Oligonukleotide oder PNA-Oligomere und Verfahren zur parallelen Detektion des Methylierungszustandes genomischer DNA Oligonucleotides or PNA oligomers and methods for the parallel detection of the methylation state of genomic DNA
Die vorliegende Erfindung betrifft Oligonukleotide oder PNA-Oligomere und ein Verfahren zur parallelen Detektion des Methylierungszustandes von genomischer DNA.The present invention relates to oligonucleotides or PNA oligomers and a method for the parallel detection of the methylation state of genomic DNA.
Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung die- ser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelier- bar. Insofern äußern sich pathogene Zustände in einem veränderten Methylie- rungsmuster einzelner Gene oder des Genoms.The observation levels that have been well studied in molecular biology according to the methodological developments of recent years are the genes themselves, the translation of these genes into RNA and the resulting proteins. When in the course of the development of an individual which gene is switched on and how activation and inhibition of certain genes in certain cells and tissues is controlled can be correlated with the extent and character of the methylation of the genes or the genome. In this respect, pathogenic conditions are expressed in a changed methylation pattern of individual genes or the genome.
Stand der Technik sind Verfahren, welche das Studium von Methylierungsmustern einzelner Gene gestatten. Jüngere Fortentwicklungen dieser Methode erlauben auch die Analyse kleinster Mengen an Ausgangsmaterial. Die vorliegende Erfindung beschreibt ein Verfahren zur parallelen Detektion des Methylierungszustandes genomischer DNA Proben, wobei ausgehend von einer Probe gleichzeitig zahlreiche verschiedenene Fragmente aus an der Genregulation beteiligten oder/und transkribierten und/oder translatierten Sequenzen amplifiziert werden und anschließend der Sequenzkontext in den amplifizierten Fragmenten enthaltenen CpG Dinukleotide untersucht wird.State of the art are methods that allow the study of methylation patterns of individual genes. Recent developments in this method also allow the analysis of the smallest quantities of starting material. The present invention describes a method for parallel detection of the methylation state of genomic DNA samples, starting from a sample simultaneously amplifying numerous different fragments from sequences involved or / and transcribed and / or translated sequences and then the sequence context contained in the amplified fragments of CpG Dinucleotides is examined.
5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryoti- scher Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, genomischem Imprinting und in der Tumorgenese. Die Identifizierung von 5- Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem5-methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, genomic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable importance
Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR-Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.
Die Modifikation der genomischen Base Cytosin zu 5'-Methylcytosin stellt den bis heute wichtigsten und bestuntersuchten epigenetischen Parameter dar. Trotzdem gibt es bis heute zwar Methoden, umfassende Genotypen von Zellen und Individuen zu ermitteln, aber noch keine vergleichbaren Ansätze auch in großem Maße epige- notypische Information zu generieren und auszuwerten.Interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. In addition, in the case of PCR amplification, the epigenetic information which the 5-methylcytosines carry is completely lost. The modification of the genomic base cytosine to 5'-methylcytosine represents the most important and best-researched epigenetic parameter to date. Nevertheless, there are still methods to determine comprehensive genotypes of cells and individuals, but no comparable approaches, even to a large extent, are epigenetic. Generate and evaluate non-typical information.
Es sind im Prinzip drei verschiedene Methoden bekannt, den 5-Methyl-Status eines Cytosins im Sequenzkontext zu bestimmen.In principle, three different methods are known for determining the 5-methyl status of a cytosine in the sequence context.
Die erste prinzipielle Methode beruht auf der Verwendung von Restriktionsendo- nukleasen (RE), welche „methylierungssensitiv" sind. REs zeichnen sich dadurch aus, daß sie an einer bestimmten DNA-Sequenz, meist zwischen 4 und 8 Basen lang, einen Schnitt in die DNA einführen. Die Position solcher Schnitte kann dann durch Gelektrophorese, Transfer auf eine Membran und Hybridisierung nachgewiesen werden. Methylierungssensitiv bedeutet, daß bestimmte Basen innerhalb der Erkennungssequenz unmethyliert vorliegen müssen, damit der Schnitt erfolgen kann. Das Bandenmuster nach einem Restriktionsschnitt und Gelektrophorese ändert sich also je nach Methylierungsmuster der DNA. Allerdings befinden sich die wenigsten methylierbaren CpG innerhalb von Erkennungssequenzen von REs, können also nach dieser Methode nicht untersucht werden.The first principal method is based on the use of restriction endonucleases (RE), which are "methylation-sensitive". REs are characterized by the fact that they cut a DNA into a specific DNA sequence, usually between 4 and 8 bases long The position of such sections can then be verified by gel electrophoresis, transfer to a membrane and hybridization. Methylation-sensitive means that certain bases within the recognition sequence must be unmethylated in order for the section to be carried out according to the methylation pattern of the DNA However, the fewest methylable CpG are within the recognition sequences of REs and cannot be examined with this method.
Die Empfindlichkeit dieser Methoden ist extrem niedrig (Bird, A.P., and Southern, E.M., J.Mol. Biol. 118, 27-47). Eine Variante kombiniert PCR mit dieser Methode, eine Amplifikation durch zwei auf beiden Seiten der Erkennungssequenz liegendeThe sensitivity of these methods is extremely low (Bird, A.P., and Southern, E.M., J.Mol. Biol. 118, 27-47). A variant combines PCR with this method, an amplification by two lying on both sides of the recognition sequence
Primer erfolgt nach einem Schnitt nur dann, wenn die Erkennungssequenz methy- liert vorliegt. Die Empfindlichkeit steigt in diesem Fall auf theoretisch ein einziges Molekül der Zielsequenz, allerdings können mit hohem Aufwand nur einzelne Positionen untersucht werden (Shemer, R. et al., PNAS 93, 6371-6376). Wiederum ist Voraussetzung, daß sich die methylierbare Position innerhalb der Erkennungssequenz einer RE befindet.Primer only occurs after a cut if the recognition sequence is methylated. In this case, the sensitivity increases theoretically to a single molecule of the target sequence, but only individual positions can be examined with great effort (Shemer, R. et al., PNAS 93, 6371-6376). Again, it is a prerequisite that the methylable position is within the recognition sequence of a RE.
Die zweite Variante beruht auf partieller chemischer Spaltung von Gesamt-DNA, nach dem Vorbild einer Maxam-Gilbert Sequenzierreaktion, Ligation von Adaptoren
an die so generierten Enden, Amplifikation mit generischen Primern und Auftrennung auf einer Gelektrophorese. Mit diesem Verfahren können definierte Bereiche bis zur Größe von weniger als tausend Basenpaaren untersucht werden. Das Verfahren ist allerdings so kompliziert und unzuverlässig, daß es praktisch nicht mehr verwendet wird (Ward, C. et al., J. Biol. Chem. 265, 3030-3033).The second variant is based on partial chemical cleavage of total DNA, modeled on a Maxam-Gilbert sequencing reaction, ligation of adapters to the ends thus generated, amplification with generic primers and separation on a gel electrophoresis. With this method, defined areas up to the size of less than a thousand base pairs can be examined. However, the process is so complicated and unreliable that it is practically no longer used (Ward, C. et al., J. Biol. Chem. 265, 3030-3033).
Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulphit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil um- gewandelt wird, welches in seinem Basen-Paarungsverhalten dem Thymidin entspricht. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, daß Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch „normale" molekularbiologische Techniken als einzig ver- bliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt werden kann.A relatively new and the most frequently used method for examining DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, which is converted into uracil after alkaline hydrolysis, which corresponds to the thymidine in its base-pairing behavior. However, 5-methylcytosine is not modified under these conditions. The original DNA is thus converted in such a way that methylcytosine, which originally cannot be distinguished from the cytosine by its hybridization behavior, can now be detected by “normal” molecular biological techniques as the only remaining cytosine, for example by amplification and hybridization or sequencing. All of these techniques are based on base pairing, which can now be fully exploited.
Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulphit reagiert nur an ein- zelsträngiger DNA) verhindert und alle Fäliungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek, A. et al., Nucl. Acids. Res. 24, 5064-5066). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Me- thode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwaThe state of the art in terms of sensitivity is defined by a method which encloses the DNA to be examined in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulphite only reacts on single-stranded DNA) and all precipitation and purification steps replaced by rapid dialysis (Olek, A. et al., Nucl. Acids. Res. 24, 5064-5066). With this method, individual cells can be examined, which illustrates the potential of the method. However, so far only individual regions are up to about
3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausende von möglichen Methylierungsereignissen ist nicht möglich.3000 base pairs in length, global examination of cells for thousands of possible methylation events is not possible.
Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nach- zuweisen, kann auch dem folgenden Übersichtsartikel entnommen werden: Rein,An overview of the other known ways of detecting 5-methylcytosine can also be found in the following review article: Rein,
T., DePamphilis, M. L, Zorbas, H., Nucleic Acids Res. 26, 2255 (1998).T., DePamphilis, M. L, Zorbas, H., Nucleic Acids Res. 26, 2255 (1998).
Die Bisulphit-Technik wird bisher bis auf wenige Ausnahmen (z.B. Zeschnigk, M. et al., Eur. J. Hum. Gen. 5, 94-98; ubota T. et al., Nat. Genet. 16, 16-17) nur in der
Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulphit-Behandlung amplifiziert und entweder komplett sequenziert (Olek, A. and Walter, J., Nat. Genet. 17, 275-276) oder einzelne Cyto- sin-Positionen durch eine „Primer-Extension-Reaktion" (Gonzalgo, M. L. and Jones, P.A., Nucl. Acids. Res. 25, 2529-2531) oder Enzymschnitt (Xiong, Z. and Laird,The bisulphite technique has so far been used with a few exceptions (e.g. Zeschnigk, M. et al., Eur. J. Hum. Gen. 5, 94-98; ubota T. et al., Nat. Genet. 16, 16-17 ) only in the Research applied. However, short, specific pieces of a known gene are always amplified after a bisulfite treatment and either completely sequenced (Olek, A. and Walter, J., Nat. Genet. 17, 275-276) or individual cytosine positions by one "Primer extension reaction" (Gonzalgo, ML and Jones, PA, Nucl. Acids. Res. 25, 2529-2531) or enzyme section (Xiong, Z. and Laird,
P.W., Nucl. Acids. Res. 25, 2532-2534) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al, WO 99/28498 A1).P.W., Nucl. Acids. Res. 25, 2532-2534). Detection by hybridization has also been described (Olek et al, WO 99/28498 A1).
Für die Korrelation zwischen Genaktivität und Methylierungsgrad ist vor allem die Methylierungsanalyse in Promotoren von Bedeutung.The methylation analysis in promoters is particularly important for the correlation between gene activity and degree of methylation.
Gemeinsamkeiten zwischen Promotoren bestehen nicht nur im Vorkommen von TATA- oder GC-Boxen sondern auch darin, für welche Transkriptionsfaktoren sie Bindestellen besitzen und in welchem Abstand diese sich zueinander befinden. Die existierenden Bindestellen für ein bestimmtes Protein stimmen in ihrer Sequenz nicht vollständig überein, es finden sich aber konservierte Folgen von mindestens 4 Basen, die durch das Einfügen von „Wobbles,,, d. h. Positionen, an denen sich jeweils unterschiedliche Basen befinden, noch verlängert werden können. Des weiteren liegen diese Bindestellen in bestimmten Abständen zueinander vor.Similarities between promoters exist not only in the occurrence of TATA or GC boxes, but also in the transcription factors for which they have binding sites and the distance between them. The existing binding sites for a certain protein do not completely match in their sequence, but there are conserved sequences of at least 4 bases, which are inserted by inserting "wobbles", i.e. H. Positions where there are different bases can still be extended. Furthermore, these binding sites are at certain distances from each other.
Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21 , January 1999), der dort zitierten Literatur und dem US-Patent 5994065 über Methoden zur Herstellung von festen Trägern für Zielmoleküle wie Oligonukleotide bei vermindertem nichtspezifischem Hintergrundsignal entnehmen.An overview of the state of the art in oligomer array production can be found in a special edition of Nature Genetics published in January 1999 (Nature Genetics Supplement, Volume 21, January 1999), the literature cited therein and US patent 5994065 on methods for production from solid supports for target molecules such as oligonucleotides with a reduced non-specific background signal.
Als Sonden, die in einem Oiigomer-Array auf einer Oberfläche fixiert werden, kommen Oligonukleotide in Frage, jedoch bietet sich auch jede Modifikation von Nuk- ieinsäuren an, z.B. Peptide Nucleic Acids (PNA), (Nielsen, P.E., Buchardt, O., Eg- holm, M. and Berg, R.H. 1993. Peptide nucleic acids. US Patent. 5,539,082; Buchardt, O., Egholm, M., Berg, R.H. and Nielsen, P.E. 1993. Peptide nucleic acids and their potential applications in biotechnology. Trends in Biotechnology, 11 : 384- 386), Phosphorothioatoligonukleotide oder Methylphosphonatoligonukleotide.
Matrix-assistierte Laser Desorptions/Ionisations Massenspektrometrie (MALDI) ist eine neue, sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Ka- ras, M. and Hillenkamp, F. 1988. Laser desorption ionization of proteins with mo- lecular masses exceeding 10.000 daltons. Anal. Chem. 60: 2299-2301). Ein Ana- lytmolekül wird in eine im UV absorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix ins Vakuum verdampft und das Analyt so unfragmentiert in die Gasphase befördert. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unter- schiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere und die Flugzeit wird in die Masse der Ionen umgerechnet.Oligonucleotides can be used as probes, which are fixed on a surface in an oligomer array, but any modification of nucleic acids is also suitable, for example peptide nucleic acids (PNA), (Nielsen, PE, Buchardt, O., Egholm, M. and Berg, RH 1993. Peptide nucleic acids. US Patent. 5,539,082; Buchardt, O., Egholm, M., Berg, RH and Nielsen, PE 1993. Peptide nucleic acids and their potential applications in biotechnology. Trends in Biotechnology, 11: 384-386), phosphorothioate oligonucleotides or methylphosphonate oligonucleotides. Matrix-assisted laser desorption / ionization mass spectrometry (MALDI) is a new, very powerful development for the analysis of biomolecules (Karas, M. and Hillenkamp, F. 1988. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons Anal Chem. 60: 2299-2301). An analyte molecule is embedded in a matrix that absorbs in the UV. A short laser pulse evaporates the matrix into a vacuum, thus transporting the analyte unfragmented into the gas phase. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones and the flight time is converted into the mass of the ions.
