg Ile Ile Leu A627836speci Ile Ala Glu Ile Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin Ile Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr Glu Leu Gin Ala Ile Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn Ile Val Thr Asp Ser Gin Tyr Ala Leu Gly Ile Ile Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin Ile Ile Glu Gin Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly Ile Trp Gin Leu Asp Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gin Glu Phe Gly Ile Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gin Val Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gin Thr Lys Glu Leu Gin Lys Gin Ile Thr Lys Ile Gin Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gin Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO:6).

The present invention also relates to a codon optimized HIV-1 Pol mutant contained within a recombinant adenoviral vector such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. Any such adenoviral-based HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide A627836speci 59 including but not limited to the human tPA leader sequence. Therefore, any such leader peptide-based HIV-lI poi mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HIV- 1 Pol. In a preferred embodiment of this portion of the invention, a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1I DNA poi construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HIV- 1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA- Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in Figure 18. The complete amino acid sequence of the expressed protein is set forth in SEQ ID NO:8. To this end, SEQ ID NO:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, "tPA-opt-IApol'). The open reading frame begins with the initiating Met (nucleotides 8- 10) and terminates with a "TAA' codon at nucleotides 2633-2635. The nucleotide sequence encoding tPA-IAPol is also disclosed as follows: GATCACCATG GATGCAATGA CTTCGTTTCG CCCAGCGAGA GCTGAAGCCT GGCATGGATG CAAGGCCCTG GTGGAAATCT CCCCGAGAAC CCCTACAACA GAGGAAGCTG GTGGACTTCA GCTGGGCATC CCCCACCCCG GGGGGATGCC TACTTCTCTG CATCCCCTCC ATCAACAATG GGGCTGGAAG GGCTCCCCTG CAGGAAGCAG AACCCTGACA TGACCTGGAG ATTGGGCAGC GTGGGGCCTG ACCACCCCTG CTATGAGCTG CACCCCGACA CTGGACTGTG AATGACATCC CCCTGGCATC AAGGTGAGGC

AGAGAGGGCT

TCTCCGCCCC

GCCCCAAGGT

GCACTGAGAT

CCCCTGTGTT

GGGAGCTGAA

CTGGCCTGAA

TGCCCCTGGA

AGACCCCTGG

CCATCTTCCA

TTGTGATCTA

ACAGGACCAA

ACAAGAAGCA

AGTGGACTGT

AGAAGCTGGT

AGCTGTGCAA

CTGCTGTGTG

CATCTCCCCC

GAAGCAGTGG

GGAGAAGGAG

TGCCATCAAG

CAAGAGGACC

GAAGAAGAAG

TGAGGACTTC

CATCAGGTAC

GTCCTCCATG

CCAGTACATG

GATTGAGGAG

CCAGAAGGAG

GCAGCCCATT

GGGCAAGCTG

GCTGCTGAGG

CTGCTGCTGT

ATTGAGACTG

CCCCTGACTG

GGCAAAATCT

AAGAAGGACT

CAGGACTTCT

TCTGTGACTG

AGGAAGTACA

CAGTACAATG

ACCAAGATCC

GCTGCCCTGT

CTGAGGCAGC

CCCCCCTTCC

GTGCTGCCTG

AACTGGGCCT

GGCACCAAGG

GTGGAGCAGT

TGCCTGTGAA

AGGAGAAGAT

CCAAGATTGG

CCACCAAGTG

GGGAGGTGCA

TGCTGGCTGT

CTGCCTTCAC

TGCTGCCCCA

TGGAGCCCTT

ATGTGGGCTC

ACCTGCTGAG

TGTGGATGGG

AGAAGGACTC

CCCAAATCTA

CCCTGACTGA

A627836speci

GGTGATCCCC

GGAGCCTGTG

GCAGGGCCAG

TGGCAAGTAT

TGTGCAGAAG

GCCCATCCAG

CCCTGAGTGG

GGAGCCCATT

GCTGGGCAA.G

CACCACCAAC

GGAGGTGAAC

TCAGTCTGAG

GTACCTGGCC

GGTGTCTGCT

GCATGAGAAG

GGTGGCTAAG

TGGGCAGGTG

GGTGATCCTG

TGAGACAGGC

GACCATCCAC

GTGGGCTGGC

GGCCTCCATG

CCTGAAGACA

CGGGGGCTAC

GGAGCTCCAG

GAACCCCCTG

CCAGGACAAC

TGGCAAGCAG

CTGACTGAGG

CATGGGGTGT

GGCCAGTGGA

GCCAGGATGA

ATCACCACTG

AAGGAGACCT

GAGTTTGTGA

GTGGGGGCTG

GCTGGCTATG

CAGAAGACTG

ATTGTGACTG

TCTGAGCTGG

TGGGTGCCTG

GGCATCAGGA

TACCACTCCA

GAGATTGTGG

GACTGCTCCC

GTGGCTGTGC

CAGGAGACTG

ACTGCCAATG

ATCAAGCAGG

AACAAGGAGC

GCTGTGCAGA

TCCGCTGGGG

AAGCAGATCA

TGGAAGGGCC

TCTGACATCA

ATGGCTGGGG

AGGCTGAGCT

ACTATGACCC

CCTACCAAAT

GGGGGGCCCA

AGTCCATTGT

GGGAGACCTG

ACACCCCCCC

AGACCTTCTA

TGACCAACAG

CCCTCCAGGC

CCTCCCAGTA

TGAACCAGAT

CCCACAAGGG

AGGTGCTGTT

ACTGGAGGGC

CCTCCTGTGA

CTGGCATCTG

ATGTGGCCTC

CCTACTTCCT

GCTCCAACTT

AGTTTGGCAT

TGAAGAAGAT

TGGCTGTGTT

AGAGGATTGT

CCAAGATCCA

CTGCCAAGCT

AGGTGGTGCC

ATGACTGTGT

GGAGCTGGCT

CTCCAAGGAC

CTACCAGGAG

CACCAATGAT

GATCTGGGGC

GTGGACTGAG

CCTGGTGAAG

TGTGGCTGGG

GGGCAGGCAG

CATCTACCTG

TGCCCTGGGC

CATTGAGCAG

CATTGGGGGC

CCTGGATGGC

TATGGCCTCT

CAAGTGCCAG

GCAGCTGGCC

CGGCTACATT

GCTGAAGCTG

CACTGGGGCC

CCCCTACAAC

CATTGGGCAG

CATCCACAAC

GGACATCATT

GAACTTCAGG

GCTGTGGAAG

CAGGAGGAAG

GGCCTCCAGG

GAGAACAGGG

CTGATTGCTG

CCCTTCAAGA

GTGAAGCAGC

AAGACCCCCA

TACTGGCAGG

CTGTGGTACC

GCTGCCAACA

AAGGTGGTGA

GCCCTCCAGG

ATCATCCAGG

CTGATCAAGA

AATGAGCAGG

ATTGACAAGG

GACTTCAACC

CTGAAGGGGG

TGCACCCACC

GAGGCTGAGG

GCTGGCAGGT

ACAGTGAGGG

CCCCAGTCCC

GTGAGGGACC

TTCAAGAGGA

GCCACAGACA

GTGTACTACA

GGGGAGGGGG

GCCAAGATCA

CAGGATGAGG

AGATCCTGAA

AGATCCAGAA

ACCTGAAGAC

TGACTGAGGC

AGTTCAAGCT

CCACCTGGAT

AGCTGGAGAA

GGGAGACCAA

CCCTGACTGA

ACTCTGGCCT

CCCAGCCTGA

AGGAGAAGGT

TGGACAAGCT

CCCAGGATGA

TGCCCCCTGT

AGGCCATGCA

TGGAGGGCAA

TGATCCCTGC

GGCCTGTGAA

CTGCCTGCTG

AGGGGGTGGT

AGGCTGAGCA

AGGGGGGCAT

TCCAGACCAA

GGGACTCCAG

CTGTGGTGAT

TCAGGGACTA

ACTAAAGCCC

I GGGCAGATCT (SEQ ID NO:7).

The open reading frame of the tPA-IA-pol construct disclosed as SEQ BID NO:7 contains 875 amino acids, disclosed herein as tPA-LA-Pol and SEQ ID NO:8, as follows: Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile Giu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Giy Pro Lys.Val Lys Gin Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Giu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg Giu Leu Asn Lys Arg Thr Gin Asp Phe Trp Giu Val Gin Leu Gly Ile Pro His Pro Ala Gly Leu Lys A627836speci 61 Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gin Tyr Asn Val Leu Pro Gin Gly Trp Lys Gly Ser Pro Ala Ile Phe Gin Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gin Asn Pro Asp Ile Val Ile Tyr Gin Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gin His Arg Thr Lys Ile Glu Glu Leu Arg Gin His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gin Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gin Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gin Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gin Ile Tyr Pro Gly Ile Lys Val Arg Gin Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gin Lys Gin Gly Gin Gly Gin Trp Thr Tyr Gin Ile Tyr Gin Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys Gin Leu Thr Glu Ala Val Gin Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gin Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gin Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gin Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gin Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gin Lys Thr Ala Leu Gin Ala Ile Tyr Leu Ala Leu Gin Asp Ser Gly Leu Glu Val Asn Ile Val Thr Ala Ser Gin Tyr Ala Leu Gly Ile Ile Gin Ala Gin Pro Asp Gin Ser Glu Ser Glu Leu Val Asn Gin Ile Ile Glu Gin Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gin Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gin Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gin Leu Lys Gly Glu Ala Met His Gly Gin Val Asp Cys Ser Pro Gly Ile Trp Gin Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly Gin Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gin Glu Phe Gly Ile Pro Tyr Asn Pro Gin Ser Gin Gly Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gin Val A627836speci 62 Arg Asp Gin Ala Glu His Leu Lys Thr Ala Val Gin Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gin Thr Lys Glu Leu Gin Lys Gin Ile Thr Lys Ile Gin Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gin Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gin Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gin Asp Glu Asp (SEQ ID NO:8).