Genomische DNA wird durch Standardmethoden aus DNA von Zeil-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Refe- renzen wie Fritsch und Maniatis eds., Molecular Cloning: A Laboratory Manual,Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual,
1989.1989th
Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoreszent markierte Sonden verwendet worden. Besonders geeignet sind für die Fluoreszenzmar- kierung ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'OH der jeweiligen Probe. Die Detektion der Fluoreszenz der hybridisierten Proben erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.Fluorescent-labeled probes have been used in many cases for scanning an immobilized DNA array. The simple application of Cy3 and Cy5 dyes to the 5'OH of the respective sample is particularly suitable for fluorescence labeling. The fluorescence of the hybridized samples is detected, for example, using a confocal microscope. The dyes Cy3 and Cy5, among many others, are commercially available.
Die vorliegende Erfindung soll ein Verfahren und einen Satz von Oligonukleotiden oder PNA-Oligomeren bereitstellen, welche sich zur parallelen Detektion des Methylierungszustandes von genomischer DNA eignen. Es sollen bevorzugt genomweit repräsentative CpG-Positionen auf Methylierung hin abgetastet werden unter Verwendung bestimmter, besonders geeigneter Oligomersonden. Zudem sollen unter- schiedliche Fragmente gleichzeitig aus einer genomischen DNA-Probe amplifiziert werden.The present invention is intended to provide a method and a set of oligonucleotides or PNA oligomers which are suitable for the parallel detection of the methylation state of genomic DNA. CpG positions representative of the genome should preferably be scanned for methylation using certain, particularly suitable oligomer probes. In addition, different fragments are to be amplified simultaneously from a genomic DNA sample.
Die vorliegende Erfindung beschreibt ein Verfahren und einen Satz von Oligonukleotiden oder PNA-Oligomeren zur parallelen Detektion des Methylierungszustandes
:ε(α)90ivi99iε(α) :ε(α)90ivi990ε(α) *ε(α)9±±vi99iε(αThe present invention describes a method and a set of oligonucleotides or PNA oligomers for the parallel detection of the methylation state : ε (α) 90ivi99i ε (α): ε (α) 90ivi990 ε (α) * ε (α) 9 ±^ vi99i ε (α
*(H)0V90±V*(H) .*(H)θWO±V*(H) .*(α)ιvQθio*(α) t7(α)ιv9iιot7(α (H)901VΘ0*(H) - (H)θ01WO (H) :t'(H)V01V90t'(H) t7(H)V01WOt7(H* (H) 0V90 ± V * (H) * (H) θWO ± V * (H) * (α) ιvQθio * (α) t7 (α) ιv9iιo t7 (α (H) 901VΘ0 * (H).. - (H) θ01WO (H): t '(H) V01V90 t' (H) t7 (H) V01WO t7 (H
*(α)Θ0ivΘ0*(α) .*(α)oιιvoo*(α) .*(α)9θivoι*(α) t7(α)9iιv9it7(α :*(H)±IΘOW*(H) :*(α)ιιoow*(α) :*(H).LIVOW*(H) (α)±±oιw (α' oε* (α) Θ0ivΘ0 * (α) * (α) oιιvoo * (α) * (α) 9θivoι * (α) t7 (α) 9iιv9i t7 (α:.. * (H) ± IΘOW * (H) * (α) ιιoow * (α): * (H) .LIVOW * (H) (α) ±^ oιw (α ' oε
- (H)00V190 (H) -fr(H)VOV±QO*(H) : (H)OOV±VO (H) l7(H)VOVlVOl7(H- (H) 00V190 (H) - fr (H) VOV ± QO * (H): (H) OOV ± VO (H) l7 (H) VOVlVO l7 (H
-*(α)oov±9θ (α) -*(α)oovιo± (α) : (α)9iv±oo (α) (α)oιv±ΘJL (α- * (α) oov ± 9θ (α) - * (α) oovιo ± (α): (α) 9iv ± oo (α) (α) oιv ± ΘJL (α
:t7(H)09390vl7(H) ^(α)ιooΘθö^(α) *l7(H)ovovovt7(H) :t7(α)i9i9i9l7(α: T7 (H) 09390v l7 (H) ^ (α) ιooΘθö ^ (α) * l7 (H) ovovov t7 (H): t7 (α) i9i9i9 l7 (α
:l7(H)vo9θvιl7(H) :*(H)VOVOVI*(H) .*(α)v±ooΘi (α) :t7(α)vιoi9it'(α: l7 (H) vo9θvι l7 (H): * (H) VOVOVI * (H). * (α) v ± ooΘi (α): t7 (α) vιoi9i t '(α
:ε(H)0V00V90Vε(H 9Z: ε (H) 0V00V90V ε (H 9Z
:ε(H)0900V90Vε(H) *ε(H)θ9θθwovε(H) *ε(H)ovoowovε(H: ε (H) 0900V90V ε (H) * ε (H) θ9θθwov ε (H) * ε (H) ovoowov ε (H
:ε(α)i90i99i9ε(α :ε(α)i90i9909ε(α) :ε(α)i9J_L9909ε(α) *ε(α)i9i±99±9ε(α :*(H)±OOOOV*(H) .*(α)±o±oιv*(α) .*(H)±VOVOV*(H) :*(α)±oιo±v*(α: :t(H)W900il7(H) :t7(H)wvooιt7(H) • (α)v990JL±t'α) -*(α)voouLi (α: 02 :*(H)V±ΘOV±*(H) -*(α)vi90v±*(α) -*(H)VIVOV.]*(H) :l7(α)vi9iv±^(α :*(H)V±QOVO*(H) :*(H)V±VOVO*(H) •*(Q)Ό±QOVIHQ) :*(α)oιo±v±*(α' - (H)±090W (H) : (H)±OVOW (H) - (α)±±ooov (α) • (α)±ιo±ovtr(α: ε (α) i90i99i9 ε (α: ε (α) i90i9909 ε (α): ε (α) i9J_L9909 ε (α) * ε (α) i9i ± 99 ± 9 ε (α: * (H) ± OOOOV * (H). * (Α) ± o ± oιv * (α). * (H) ± VOVOV * (H): * (α) ± oιo ± v * (α:: t (H) W900i l7 (H) : t7 (H) wvooι t7 (H) • (α) v990JL ± t 'α) - * (α) voouLi (α: 02: * (H) V ± ΘOV ± * (H) - * (α) vi90v ± * (α) - * (H) VIVOV. ] * (H): l7 (α) vi9iv ± ^ (α: * (H) V ± Q OVO * (H): * (H) V ± VOVO * (H ) • * ( Q ) Ό ± QOVIH Q ): * (α) oιo ± v ± * (α ' - (H) ± 090W (H): (H) ± OVOW (H) - (α) ±^ ooov ( α) • (α) ± ιo ± ov tr (α
:ε(H)ooosvoo^(H: ε (H) ooosvoo ^ (H
^(H)900SV90ε(H) :ε(H)VOOSVΘO^(H) :t'(H)V00SV90ε(H ςτ^ (H) 900SV90 ε (H): ε (H) VOOSVΘO ^ (H): t '(H) V00SV90 ε (H ςτ
-ε(H)900SWO (H :t'(H)900SW0ε(H) :ε(H)vooswot7(H) ^(H)V00SW0ε(H- ε (H) 900SWO (H t '(H) 900SW0 ε (H): ε (H) vooswo t7 (H) ^ (H) V00SW0 ε (H
^(αϊooiMOΘO^α ^(α)90iΛΛ990ε(α) :ε(α)90iM99il(α) :t7(α)90iM99iε(α^ (αϊooiMOΘO ^ α ^ (α) 90iΛΛ990 ε (α): ε (α) 90iM99i l (α): t7 (α) 90iM99i ε (α
:ε(α)oii θoofr(α oτ: ε (α) oii θoo fr (α oτ
:t7(α)9J_LΛ990ε(α) •ε(α)91±ΛΛ99J/'(α) :l7(α)9J_LM99iε(α: t7 (α) 9J_LΛ990 ε (α) • ε (α) 91 ± ΛΛ99J / ' (α): l7 (α) 9J_LM99i ε (α
•*(H)IVOOIV*(H)
• * (H) IVOOIV * (H)
- (H)WOO.LL (H) -t7(α)w90iιt'(α) . (H)VWO±± (H) . (α)W9iι± (α- (H) WOO.LL (H) - t7 (α) w90iι t '(α) . (H) VWO ± (H). (α) W9iι ± (α
:*(H)WOOO±*(H) .*(H)WOVOI*(H) .*(α)voθ9i±*(α) :t7(α)v9i9iιt7(α: * (H) WOOO ± * (H) . * (H) WOVOI * (H) * (α) voθ9i ± * (α). T7 (α) v9i9iι t7 (α
•*(H)0190W*(H) :*(H)O±VOW*(H) .*(α)±±90V9*(α)
• * (H) 0190W * (H): * (H) O ± VOW * (H) . * (Α) ±± 90V9 * (α)
--TOBJ -uin uθzuθnbθsuθseg uθpuθß|θj Jθp ΘUIΘ p|}θθ|>|nuo6!io UJΘ
'zjes uθpuθß|oj uiθp UΘUIUIB}S}UΘ θJθuιo6j|θ-VNd J9P0 θP!lθθ|>|nuo6!io SjQ VNQ Jθipsjiuouθß--TOBJ -uin uθzuθnbθsuθseg uθpuθß | θj Jθp ΘUIΘ p |} θθ |> | nuo6! Io UJΘ 'zjes uθpuθß | oj uiθp UΘUIUIB} S} UΘ θJθuιo6j | θ-VNd J9P0 θP! lθθ |> | nuo6! io SjQ VNQ Jθipsjiuouθß
68010/lθad/lDd 01689/10 OΛV
D)3CGGTATTG(D)3;68010 / lθad / lDd 01689/10 OΛV D) 3 CGGTATTG (D) 3 ;
H)3CAATACCA(H)3; (H)3CGATACCG(H)3; (H)3CGATACCA(H)3;H) 3 CAATACCA (H) 3 ; (H) 3 CGATACCG (H) 3 ; (H) 3 CGATACCA (H) 3 ;
H)3CAATACCG(H)3;H) 3 CAATACCG (H) 3 ;
D)4TGTTTT(D)4; (D)4CGTπT(D)4; (H)4AAAACA(H)4; (H)4AAAACG(H)4;D) 4TGTTTT (D) 4 ; (D) 4 CGTπT (D) 4 ; (H) 4 AAAACA (H) 4 ; (H) 4 AAAACG (H) 4 ;
D)3GTGTATG(D)4; (D)4GTGTATG(D)3; (D)3GTGTACG(D)4;D) 3 GTGTATG (D) 4 ; (D) 4 GTGTATG (D) 3 ; (D) 3 GTGTACG (D) 4 ;
D)4GTGTACG(D)3;D) 4 GTGTACG (D) 3 ;
H)3CATACAC(H)4; (H)4CATACAC(H)3; (H)3CGTACAC(H)4;H) 3 CATACAC (H) 4 ; (H) 4 CATACAC (H) 3 ; (H) 3 CGTACAC (H) 4 ;
H)4CGTACAC(H)3;H) 4 CGTACAC (H) 3 ;
D)4GATTG(D)5; (D)5GATTG(D)4; (D)4GATCG(D)5; (D)5GATCG(D)4;D) 4 GATTG (D) 5 ; (D) 5 GATTG (D) 4 ; (D) 4 GATCG (D) 5 ; (D) 5 GATCG (D) 4 ;
H)4CAATC(H)5; (H)5CAATC(H)4; (H)4CTAGC(H)5; (H)5CTAGC(H)4;H) 4 CAATC (H) 5 ; (H) 5 CAATC (H) 4 ; (H) 4 CTAGC (H) 5 ; (H) 5 CTAGC (H) 4 ;
D)3TGTATATG(D)3; (D)3TGTATACG(D)3; (D)3CGTATATG(D)3;D) 3 TGTATATG (D) 3 ; (D) 3 TGTATACG (D) 3 ; (D) 3 CGTATATG (D) 3 ;
D)3CGTATACG(D)3;D) 3 CGTATACG (D) 3 ;
H)3CATATACA(H)3; (H)3CGTATACA(H)3; (H)3CATATACG(H)3;H) 3 CATATACA (H) 3 ; (H) 3 CGTATACA (H) 3 ; (H) 3 CATATACG (H) 3 ;
H)3CGTATACG(H)3;H) 3 CGTATACG (H) 3 ;
D)3TGAGTTTG(D)3; (D)3TGAGTTCG(D)3; (D)3CGAGTTTG(D)3;D) 3 TGAGTTTG (D) 3 ; (D) 3 TGAGTTCG (D) 3 ; (D) 3 CGAGTTTG (D) 3 ;
D)3CGAGTTCG(D)3;D) 3 CGAGTTCG (D) 3 ;
H)3CAAACTCA(H)3; (H)3CGAACTCA(H)3; (H)3CAAACTCG(H)3;H) 3 CAAACTCA (H) 3 ; (H) 3 CGAACTCA (H) 3 ; (H) 3 CAAACTCG (H) 3 ;
H)3CGAACTCG(H)3;H) 3 CGAACTCG (H) 3 ;
D)3TGTTAATG(D)3; (D)3CGTTAATG(D)3; (D)3TGTTAACG(D)3;D) 3 TGTTAATG (D) 3 ; (D) 3 CGTTAATG (D) 3 ; (D) 3 TGTTAACG (D) 3 ;
D)3CGTTAACG(D)3;D) 3 CGTTAACG (D) 3 ;
H)3CATTAACA(H)3; (H)3CATTAACG(H)3; (H)3CGTTAACA(H)3;H) 3 CATTAACA (H) 3 ; (H) 3 CATTAACG (H) 3 ; (H) 3 CGTTAACA (H) 3 ;
H)3CGTTAACG(H)3;H) 3 CGTTAACG (H) 3 ;
D)4TGTATG(D)4; (D)4TGTACG(D)4; (D)4CGTATG(D)4; (D)4CGTACG(D)4;D) 4 TGTATG (D) 4 ; (D) 4 TGTACG (D) 4 ; (D) 4 CGTATG (D) 4 ; (D) 4 CGTACG (D) 4 ;