EXAMPLE 18 CODON OPTIMIZED HIV-1 NEF AND CODON OPTIMIZED HIV-1 NEF MODIFICATIONS Codon optimized version of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. Application Serial No. 09/738,782, filed December 15, 2000 and PCT International Application PCT/US00/34162, also filed December 15, 2000, both documents which are hereby incorporated by reference. As disclosed within the above-mentioned documents, particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO:10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH2-terminus of the HIV-1 Nefpolypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:11, while the expressed open reading frame is disclosed herein as SEQ ID NO:12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:13, while the expressed open reading frame is disclosed herein as SEQ ID NO:14. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is A627836speci 63 disclosed herein as SEQ ID NO: 15, while the expressed open reading frame is disclosed herein as SEQ ID NO: 16.

As disclosed in the above-identified documents Application Serial No.

09/738,782 and PCT International Application PCT/USOO/34 162) and reiterated herein, the following nef-based nucleotide and amino acid sequences which comprise the respective open reading frame are as follows: 1 The nucleotide sequence of the codon optimized version of HIV- I jrfi nef gene is disclosed herein as GATCTGCCAC CATGGGCGGC GGGAGAGGAT GAGGAGGGCC CCGTGGGCGT GGGCGCCGTG ACACCGCCGC CACCAACGCC GCTTCCCCGT GAGGCCCCAG TGTCCCACTT CCTGAAGGAG AGGACATCCT GGACCTGTGG ACACCCCCGG CCCCGGCATC CCGTGGAGCC CGAGAAGGTG CCATGTCCCA GCACGGCATC CCAAGCTGGC CTTCCACCAC SEQ ID NO:9, as shown herein:

AAGTGGTCCA

GAGCCCGCCG

TCCAGGGACC

GACTGCGCCT

GTGCCCCTGA

AAGGGCGGCC

GTGTACCACA

AGGTTCCCCC

GAGGAGGCCA

GAGGACCCCG

GTGGCCAGGG

AGAGGTCCGT GCCCGGCTGG TCCACCGTGA

CCGACAGGGT

TGGAGAAGCA

GGCTGGAGGC

GGCCCATGAC

TGGAGGGCCT

CCCAGGGCTA

TGACCTTCGG

ACGAGGGCGA

AGAAGGAGGT

AGCTGCACCC

GAGGAGGACC

CGGCGCCATC

CCAGGAGGAC

CTACAAGGGC

GATCCACTCC

CTTCCCCGAC

CTGGTGCTTC

GAACAACTGC

GCTGGAGTGG

CGAGTACTAC

GAGCCCGCCG

ACCTCCTCCA

GAGGAGGTGG

GCCGTGGACC

CAGAAGAGGC

TGGCAGAACT

AAGCTGGTGC

CTGCTGCACC

AGGTTCGACT

AAGGACTGCT

AAAGCCCGGG C (SEQ ID NO:9).

Preferred codon usage is as follows: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mamnmalian (human) codon optimization, see WO 97/31115 (PCT/US97/022 94), which is hereby incorporated by reference. See also Figures 19A-1 to 19A-2 for a comparison of wild type vs. codon optimized nucleotides comprising the open reading frame of HIV-Nef.

The open reading frame for SEQ ID NO:9 above comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660-662. The open reading frame of SEQ ID NO:9 provides for a 216 amino acid HLV-1 Nef protein expressed through utilization of a codon optimized DNA vaccine vector. The 216 amino acid HIV-lI Nef 0 frl) protein is disclosed herein as SEQ ID NO: 10, and as follows: Met Gly Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser .Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gin Glu Asp Glu Glu Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp A627836speci 64 Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His Ser Gin Lys Arg Gin Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gin Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His Pro Met Ser Gin His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID HIV-1 Nef is a 216 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2 (Franchini et al., 1986, Virology 155: 593-599). While not all possible Nef functions have been elucidated, it has become clear that correct trafficking of Nef to the inner plasma membrane promotes viral replication by altering the host intracellular environment to facilitate the early phase of the HIV-1 life cycle and by increasing the infectivity of progeny viral particles. In one aspect of the invention regarding codon-optimized, protein-modified polypeptides, the nef-encoding region of the adenovirus vector of the present invention is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide. The diversity of function that typifies eukaryotic cells depends upon the structural differentiation of their membrane boundaries. To generate and maintain these structures, proteins must be transported from their site of synthesis in the endoplasmic reticulum to predetermined destinations throughout the cell. This requires that the trafficking proteins display sorting signals that are recognized by the molecular machinery responsible for route selection located at the access points to the main trafficking pathways. Sorting decisions for most proteins need to be made only once as they traverse their biosynthetic pathways since their final destination, the cellular location at which they perform their function, becomes their permanent residence. Maintenance of intracellular integrity depends in part on the selective sorting and accurate transport of proteins to their correct destinations. Defined sequence motifs exist in proteins which can act as 'address labels'.

A number of sorting signals have been found associated with the cytoplasmic domains of membrane proteins. An effective induction of CTL responses often required sustained, high level endogenous expression of an antigen. As membrane-association via myristylation is an essential requirement for most of Nefs function, mutants lacking myristylation, by glycine-to-alanine change, change of the dileucine motif and/or by substitution with a tpa leader sequence as described herein, will be functionally defective, and therefore will have improved safety profile compared to wild-type Nef for use as an HIV-1 vaccine component.

In another embodiment of this portion of the invention, either the DNA vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific A627836speci plasminogen activator (tPA) leader. As shown in Figure 16A-B, a DNA vector may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Nefprotein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Nef protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Nef protein of interest, including but not limited to a HIV-1 Nef protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO:17).

It has been shown that myristylation of Gly-2 in conjunction with a dileucine motif in the carboxy region of the protein is essential for Nef-induced down regulation of CD4 (Aiken et al., 1994, Cell 76: 853-864) via endocytosis. It has also been shown that Nef expression promotes down regulation of MHCI (Schwartz et al., 1996, Nature Medicine 338-342) via endocytosis. The present invention relates in part to DNA vaccines which encode modified Nef proteins altered in trafficking and/or functional properties. The modifications introduced into the adenoviral vector HIV vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell. Therefore, a central theme of the DNA molecules and recombinant adenoviral HIV vaccines of the present invention is host administration and intracellular delivery of a codon optimized nef-based adenoviral HIV vaccine; expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, inhibiting or at least altering known early viral functions of Nef which have been shown to promote HIV-1 replication and load within an infected host. Therefore, the nef coding region may be altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues. Also, the nef coding region may be altered so as to result in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues. In addition, the adenoviral vector HIV vaccines of the present invention also relate to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nefproteins which comprise a A627836spcci 66 deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence.

Therefore, specific Nef-based constructs further include the following, as exemplification's and not limitations. For example, the present invention relates to an adenoviral vector vaccine which encodes modified forms of H1V-1, an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to ammno acid residue 6-216 of HIV-1 Nef Ofri) is referred to herein as opt tpanef. The nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ lID NO: 11, as shown below:

CATGGATGCA

TTCGCCCAGC

GATGAGGAGG

CGTGGGCGCC

CGCCACCAAC

CGTGAGGCCC

CTTCCTGAAG

CCTGGACCTG

CGGCCCCGGC

GCCCGAGAAG

CCAGCACGGC

GGCCTTCCAC

NO:ii).

ATGAAGAGAG

GAGATCTCCT

GCCGAGCCCG

GTGTCCAGGG

GCCGACTGCG

CAGGTGCCCC

GAGAAGGGCG

TGGGTGTACC

ATCAGGTTCC

GTGGAGGAGG

ATCGAGGACC

CACGTGGCCA

GGCTCTGCTG

CCAAGAGGTC

CCGCCGACAG

ACCTGGAGAA

CCTGGCTGGA

TGAGGCCCAT

GCCTGGAGGG

ACACCCAGGG

CCCTGACCTT

CCAACGAGGG

CCGAGAAGGA

GGGAGCTGCA

TGTGCTGCTG

CGTGCCCGGC

GGTGAGGAGG

GCACGGCGCC

GGCCCAGGAG

GACCTACAAG

CCTGATCCAC

CTACTTCCCC

CGGCTGGTGC

CGAGAACAAC

GGTGCTGGAG

CCCCGAGTAC

CTGTGTGGAG

TGGTCCACCG

ACCGAGCCCG

ATCACCTCCT

GACGAGGAGG

GGCGCCGTGG

TCCCAGAAGA

GACTGGCAGA

TTCAAGCTGG

TGCCTGCTGC

TGGAGGTTCG

TACAAGGACT

CAGTCTTCGT

TGAGGGAGAG

CCGCCGTGGG

CCAACACCGC

TGGGCTTCCC

ACCTGTCCCA

GGCAGGACAT

ACTACACCCC

TGCCCGTGGA

ACCCCATGTC

ACTCCAAGCT

GCTAAAGCC (SEQ ID The open reading frame for SEQ ID NO:1 1 comprises an initiating methionine residue at nucleotides 2-4 and a "TAA" stop codon from nucleotides 713-715. The open reading frame of SEQ ID NO: 11 provides for a 23 7 amino acid HIV-1I Nef protein which comprises a tPA leader sequence fused to amino acids 6-2 16 of HIV-1 Nef, including the dileucine motif at amino acid residues 174 and 175. This 237 amino acid tPA/Nef jfrl) fusion protein is disclosed herein as SEQ ID NO: 12, and is shown as follows: Met Asp Ala Met Lys Ala Gly Asp Ser Ala Val Lys Giu Val1 Gly Val Trp Arg Arg Thr Gly Gly Gly Tyr Pro Ser Val Arg Giu Asp Val Asp His Gin Arg Arg Pro Arg Thr Lys Cys Arg Leu Ser Gly Phe Gly Ser Glu Glu His Ala Pro Ser Gin Tyr Pro Leu Giu Arg Pro Gly Trp Gin His Lys Phe Leu Cys Ile Met Al a Ala Leu Val Phe Arg Pro Thr Cys Ser Arg Ala Ile Giu Pro Leu Gin Asp Phe Leu Lys Ala Gly Ser Gin Arg Glu Ile Gin Trp Leu Arg Glu Val1 Ser Giu Pro Lys Leu Asn Cys Leu Ser Pro Gly Asn Asp Met Gly Asp Tyr Phe Gly Pro Ala Val Ala Giu Tyr Leu Trp Pro Leu A627836speci 67 Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His Pro Met Ser Gin His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID NO:12).

Therefore, this exemplified Nef protein, Opt tPA-Nef, contains both a tPA leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.

In another specific embodiment of the present invention, a DNA molecule is disclosed which encodes optimized HIV-1 Nef wherein the open reading frame of a recombinant adenoviral HIV vaccine encodes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175. This open reading frame is herein described as opt nef (G2A,LLAA) and is disclosed as SEQ ID NO:13, which comprises an initiating methionine residue at nucleotides 12-14 and a "TAA" stop codon from nucleotides 660- 662. The nucleotide sequence of this codon optimized version of HIV-1 jrfl nef gene with the above mentioned modifications is disclosed herein as SEQ ID NO: 13, as follows:

GATCTGCCAC

GGGAGAGGAT

CCGTGGGCGT

ACACCGCCGC

GCTTCCCCGT

TGTCCCACTT

AGGACATCCT

ACACCCCCGG

CCGTGGAGCC

CCATGTCCCA

CATGGCCGGC

GAGGAGGGCC

GGGCGCCGTG

CACCAACGCC

GAGGCCCCAG

CCTGAAGGAG

GGACCTGTGG

CCCCGGCATC

CGAGAAGGTG

GCACGGCATC

AAGTGGTCCA

GAGCCCGCCG

TCCAGGGACC

GACTGCGCCT

GTGCCCCTGA

AAGGGCGGCC

GTGTACCACA

AGGTTCCCCC

GAGGAGGCCA

GAGGACCCCG

AGAGGTCCGT

CCGACAGGGT

TGGAGAAGCA

GGCTGGAGGC

GGCCCATGAC

TGGAGGGCCT

CCCAGGGCTA

TGACCTTCGG

ACGAGGGCGA

AGAAGGAGGT

AGCTGCACCC

GCCCGGCTGG TCCACCGTGA

GAGGAGGACC

CGGCGCCATC

CCAGGAGGAC

CTACAAGGGC

GATCCACTCC

CTTCCCCGAC

CTGGTGCTTC

GAACAACTGC

GCTGGAGTGG

CGAGTACTAC

GAGCCCGCCG

ACCTCCTCCA

GAGGAGGTGG

GCCGTGGACC

CAGAAGAGGC

TGGCAGAACT

AAGCTGGTGC

GCCGCCCACC

AGGTTCGACT

AAGGACTGCT

CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AAAGCCCGGG C (SEQ ID NO:13).

The open reading frame of SEQ ID NO:13 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID NO:14, as follows: Met Ala Gly Lys Trp Ser Lys Arg Arg Glu Arg Met Arg Arg Ala Glu Thr Glu Pro Ala Ala Val Gly Val Lys His Gly Ala Ile Thr Ser Ser Cys Ala Trp Leu Glu Ala Gin Glu Arg Pro Gin Val Pro Leu Arg Pro Leu Ser His Phe Leu Lys Glu Lys Ser Gln Lys Arg Gln Asp Ile Leu Ser Pro Gly Asn Asp Met Gly Asp Val Ala Ala Thr Glu Thr Gly Leu Pro Ala Val Ala Glu Tyr Leu Trp Trp Arg Arg Thr Gly Gly Gly Tyr Ser Val Asp Asn Phe Ala Leu His A627836speci 68 Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Giu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His Pro Met Ser Gin His Gly Ile Glu Asp Pro Giu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys Ser (SEQ ID NO:14).

An additional embodiment of the present invention relates to another DNA molecule encoding optimized HLV-1 Nef wherein the amino terminal myristylation site and dilcucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV- 1 Nef jfl), wherein Leu-174 and Leu-175 arc substituted with Ala-174 and Ala-175 (Ala- 195 and Ala-196 in this tPA-based fusion protein). The nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ lID NO: 15, as shown below: CATGGATGCA ATGAAGAGAG TTCGCCCAGC GAGATCTCCT GATGAGGAGG GCCGAGCCCG CGTGGGCGCC GTGTCCAGGG CGCCACCAAC GCCGACTGCG CGTGAGGCCC CAGGTGCCCC CTTCCTGAAG GAGAAGGGCG CCTGGACdTG TGGGTGTACC CGGCCCCGGC ATCAGGTTCC GCCCGAGAAG GTGGAGGAGG CCAGCACGGC ATCGAGGACC

GGCTCTGCTG

CCAAGAGGTC

CCGCCGACAG

ACCTGGAGAA

CCTGGCTGGA

TGAGGCCCAT

GCCTGGAGGG

ACACCCAGGG

CCCTGACCTT

CCAACGAGGG

CCGAGAAGGA

TGTGCTGCTG

CGTGCCCGGC

GGTGAGGAGG

GCACGGCGCC

GGCCCAGGAG

GACCTACAAG

CCTGATCCAC

CTACTTCCCC

CGGCTGGTGC

CGAGAACAAC

GGTGCTGGAG

CCCCGAGTAC

CTGTGTGGAG

TGGTCCACCG

ACCGAGCCCG

ATCACCTCCT

GACGAGGAGG

GGCGCCGTGG

TCCCAGAAGA

GACTGGCAGA

TTCAAGCTGG

TGCGCCGCCC

TGGAGGTTCG

TACAAGGACT

CAGTCTTCGT

TGAGGGAGAG

CCGCCGTGGG

CCAACACCGC

TGGGCTTCCC

ACCTGTCCCA

GGCAGGACAT

ACTACACCCC

TGCCCGTGGA

ACCCCATGTC

ACTCCAAGCT

GCTAAAGCCC

GGCCTTCCAC CACGTGGCCA GGGAGCTGCA

(SEQ

ID The open reading frame of SEQ ID NO: 15 encoding tPA-Nef (LLAA), disclosed herein as SEQ ID NO: 16, is as follows: Met Ala Gly Asp Ser Ala Val Lys Glu Asp Val Trp Arg Arg Thr Gly Gly Gly Al a Phe Ser Val Asp Asn Phe Al a Leu Met Val Thr Arg Leu Al a Pro Val Ile Lys Ser Val Arg Glu Asp Val Asp His Arg Pro Arg Thr Lys Cys Arg Leu Ser Gly Ser Glu Giu His Ala Pro Ser Gin Leu Cys Cys Giu Ile Ser Arg Met Arg Pro Ala Ala Gly Ala Ile Trp Leu Giu Gin Val Pro His Phe Leu Lys Arg Gin Val Ser Arg Val Thr Al a Leu Lys Asp Leu Lys Al a Gly Ser Gin Arg Giu Ile Leu Arg Glu Val Ser Giu Pro Lys Leu Leu Ser Pro Gly Asn Asp Met Gly Asp Cys Val Ala Al a Thr Glu Thr Gly Leu Gly Pro Al a Val Ala Giu Tyr Leu Trp A627836speci Val Tyr His Thr Gin Gly Tyr Phe Pro Asp Trp Gin Asn Tyr Thr Pro Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His Pro Met Ser Gin His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys (SEQ ID NO:16).

An adenoviral vector of the present invention may comprise a DNA sequence, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nefproteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize "noncodon optimized" versions of the constructs disclosed herein, especially modified versions of HIV Nef which are shown to promote a substantial cellular immune response subsequent to host administration.

Figure 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors V1Jns/nef (Figure V1Jns/nef(G2A,LLAA) (Figure 20B), V1Jns/tpanef (Figure 20C) and V1Jns/tpanef(LLAA) (Figure 20C, also). 5' and 3' flanking sequences ofcodon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. V1Jns/tpanef and V1Jns/tpanef(LLAA) have identical sequences at the junctions.

Figure 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucinel74 and 175 are the sites involved in myristylation and dileucine motif, respectively.