H)4CATACA(H)4; (H)4CGTACA(H)4; (H)4CATACG(H)4; (H)4CGTACG(H)4;H) 4 CATACA (H) 4 ; (H) 4 CGTACA (H) 4 ; (H) 4 CATACG (H) 4 ; (H) 4 CGTACG (H) 4 ;
D)3GGTCGGTT(D)3; (D)3GGTTGGTT(D)3; (H)3AACCGACC(H)3;D) 3 GGTCGGTT (D) 3 ; (D) 3 GGTTGGTT (D) 3 ; (H) 3 AACCGACC (H) 3 ;
H)3AACCAACC(H)3;H) 3 AACCAACC (H) 3 ;
D)4GACGT(D)5; (D)5GACGT(D)4; (D)4GATGT(D)5; (D)5GATGT(D)4;D) 4 GACGT (D) 5 ; (D) 5 GACGT (D) 4 ; (D) 4 GATGT (D) 5 ; (D) 5 GATGT (D) 4 ;
H)4ACGTC(H)5; (H)5ACGTC(H)4; (H)4ACATC(H)5; (H)5ACATC(H)4;H) 4 ACGTC (H) 5 ; (H) 5 ACGTC (H) 4 ; (H) 4 ACATC (H) 5 ; (H) 5 ACATC (H) 4 ;
D)4GGCGTT(D)4; (D)4GGTGTT(D)4; (H)4AACGCC(H)4; (H)4AACACC(H)4;D) 4 GGCGTT (D) 4 ; (D) 4 GGTGTT (D) 4 ; (H) 4 AACGCC (H) 4 ; (H) 4 AACACC (H) 4 ;
D)4GTCGGT(D)4; (D)4GTTGGT(D)4; (H)4ACCGAC(H)4; (H)4ACCAAC(H)4;D) 4 GTCGGT (D) 4 ; (D) 4 GTTGGT (D) 4 ; (H) 4 ACCGAC (H) 4 ; (H) 4 ACCAAC (H) 4 ;
D)4TGCGG(D)4; (D)4TTGTGG(D)4; (H)4CCGCGA(H)4; (H)4CCACAA(H)4;D) 4 TGCGG (D) 4 ; (D) 4 TTGTGG (D) 4 ; (H) 4 CCGCGA (H) 4 ; (H) 4 CCACAA (H) 4 ;
D)4TTCGGG(D)4; (D)4TTTGGG(D)4; (H)4CCCGAA(H)4; (H)4CCCAAA(H)4;D) 4 TTCGGG (D) 4 ; (D) 4 TTTGGG (D) 4 ; (H) 4 CCCGAA (H) 4 ; (H) 4 CCCAAA (H) 4 ;
D)4TTCGAG(D)4; (D)4TTTGAG(D)4; (H)4CTCGAA(H)4; (H)4CTCAAA(H)4;D) 4 TTCGAG (D) 4 ; (D) 4 TTTGAG (D) 4 ; (H) 4 CTCGAA (H) 4 ; (H) 4 CTCAAA (H) 4 ;
D)4CGGTCG(D)4; (D)4TGGTTG(D)4; (D)4CGGTTG(D)4; (D)4TGGTCG(D)4;
:2(H)09090V3(H) :2(α)i909093(α) :2(H)OVOVOV2(H) *2(α)i9i9i92(α :2(H)VO93V1S(H) :3(H)V3VOVI2(H) :2(α)vi939i3(α) ^(α)vi9i9i3(αD) 4 CGGTCG (D) 4 ; (D) 4 TGGTTG (D) 4 ; (D) 4 CGGTTG (D) 4 ; (D) 4 TGGTCG (D) 4 ; : 2 (H) 09090V 3 (H): 2 (α) i90909 3 (α): 2 (H) OVOVOV 2 (H) * 2 (α) i9i9i9 2 (α: 2 (H) VO93V1 S (H): 3 (H) V3VOVI 2 (H): 2 (α) vi939i 3 (α) ^ (α) vi9i9i 3 (α
^(HJOVOO ΘOV^H^ (HJOVOO ΘOV ^ H
:|,(H)3933V93VI'(H) * I'(H)3933W3V1'(H) • 1'(H)3V33W3VI'(H: |, (H) 3933V93V I '(H) * I ' (H) 3933W3V 1 '(H) • 1' (H) 3V33W3V I '(H
- l (0)19319919 Ha. oε- l (0) 19319919 ha. oε
-I,(α)i90±9909,'(α) :l(α)i9ii9939l'(α) :l'(α)i9ii99i9l'(α !3(H)19393V3(H) :2(α)i9i9iv3(α) *2(H)IV3V3V2(H) :2(α)i9i9iv2(α- I, (α) i90 ± 9909 , '(α): l (α) i9ii9939 l' (α): l '(α) i9ii99i9 l ' (α! 3 (H) 19393V 3 (H): 2 (α ) i9i9iv 3 (α) * 2 (H) IV3V3V 2 (H): 2 (α) i9i9iv 2 (α
•2(H)W93313(H) ^(HJWVOOI^H) *2(α)V993112(α) *2(θ)V991112(α• 2 (H) W9331 3 (H) ^ (HJWVOOI ^ H) * 2 (α) V99311 2 (α) * 2 (θ) V99111 2 (α
:2(H)VI93V12(H) :ζ(α)vi93vι2(α) *3(H)VIV3VI2(H) :2(α)vi9ivι2(α •3(H)VI93V33(H) :3(H)VIV3V33(H) *2(α)9i93vι2(α) *2(α)9i9ivι2(α 9Z :2(H)1393W3(H) *2(H)13V3W2(H) *3(α)ιi939v3(α) :3(α)ιi9i9v3(α: 2 (H) VI93V1 2 (H): ζ (α) vi93vι 2 (α) * 3 (H) VIV3VI 2 (H): 2 (α) vi9ivι 2 (α • 3 (H) VI93V3 3 (H): 3 (H) VIV3V3 3 (H) * 2 (α) 9i93vι 2 (α) * 2 (α) 9i9ivι 2 (α 9Z: 2 (H) 1393W 3 (H) * 2 (H) 13V3W 2 (H) * 3 (α) ιi939v 3 (α): 3 (α) ιi9i9v 3 (α
:l'(H)930SV932(H •3(H)933SV93I'(H) -"-(HJVSSSVgS^H) :2(H)V33SV93I'(H: l '(H) 930SV93 2 (H • 3 (H) 933SV93 I ' (H) - "- (HJVSSSVgS ^ H): 2 (H) V33SV93 I '(H
•l'(H)933SW33(H
• l '(H) 933SW3 3 (H
:l'(α)93i 9933(α 'Z(Q)ΌOIN ΌΌO1(Q) :|,(α)93iΛΛ99i2(α) :2(α)ooiM99il'(α: l '(α) 93i 993 3 (α' Z (Q) ΌOIN ΌΌO 1 (Q): |, (α) 93iΛΛ99i 2 (α): 2 (α) ooiM99i l '(α
*1'(α)911M9933(α* 1 '(α) 911M993 3 (α
:3(α)9J_L 993l'(α) :|'(α)9iiM99i2(α) :2(α)9iiM99il'(α: 3 (α) 9J_L 993 l '(α): | '(α) 9iiM99i 2 (α): 2 (α) 9iiM99i l ' (α
*3(H)IV931V3(H) :3(α)ιv93iv2(α) *3(H)IWOIV2(H) *z(α)ιv9iιv2(α ςτ* 3 (H) IV931V 3 (H): 3 (α) ιv93iv 2 (α) * 3 (H) IWOIV 2 (H) * z (α) ιv9iιv 2 (α ςτ
:2(H)W93112(H) :2(α)W93iι2(α) *3(H)WV3J_L2(H) *3(α)W9iιι2(α: 2 (H) W9311 2 (H): 2 (α) W93iι 2 (α) * 3 (H) WV3J_L 2 (H) * 3 (α) W9iιι 2 (α
:3(H)W39313(H) *3(H)W3V313(H) :3(α)v939iιz(α) *2(α)V9i9iι3(α: 3 (H) W3931 3 (H) * 3 (H) W3V31 3 (H): 3 (α) v939iι z (α) * 2 (α) V9i9iι 3 (α
:3(H)3193W2(H) *2(H)31V3WS(H) :2(α)ιi90V92(α) -z(α)j_L9iv92(cι: 3 (H) 3193W 2 (H) * 2 (H) 31V3W S (H): 2 (α) ιi90V9 2 (α) - z (α) j_L9iv9 2 (cι
:uθzuθnbθs uθpuθßjoj Jθp ΘUJΘ ι$jeι,u n Jθuioßjio-VNd u!3 oτ: uθzuθnbθs uθpuθßjoj Jθp ΘUJΘ ι $ jeι, u n Jθuioßjio-VNd u! 3 oτ
(9) ujueno Jθpo (o) UISOJΛO uθseg jθp ΘU|Θ S(9) ujueno Jθpo (o) UISOJΛO uθseg jθp ΘU | Θ S
(l) ujLUÄμi Jθpo (v) uμapv uθseg jθp ΘUJΘ ΛΛ(l) ujLUÄμi Jθpo (v) uμapv uθseg jθp ΘUJΘ ΛΛ
(l) UJIUΛU . Jθpo (o) ujueno '(v) u uθpv uθseg jθp ΘUJΘ α(l) UJIUΛU. Jθpo (o) ujueno '(v) u uθpv uθseg jθp ΘUJΘ α
( ) miuΛμi jθpo (o) UJSOJÄO '(v) uwθpv uθseg jθp ΘUJΘ H() miuΛμi jθpo (o) UJSOJÄO '(v) uwθpv uθseg jθp ΘUJΘ H
UIJOΛΛUIJOΛΛ
(H)V00V90*(H) :t (H)933W3t7(H) -*(H)VOOWO (H)
(H) V00V90 * (H) t (H) 933W3 t7 (H) - * (H) VOOWO (H)
68010/ιoaα/iDd 01689/10 OΛV
(D)2TGTATG(D)2; (D)2CGTATG(D)2; (D)2TGTACG(D)2; (D)2CGTACG(D)2;68010 / ιoaα / iDd 01689/10 OΛV (D) 2 TGTATG (D) 2 ; (D) 2 CGTATG (D) 2 ; (D) 2 TGTACG (D) 2 ; (D) 2 CGTACG (D) 2 ;
(H)2CATACA(H)2; (H)2CATACG(H)2; (H)2CGTACA(H)2; (H)2CGTACG(H)2;(H) 2 CATACA (H) 2 ; (H) 2 CATACG (H) 2 ; (H) 2 CGTACA (H) 2 ; (H) 2 CGTACG (H) 2 ;
(D)2AATGTT(D)2; (H)2AACATT(H)2; (D)2AACGTT(D)2; (H)2AACGTT(H)2;(D) 2 AATGTT (D) 2 ; (H) 2 AACATT (H) 2 ; (D) 2 AACGTT (D) 2 ; (H) 2 AACGTT (H) 2 ;
(D)2TGATTG(D)2; (D)2TGATCG(D)2; (D)2CGATTG(D)2; (D)2CGATCG(D)2;(D) 2 TGATTG (D) 2 ; (D) 2 TGATCG (D) 2 ; (D) 2 CGATTG (D) 2 ; (D) 2 CGATCG (D) 2 ;
(H)2CAATCA(H)2; (H)2CGATCA(H)2; (H)2CAATCG(H)2; (H)2CGATCG(H)2;(H) 2 CAATCA (H) 2 ; (H) 2 CGATCA (H) 2 ; (H) 2 CAATCG (H) 2 ; (H) 2 CGATCG (H) 2 ;
(D)2GTTGAT(D)2; (D)2GTCGAT(D)2; (H)2ATCAAC(H)2; (H)2ATCGAC(H)2;(D) 2 GTTGAT (D) 2 ; (D) 2 GTCGAT (D) 2 ; (H) 2 ATCAAC (H) 2 ; (H) 2 ATCGAC (H) 2 ;
(D)1TGGTATTG(D)1; (D)1CGGTATCG(D)1; (D)1TGGTATCG(D)1 ;(D) 1 TGGTATTG (D) 1 ; (D) 1 CGGTATCG (D) 1 ; (D) 1 TGGTATCG (D) 1 ;
(D)1CGGTATTG(D)1 ;(D) 1 CGGTATTG (D) 1 ;
(H)1CAATACCA(H)1 ; (H)1CGATACCG(H)1; (H)1CGATACCA(H)1 ;(H) 1 CAATACCA (H) 1 ; (H) 1 CGATACCG (H) 1 ; (H) 1 CGATACCA (H) 1 ;
(H)1CAATACCG(H)1;(H) 1 CAATACCG (H) 1 ;
(D)2TGTπT(D)2; (D)2CGTTrT(D)2; (H)2AAAACA(H)2; (H)2AAAACG(H)2;(D) 2 TGTπT (D) 2 ; (D) 2 CGTTrT (D) 2 ; (H) 2 AAAACA (H) 2 ; (H) 2 AAAACG (H) 2 ;
(D)1GTGTATG(D)2; (D)2GTGTATG(D)1 ; (D)1GTGTACG(D)2;(D) 1 GTGTATG (D) 2 ; (D) 2 GTGTATG (D) 1 ; (D) 1 GTGTACG (D) 2 ;
(D)2GTGTACG(D)1 ;(D) 2 GTGTACG (D) 1 ;
(H)3CATACAC(H)2; (H)2CATACAC(H)1 ; (H)1CGTACAC(H)2;(H) 3 CATACAC (H) 2 ; (H) 2 CATACAC (H) 1 ; (H) 1 CGTACAC (H) 2 ;
(H)2CGTACAC(H)1 ;(H) 2 CGTACAC (H) 1 ;
(D)2GATTG(D)3; (D)3GATTG(D)2; (D)2GATCG(D)3; (D)3GATCG(D)2;(D) 2 GATTG (D) 3 ; (D) 3 GATTG (D) 2 ; (D) 2 GATCG (D) 3 ; (D) 3 GATCG (D) 2 ;
(H)2CAATC(H)3; (H)3CAATC(H)2; (H)2CTAGC(H)3; (H)3CTAGC(H)2;(H) 2 CAATC (H) 3 ; (H) 3 CAATC (H) 2 ; (H) 2 CTAGC (H) 3 ; (H) 3 CTAGC (H) 2 ;
(D)1TGTATATG(D)1; (D)1TGTATACG(D)1; (D)1CGTATATG(D)1;(D) 1 TGTATATG (D) 1 ; (D) 1 TGTATACG (D) 1 ; (D) 1 CGTATATG (D) 1 ;
(D)1CGTATACG(D)1 ;(D) 1 CGTATACG (D) 1 ;
(H)1CATATACA(H)1 ; (H)1CGTATACA(H)1 ; (H)1CATATACG(H)1 ;(H) 1 CATATACA (H) 1 ; (H) 1 CGTATACA (H) 1 ; (H) 1 CATATACG (H) 1 ;
(H)1CGTATACG(H)1;(H) 1 CGTATACG (H) 1 ;
(D)1TGAGTTTG(D)1 ; (D)1TGAGTTCG(D)1 ; (D)1CGAGTTTG(D)1 ;(D) 1 TGAGTTTG (D) 1 ; (D) 1 TGAGTTCG (D) 1 ; (D) 1 CGAGTTTG (D) 1 ;
(D)1CGAGTTCG(D)1 ;(D) 1 CGAGTTCG (D) 1 ;
(H)1CAAACTCA(H)1; (H)1CGAACTCA(H)1; (H)1CAAACTCG(H)1 ;(H) 1 CAAACTCA (H) 1 ; (H) 1 CGAACTCA (H) 1 ; (H) 1 CAAACTCG (H) 1 ;
(HJ^GAACTCG^)^(HJ ^ GAACTCG ^) ^
(D)1TGTTAATG(D)1 ; (D)1CGTTAATG(D)1 ; (D)1TGTTAACG(D)1 ;(D) 1 TGTTAATG (D) 1 ; (D) 1 CGTTAATG (D) 1 ; (D) 1 TGTTAACG (D) 1 ;
(D)1CGTTAACG(D)1;(D) 1 CGTTAACG (D) 1 ;
(H)1CATTAACA(H)1 ; (H)1CATTAACG(H)1; (H)1CGTTAACA(H)1 ;(H) 1 CATTAACA (H) 1 ; (H) 1 CATTAACG (H) 1 ; (H) 1 CGTTAACA (H) 1 ;
(H^CGTTAACGOH)., ;(H ^ CGTTAACGOH).,;
(D)2TGTATG(D)2; (D)2TGTACG(D)2; (D)2CGTATG(D)2; (D)2CGTACG(D)2;(D) 2 TGTATG (D) 2 ; (D) 2 TGTACG (D) 2 ; (D) 2 CGTATG (D) 2 ; (D) 2 CGTACG (D) 2 ;
(H)2CATACA(H)2; (H)2CGTACA(H)2; (H)2CATACG(H)2; (H)2CGTACG(H)2;(H) 2 CATACA (H) 2 ; (H) 2 CGTACA (H) 2 ; (H) 2 CATACG (H) 2 ; (H) 2 CGTACG (H) 2 ;