EXAMPLE 19 MRKAd5Pol Construction and Virus Rescue Construction of vector: shuttle plasmid and pre-adenovirus plasmid Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5pol, is depicted in Figure 22. Briefly, the adenoviral shuttle vector for the full-length inactivated HIV-1 pol gene is as follows. The vector MRKpdelE1(Pac/plX/pack450)+CMVmin+BGHpA(str.) is a derivative of the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. The vector contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BglII site will ensure A627836speci the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(El-/E3+)Clal (or MRKpAdHVE3) pre-plasmid. The vector, similar to the original shuttle vector contains the Pad site, extension to the packaging signal region, and extension to the pIX gene. The synthetic full-length codon-optimized HIV-1 pol gene was isolated directly from the plasmid pVlJns-HIV-pol-inact(opt). Digestion of this plasmid with Bgl II releases the pol gene intact (comprising a codon optimized IA pol sequence as disclosed in SEQ ID NO:3). The pol fragment was gel purified and ligated into the MRKpdelEl(Pac/pIX/pack450)+CMVmin+BGHpA(str.) shuttle vector at the BglI site. The clones were checked for the correct orientation of the gene by using restriction enzymes DraIIIINotl. A positive clone was isolated and named MRKpdel+hCMVmin+FL-pol+bGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdel+hCMVmin+FL-pol+bGHpA(S) was digested with restriction enzymes Pad and Bstl 107 I(or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(E1-/E3+)Clal. The resulting preplasmid originally named MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+ is now referred to as "pMRKAd5pol". The genetic structure of the resulting pMRKAd5pol was verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the pol transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-lpol adenoviral vector is shown in Figures 26A-1 to 26A-46.

Generation of research-grade recombinant adenovirus The pre-adenovirus plasmid, pMRKAd5pol, was rescued as infectious virions in PER.C6® adherent monolayer cell culture. To rescue infectious virus, 12 pg of pMRKAd5pol was digested with restriction enzyme PacI (New England Biolabs) and 3.3 p.g was transfected per 6 cm dish of PER.C6® cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). PacI digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6®cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at -60 0 C. This pol containing recombinant adenovirus is referred to herein as "MRKAd5pol". This recombinant adenovirus expresses an inactivated HIV-1 Pol protein as shown in SEQ ID NO:6.

A627836speci EXAMPLE Construction and Virus Rescue Construction of vector: shuttle plasmid and pre-adenovirus plasmid Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5nef, is depicted in Figure 23. Briefly, as shown in Example 19 above, the vector MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. It has been modified to contain the Pacl site, extension to the packaging signal region, and extension to the pIX gene. It contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bgll 1 site will ensure the direction of transcription of the transgene will be Ad5 El parallel when inserted into the MRKpAd5(E1-/E3+)Clal pre-plasmid. The synthetic full-length codon-optimized HIV-1 nef gene was isolated directly from the plasmid pV1Jns/nef (G2A,LLAA). Digestion of this plasmid with Bgll 1 releases the nef gene intact, which comprises the nucleotide sequence as disclosed in SEQ ID NO:13. The nef fragment was gel purified and ligated into the MRKpdelE1+CMVmin+BGHpA(str.) shuttle vector at the Bgll 1 site. The clones were checked for correction orientation of the gene by using restriction enzyme Scal. A positive clone was isolated and named MRKpdelElhCMVminFL-nefBGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdelElhCMVminFL-nefBGHpA(s) was digested with restriction enzymes Pad and Bstl 107 I (or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Clal digested) adenoviral backbone plasmid, MRKpAd(E1/E3+)Clal. The resulting preplasmid originally named MRKpdelElhCMVminFL-nefBGHpA(s) is now referred to as The genetic structure of the resulting pMRKAd5nefwas verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the nef transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-lnef adenoviral vector is shown in Figures 27A-1 to 27A-44.

Generation of research-grade recombinant adenovirus The pre-adenovirus plasmid, pMRKAd5nef, was rescued as infectious virions in PER.C66 adherent monolayer cell culture. To rescue infectious virus, 12 pg of pMRKAdnef was digested with restriction enzyme Pad (New England Biolabs) and 3.3 pg was transfected per 6 cm dish of PER.C6® cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Pad digestion releases the viral A627836speci 72 genome from plasmid sequences allowing viral replication to occur after entry into PER.C6®cells. Infected cells and media were harvested 6 -10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at -60 0 C. This nef containing recombinant adenovirus is now referred to as EXAMPLE 21 Construction ofMurine CMV Promoter Containing Shuttle Vectors for Inactivated Pol and Nef/G2A,LLAA The murine CMV (mCMV) was amplified from the plasmid pMH4 (supplied by Frank Graham, McMaster University) using the primer set: mCMV (Not I) Forward: AGA ATG CGG CCG CCA TAT ACT GAG TCA TTA GG-3' (SEQ ID NO: mCMV (Bgl II)Reverse: 5'-AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C-3' (SEQ ID NO:21). The underlined nucleotides represent the Not I and the Bgl II sites respectively for each primer. This PCR amplicon was used for the construction of the mCMV shuttle vector containing the transgene in the El parallel orientation. The hCMV promoter was removed from the original shuttle vector (containing the hCMV-gag-bGHpA transgene in the El parallel orientation) by digestion with Not I and Bgl II. The mCMV promoter (Not I/Bgl II digested PCR product) was inserted into the shuttle vector in a directional manner. The shuttle vector was then digested with Bgl n and the gag reporter gene (Bgl II fragment) was re-inserted back into the shuttle vector.

Several clones were screened for correct orientation of the reporter gene. For the construction of the mCMV-gag in the El antiparallel orientation, the mCMV promoter was amplified from the plasmid pMH4 using the following primer set: mCMV (Asc I) Forward: ATA AGA ATG GCG CGC CAT ATA CTG AGT CAT TAG G (SEQ ID NO:22); mCMV (Bgl II) Reverse: 5' AAG GAA GAT CTA CCG ACG CTG GTC GCG CCT C (SEQ ID NO:21). The underlined nucleotides represent the Asc I and Bgl H sites, respectively for each primer. The shuttle vector containing the hCMV-gag transgene in the El antiparallel orientation was digested with Ascl and Bgll 1 to remove the hCMVgag portion of the transgene. The mCMV promoter (Ascl/Bgll 1 digested PCR product) was inserted into the shuttle vector in a directional manner. The vector was then digested with Bgll1 and the gag reporter gene (Bgll 1 fragment) was re-inserted. Several clones were screened for correct orientation of the reporter gene. For each of the full length IA pol and full length nef/G2A,LLAA genes, cloning was performed using the unique Bgl II site within the mCMV-bGHpA shuttle vector. The pol and nef genes were excised from their respective pV 1 Jns plasmids by Bgl II digestion.

A627836speci 73 EXAMPLE 22 Construction of mCMV Full Length Inactivated Pol and Full Length nef/G2A.LLAA Adenovectors Each of these transgenes of Example 21 were inserted into the modified shuttle vector in both the El parallel and El anti-parallel orientations. Pad and BstZ110I digestion of each shuttle vector was performed and each specific transgene fragment containing the flanking Ad5 sequences was isolated and co-transformed with Cla I digested MRKpAd5(E3+) or MRKpAd5(E3-) adenovector plasmids via bacterial homologous recombination in BJ5183 E. coli cells. Recombinant pre-plasmid adenovectors containing the various transgenes in both the E3- and E3+ versions (and in the El parallel and El antiparallel orientations) were subsequently prepared in large scale following transformation into XL-1 Blue E. coli cells and analyzed by restriction analysis and sequencing.

EXAMPLE 23 Construction of hCMV-tpa-nef (LLAA) Adenovector The tpa-nef gene was amplified out from GMP grade pV1Jns-tpanef (LLAA) vector using the primer sets: Tpanef(BamHI) F 5'-ATT GGA TCC ATG GAT GCA ATG AAG AGA GGG (SEQ ID NO:23); Tpanef(BamHI) R 5'-ATA GGA TCC TTA GCA GTC CTT GTA GTA CTC G (SEQ ID NO:24). The resulting PCR product was digested with BamHI, gel purified and cloned into the Bgl II site of MRKAd5CMV-bGHpA shuttle vector (Bgl II digested and calf intestinal phosphatase treated). Clones containing the tpanef (LLAA) gene (see SEQ ID NO:15 for complete coding region) in the correct orientation with respect to the hCMV promoter were selected following Sca I digestion.

The resulting MRKAd5tpanef shuttle vector was digested with Pac I and Bst Z1101 and cloned into the E3+ MRKAd5 adenovector via bacterial homologous recombination techniques.

EXAMPLE 24 Immunogenicity of MRKAd5pol and MRKAd5nef Vaccine Materials and Methods Rodent Immunization Groups of N=10 BALB/c mice were immunized i.m. with the following vectors: MRKAd5hCMV-IApol at either 10^7 vp and 10^9 vp; and MRKAd5hCMV-IApol at either 10^7 vp and 10A9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively. For all rodent immunizations, the Ad5 vectors were diluted in 5 mM Tris, sucrose, 75 mM NaCI, 1 mM MgC12, 0.005% polysorbate 80, pH 8.0. The total dose was injected to both quadricep muscles in 50 1 tL aliquots using a 0.3-mL insulin syringe with 28-1/2G needles (Becton-Dickinson, Franklin Lakes, NJ).

A627836speci Groups of N=10 C57/BL6 mice were immunized i.m. with the following vectors: MRKAd5hCMV-nef(G2A,LLAA) at either 10^7 vp and 10^9 vp; (2) MRKAd5mCMV-nef(G2A,LLAA) at either 10^7 vp and 10^9 vp; and (3) at either 10^7 vp and 10^9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively.

Non-human Primate immunization Cohorts of 3 rhesus macaques (2-3 kg) were vaccinated with the following Ad vectors: MRKAd5hCMV-IApol at either 10^9 vp and 10 11 vp dose; and MRKAd5hCMV-IApol at either 10^9 vp and 10^11 vp; MRKAd5hCMV-nef(G2A,LLAA) at either 10^9 vp and 10^11 vp; and MRKAd5mCMV-nef(G2A,LLAA) at either 10^9 vp and 10^11 vp. The vaccine was administered to chemically restrained monkeys (10 mg/kg ketamine) by needle injection of two 0.5 mL aliquots of the Ad vectors (in 5 mM Tris, 5% sucrose, mM NaC1, 1 mM MgC12, 0.005% polysorbate 80, pH 8.0) into both deltoid muscles. The animals were immunized twice at a 4 week interval 4 weeks).

Murine anti-RT and anti-nefELISA Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, NY) were coated by overnight incubation with 100 [tL of 1 lg /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, MD) in PBS. For anti-nef ELISA, 100 uL of 1 ug/mL HIV-1 nef (Advanced Biotechnologies, Columbia, MD) was used to coat the plates. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, AL) and incubated for 2 h with 200 itL/well of blocking solution (PBS/0.05% tween/l% BSA). An initial serum dilution of 100-fold was performed followed by 4-fold serial dilution. 100- LL aliquots of serially diluted samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 tL of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, CA) were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 p.L 1,2phenylenediamine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for min. The reaction was quenched by adding 100 [pL of 0.5M H 2 S04 per well. OD 4 92 readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD 49 2 (2.5 times the background value).

Non-human primate and murine ELIspot assays The enzyme-linked immunospot (ELISpot) assay was utilized to enumerate antigen-specific INFy-secreting cells from mouse spleens (Miyahira, et al. 1995, J. Immunol. Methods 181:45-54) or macaque PBMCs. Mouse spleens were pooled from 5 mice/cohort and single cell suspensions were prepared at 5x10 6 /mL in complete RPMI media (RPMI1640, 10% FBS, 2mM Lglutamine, 100U/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM (1-ME).

A627836speci Rhesus PBMCs were prepared from 8-15 mL of heparinized blood following standard Ficoll gradient separation (Coligan, et al, 1998, Current Protocols in Immunology. John Wiley Sons, Inc.). Multiscreen opaque plates (Millipore, France) were coated with 100 tL/well of either 5 (pg/mL purified rat anti-mouse IFN-y IgG1, clone R4-6A2 (Pharmingen, San Diego, CA), or 15 ug/mL mouse anti-human IFN-y IgG2a (Cat. No.

1598-00, R&D Systems, Minneapolis, MN) in PBS at 4 0 C overnight for murine or monkey assays, respectively. The plates were washed with PBS/penicillin/streptomycin and blocked with 200 tL/well of complete RPMI media for 37 oC for at least 2 h.

To each well, 50 utL of cell samples (4-5x10 5 cells per well) and 50 tiL of the antigen solution were added. To the control well, 50 |tL of the media containing DMSO were added; for specific responses, either selected peptides or peptide pools (4 ug/mL per peptide final concentration) were added. For BALB/c mice immunized with the pol constructs, stimulation was conducted using a pool of CD4 -epitope containing peptides (aa21-40, aa411-430, aa641-660, aa731-750, aa771-790) or a pool of CD8 epitope containing peptides (aa201-220, aa311-330, aa781-800). For C57/BL6 mice immunized with the nef construct, either aa51-70 (CD8 T cell epitope) or aa81-100 (CD4 peptide derived from the nef sequence was added for specific stimulation. In monkeys, the responses against pol were evaluated using two pools (L and R) of peptides that encompass the entire pol sequence and overlap by 10 amino acids. In monkeys vaccinated with the nef constructs, a single pool containing 20-mer peptides covering the entire HV- 1 nef sequence and overlapping by 10 aa was used. Each sample/antigen mixture was performed in triplicate wells for murine samples or in duplicate wells for rhesus PBMCs. Plates were incubated at 37 0 C, 5% CO2, humidity for 20-24 h. The plates were washed with PBS/0.05% Tween 20 and incubated with 100 tL/well of either 1.25 utg/mL biotin-conjugated rat anti-mouse IFN-y mAb, clone XMG1.2 (Pharmingen) or of 0.1 ug/mL biotinylated anti-human IFN-gamma goat polyclonal antibody (R&D Systems) at 4°C overnight. The plates were washed and incubated with 100 jtL/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37 Spots were developed by incubating with 100 [tL/well 1-step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 106 cell input.

Non-human Primate anti-RTELISA The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well.

Briefly, Maxisorp plates were coated with saturating amounts ofpol positive human serum (#97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN 3 and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature. Similar mixtures A627836speci are prepared using serially diluted samples of a standard and a negative control which defines maximum RT binding. 200 uL/well of each sample and standard were added to the washed plate and the plate incubated 16-24 h at room temperature. Bound RT is quantified following the procedures described in Coulter p24 assay kit and reported in milliMerck units per mL arbitrarily defined by the chosen standard.

Results Rodent Studies BALB/c mice (n=5 mice/cohort) were immunized once or twice with varying doses of MRKAd5hCMV-IApol(E3+) and IApol(E3-). At 3 weeks after the second dose, Anti-pol IgG levels were determined by an ELISA assay using RT as a surrogate antigen. Cellular response were quantified via IFNy ELISpot assay against pools ofpol-epitope containing peptides. The results of these assays are summarized in Table 10. The results indicate that the mouse vaccinees exhibited detectable anti-RT IgGs with an adenovector dose as low as 10^7 vp. The humoral responses are highly dose-dependent and are boostable with a second immunization. One or two doses of either pol vectors elicit high frequencies of antigenspecific CD4' and CD8 T cells; the responses are weakly dose-dependent but are boostable with a second immunization.

A T 6 O Table 10. Immunogenicit of MRKAd5 ol Vectors in BALB/c mice.

Anti.RT IgG Titers SFC/10^6 cells' No. of CD4+ CD8+ Group Vaccine Dose Do GMT +SE .SE Medium peptide peptide Doses pool pool 1 MRKAd5hCMVFLpol 10"7 vp 2 310419 301785 153020 1(1) 75(4) 2313(67) 1 919 372 265 1(1) 72(9) 533(41) 2 MRKAd5hCMVFLpol 10^9 vp 2 1638400 b 0 0 2(2) 114(9) 2063(182) 1 713155 528520 303555 1(1) 48(7) 733(89) 3 MRKAd5hCMVFLpol 10"7 vp 2 310419 386218 172097 0(0) 223(7) 2607(27) 1 6400 14013 4393 10(8) 141(21) 409(28) 4 MRKAd5hCMVFLpol 109 vp 2 1638400 b 0 0 1(1) 160(13) 2385(11) 1 12 4 167 5 b 396725 300661 0(0) 39(13) 833(83) Naive none none 57 9 7 9(2) 11(4) 10(1) °GMT, geometric mean titer of the conort of 5 mice; SE, standard error of the gemetric mean bNear or at the upper limit of the serial dilution; hence, could be greater than this value °No. of Spot-forming Cells per million splecnoytes; mean values of triplicates are reported along with standard errors in parenthesis.

C57/BL6 mice were immunized once or twice with varying doses of nef(G2A,LLAA) MRKAd5mCMV-nef(G2A,LLAA) at either 10^7 vp and(3) MRKAd5mCMV-tpanef(LLAA) at either 10^7 vp and 10^9 vp. The immune response were analyzed using similar protocols and the results are listed in Table 11. While anti-nefIgG responses could not be detected in this model system with any of the constructs, there are strong indications of a cellular immunity generated against nef using the ELIspot assay.

A627836speci Table 11. Immunogenicity of IvIRKd~nef Vectors in C57/BL6 mice.

Anti-nef IgG Titers' _____SFCIIO6_cellSb Gru acn oe No. of GT SE -EaaSl-70 aa8l-100 Grop Vccie Dse Doses GT 4E -E Medium 008+ 004+ 1 MRKAd~hCMVFLnef lOA7 vp 2 174 70 50 1 23(1) 1(1)- 1 132 42 32 0(0) 0(0) 0(0) 2 MRKAd~hCMVFLnef I A9 Vp 2 174 70 50 0(0) 61(7) 4(2) 1 132 42 32 1 62(7) 3(1) 3 MRKAd5mOMVFLnef I 0A7 VP 2 132 42 32 3(1) 15(5) 5(2) 1 115 46 33 3(2) 3(2) 4(2) 4 MRKAd5mCMVFLnef 10^9 vp 2 132 42 32 4(2) 83(13) 5(1) 1 132 42 32 2(1) 29(2) MRKAd~mCMVtpanef(E3+) 10^7 vp 2 132 42 32 3(2) 14(2) 5(1) 1 100 0 0 3(1) 13(4) 10(3) 6 MRKAd5mOMVtpanef(E3+) 10OA9 Vp 2 230 170 96 3(2) 145(29) 1 115 46 33 7(1) 151(14) 10(0) 7 Na~ve none none 152 78 52 21(2) 18(6) 26(3) *GMT, geometric mean titer of the cohort of 5 mice; SE, standard error of the gemetric mean b No. of spot-forming cells per million splecnoytes; mean values of triplicates are reported along with standard errors in parenthesis.

Monkey Studies Cohorts of 3 rhesus macaques were immunized with 2 doses of MRKAd5hCMV-JApol(E3+) and MRKAd5hCMV-JApol(E3-). The number of antigenspecific T cells (per million PBMCs) were enumerated using one of two peptide pools (L and R) that cover the entire pol sequence; the results are listed in Table 12. Moderate-tostrong T cell responses were detected in the vaccinees using either constructs even at a low dose of 10A9 vp. Longitudinal analyses of the anti-RT antibody titers in the animals suggest that the pol transgene product is expressed efficiently to elicit a humoral response (Table 13). It would appear that generally higher immune responses were observed in animals that received the E3- construct compared to the E3± virus.

Table 12.h Pol-specific T Cell Resnonses in N4RKAd51ool Immunized Rhesus Macaaues.