(D^GGTCGGTT )., ; (D^GGTTGGTT )., ; (H^AACCGACC ".)., ;(D ^ GGTCGGTT).,; (D ^ GGTTGGTT).,; (H ^ AACCGACC ".).,;
(H)1AACCAACC(H)1 ;(H) 1 AACCAACC (H) 1 ;
(D)2GACGT(D)3; (D)3GACGT(D)2; (D)2GATGT(D)3; (D)3GATGT(D)2;
(H)2ACGTC(H)3; (H)3ACGTC(H)2; (H)2ACATC(H)3; (H)3ACATC(H)2; (D)2GGCGTT(D)2; (D)2GGTGTT(D)2; (H)2AACGCC(H)2; (H)2AACACC(H)2; (D)2GTCGGT(D)2; (D)2GTTGGT(D)2; (H)2ACCGAC(H)2; (H)2ACCAAC(H)2; (D)2TGCGG(D)2; (D)2TTGTGG(D)2; (H)2CCGCGA(H)2; (H)2CCACAA(H)2; (D)2TTCGGG(D)2; (D)2TTTGGG(D)2; (H)2CCCGAA(H)2; (H)2CCCAAA(H)2;(D) 2 GACGT (D) 3 ; (D) 3 GACGT (D) 2 ; (D) 2 GATGT (D) 3 ; (D) 3 GATGT (D) 2 ; (H) 2 ACGTC (H) 3 ; (H) 3 ACGTC (H) 2 ; (H) 2 ACATC (H) 3 ; (H) 3 ACATC (H) 2 ; (D) 2 GGCGTT (D) 2 ; (D) 2 GGTGTT (D) 2 ; (H) 2 AACGCC (H) 2 ; (H) 2 AACACC (H) 2 ; (D) 2 GTCGGT (D) 2 ; (D) 2 GTTGGT (D) 2 ; (H) 2 ACCGAC (H) 2 ; (H) 2 ACCAAC (H) 2 ; (D) 2 TGCGG (D) 2 ; (D) 2 TTGTGG (D) 2 ; (H) 2 CCGCGA (H) 2 ; (H) 2 CCACAA (H) 2 ; (D) 2 TTCGGG (D) 2 ; (D) 2 TTTGGG (D) 2 ; (H) 2 CCCGAA (H) 2 ; (H) 2 CCCAAA (H) 2 ;
(D)2TTCGAG(D)2; (D)2TTTGAG(D)2; (H)2CTCGAA(H)2; (H)2CTCAAA(H)2; (D)2CGGTCG(D)2; (D)2TGGTTG(D)2; (D)2CGGTTG(D)2; (D)2TGGTCG(D)2; (H)2CGACCG(H)2; (H)2CAACCA(H)2; (H)2CAACCG(H)2; (H)2CGACCA(H)2*(D) 2 TTCGAG (D) 2 ; (D) 2 TTTGAG (D) 2 ; (H) 2 CTCGAA (H) 2 ; (H) 2 CTCAAA (H) 2 ; (D) 2 CGGTCG (D) 2 ; (D) 2 TGGTTG (D) 2 ; (D) 2 CGGTTG (D) 2 ; (D) 2 TGGTCG (D) 2 ; (H) 2 CGACCG (H) 2 ; (H) 2 CAACCA (H) 2 ; (H) 2 CAACCG (H) 2 ; (H) 2 CGACCA (H) 2 *
worinwherein
H eine der Basen Adenin (A), Cytosin (C) oder Thymin (T)H one of the bases adenine (A), cytosine (C) or thymine (T)
D eine der Basen Adenin (A), Guanin (G) oder Thymin (T)D one of the bases adenine (A), guanine (G) or thymine (T)
W eine der Basen Adenin (A) oder Thymin (T)W one of the bases adenine (A) or thymine (T)
S eine der Basen Cytosin (C) oder Guanin (G) ist.S is one of the bases cytosine (C) or guanine (G).
Dabei sollen mehrere Cytosin-Methylierungen in einer DNA-Probe und bevorzugt der obere und untere DNA-Strang gleichzeitig analysiert werden. Dazu werden die folgenden Verfahrensschritte nacheinander ausgeführt:Several cytosine methylations in a DNA sample and preferably the upper and lower DNA strand should be analyzed simultaneously. The following process steps are carried out one after the other:
Die zu analysierende genomische DNA wird bevorzugt aus üblichen Quellen für DNA erhalten, wie z. B. Zelllinien, Blut, Sputum, Stuhl, Urin, Gehirn-Rückenmarks- Flüssigkeit, in Paraffin einbettetes Gewebe, histologische Objektträger und alle möglichen Kombinationen hiervon.The genomic DNA to be analyzed is preferably obtained from conventional sources for DNA, such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, histological slides and all possible combinations thereof.
Bevorzugt erzeugt man die Fragmente der DNA durch Verdau mit einer oder mehrerer Exo- oder Endonukleasen.The fragments of the DNA are preferably generated by digestion with one or more exo- or endonucleases.
Im ersten Verfahrensschritt wird eine genomische DNA Probe derart chemisch be- handelt, dass an der 5'-Position unmethylierte Cytosinbasen in Uracil, Thymin oder eine andere vom Hybridisierungsverhalten her dem Cytosin unähnliche Base verwandelt werden.
Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bi- sulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse verwendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil führt.In the first process step, a genomic DNA sample is chemically treated in such a way that at the 5'-position unmethylated cytosine bases are converted into uracil, thymine or another base which is unlike cytosine in terms of hybridization behavior. The treatment of genomic DNA with bisulfite (bisulfite, disulfite) and subsequent alkaline hydrolysis, which leads to a conversion of unmethylated cytosine nucleobases into uracil, is preferably used for this purpose.
In einem zweiten Verfahrensschritt werden aus der vorbehandelten genomischenIn a second process step, the pre-treated genomic
DNA mehr als zehn unterschiedliche Fragmente gleichzeitig durch Verwendung von synthetischen Ohgonukleotiden als Primer amplifiziert.DNA amplified more than ten different fragments simultaneously using synthetic ohgonucleotides as primers.
Diese Fragmente umfassen bevorzugt Sequenzen aus an der Genregulation betei- ligten und/oder transkribierten und/oder translatierten genomischen Sequenzen, wie sie nach einer chemischen Behandlung wie oben beschrieben vorliegen würden.These fragments preferably comprise sequences from genomic sequences which are involved in and / or transcribed and / or translated in gene regulation, as would be present after a chemical treatment as described above.
In einer bevorzugten Variante des Verfahrens führt man die Amplifikation mittels der Polymerasekettenreaktion (PCR) durch, wobei eine thermostabile DNA-Polymerase verwendet wird.In a preferred variant of the method, the amplification is carried out by means of the polymerase chain reaction (PCR), a thermostable DNA polymerase being used.
In einer weiteren bevorzugten Variante des Verfahrens wird die thermostabile DNA Poiymerase aus folgender Gruppe auswählt: Taq DNA Polymerase, AmpliTaq FS DNA Polymerase, Deep Vent (exo.sup.-) DNA Polymerase, Vent DNA Polymerase, Vent (exo.sup.-) DNA Polymerase und Deep Vent DNA Polymerase, Thermo Se- quenase, exo(-) Pseudococcus furiosus (Pfu) DNA Polymerase, AmpliTaq, Ultman, 9 degree Nm, Tth, Hot Tub, Pyrococcus furiosus (Pfu) und Pyrococcus woesei (Pwo) DNA Polymerase.In a further preferred variant of the method, the thermostable DNA polymerase is selected from the following group: Taq DNA polymerase, AmpliTaq FS DNA polymerase, Deep Vent (exo.sup.-) DNA polymerase, Vent DNA polymerase, Vent (exo.sup.-) DNA Polymerase and Deep Vent DNA Polymerase, Thermo Sequenase, exo (-) Pseudococcus furiosus (Pfu) DNA Polymerase, AmpliTaq, Ultman, 9 degree Nm, Tth, Hot Tub, Pyrococcus furiosus (Pfu) and Pyrococcus woesei (Pwo) DNA polymerase.
In einer wiederum bevorzugten Variante wird die Größe der amplifizierten Fragmente in der PCR auf weniger als 30 s verkürzte Kettenverlängerungsschritte begrenzt.In another preferred variant, the size of the amplified fragments in the PCR is limited to chain extension steps shortened by less than 30 s.
In einer besonders bevorzugten Variante des Verfahrens enthält mindestens eines der für die Amplifikation verwendeten Oligonukleotide weniger Nukleobasen als es für eine sequenzspezifische Hybridisierung an die chemisch behandelte genomische DNA Probe erforderlich wäre.In a particularly preferred variant of the method, at least one of the oligonucleotides used for the amplification contains fewer nucleobases than would be required for a sequence-specific hybridization to the chemically treated genomic DNA sample.
In einer weiteren, besonders bevorzugten Variante des Verfahrens ist mindestens ein Oligonukleotid kürzer als 18 Nukleobasen. In einer wiederum besonders bevor-
zugten Variante des Verfahrens ist mindestens ein Oligonukleotid kürzer als 15 Nukleobasen.In a further, particularly preferred variant of the method, at least one oligonucleotide is shorter than 18 nucleobases. In a particularly preferred variant of the method is at least one oligonucleotide shorter than 15 nucleobases.
In einer wiederum bevorzugten Variante des Verfahrens werden für die Amplifikati- on mehr als 4 Oligonukleotide mit unterschiedlicher Sequenz gleichzeitig in einemIn another preferred variant of the method, more than 4 oligonucleotides with different sequences are simultaneously used in one for the amplification
Reaktionsgefäß verwendet.Reaction vessel used.
In einer besonders bevorzugten Varianten werden zur Herstellung eines komplexen Amplifikates mehr als 26 verschiedene Oligonukleotide gleichzeitig verwendet.In a particularly preferred variant, more than 26 different oligonucleotides are used simultaneously to produce a complex amplificate.
In einer weiteren, besonders bevorzugten Variante des Verfahrens werden zur Amplifikation der beschriebenen Fragmente zwei Oligonukleotide oder zwei Klassen von Oligonukleotiden verwendet, von denen eines oder eine der Klassen außer im Kontext CpG die Basen C, A und T enthalten kann, nicht aber die Base G und von denen das andere oder die andere Klasse außer im Kontext CpG die Basen G, A und T, nicht aber die Base C enthalten kann.In a further, particularly preferred variant of the method, two oligonucleotides or two classes of oligonucleotides are used to amplify the fragments described, one or one of the classes except the context CpG can contain the bases C, A and T, but not the base G. and of which the other or the other class can contain the bases G, A and T, but not the base C, except in the context of CpG.
In einer bevorzugten Variante des Verfahrens werden die nach der Amplifikation erhaltenen Produkte durch Gelektrophorese aufgetrennt und die Fragmente, die kleiner als 2000 Basenpaare oder kleiner als ein beliebiger Grenzwert unterhalb vonIn a preferred variant of the method, the products obtained after the amplification are separated by gel electrophoresis and the fragments which are smaller than 2000 base pairs or smaller than any limit below
2000 Basenpaaren sind, durch Ausschneiden von den anderen Produkten der Amplifikation vor der Auswertung abgetrennt. Besonders bevorzugt werden diese Amplifikate bestimmter Größe vor der Durchführung der Hybridisierung nochmals amplifiziert.2000 base pairs are cut out from the other amplification products before analysis. These amplified products of a certain size are particularly preferably amplified again before the hybridization is carried out.
in einem dritten Verfahrensschritt werden nun die in den amplifizierten Fragmenten enthaltenen CpG Dinukleotide vollständig oder teilweise durch Hybridisierung der bereits in der Amplifikation mit einer nachweisbaren Markierung versehenen Fragmente an einen Satz von Oligonukleotiden untersucht, der mindestens zwei der folgenden Sequenzen umfasst:In a third method step, the CpG dinucleotides contained in the amplified fragments are examined completely or partially by hybridization of the fragments already provided with a detectable label in the amplification to a set of oligonucleotides which comprises at least two of the following sequences:
(D)4GATGTT(D)4; (D)4GACGTT(D)4; (H)4AACATC(H)4; (H)4AACGTC(H)4; (D)4TTGTGA(D)4; (D)4TTGCGA(D)4; (H)4TCACAA(H)4; (H)4TCGCAA(H)4; (D)4TTTGAA(D)4; (H)4TTCAAA(H)4; (D)4TTCGAA(D)4; (H)4TTCGAA(H)4;
D)4ATTGAT(D)4; (H)4ATCAAT(H)4; (D)4ATCGAT(D)4; (H)4ATCGAT(H)4;(D) 4 GATGTT (D) 4 ; (D) 4 GACGTT (D) 4 ; (H) 4 AACATC (H) 4 ; (H) 4 AACGTC (H) 4 ; (D) 4 TTGTGA (D) 4 ; (D) 4 TTGCGA (D) 4 ; (H) 4 TCACAA (H) 4 ; (H) 4 TCGCAA (H) 4 ; (D) 4 TTTGAA (D) 4 ; (H) 4 TTCAAA (H) 4 ; (D) 4 TTCGAA (D) 4 ; (H) 4 TTCGAA (H) 4 ; D) 4 ATTGAT (D) 4 ; (H) 4 ATCAAT (H) 4 ; (D) 4 ATCGAT (D) 4 ; (H) 4 ATCGAT (H) 4 ;
D)3TGGWTTG(D)4; (D)4TGGWTTG(D)3; (D)3CGGWTTG(D)4;D) 3 TGGWTTG (D) 4 ; (D) 4 TGGWTTG (D) 3 ; (D) 3 CGGWTTG (D) 4 ;
D)4CGGWTTG(D)3;D) 4 CGGWTTG (D) 3 ;
D)3TGGWTCG(D)4; (D)4TGGWTCG(D)3; (D)3CGGWTCG(D)4;D) 3 TGGWTCG (D) 4 ; (D) 4 TGGWTCG (D) 3 ; (D) 3 CGGWTCG (D) 4 ;
D)4CGGWTCG(D)3;D) 4 CGGWTCG (D) 3 ;
H)3CAASCCA(H)4; (H)4CAASCCA(H)3; (H)3CAASCCG(H)4;H) 3 CAASCCA (H) 4 ; (H) 4 CAASCCA (H) 3 ; (H) 3 CAASCCG (H) 4 ;
H)4CAASCCG(H)3;H) 4 CAASCCG (H) 3 ;
H)3CGASCCA(H)4; (H)4CGASCCA(H)3; (H)3CGASCCG(H)4;H) 3 CGASCCA (H) 4 ; (H) 4 CGASCCA (H) 3 ; (H) 3 CGASCCG (H) 4 ;
H)4CGASCCG(H)3; (D)4AGTGTT(D)4; (D)4AGCGTT(D)4; (H)4AACACT(H)4; (H)4AACGCT(H)4;H) 4 CGASCCG (H) 3 ; (D) 4 AGTGTT (D) 4 ; (D) 4 AGCGTT (D) 4 ; (H) 4 AACACT (H) 4 ; (H) 4 AACGCT (H) 4 ;
D)4TATGTG(D)4; (D)4TACGTG(D)4; (H)4CACATA(H)4; (H)4CACGTA(H)4;D) 4 TATGTG (D) 4 ; (D) 4 TACGTG (D) 4 ; (H) 4 CACATA (H) 4 ; (H) 4 CACGTA (H) 4 ;
D)4TATGTA(D)4; (H)4TACATA(H)4; (D)4TACGTA(D)4; (H)4TACGTA(H)4;D) 4 TATGTA (D) 4 ; (H) 4 TACATA (H) 4 ; (D) 4 TACGTA (D) 4 ; (H) 4 TACGTA (H) 4 ;
D)4TTTGGA(D)4; (D)4TTCGGA(D)4; (H)4TCCAAA(H)4; (H)4TCCGAA(H)4;D) 4 TTTGGA (D) 4 ; (D) 4 TTCGGA (D) 4 ; (H) 4 TCCAAA (H) 4 ; (H) 4 TCCGAA (H) 4 ;
D)4ATGTGT(D)4; (H)4ACACAT(H)4; (D)4ATGTGT(D)4; (H)4ACGCGT(H)4; (D)3GTGGTTGT(D)3; (D)3GCGGTTGT(D)3; (D)3GCGGTCGT(D)3;D) 4 ATGTGT (D) 4 ; (H) 4 ACACAT (H) 4 ; (D) 4 ATGTGT (D) 4 ; (H) 4 ACGCGT (H) 4 ; (D) 3 GTGGTTGT (D) 3 ; (D) 3 GCGGTTGT (D) 3 ; (D) 3 GCGGTCGT (D) 3 ;
D)3GTGGTCGT(D)3;D) 3 GTGGTCGT (D) 3 ;
H)3ACAACCAC(H)3; (H)3ACAACCGC(H)3; (H)3ACGACCGC(H)3;H) 3 ACAACCAC (H) 3 ; (H) 3 ACAACCGC (H) 3 ; (H) 3 ACGACCGC (H) 3 ;
H)3ACGACCAC(H)3;H) 3 ACGACCAC (H) 3 ;
D)4TGTGTA(D)4; (D)4TGCGTA(D)4; (H)4TACACA(H)4; (H)4TACGCA(H)4; (D)4GTGTGT(D)4; (H)4ACACAC(H)4; (D)4GCGCGT(D)4; (H)4ACGCGC(H)4;D) 4 TGTGTA (D) 4 ; (D) 4 TGCGTA (D) 4 ; (H) 4 TACACA (H) 4 ; (H) 4 TACGCA (H) 4 ; (D) 4 GTGTGT (D) 4 ; (H) 4 ACACAC (H) 4 ; (D) 4 GCGCGT (D) 4 ; (H) 4 ACGCGC (H) 4 ;
D)4TGTATG(D)4; (D)4CGTATG(D)4; (D)4TGTACG(D)4; (D)4CGTACG(D)4;D) 4 TGTATG (D) 4 ; (D) 4 CGTATG (D) 4 ; (D) 4 TGTACG (D) 4 ; (D) 4 CGTACG (D) 4 ;
H)4CATACA(H)4; (H)4CATACG(H)4; (H)4CGTACA(H)4; (H)4CGTACG(H)4;H) 4 CATACA (H) 4 ; (H) 4 CATACG (H) 4 ; (H) 4 CGTACA (H) 4 ; (H) 4 CGTACG (H) 4 ;
D)4AATGTT(D)4; (H)4AACATT(H)4; (D)4AACGTT(D)4; (H)4AACGTT(H)4;D) 4 AATGTT (D) 4 ; (H) 4 AACATT (H) 4 ; (D) 4 AACGTT (D) 4 ; (H) 4 AACGTT (H) 4 ;
D)4TGATTG(D)4; (D)4TGATCG(D)4; (D)4CGATTG(D)4; (D)4CGATCG(D)4; (H)4CAATCA(H)4; (H)4CGATCA(H)4; (H)4CAATCG(H)4; (H)4CGATCG(H)4;D) 4 TGATTG (D) 4 ; (D) 4 TGATCG (D) 4 ; (D) 4 CGATTG (D) 4 ; (D) 4 CGATCG (D) 4 ; (H) 4 CAATCA (H) 4 ; (H) 4 CGATCA (H) 4 ; (H) 4 CAATCG (H) 4 ; (H) 4 CGATCG (H) 4 ;
D)4GTTGAT(D)4; (D)4GTCGAT(D)4; (H)4ATCAAC(H)4; (H)4ATCGAC(H)4;D) 4 GTTGAT (D) 4 ; (D) 4 GTCGAT (D) 4 ; (H) 4 ATCAAC (H) 4 ; (H) 4 ATCGAC (H) 4 ;
D)3TGGTATTG(D)3; (D)3CGGTATCG(D)3; (D)3TGGTATCG(D)3;D) 3 TGGTATTG (D) 3 ; (D) 3 CGGTATCG (D) 3 ; (D) 3 TGGTATCG (D) 3 ;
D)3CGGTATTG(D)3;D) 3 CGGTATTG (D) 3 ;
H)3CAATACCA(H)3; (H)3CGATACCG(H)3; (H)3CGATACCA(H)3; (H)3CAATACCG(H)3;H) 3 CAATACCA (H) 3 ; (H) 3 CGATACCG (H) 3 ; (H) 3 CGATACCA (H) 3 ; (H) 3 CAATACCG (H) 3 ;
D)4TGTTTT(D)4; (D)4CGTTTT(D)4; (H)4AAAACA(H)4; (H)4AAAACG(H)4;D) 4 TGTTTT (D) 4 ; (D) 4 CGTTTT (D) 4 ; (H) 4 AAAACA (H) 4 ; (H) 4 AAAACG (H) 4 ;
D)3GTGTATG(D)4; (D)4GTGTATG(D)3; (D)3GTGTACG(D)4;D) 3 GTGTATG (D) 4 ; (D) 4 GTGTATG (D) 3 ; (D) 3 GTGTACG (D) 4 ;
D)4GTGTACG(D)3;
(H)3CATACAC(H)4; (H)4CATACAC(H)3; (H)3CGTACAC(H)4;D) 4 GTGTACG (D) 3 ; (H) 3 CATACAC (H) 4 ; (H) 4 CATACAC (H) 3 ; (H) 3 CGTACAC (H) 4 ;
(H)4CGTACAC(H)3;(H) 4 CGTACAC (H) 3 ;
(D)4GATTG(D)5; (D)5GATTG(D)4; (D)4GATCG(D)5; (D)5GATCG(D)4;(D) 4 GATTG (D) 5 ; (D) 5 GATTG (D) 4 ; (D) 4 GATCG (D) 5 ; (D) 5 GATCG (D) 4 ;
(H)4CAATC(H)5; (H)5CAATC(H)4; (H)4CTAGC(H)5; (H)5CTAGC(H)4; (D)3TGTATATG(D)3; (D)3TGTATACG(D)3; (D)3CGTATATG(D)3;(H) 4 CAATC (H) 5 ; (H) 5 CAATC (H) 4 ; (H) 4 CTAGC (H) 5 ; (H) 5 CTAGC (H) 4 ; (D) 3 TGTATATG (D) 3 ; (D) 3 TGTATACG (D) 3 ; (D) 3 CGTATATG (D) 3 ;
(D)3CGTATACG(D)3;(D) 3 CGTATACG (D) 3 ;
(H)3CATATACA(H)3; (H)3CGTATACA(H)3; (H)3CATATACG(H)3;(H) 3 CATATACA (H) 3 ; (H) 3 CGTATACA (H) 3 ; (H) 3 CATATACG (H) 3 ;
(H)3CGTATACG(H)3;(H) 3 CGTATACG (H) 3 ;
(D)3TGAGTTTG(D)3; (D)3TGAGTTCG(D)3; (D)3CGAGTTTG(D)3; (D)3CGAGTTCG(D)3;(D) 3 TGAGTTTG (D) 3 ; (D) 3 TGAGTTCG (D) 3 ; (D) 3 CGAGTTTG (D) 3 ; (D) 3 CGAGTTCG (D) 3 ;
(H)3CAAACTCA(H)3; (H)3CGAACTCA(H)3; (H)3CAAACTCG(H)3;(H) 3 CAAACTCA (H) 3 ; (H) 3 CGAACTCA (H) 3 ; (H) 3 CAAACTCG (H) 3 ;
(H)3CGAACTCG(H)3;(H) 3 CGAACTCG (H) 3 ;
(D)3TGTTAATG(D)3; (D)3CGTTAATG(D)3; (D)3TGTTAACG(D)3;(D) 3 TGTTAATG (D) 3 ; (D) 3 CGTTAATG (D) 3 ; (D) 3 TGTTAACG (D) 3 ;
(D)3CGTTAACG(D)3; (H)3CATTAACA(H)3; (H)3CATTAACG(H)3; (H)3CGTTAACA(H)3;(D) 3 CGTTAACG (D) 3 ; (H) 3 CATTAACA (H) 3 ; (H) 3 CATTAACG (H) 3 ; (H) 3 CGTTAACA (H) 3 ;
(H)3CGTTAACG(H)3;(H) 3 CGTTAACG (H) 3 ;
(D)4TGTATG(D)4; (D)4TGTACG(D)4; (D)4CGTATG(D)4; (D)4CGTACG(D)4;(D) 4 TGTATG (D) 4 ; (D) 4 TGTACG (D) 4 ; (D) 4 CGTATG (D) 4 ; (D) 4 CGTACG (D) 4 ;
(H)4CATACA(H)4; (H)4CGTACA(H)4; (H)4CATACG(H)4; (H)4CGTACG(H)4;(H) 4 CATACA (H) 4 ; (H) 4 CGTACA (H) 4 ; (H) 4 CATACG (H) 4 ; (H) 4 CGTACG (H) 4 ;
(D)3GGTCGGTT(D)3; (D)3GGTTGGTT(D)3; (H)3AACCGACC(H)3; (H)3AACCAACC(H)3;(D) 3 GGTCGGTT (D) 3 ; (D) 3 GGTTGGTT (D) 3 ; (H) 3 AACCGACC (H) 3 ; (H) 3 AACCAACC (H) 3 ;
(D)4GACGT(D)5; (D)5GACGT(D)4; (D)4GATGT(D)5; (D)5GATGT(D)4;(D) 4 GACGT (D) 5 ; (D) 5 GACGT (D) 4 ; (D) 4 GATGT (D) 5 ; (D) 5 GATGT (D) 4 ;
(H)4ACGTC(H)5; (H)5ACGTC(H)4; (H)4ACATC(H)5; (H)5ACATC(H)4;(H) 4 ACGTC (H) 5 ; (H) 5 ACGTC (H) 4 ; (H) 4 ACATC (H) 5 ; (H) 5 ACATC (H) 4 ;