Vaccine (T=0,4 wks) Monk rPrebleed T=4 T=7 T=11O Mock Pol L PoI R Mock Pol L PoI R Mock Pol L Pol R Mock Pol L PolIR MRKAd~hCMV-lApoI(E3+) 990100 1 0 0 1 38 31 0 52 146 0 49 715 10^11 vp 990215 1 2 2 10 98 249 1 109 305 22 88 250 99D201 5 5 4 6 149 95 0 40 35 0 35 18 MRKAd5hCMV-IApol(E3+) 99D212 0 2 0 4 331 114 0 58 14 0 6 6 1 A9 Vp 990180 0 4 2 0 19 192 4 38 156 5 38 106 990201 8 5 21 6 62 62 0 18 32 1 14 MRKAd5hCMVlApol(E3-) 99D239 5 2 2 20 82 172 1 66 114 9 21 bOAll VP 99C186 4 12 6 5 120 421 2 271 489 16 875 530 990084 1 8 9 8 84 454 0 14 236 1 24 264 MRKAd5hMV-lApol(E3-) 0070 10 10 8 12 724 745 4 322 376 4 188 176 lOA9 Vp CDIG 2 0 1 5 474 468 0 232 212 0 101 121 CDIl 6 6 12 10 98 110 5 60 80. 8 25 34 Nafve 0830 1nd 1nd nd Ind nd nd 4 2 12 2 1 2 nd. not determined Reported are SFC per million PBMCs; mean of duplicate wells.

A627836speci Table 13. Anti-RT Ig Levels in MIRKAd5pol Immunized macaques.

RT ANTIBODY ASSAY TITERS IN mMU/ml Vaccine/Monkey Tag T=4 T=7 T=12 Tin16 MRKAd5hCMV-IApoI(E3+), IOAII VP 99C 100 61 1999 5928 4768 99C215 81 1541 2356 2767 99D201 53 336 539 387 MRKAd5hCMV-IApoI(E3+), 10OA9 vp 99D212 10 40 49 68 99D 180 <10 36 79 93 99C201 <10 37 71 76 MRKAd5hCMV-IApoI(E3-), lUAJJ Vp 99D239 44 460 1234 1015 99C 186 21 233 480 345 99C084 235 2637 2858 1626 MRKAd5hCMV-IApoI(E3-), 10A9 VP CC7C 32 175 306 235 CD1G 20 140 273 419 CD11 15 112 149 237 When rhesus macaques were immunized i.m. with two doses of MIRKAd5nef constructs, vigorous T cell responses ranging from 100 to as high as 1 100 per million were observed in 8 of 12 vaccinees (Table 14). The efficacies of the mCMV- and hCMV.- driven nef constructs are comparable on the basis of the data generated thus far.

Table 14. Nef-specific T cell Responses in MIRKAd5nef Immunized Rhesus Macaques.

Vaccine (T=0,4 wks) Monk Pre T=4 T=7 T1 6 Mock Nef Mock Nef Mock Nef Mock Nef MRKAd5hCMV-nef(G2A,LLAA) C020 0 4 31 440 4 368 1 251 1 0AJ IVp CC7B 0 0 2 521 0 1 78 1 1522 CC61 2 9 31 112 0 108 11 100 MRKAd5hCMV-nef(G2A,LLAA) CC2K 9 9 6 52 0 35 0 1lOA9 Vp CD15 5 4 30 998 2 586 0 434 CD16 6 1 6 1146 10 369 1 212 MRKAd5mnCMV-nef(G2A,LLAA) 99DI91 1 5 4 614 0 298 2 419 JOAJJ Vp 99DI44 4 6 5 434 0 1100 2 932 99C193 1 2 1 58 1 22 0 64 MRKAd5tZMV-nef(G2A,LLAA) 99D224 1 11 14 231 1 125 0 10A9 Vp 99D250 8 9 4 108 0 54 0 99CI20 1 6 20 299 0 92 0 79 Naive 0830Q nd Ind 118 22 14 5 12 1=: EXAMPLE [0 Comparison of Glade B vs. Glade C T Cell Responses in 11W-Infected Subjects PBMC samples collected from two dozens of patients infected with H1W-i in US were tested in ELISPOT assays with peptide pools of 20-mer peptides overlapping by amino acids. Four different peptide pools were tested for cross-dlade recognition, and A627836speci they were either derived from a clade B-based isolate (gag H-b; nef-b) or a clade C-based isolate (gag H-c, nef-c). Data in Table 15 shows that T cells from these patients presumably infected with clade B HIV-1 could recognize clade C gag and nef antigens in ELISPOT assay. Correlation analysis further demonstrated that these T cell responses against clade C gag peptide pool were about 60% of the clade B counterpart (Figure 24), while the T cell responses against clade C nef were about 85% of the clade B counterpart (Figure 25). These results suggest that cellular immune responses generated in patients infected with clade B HIV-1 can recognize gag and nef antigens derived from clade C HIV-1. These data show that a HIV vaccine, such as a DNA or adenoviral vaccine expressing a clade B gag and/or nef antigen will potentially have the ability to provide a prophylactic and/or therapetic advantage on a global scale.

Table Responses Shown as the Number of glFN-Secreting T Cells per Million PBMCs subject bleed date gag epitope mock gag H-b gagH-c nef-b nef-c Sfrom mapping) #100 19-Jul-99 12 10 3950 1385 1295 1300 #101 25-Jul-99 3 15 3885 1280 na 1020 #102 25-Jul-99 4 15 1740 850 1255 1785 #104 7-Jun-99 2 5 1355 1185 na 1060 #107 11-Oct-99 2 25 3305 2795 670 870 #405 11-Jul-99 2 15 4575 3180 1700 1500 #501 19-Jul-99 2 15 1100 570 3365 3460 #505 18-Jul-99 5 10 2145 1725 1235 na #506 28-Feb-99 2 25 150 45 400 610 #701 28-Mar-99 5 30 7620 4775 3320 2780 #709 17-May-99 3 15 2785 1945 1090 1630 #710 24-May-99 4 5 1055 1080 2210 2140 EXAMPLE 26 Characterization and Production of MRKAd5pol and Vectors in Roller Bottles Expansion ofnefandpol Adenovectors Nef and pol CsCl purified seeds were used to infect roller bottles to produce P4 virus to be used as a seed for further experiments. P4 MRKAd5 pol and nef vectors were used to infect roller bottles at an MOI 280 vp/cell, except for hCMV-tpa-nef which was infected at an MOI of 125 due to low titers of seed obtained at P4.

A627836speci Table 16 Viral particle concentrations for P5 nef and poi adenovectors Adenovector AEX Titer AEX Titer Amplification 10 vp/mi culture) (104 vp/cell) Ratio hCMV-FL-nef 1.1 0.9 mCMV-FL-nef 2.2 2.1 hCMV-tpa-nef 0.07 0.1 mCMY-tpa-nef 1.3 0.9 hCMV-FL-pol 2.7 2.1 hCMV-FL-pol 1.9 1.3 Roller Bottle Passaging Passaging of the pol and nef constructs continued through passage seven. Cell-associated (freeze/thaw lysis) and whole broth (triton-lysis) titers obtained in all passages were very consistent. In general, MRK.Ad5pol is ca. 70% as productive as MIRKAd5gag while MRKAd5nef is ca. 25% as productive as Samples of P7 virus for both constructs were analyzed by V&CB by restriction digest analysis and did not show any rearrangements.

Table 17. Passage Six Viral Productivity for MIRKAd5pol and Xviable (106 cells/mi), Viability Infection IHarvest Cell Passage Number AEX Titer (Cell Associated) 10 10 vp/n-I culture Titer 10" vp/cell Amplification Ratio Triton LysisTie 101" vp/mI culture hCMV-FL-nef pool 1.22, 85% 62 0.8 0.7 25 1.6 1 0.99,62% 2 1.10,72% hCMV-FL-pol pool 1.42, 89% 62 4.5 3.2 115 [E3+1 1 1.22, 2 1.42, 74% Table 18. Passage Seven Viral Productivity for MvRKAd5pol and Xviable (106 cells/mI), Cell Passage AEX Titer Titer Amplification Triton Lysis Titer Viability (Cell Associated) Infection Harvest Number 1010 vp/mI culture 104 vp/cell Ratio 10 10 vp/mI culture hCMV-FL-nef Pool 1.33, 90% 66 1.0 0.8 29 2.1 1 0.96, 2 1.18, 73% hCMV-FL-pol Pool 0.90*, 90% 56 4.2 4.7 168 1 1.18,88% 2 1.04, MRKAd~nef and MRKAd~pol Viral Production Kinetics A timecourse experiment was carried out in roller bottles to determine if the viral production kinetics of the MRKAd5pol and MlRK.Ad5nef vectors were similar to those of PER.C6® cells in roller bottle cultures were infected at an MOI of 280 vp/cells with MiRKAd5pol, P5 IRKAd5nef and P7 MIRKAd~gag; for each adenovector, two infected A627836speci bottles were sampled at 24, 36, 48, and 60 hours post infection. In addition, two bottles were left unsampled until 48 hpi when they were harvested under the Phase I process conditions. The anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi timepoints are shown in Figure 29A-B. The QPA titers show a similar trend (data not shown).

Comparison ofhCMV- and mCMV-FL-nef- As the titers obtained with the construct (hCMV-FL-nef) were lower than those obtained with or MRKAd5pol, a viral productivity comparison experiment was performed with mCMV-FL-nef. For each of the two adenovectors (hCMV- and mCMV-FL-nef), two roller bottles were infected at an MOI of 280 vp/cell with passage five clarified lysate.