(D)4GGCGTT(D)4; (D)4GGTGTT(D)4; (H)4AACGCC(H)4; (H)4AACACC(H)4;(D) 4 GGCGTT (D) 4 ; (D) 4 GGTGTT (D) 4 ; (H) 4 AACGCC (H) 4 ; (H) 4 AACACC (H) 4 ;
(D)4GTCGGT(D)4; (D)4GTTGGT(D)4; (H)4ACCGAC(H)4; (H)4ACCAAC(H)4; (D)4TGCGG(D)4; (D)4TTGTGG(D)4; (H)4CCGCGA(H)4; (H)4CCACAA(H)4;(D) 4 GTCGGT (D) 4 ; (D) 4 GTTGGT (D) 4 ; (H) 4 ACCGAC (H) 4 ; (H) 4 ACCAAC (H) 4 ; (D) 4 TGCGG (D) 4 ; (D) 4 TTGTGG (D) 4 ; (H) 4 CCGCGA (H) 4 ; (H) 4 CCACAA (H) 4 ;
(D)4TTCGGG(D)4; (D)4TTTGGG(D)4; (H)4CCCGAA(H)4; (H)4CCCAAA(H)4;(D) 4 TTCGGG (D) 4 ; (D) 4 TTTGGG (D) 4 ; (H) 4 CCCGAA (H) 4 ; (H) 4 CCCAAA (H) 4 ;
(D)4TTCGAG(D)4; (D)4TTTGAG(D)4; (H)4CTCGAA(H)4; (H)4CTCAAA(H)4;(D) 4 TTCGAG (D) 4 ; (D) 4 TTTGAG (D) 4 ; (H) 4 CTCGAA (H) 4 ; (H) 4 CTCAAA (H) 4 ;
(D)4CGGTCG(D)4; (D)4TGGTTG(D)4; (D)4CGGTTG(D)4; (D)4TGGTCG(D)4;(D) 4 CGGTCG (D) 4 ; (D) 4 TGGTTG (D) 4 ; (D) 4 CGGTTG (D) 4 ; (D) 4 TGGTCG (D) 4 ;
(H)4CGACCG(H)4; (H)4CAACCA(H)4; (H)4CAACCG(H)4; (H)4CGACCA(H)4.(H) 4 CGACCG (H) 4 ; (H) 4 CAACCA (H) 4 ; (H) 4 CAACCG (H) 4 ; (H) 4 CGACCA (H) 4 .
worinwherein
H eine der Basen Adenin (A), Cytosin (C) oder Thymin (T)H one of the bases adenine (A), cytosine (C) or thymine (T)
D eine der Basen Adenin (A), Guanin (G) oder Thymin (T)D one of the bases adenine (A), guanine (G) or thymine (T)
W eine der Basen Adenin (A) oder Thymin (T)
S eine der Basen Cytosin (C) oder Guanin (G) ist.W one of the bases adenine (A) or thymine (T) S is one of the bases cytosine (C) or guanine (G).
Nach dem dritten Verfahrensschritt werden ferner die in den amplifizierten Fragmenten enthaltenen CpG Dinukleotide vollständig oder teilweise durch Hybridisierung der bereits in der Amplifikation mit einer nachweisbaren Markierung versehenen Fragmente an einen Satz von PNA-Oligomeren untersucht, der mindestens zwei der folgenden Sequenzen umfasst:After the third method step, the CpG dinucleotides contained in the amplified fragments are also examined completely or partially by hybridization of the fragments already provided with a detectable label in the amplification to a set of PNA oligomers which comprises at least two of the following sequences:
(D)2GATGTT(D)2; (D)2GACGTT(D)2; (H)2AACATC(H)2; (H)2AACGTC(H)2;(D) 2 GATGTT (D) 2 ; (D) 2 GACGTT (D) 2 ; (H) 2 AACATC (H) 2 ; (H) 2 AACGTC (H) 2 ;
(D)2TTGTGA(D)2; (D)2TTGCGA(D)2; (H)2TCACAA(H)2; (H)2TCGCAA(H)2;(D) 2 TTGTGA (D) 2 ; (D) 2 TTGCGA (D) 2 ; (H) 2 TCACAA (H) 2 ; (H) 2 TCGCAA (H) 2 ;
(D)2TTTGAA(D)2; (H)2TTCAAA(H)2; (D)2TTCGAA(D)2; (H)2TTCGAA(H)2;(D) 2 TTTGAA (D) 2 ; (H) 2 TTCAAA (H) 2 ; (D) 2 TTCGAA (D) 2 ; (H) 2 TTCGAA (H) 2 ;
(D)2ATTGAT(D)2; (H)2ATCAAT(H)2; (D)2ATCGAT(D)2; (H)2ATCGAT(H)2;(D) 2 ATTGAT (D) 2 ; (H) 2 ATCAAT (H) 2 ; (D) 2 ATCGAT (D) 2 ; (H) 2 ATCGAT (H) 2 ;
(D)1TGGWTTG(D)2; (D)2TGGWTTG(D)1 ; (D)1CGGWTTG(D)2;(D) 1 TGGWTTG (D) 2 ; (D) 2 TGGWTTG (D) 1 ; (D) 1 CGGWTTG (D) 2 ;
(D)2CGGWTTG(D)1 ;(D) 2 CGGWTTG (D) 1 ;
(D)1TGGWTCG(D)2; (D)2TGGWTCG(D)1 ; (D)1CGGWTCG(D)2;(D) 1 TGGWTCG (D) 2 ; (D) 2 TGGWTCG (D) 1 ; (D) 1 CGGWTCG (D) 2 ;
(D)2CGGWTCG(D)1 ;(D) 2 CGGWTCG (D) 1 ;
(H)1CAASCCA(H)2; (H)2CAASCCA(H)1 ; (H)1CAASCCG(H)2;(H) 1 CAASCCA (H) 2 ; (H) 2 CAASCCA (H) 1 ; (H) 1 CAASCCG (H) 2 ;
(H)2CAASCCG(H)1;(H) 2 CAASCCG (H) 1 ;
(H)1CGASCCA(H)2; (H)2CGASCCA(H)1; (H)1CGASCCG(H)2;(H) 1 CGASCCA (H) 2 ; (H) 2 CGASCCA (H) 1 ; (H) 1 CGASCCG (H) 2 ;
(H)2CGASCCG(H)1 ;(H) 2 CGASCCG (H) 1 ;
(D)2AGTGTT(D)2; (D)2AGCGTT(D)2; (H)2AACACT(H)2; (H)2AACGCT(H)2;(D) 2 AGTGTT (D) 2 ; (D) 2 AGCGTT (D) 2 ; (H) 2 AACACT (H) 2 ; (H) 2 AACGCT (H) 2 ;
(D)2TATGTG(D)2; (D)2TACGTG(D)2; (H)2CACATA(H)2; (H)2CACGTA(H)2;(D) 2 TATGTG (D) 2 ; (D) 2 TACGTG (D) 2 ; (H) 2 CACATA (H) 2 ; (H) 2 CACGTA (H) 2 ;
(D)2TATGTA(D)2; (H)2TACATA(H)2; (D)2TACGTA(D)2; (H)2TACGTA(H)2;(D) 2 TATGTA (D) 2 ; (H) 2 TACATA (H) 2 ; (D) 2 TACGTA (D) 2 ; (H) 2 TACGTA (H) 2 ;
(D)2TTTGGA(D)2; (D)2TTCGGA(D)2; (H)2TCCAAA(H)2; (H)2TCCGAA(H)2;(D) 2 TTTGGA (D) 2 ; (D) 2 TTCGGA (D) 2 ; (H) 2 TCCAAA (H) 2 ; (H) 2 TCCGAA (H) 2 ;
(D)2ATGTGT(D)2; (H)2ACACAT(H)2; (D)2ATGTGT(D)2; (H)2ACGCGT(H)2;(D) 2 ATGTGT (D) 2 ; (H) 2 ACACAT (H) 2 ; (D) 2 ATGTGT (D) 2 ; (H) 2 ACGCGT (H) 2 ;
(D^GTGGTTGTfD)., ; (D)1GCGGTTGT(D)1 ; (D)1GCGGTCGT(D)1;(D ^ GTGGTTGTfD).,; (D) 1 GCGGTTGT (D) 1 ; (D) 1 GCGGTCGT (D) 1 ;
(D)1GTGGTCGT(D)1;(D) 1 GTGGTCGT (D) 1 ;
(HJ^CAACCAC^)^ (H^ACAACCGCO-I)., ; (H^ACGACCGCOH)., ;(HJ ^ CAACCAC ^) ^ (H ^ ACAACCGCO-I).,; (H ^ ACGACCGCOH).,;
(H)1ACGACCAC(H)1 ;(H) 1 ACGACCAC (H) 1 ;
(D)2TGTGTA(D)2; (D)2TGCGTA(D)2; (H)2TACACA(H)2; (H)2TACGCA(H)2;(D) 2 TGTGTA (D) 2 ; (D) 2 TGCGTA (D) 2 ; (H) 2 TACACA (H) 2 ; (H) 2 TACGCA (H) 2 ;
(D)2GTGTGT(D)2; (H)2ACACAC(H)2; (D)2GCGCGT(D)2; (H)2ACGCGC(H)2;(D) 2 GTGTGT (D) 2 ; (H) 2 ACACAC (H) 2 ; (D) 2 GCGCGT (D) 2 ; (H) 2 ACGCGC (H) 2 ;
(D)2TGTATG(D)2; (D)2CGTATG(D)2; (D)2TGTACG(D)2; (D)2CGTACG(D)2;
)2CATACA(H)2; (H)2CATACG(H)2; (H)2CGTACA(H)2; (H)2CGTACG(H)2;(D) 2 TGTATG (D) 2 ; (D) 2 CGTATG (D) 2 ; (D) 2 TGTACG (D) 2 ; (D) 2 CGTACG (D) 2 ; ) 2 CATACA (H) 2 ; (H) 2 CATACG (H) 2 ; (H) 2 CGTACA (H) 2 ; (H) 2 CGTACG (H) 2 ;
)2AATGTT(D)2; (H)2AACATT(H)2; (D)2AACGTT(D)2; (H)2AACGTT(H)2;) 2 AATGTT (D) 2 ; (H) 2 AACATT (H) 2 ; (D) 2 AACGTT (D) 2 ; (H) 2 AACGTT (H) 2 ;
)2TGATTG(D)2; (D)2TGATCG(D)2; (D)2CGATTG(D)2; (D)2CGATCG(D)2;) 2 TGATTG (D) 2 ; (D) 2 TGATCG (D) 2 ; (D) 2 CGATTG (D) 2 ; (D) 2 CGATCG (D) 2 ;
)2CAATCA(H)2; (H)2CGATCA(H)2; (H)2CAATCG(H)2; (H)2CGATCG(H)2;) 2 CAATCA (H) 2 ; (H) 2 CGATCA (H) 2 ; (H) 2 CAATCG (H) 2 ; (H) 2 CGATCG (H) 2 ;
)2GTTGAT(D)2; (D)2GTCGAT(D)2; (H)2ATCAAC(H)2; (H)2ATCGAC(H)2;) 2 GTTGAT (D) 2 ; (D) 2 GTCGAT (D) 2 ; (H) 2 ATCAAC (H) 2 ; (H) 2 ATCGAC (H) 2 ;
)1TGGTATTG(D)1; (D)1CGGTATCG(D)1; (D)1TGGTATCG(D)1;) 1 TGGTATTG (D) 1 ; (D) 1 CGGTATCG (D) 1 ; (D) 1 TGGTATCG (D) 1 ;
)1CGGTATTG(D)1;) 1 CGGTATTG (D) 1 ;
)1CAATACCA(H)1; (H)1CGATACCG(H)1; (H)1CGATACCA(H)1;) 1 CAATACCA (H) 1 ; (H) 1 CGATACCG (H) 1 ; (H) 1 CGATACCA (H) 1 ;
)1CAATACCG(H)1;) 1 CAATACCG (H) 1 ;
)2TGTTTT(D)2; (D)2CGTTTT(D)2; (H)2AAAACA(H)2; (H)2AAAACG(H)2;) 2TGTTTT (D) 2 ; (D) 2 CGTTTT (D) 2 ; (H) 2 AAAACA (H) 2; (H) 2 AAAACG (H) 2 ;
)1GTGTATG(D)2; (D)2GTGTATG(D)1; (D)1GTGTACG(D)2;) 1 GTGTATG (D) 2 ; (D) 2 GTGTATG (D) 1 ; (D) 1 GTGTACG (D) 2 ;
)2GTGTACG(D)1;) 2 GTGTACG (D) 1 ;
)3CATACAC(H)2; (H)2CATACAC(H)1; (H)1CGTACAC(H)2;) 3 CATACAC (H) 2 ; (H) 2 CATACAC (H) 1 ; (H) 1 CGTACAC (H) 2 ;
)2CGTACAC(H)1;) 2 CGTACAC (H) 1 ;
)2GATTG(D)3; (D)3GATTG(D)2; (D)2GATCG(D)3; (D)3GATCG(D)2;) 2 GATTG (D) 3 ; (D) 3 GATTG (D) 2 ; (D) 2 GATCG (D) 3 ; (D) 3 GATCG (D) 2 ;
)2CAATC(H)3; (H)3CAATC(H)2; (H)2CTAGC(H)3; (H)3CTAGC(H)2;) 2 CAATC (H) 3 ; (H) 3 CAATC (H) 2 ; (H) 2 CTAGC (H) 3 ; (H) 3 CTAGC (H) 2 ;
)1TGTATATG(D)1 ; (D)1TGTATACG(D)1 ; (D)1CGTATATG(D)1 ;) 1 TGTATATG (D) 1 ; (D) 1 TGTATACG (D) 1 ; (D) 1 CGTATATG (D) 1 ;
)1CGTATACG(D)1;) 1 CGTATACG (D) 1 ;
)1 CATATACA(H)1 ; (H)1 CGTATACA(H)1 ; (H)1 CATATACG(H)1 ;) 1 CATATACA (H) 1 ; (H) 1 CGTATACA (H) 1 ; (H) 1 CATATACG (H) 1 ;
)1CGTATACG(H)1 ;) 1 CGTATACG (H) 1 ;
)1TGAGTTTG(D)1 ; (D)1TGAGTTCG(D)1 ; (D)1CGAGTTTG(D)1 ;) 1 TGAGTTTG (D) 1 ; (D) 1 TGAGTTCG (D) 1 ; (D) 1 CGAGTTTG (D) 1 ;
)1CGAGTTCG(D)1;) 1 CGAGTTCG (D) 1 ;
)1CAAACTCA(H)1 ; (H)1CGAACTCA(H)1; (H)1CAAACTCG(H)1;) 1 CAAACTCA (H) 1 ; (H) 1 CGAACTCA (H) 1 ; (H) 1 CAAACTCG (H) 1 ;
)1CGAACTCG(H)1;) 1 CGAACTCG (H) 1 ;
)1TGTTAATG(D)1 ; (D)1CGTTAATG(D)1 ; (D)1TGTTAACG(D)1 ;) 1 TGTTAATG (D) 1 ; (D) 1 CGTTAATG (D) 1 ; (D) 1 TGTTAACG (D) 1 ;
)1CGTTAACG(D)1;) 1 CGTTAACG (D) 1 ;
)1CATTAACA(H)1 ; (H)1CATTAACG(H)1 ; (H)1CGTTAACA(H)1 ;) 1 CATTAACA (H) 1 ; (H) 1 CATTAACG (H) 1 ; (H) 1 CGTTAACA (H) 1 ;
)1CGTTAACG(H)1;) 1 CGTTAACG (H) 1 ;
)2TGTATG(D)2; (D)2TGTACG(D)2; (D)2CGTATG(D)2; (D)2CGTACG(D)2;) 2 TGTATG (D) 2 ; (D) 2 TGTACG (D) 2 ; (D) 2 CGTATG (D) 2 ; (D) 2 CGTACG (D) 2 ;
)2CATACA(H)2; (H)2CGTACA(H)2; (H)2CATACG(H)2; (H)2CGTACG(H)2;) 2 CATACA (H) 2 ; (H) 2 CGTACA (H) 2 ; (H) 2 CATACG (H) 2 ; (H) 2 CGTACG (H) 2 ;
^GGTCGGT^D)., ; (D)1GGTTGGTT(D)1 ; (H^AACCGACCOH).. ;^ GGTCGGT ^ D).,; (D) 1 GGTTGGTT (D) 1 ; (H ^ AACCGACCOH) ..;
^AACCAACC H)., ;^ AACCAACC H).,;
)2GACGT(D)3; (D)3GACGT(D)2; (D)2GATGT(D)3; (D)3GATGT(D)2;) 2 GACGT (D) 3 ; (D) 3 GACGT (D) 2 ; (D) 2 GATGT (D) 3 ; (D) 3 GATGT (D) 2 ;
)2ACGTC(H)3; (H)3ACGTC(H)2; (H)2ACATC(H)3; (H)3ACATC(H)2;