The macroscopic and microscopic observations of the four roller bottles were identical at the time of harvest. Analysis of the clarified lysate produced indicated a higher viral particle concentration in the bottles infected with mCMV-FL-nef, as shown in Table 19. It is stipulated that the higher productivity with mCMV promoter driven nef vector is due to lower nef expression levels in PER.C6® cells- experiments are underway at V&CB to measure nef expression levels.

Table 19. Passage Six Viral Productivity Comparison ofhCMV- and mCMV-FL-nef Xv (106 cells/ml), Cell Passage AEX Titer Titer Amplification Triton Lysis Titer Viability Infection Harvest Number 10'0 vp/ml culture 104 vp/cell Ratio 1010 vp/ml culture hCMV-FL-nef Pool 1.11,91% 60 1.5 1.4 50 2.8 1 1.23, 2 1.34,74% mCMV-FL-nef Pool 1.11,91% 60 2.3 2.1 75 4.6 1 1.49, 84% 2 1.18, 77% EXAMPLE 27 Characterization and Large Scale Production of Virus in Bioreactors Materials and Methods The experiment of the present example was run twice under the following conditions: 36.5 0 C, DO 30%, pH 7.30, 150rpm agitation rate, no sparging, Life Technologies (Gibco, Invitrogen) 293 SFM II (with 6mM L-glutamine), 0.5M NaOH as base for pH control. During the first run (B20010115), two 10L stirred vessel bioreactors were inoculated with PER.C6® cells at a concentration of 0.2x106 cells/ml. Cells were grown until they reached a cell concentration of approximately lx106 cells/ml. The cells were infected with uncloned MRKAd5nef (G2A,LLAA) at a MOI of 280 virus particles (vp)/cell. For the second batch (B20010202), the same procedure as the first run was used, except the cells were infected with cloned During both runs, the bioreactors were harvested 48 hours post-infection.

A627836speci Samples were taken and virus concentrations were determined from whole broth (with triton lysis), supernatant, and cell pellets (3 X freeze/thaw) with the AEX and QPA assays. Metabolites were measured with BioProfile 250 throughout the process.

Table 20: Experimental Conditions Temperature 36.5 C DO PH 7.30 Agitation 150 rpm Sparging None Table 21: Virus source used for experiments.

Run Batch ID Cloned/Uncloned MOI (vp/cells) #1 B20010115-1 Uncloned 280 B20010115-2 Uncloned 280 #2 B20010202-1 Cloned 280 B20010202-2 Cloned 280 Results Table 22 and 23 show an the ability to scale up production of by growth in a bioreactor.

Table 22: Virus Concentration as measured by the AEX assay Run Batch ID Cloned/Uncloned Virus Concentration 48hpi (1x0 I v/L) Supernatant Clarified Lysate Total Triton Lysate #1 B20010115-1 Uncloned 0.72 3.26 3.98 5.76 B20010115-2 Uncloned 0.38 1.67 2.05 2.46 #2 B20010202-1 Cloned 0.80 6.00 6.80 8.88 B20010202-2 Cloned 0.50 6.00 6.50 8.47 Table 23: Virus Titers as measured by the QPA assay Run Batch ID Cloned/Uncloned Virus Concentration 48hpi (lxl0" IU/L Whole Supernatant Clarified Total Triton Broth Lysate Lysate #1 B20010115-1 Uncloned 0.13 1.12 1.76 2.88 11.28 B20010115-2 Uncloned 0.14 0.73 1.54 2.27 5.86 #2 B20010202-1 Cloned 0.14 0.97 1.62 2.69 11.89 B20010202-2 Cloned 0.14 1.17 1.70 2.97 12.47 The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

EXAMPLE 28 MRKAd5HIV-1gag Boosting of DNA-Primed Animals Groups of 3-5 rhesus macaques were immunized with 5 mgs of V1Jns-Flgag (pVIJnsCMV(no intron)-FL-gag-bGHpA), 5 mgs of V1Jns-Flgag formulated with A627836speci 83 mgs of a non-ionic block copolymer CRL1005, or 5 mgs of V1Jns-Flgag formulated with 7.5 mgs of CRL1005 and 0.6 mM benzalkonium chloride at weeks 0, 4, and 8. All animals received a single dose of 10e7 viral particles (vp) of the MRKAd5HIV-lgag at week 26. Note: 10e7 is too low to prime or boost effectively when used as a single modality (dose is selected to mimic preexposure to adenovirus); see Figure 32.

Blood samples were collected from all animals at several time points and peripheral blood mononuclear cells (PBMCs) were prepared using standard Ficoll method. The PBMCs were counted and analyzed for gamma-interferon secretion using the ELISpot assay (Table 24). For each monkey, the PBMCs were incubated overnight either in the absence (medium) or presence of a pool (called "gag of 50 20-aa long peptides that encompass the entire HIV-1 gag sequence.

The results indicate that MRKAd5HIV-lgag was very effective in boosting the T cell immune responses in these monkeys. At week 28 or 2 weeks after the viral boost, the number of gag-specific T cells per million PBMCs increased 2-48 fold compared to the levels observed at week 24 or 2 weeks prior to the boost.

The PBMCs were also analyzed by intracellular gamma-interferon staining prior to (at week 10) and after the MRKAd5gag boost (at week 30). The results for select animals are shown on Figure 31. The results indicate that immunization with DNA/adjuvant formulation elicited T cell responses which can either be balanced, CD4 biased or CD8 -biased, and boosting with the MRKAd5gag construct produced in all cases a strongly CD8+-biased response. These results suggest that boosting with construct is able to improve the levels of antigen-specific CD8 T cells.

EXAMPLE 29 Construction of gagpol fusion for MRKAd5gagpol fusion constructs The open reading frames for the codon-optimized HIV-1 gag gene was fused directly to the open reading frame of the IA pol gene (consisting of RT, RNAseH and integrase domains) by stepwise PCR. Because the gene (SEQ ID NO:34) does not include the protease gene and the frameshift sequence, it encodes a single polypeptide of the combined size of p55, RT, RNAse H and integrase (1350 amino acids; SEQ ID The fragment that extends from the BstEII site within the gag gene to the last nonstop codon was ligated via PCR to a fragment that extends from the start codon of the lApol to a unique BamH/ site. This fragment was digested with BstEII and BamHI Construction of gag-IApol fusion was achieved via three-fragment ligation involving the Pstl-BstEII gag digestion fragment, the BstEII/BamHI digested PCR product and long Pstl/BamHIV1R-FLpol backbone fragment.

The MRKAd5-gagpol adenovirus vector was constructed using the BglII fragment of the V1R-gagpol containing the entire ORF of gag-IApol fusion gene.

A627836speci 2001294562 17 Sep 2004 Table 24. Boosting of DNAIAdjuvant-Primed Rhesus Monkeys with Number of SFC/mllionPBMCs Grp# Priming Boost Monk# T0 T4 T-6 T-10 T-17 T=24 T=28 T=30 T, 4,8 wks T26 wks Medium gag H Medium gag H edium gag H Medium gaq H Medium gag H Medium gag H Medium gag H Medium gag H 1 DNA/5 mngs MRKAd5gag(E3+) CB5H NA NA 3 35 15 71 1 4 224 8 115 6 85 19 956 0 316 PBS 107 vp CC6X 0 0 0 15 0 46 0 58 09 75 0 35 3 1705 1 (D101) AW3G 5 11 0 36 3 51 3 46 2 89 8 65 10 989 0 395 2 DNA/5mgs+ MRKAd5gag(E3+) CCIC 0 4 1 80 0 111 5 270 4 280 8 232 3 959 19 1345 CRL1005/45mgs 107 vp CC1K 4 0 1 101 0 254 0 791 5 452 0 321 0 191 1 1099 AW3P 9 8 1 10 4 71 4 154 8 104 5 85 11 838 6 241 CBSF NA NA 0 31 0 288 0 530 19 374 9 251 8 1549 20 1734 AKB8 9 12 4 36 1 119 0 439 0 425 0 316 4 1229 5 1354 3 DNA/S mgs, MRKAd5gag(E3+) AW20 10 4 1 59 5 284 19 425 6 105 9 205 18 565 8 404 CRL100.5 mgs 0.6 nM BAK 10 7 vp CA4R 1 0 3 121 1 135 1 270 5 130 1 105 14 1384 10 978 CB58 8 6 0 6 3 119 0 274 6 282 1 208 0 636 1 828 4 3 0 26 1 91 0 139 0 164 1 62 5 543 1 349 CB7D 1 0 0 136 0 316 1 609 5 626 1 759 0 2278 4 1831 4 none None 98D201 3 0 0 0 1 0 0 0 0 1 1 2 3 0 0 0 NA, not available EXAMPLE Immunogenicity Studies in Non-Human Primates Cohorts of three macaques were immunized with 10Oe8 or IlOel10 viral particles (vp) of one of the following MRK<Ad5 HIV-1 vaccines: MIRKAd5 gag; (2) M4RKAd5pol; MRK,'Ad~nef; a mixture containing equal amounts of and MiRKAd5nef, or a mixture of equal amounts of MRKAd~gagpol and MRKAd5nef. The vaccines were administered at weeks 0 and 4.

The T cell responses against each of the HIV- 1 antigens were assayed by IFNgamma ELISpot assay using poois of 20-aa, peptides that encompass the entire protein sequence of each antigen. The results (Table 25) are expressed as the number of spot- Table 25. Evaluation of Mixtures of MRKAd5 vectors expressing humanized HIV-1 Grp Vaccine Monk _T=6 wks 4 wks Mock Gag H Pol1 I Pol -2 Net 1 MRKAd5 gag CB9V 0 15 10A10 Vp CD19 0 374 109H 1 843 2 MRKAd5 gag 9913130 1 948 1lOA8 vp W277 16 324 143H 4 595 3 MRKAd5 pol CCIX 4 46 256 lOAlO Vp AW3W 3 463 550 AV43 6 95 1333 4 MRKAd5 pol AW38 1 19, 30 1lOA8 vp CC8K 0 50 995 CC21 1 33 436 MRKAd5 nef 0760 9 1204 1 OAl 0Vp 0910 4 083Q 0 176 6 MRKAd5 nef 00C029 1 114 lOA 8vp 98D022 6 170 980160 3 198 7 MRKAd5gag+MRKAd5poI+MRKAd5nef 990251 3 206 15 193 120 lOAlO vp each 05H 3 135 .21 9 638 00C016 3 26 4 51 23 8 MRKAd5gag+MRKAd~poI+MRKAd5nef 990215 1 171 18 193 240 10OA8 vp each 81H 5 73 6 14 243 12H 8 1140 115 811 719 9 MRKAd~gagpoI +MRKAd5 nef 99D21 1 0 83 56 838 725 vpeach 22H 4 385 119 1194 1915 61 H 4 343 11 765 853 MRKAdgagpoI +MRKAd5 nef 34H 3 78 19 5 OA 8 vp each 48H 1 65 105 46 43 5 158 15 220 191 Inaicated are numbers 01 spot-iorming cells per million F13 CS against thle pepiiue pools. LVIUI.K, n1o pepiUdes, ga ri, fifty 20-aa peptides encompassing p55 sequence; pal-I, 20-aa peptides representing N-terminal half of IA po1; pa1-2, peptides representing the carboxy-terminal half of IA pal;- nef, 20-aa peptides encompassing the entire wild-type nef sequence. Responses to the antigens prior ta the first immunization did not exceed 40 sfc/l A6 PBMC.

A627836speci forming cells (sfc) per million peripheral blood mononuclear cells (PBMC) that respond to each of the peptide pools.

Results indicate the following observations: each of the single gene constructs MRKAd5pol, or MRKAd5nef) is able to elicit high levels of antigenspecific T cells in monkeys; the single-gene MRKAd5 constructs can be mixed as a multi-cocktail formulation capable of eliciting very broad T cell responses against gag, pol, and nef; the MRKAd5 vector expressing the fusion protein of gag plus IA pol is capable of inducing strong T cell responses to both gag and pol.

A627836speci

Claims (26)

1. A recombinant adenoviral vector at least partially deleted in El and devoid of El activity, comprising: a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between from about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) at least one gene encoding an HIV protein selected from the group consisting of HIV gag, nef, pol, and immunologically relevant modifications thereof, wherein the at least one gene comprises codons optimized for expression in a human; and wherein the at least one gene is inserted into an El region in an El parallel orientation.

2. An adenoviral vector in accordance with claim 1 comprising a packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome.

3. An adenoviral vector in accordance with claim 1 further comprising nucleotides corresponding to between from about base pair 3511 to about 3524 to about base pair 5798 of a wildtype adenovirus genome.

4. An adenoviral vector in accordance with claim 3 comprising base pairs corresponding to 1-450 and 3511-5798 of a wildtype adenovirus genome. An adenoviral vector in accordance with claim 4 which is deleted of base pairs 451-3510.

6. An adenoviral vector in accordance with claim 1 which is at least partially deleted in E3.

7. An adenoviral vector in accordance with claim 6 wherein the E3 deleted region is from base pairs 28,133-30,818.

8. An adenoviral vector in accordance with claim 1 wherein the vector comprises a gene expression cassette comprising: a) a nucleic acid encoding a protein; b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and c) a transcription termination sequence. 749193 I:LNB 88

9. An adenoviral vector in accordance with claim 8 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences. An adenoviral vector in accordance with claim 9 wherein the promoter is an immediate early human cytomegalovirus promoter.

11. An adenoviral vector in accordance with claim 8 wherein the promoter is a murine cytomegalovirus promoter. I 12. An adenoviral vector in accordance with claim 8 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription C, termination sequence. S 10 13. An adenoviral vector in accordance with any one of the preceding claims CNi comprising SEQ ID NO: 27.

14. An adenoviral vector in accordance with any of the preceding claims comprising sequence selected from the group consisting of nucleotides 10-2559 of SEQ ID NO: 1, nucleotides 10-2559 of SEQ ID NO: 3, nucleotides 8-2632 of SEQ ID NO: and nucleotides 8-2632 of SEQ ID NO: 7. An adenoviral vector in accordance with any of the preceding claims comprising sequence selected from the group consisting of nucleotides 12-659 of SEQ ID NO: 9, nucleotides 2-712 of SEQ ID NO: 11, nucleotides 12-659 of SEQ ID NO: 13, and nucleotides 2-712 of SEQ ID NO:

16. A cell comprising an adenoviral vector in accordance with any of the preceding claims.

17. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of an adenoviral vector in accordance with any of claims 1-15 into a cell line which expresses adenovirus El protein at complementing levels.

18. An HIV vaccine composition comprising recombinant, replication-defective adenovirus particles in accordance with claim 17.

19. An HIV vaccine composition in accordance with claim 18 which comprises a physiologically acceptable carrier.

20. A method of producing recombinant, replication defective adenovirus particles containing an adenoviral genome of an adenoviral vector in accordance with any of claims 1-15 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral El protein, and harvesting the resultant recombinant, replication- defective adenovirus. 749193 1:LNB

21. A method in accordance with claim 20 wherein the cell expresses a transgene inclusive of nucleotides 459-3510 of adenovirus serotype

22. A method of generating a cellular-mediated immune response against HIV in an individual comprising administering to the individual a vaccine composition in accordance with claim 18.

23. A method in accordance with claim 22 which further comprises administration to the individual a DNA plasmid vaccine, optionally administered with a biologically effective adjuvant, protein or other agent capable of increasing the immune response.

24. A method in accordance with claim 23 wherein the DNA plasmid vaccine is administered to the individual prior to administration of the vaccine composition. A method in accordance with claim 22 wherein the vaccine composition is preceded by a vaccine composition comprising purified recombinant, replication- defective adenvirus particles of a different serotype.

26. A method in accordance with claim 22 which comprises administering and readministering the vaccine composition to the individual.

27. A multivalent adenovirus vaccine composition which comprises recombinant, replication-defective adenovirus particles, harvested and purified from a cell line(s) transfected with a recombinant adenoviral vector(s) of claim 1; said cell line(s) expressing adenovirus El protein at complementing levels; said recombinant adenoviral vector(s) being at least partially deleted in El and devoid of El activity, and comprises: a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) a gene expression cassette or cassettes comprising nucleotide sequences encoding HIV proteins selected from the group consisting of: i) gag, pol, and nef, expressed independently from three individual vectors; ii) gag, pol, and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; iii) gag, pol, and nef, expressed via two vectors, one expressing a pol- nef fusion, and another expressing gag; iv) gag, pol, and nef, expressed via two vectors, one expressing a gag- pol fusion and another expressing nef; 749193 1:LNB v) gag, pol and nef, expressed via two vectors, one expressing a nef- gag fusion and another expressing pol; vi) gag, pol, and nef, expressed via one vector expressing a gag-pol- nef fusion; vii) gag and pol, expressed independently from two individual vectors; viii) gag and pol, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; ix) pol and nef, expressed independently from two individual vectors; x) pol and nef, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; xi) nef and gag, expressed independently from two individual vectors; xii) nef and gag, expressed independently from one vector with the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences; xiii) gag and pol, expressed via one vector expressing a gag-pol fusion; xiv) pol and nef, expressed via one vector expressing a pol-nef fusion; and xv) nef and gag, expressed via one vector expressing a nef-gag fusion.

28. A multivalent adenovirus vaccine composition in accordance with claim 27 wherein the gag-pol fusion comprises SEQ ID NO:

29. A multivalent adenovirus vaccine composition in accordance with claim 27 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to distinct promoters and transcription termination sequences. A multivalent adenovirus vaccine composition in accordance with claim 27 wherein the fused sequences have the encoding nucleic acid sequences operatively linked to a single promoter; and the encoding nucleic acid sequences operatively linked by an internal ribosome entry sequence ("IRES").

31. A recombinant adenoviral vector in accordance with claim 1 which comprises: at least one gene encoding an HIV gag protein; wherein the at least one gene comprises codons optimized for expression in a human; and wherein the at least one gene is inserted into an El region in an El parallel orientation; said recombinant adenoviral vector which comprises, or is administered in combination with, a recombinant adenoviral vector which comprises at least one 749193 I:LNB additional gene encoding an HIV protein; wherein the at least one additional gene is c selected from the group consisting of HIV nef, pol, and immunologically relevant modifications thereof; wherein the at least one additional gene is inserted into an El region in an El parallel orientation; and wherein the at least one additional gene comprises codons optimized for expression in a human.

32. A recombinant adenoviral vector substantially as hereinbefore described Swith reference to any one of the examples. \0 t) 33. A cell comprising the adenoviral vector of claim 31.

34. Recombinant, replication-defective adenovirus particles substantially as hereinbefore described with reference to any one of the examples. A method of producing the recombinant, replication-defective adenovirus substantially as hereinbefore described with reference to any one of the examples. Dated 4 May 2007 Merck Co., Inc. Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON 749193 1:LNB