(D)2GGCGTT(D)2; (D)2GGTGTT(D)2; (H)2AACGCC(H)2; (H)2AACACC(H)2; (D)2GTCGGT(D)2; (D)2GTTGGT(D)2; (H)2ACCGAC(H)2; (H)2ACCAAC(H)2; (D)2TGCGG(D)2; (D)2TTGTGG(D)2; (H)2CCGCGA(H)2; (H)2CCACAA(H)2; (D)2TTCGGG(D)2; (D)2TTTGGG(D)2; (H)2CCCGAA(H)2; (H)2CCCAAA(H)2; (D)2TTCGAG(D)2; (D)2TTTGAG(D)2; (H)2CTCGAA(H)2; (H)2CTCAAA(H)2;) 2 ACGTC (H) 3 ; (H) 3 ACGTC (H) 2 ; (H) 2 ACATC (H) 3 ; (H) 3 ACATC (H) 2 ; (D) 2 GGCGTT (D) 2 ; (D) 2 GGTGTT (D) 2 ; (H) 2 AACGCC (H) 2 ; (H) 2 AACACC (H) 2 ; (D) 2 GTCGGT (D) 2 ; (D) 2 GTTGGT (D) 2 ; (H) 2 ACCGAC (H) 2 ; (H) 2 ACCAAC (H) 2 ; (D) 2 TGCGG (D) 2 ; (D) 2 TTGTGG (D) 2 ; (H) 2 CCGCGA (H) 2 ; (H) 2 CCACAA (H) 2 ; (D) 2 TTCGGG (D) 2 ; (D) 2 TTTGGG (D) 2 ; (H) 2 CCCGAA (H) 2 ; (H) 2 CCCAAA (H) 2 ; (D) 2 TTCGAG (D) 2 ; (D) 2 TTTGAG (D) 2 ; (H) 2 CTCGAA (H) 2 ; (H) 2 CTCAAA (H) 2 ;
(D)2CGGTCG(D)2; (D)2TGGTTG(D)2; (D)2CGGTTG(D)2; (D)2TGGTCG(D)2; (H)2CGACCG(H)2; (H)2CAACCA(H)2; (H)2CAACCG(H)2; (H)2CGACCA(H)2-(D) 2 CGGTCG (D) 2 ; (D) 2 TGGTTG (D) 2 ; (D) 2 CGGTTG (D) 2 ; (D) 2 TGGTCG (D) 2 ; (H) 2 CGACCG (H) 2 ; (H) 2 CAACCA (H) 2 ; (H) 2 CAACCG (H) 2 ; (H) 2 CGACCA (H) 2 -
worin H eine der Basen Adenin (A), Cytosin (C) oder Thymin (T)where H is one of the bases adenine (A), cytosine (C) or thymine (T)
D eine der Basen Adenin (A), Guanin (G) oder Thymin (T)D one of the bases adenine (A), guanine (G) or thymine (T)
W eine der Basen Adenin (A) oder Thymin (T)W one of the bases adenine (A) or thymine (T)
S eine der Basen Cytosin (C) oder Guanin (G) ist.S is one of the bases cytosine (C) or guanine (G).
In einer bevorzugten Variante des Verfahrens werden die besagten Fragmente an einem Oligonukleotid-Array (DNA Chip) untersucht. Die Trägermaterialen werden vorzugsweise aus einer Gruppe ausgewählt, die aus folgenden Komponenten besteht: Beads, Kapillaren, ebene Trägermaterialen, Membranen, Wafers, Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold.In a preferred variant of the method, said fragments are examined on an oligonucleotide array (DNA chip). The carrier materials are preferably selected from a group consisting of the following components: beads, capillaries, flat carrier materials, membranes, wafers, silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
In einer bevorzugten Variante des Verfahrens werden die Markierungen aus einer Gruppe ausgewählt, bestehend aus Fluoreszenzmarkierungen, Radionukliden und ablösbaren Massenmarkierungen.In a preferred variant of the method, the labels are selected from a group consisting of fluorescent labels, radionuclides and detachable mass labels.
In einer weiteren bevorzugten Variante des Verfahrens werden die amplifizierten Fragmente auf einer Oberfläche immobilisiert und anschließend eine Hybridisierung mit einer kombinatorischen Bibiliothek von unterscheidbaren Oligonukleotid- oder PNA-Oligomer-Sonden durchgeführt. Sonden können beliebige Nukleinsäurese- quenzen sein. Diese Sonden oder die oben erwähnten, ablösbaren Massenmarkierungen werden vorzugsweise mittels Matrix-assistierter Laser- Desorptions/Ionisations Massenspektrometrie (Maldi-MS) anhand ihrer eindeutigen Masse nachgewiesen. Die besagten Sonden oder Massenmarkierungen tragen bevorzugt jeweils eine einzelne positive oder negative Nettoladung.
Weiterer Gegenstand der Erfindung ist ein Kit, der mindestens zwei Primerpaare, Reagenzien und Hilfsstoffe für die Amplifikation und/oder Reagenzien und Hilfsmittel für die chemische Behandlung und/oder eine kombinatorische Sondenbibliothek und/oder einen Oligonukleotid-Array (DNA-Chip) enthält, soweit er für die Durchführung des erfindungsgemäßen Verfahrens erforderlich oder dienlich ist.In a further preferred variant of the method, the amplified fragments are immobilized on a surface and then hybridization is carried out with a combinatorial library of distinguishable oligonucleotide or PNA oligomer probes. Probes can be any nucleic acid sequences. These probes or the detachable mass markings mentioned above are preferably detected using matrix-assisted laser desorption / ionization mass spectrometry (Maldi-MS) on the basis of their unique mass. Said probes or mass markings preferably each carry a single positive or negative net charge. The invention furthermore relates to a kit which contains at least two primer pairs, reagents and auxiliaries for amplification and / or reagents and auxiliaries for chemical treatment and / or a combinatorial probe library and / or an oligonucleotide array (DNA chip), to the extent it is necessary or useful for carrying out the method according to the invention.
Verzeichnis der AbkürzungenList of abbreviations
H eine der Basen Adenin (A), Cytosin (C) oder Thymin (T)H one of the bases adenine (A), cytosine (C) or thymine (T)
D eine der Basen Adenin (A), Guanin (G) oder Thymin (T)D one of the bases adenine (A), guanine (G) or thymine (T)
W eine der Basen Adenin (A) oder Thymin (T)W one of the bases adenine (A) or thymine (T)
S eine der Basen Cytosin (C) oder Guanin (G)S one of the bases cytosine (C) or guanine (G)
Die nachfolgenden Beispiele erläutern die Erfindung:The following examples illustrate the invention:
Beispiel 1 : Durchführung der Methylierungsanalyse des Gens P-cadherinExample 1: Performing the methylation analysis of the P-cadherin gene
Das folgende Beispiel bezieht sich auf ein Fragment des Gens P-cadherin, in dem eine bestimmte CG-Position auf Methylierung zu untersuchen ist.The following example relates to a fragment of the P-cadherin gene in which a specific CG position is to be examined for methylation.
Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, dass alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, dass eine hinsichtlich dem Basenpaa- rungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben. Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht me- thylierten Cytosin-Nukleobasen in Uracil. Diese umgewandelte DNA dient dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wässrigen Lösung. Es wird an- schliessend eine Desulfonierung der DNA (10-30 min, 90-100 °C) bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-
Probe in einer Polymerasekettenreaktion mit einer hitzebeständigen DNA- Polymerase. Im vorliegenden Fall werden Cytosine des Gens P-cadherin untersucht. Dazu wird mit den spezifischen Primeroligonukleotiden GTTTAGAAGTTTAAGATTAG und CAAAAACTCAACCTCTATCT ein definiertes Fragment der Länge 609 bp amplifiziert. Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise I I I 1 lAGTCGA l I I lAGA für den methylierten und M M lAGTTGA i I I lAGA für den nicht-methylierten Zustand, wobei sich das nachzuweisende Cytosin an Position 186 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primeroligonukleotiden, die für die Amplifikation verwendet wurden (Figur 1). Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyiiertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit entscheidet der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt.In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a way that all of the cytosines that are not methylated at the 5-position of the base are changed in such a way that a base which is different with regard to the base pairing behavior is formed, while the base in FIG -Position methylated cytosines remain unchanged. If bisulfite is used for the reaction, an addition takes place on the unmethylated cytosine bases. In addition, a denaturing reagent or solvent and a radical scavenger must be present. Subsequent alkaline hydrolysis then leads to the conversion of non-methylated cytosine nucleobases into uracil. This converted DNA is used to detect methylated cytosines. In the second process step, the treated DNA sample is diluted with water or an aqueous solution. The DNA is then desulfonated (10-30 min, 90-100 ° C) at an alkaline pH. In the third step of the process, the DNA is amplified Sample in a polymerase chain reaction with a heat-resistant DNA polymerase. In the present case, cytosines of the P-cadherin gene are examined. For this purpose, a defined fragment with a length of 609 bp is amplified with the specific primer oligonucleotides GTTTAGAAGTTTAAGATTAG and CAAAAACTCAACCTCTATCT. This amplificate serves as a sample which hybridizes to an oligonucleotide previously bound to a solid phase to form a duplex structure, for example III 1 lAGTCGA l II lAGA for the methylated and MM lAGTTGA i II lAGA for the non-methylated state, the cytosine to be detected becoming apparent Position 186 of the amplificate is located. The detection of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification (FIG. 1). A hybridization reaction of the amplified DNA with the oligonucleotide only occurs if a methylated cytosine is present at this point in the bisulfite-treated DNA. The methylation status of the respective cytosine to be examined thus decides on the hybridization product.
Beispiel 2: Durchführung der Methylierungsanalyse des Gens DBCCR1Example 2: Performing the methylation analysis of the DBCCR1 gene
Das folgende Beispiel bezieht sich auf ein Fragment des Gens DBCCR1, in dem eine bestimmte CG-Position auf Methylierung zu untersuchen ist.The following example relates to a fragment of the DBCCR1 gene in which a specific CG position is to be examined for methylation.
Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, dass alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, dass eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylier- ten Cytosine unverändert bleiben. Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Diese umgewandelte DNA dient dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wässrigen Lösung. Es wird an- schliessend eine Desulfonierung der DNA (10-30 min, 90-100 °C) bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA- Probe in einer Polymerasekettenreaktion mit einer hitzebeständigen DNA-
Polymerase. Im vorliegenden Fall werden Cytosine des Gens DBCCR1 untersucht. Dazu wird mit den spezifischen PrimeroligonukleotidenIn the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a way that all of the cytosines that are not methylated at the 5-position of the base are modified in such a way that a base which is different in terms of the base pairing behavior is formed, while the base in the 5-position methylated cytosines remain unchanged. If bisulfite is used for the reaction, an addition takes place on the unmethylated cytosine bases. In addition, a denaturing reagent or solvent and a radical scavenger must be present. Subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases into uracil. This converted DNA is used to detect methylated cytosines. In the second process step, the treated DNA sample is diluted with water or an aqueous solution. The DNA is then desulfonated (10-30 min, 90-100 ° C) at an alkaline pH. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction with a heat-resistant DNA Polymerase. In the present case, cytosines of the DBCCR1 gene are examined. To do this, use the specific primer oligonucleotides
ATTTGGAGTTGAAGTATTTG und AACTATACCCAAACACCTAC ein definiertes Fragment der Länge 531 bp amplifiziert. Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einerATTTGGAGTTGAAGTATTTG and AACTATACCCAAACACCTAC amplified a defined fragment with a length of 531 bp. This amplificate serves as a sample which is attached to an oligonucleotide previously bound to a solid phase to form a
Duplexstruktur hybridisiert, hier TGTTTATGCGTATTTGTT für den methylierten und TGTTTATGTGTATTTGTT für den nicht-methylierten Zustand, wobei sich das nachzuweisende Cytosin an Position 444 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Prime- roligonukleotiden, die für die Amplifikation verwendet wurden (Figur 1). Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit entscheidet der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt.Duplex structure hybridized, here TGTTTATGCGTATTTGTT for the methylated and TGTTTATGTGTATTTGTT for the non-methylated state, the cytosine to be detected being at position 444 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled prime oligonucleotides that were used for the amplification (FIG. 1). A hybridization reaction of the amplified DNA with the oligonucleotide occurs only if a methylated cytosine was present at this point in the bisulfite-treated DNA. The methylation status of the respective cytosine to be examined thus decides on the hybridization product.
Beispiel 3: Durchführung der Methylierungsanalyse des Gens Faktor VIIIExample 3: Performing the methylation analysis of the factor VIII gene
Das folgende Beispiel bezieht sich auf ein Fragment des Gens Faktor VIII, in dem eine bestimmte CG-Position auf Methylierung zu untersuchen ist.The following example relates to a fragment of the factor VIII gene in which a specific CG position is to be examined for methylation.
Im ersten Schritt wird eine genomische Sequenz unter Verwendung von BisulfitThe first step is a genomic sequence using bisulfite
(Hydrogensulfit, Disulfit) derart behandelt, dass alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, dass eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben. Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Diese umgewandelte DNA dient dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wässrigen Lösung. Es wird an- schliessend eine Desulfonierung der DNA (10-30 min, 90-100 °C) bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA- Probe in einer Polymerasekettenreaktion mit einer hitzebeständigen DNA- Polymerase. Im vorliegenden Fall werden Cytosine des Gens Faktor VIII unter-
sucht. Dazu wird mit den spezifischen Primeroligonukleotiden AGGGAG I I I I I I I TAGGGAATAGAGGGA und(Hydrogen sulfite, disulfite) treated in such a way that all cytosines that are not methylated at the 5-position of the base are changed in such a way that a base which is different with regard to the base pairing behavior is formed, while the cytosines methylated in the 5-position remain unchanged. If bisulfite is used for the reaction, an addition takes place on the unmethylated cytosine bases. In addition, a denaturing reagent or solvent and a radical scavenger must be present. Subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases into uracil. This converted DNA is used to detect methylated cytosines. In the second process step, the treated DNA sample is diluted with water or an aqueous solution. The DNA is then desulfonated (10-30 min, 90-100 ° C) at an alkaline pH. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction with a heat-resistant DNA polymerase. In the present case, cytosines of the factor VIII gene are examined. For this purpose, the specific primer oligonucleotides AGGGAG IIIIIII TAGGGAATAGAGGGA and
TAATCCCAAAACCTCTCCACTACAACAA ein definiertes DNA-Fragment der Länge 561 bp amplifiziert. Dieses DNA-Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes PNA-Oligonukleotid unter Ausbildung einerTAATCCCAAAACCTCTCCACTACAACAA amplified a defined DNA fragment with a length of 561 bp. This DNA amplificate serves as a sample which is attached to a PNA oligonucleotide previously bound to a solid phase to form a
Duplexstruktur hybridisiert, beispielsweise CAAACGTTCAA für den methylierten bzw. CAAACATTCAA für den nicht-methylierten Zustand, wobei sich das nachzuweisende Cytosin an Position 241 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primeroli- gonukleotiden, die für die Amplifikation verwendet wurden (Fig. 2A, 2B). Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit entscheidet der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt.Duplex structure hybridizes, for example CAAACGTTCAA for the methylated or CAAACATTCAA for the non-methylated state, the cytosine to be detected being at position 241 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification (FIGS. 2A, 2B). A hybridization reaction of the amplified DNA with the oligonucleotide occurs only if a methylated cytosine was present at this point in the bisulfite-treated DNA. The methylation status of the respective cytosine to be examined thus decides on the hybridization product.
Die Figuren zeigen:The figures show:
Figur 1 : Hier ist ein Hoch-Dichte DNA Chip nach Hybridisierung dargestellt. Dargestellt ist das Falschfarben-Bild wie es nach dem Scannen erzeugt wird. Entgegen der hier dargestellten schwarz-weiß Abbildung wird von dem Scanner ein farbigesFigure 1: Here a high-density DNA chip is shown after hybridization. The false color image is shown as it is generated after scanning. Contrary to the black and white illustration shown here, the scanner turns a colored one
Bild erzeugt. Die Intensität der verschiedenen Farben repräsentiert den Grad der Hybridisierung, wobei der Hybridisierungsgrad von rot (in Figur 1 als helle Spots zu erkennen) nach blau (in Figur 1 als dunkle Spots zu erkennen) abnimmt. Die Oligo- nukeotide sind derart gespottet, daß sich jeweils links die den nicht-methylierten Zustand nachweisenden Oligonukeotide (hier oben links jeweilsImage created. The intensity of the different colors represents the degree of hybridization, the degree of hybridization decreasing from red (shown in FIG. 1 as bright spots) to blue (shown in FIG. 1 as dark spots). The oligonucleotides are spotted in such a way that the oligonucleotides detecting the non-methylated state are located on the left (top left here in each case)
M M l AGTTGATTT und TGTTTATGTGTATTTGTT) und rechts daneben die den methylierten Zustand nachweisenden Oligonukeotide (ebenfalls jeweils oben links TTTTTAGTCGATTT bzw. TGTTTATGCGTATTTGTT) befinden. Es ist zu erkennen, dass durch die Oligonukeotide I I I I lAGTTGATTT und TGTTTATGTGTATTTGTT jeweils ein nicht-methylierter Zustand nachgewiesen werden kann.M M l AGTTGATTT and TGTTTATGTGTATTTGTT) and on the right next to it the oligonucleotides which detect the methylated state (likewise in the top left of TTTTTAGTCGATTT and TGTTTATGCGTATTTGTT). It can be seen that the oligonucleotides I I I I LAGTTGATTT and TGTTTATGTGTATTTGTT can detect a non-methylated state in each case.
Figur 2: Hier ist ein PNA Chip nach Hybridisierung dargestellt. Dargestellt ist das Falschfarben-Bild wie es nach dem Scannen erzeugt wird. Entgegen der hier dar-
gestellten schwarz-weiß Abbildung wird von dem Scanner ein farbiges Bild erzeugt. Die Intensität der verschiedenen Farben repräsentiert den Grad der Hybridisierung, wobei der Hybridisierungsgrad von rot (in Figur 2 als helle Spots zu erkennen) nach blau (in Figur 2A und B als dunkle Spots zu erkennen) abnimmt. Figur 2A repräsen- tiert das Bild wie es nach dem Scannen mit der Wellenlänge 532 nm auftritt, die spezifisch für den Fluoreszenzfarbstoff Cy3 ist. In der oberen linken Ecke befindet sich ein 4-fach gespottetes PNA-Oligomer (CAAACGTTCAA) welches einen methylierten Zustand nachweisen kann. Nach Hybridisierung mit einer Sonde, welche spezifisch diesen Zustand repräsentiert, sind nur an solchen spezifischen Positio- nen positive Signale zu erkennen (exemplarisch durch einen weißen quadratischenFigure 2: Here a PNA chip is shown after hybridization. The false color image is shown as it is generated after scanning. Contrary to the The black-and-white image is generated by the scanner a colored image. The intensity of the different colors represents the degree of hybridization, the degree of hybridization decreasing from red (in FIG. 2 as bright spots) to blue (in FIGS. 2A and B as dark spots). FIG. 2A represents the image as it occurs after scanning with the wavelength 532 nm, which is specific for the fluorescent dye Cy3. In the upper left corner there is a 4-spotted PNA oligomer (CAAACGTTCAA) which can detect a methylated state. After hybridization with a probe that specifically represents this state, positive signals can only be recognized at such specific positions (exemplarily by a white square
Rahmen gekennzeichnet). In Figur 2B dagegen wird ein Bild gezeigt, wie es nach dem Scannen mit den Wellenlänge 635 nm auftritt, die spezifisch für den Fluoreszenzfarbstoff Cy5 ist. Hier sind an den Positionen, an denen mit PNA-Oligomere ein nicht methyiierter Zustand nachgewiesen werden kann (CAAACATTCAA), nach Hybridisierung mit einer diesen Methylierungszustand repräsentierenden Sonde, positive Signale zu erkennen (wiederum durch einen weißen quadratischen Rahmen für einen 4er-Block gekennzeichnet).
Marked frame). In contrast, FIG. 2B shows an image as it occurs after scanning with the wavelength 635 nm, which is specific for the fluorescent dye Cy5. Here, positive signals can be recognized at the positions at which a non-methylated state can be detected with PNA oligomers (CAAACATTCAA) after hybridization with a probe representing this methylation state (again identified by a white square frame for a block of 4) ,
SEQUENZPROTOKOLLSEQUENCE LISTING
<110> Epigenomics AG <120> Oligonukleotide oder PNA-Oligomere und Verfahren zur parallelen Detektion des Methylierungszustandes genomischer DNA<110> Epigenomics AG <120> oligonucleotides or PNA oligomers and methods for parallel detection of the methylation state of genomic DNA
<130> E01-1186-WO<130> E01-1186-WO
<140> <141><140> <141>
<160> 396<160> 396
<170> Patentin Ver. 2.1<170> Patentin Ver. 2.1
<210> 1 <211> 14 <212> DNA<210> 1 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 1 ddddgatgtt dddd 14 <210> 2 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 1 ddddgatgtt dddd 14 <210> 2 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 2 ddddgacgtt dddd 14<400> 2 ddddgacgtt dddd 14
<210> 3 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 3 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 3 hhhhaacatc hhhh 14<400> 3 hhhhaacatc hhhh 14
<210> 4 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 4 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400 > 4 hhhhaacgtc hhhh 14<220><223> Description of the artificial sequence: oligonucleotide <400> 4 hhhhaacgtc hhhh 14
<210> 5 <211> 14<210> 5 <211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 5 ddddttgtga dddd 14<400> 5 ddddttgtga dddd 14
<210> 6 <211> 14 <212> DNA<210> 6 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 6 ddddttgcga dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 6 ddddttgcga dddd 14
<210> 7 <211> 14 <212> DNA<210> 7 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 7 hhhhtcacaa hhhh 14 <210> 8 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 7 hhhhtcacaa hhhh 14 <210> 8 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 8 hhhhtcgcaa hhhh 14<400> 8 hhhhtcgcaa hhhh 14
<210> 9 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 9 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 9 ddddtttgaa dddd 14
<210> 10<400> 9 ddddtttgaa dddd 14 <210> 10
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 10 hhhhttcaaa hhhh 14<400> 10 hhhhttcaaa hhhh 14
<210> 11 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 11 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 11 ddddttcgaa dddd 14<400> 11 ddddttcgaa dddd 14
<210> 12<210> 12
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 12 hhhhttcgaa hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 12 hhhhttcgaa hhhh 14
<210> 13 <211> 14 <212> DNA<210> 13 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 13 ddddattgat dddd 14 <210> 14 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 13 ddddattgat dddd 14 <210> 14 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 14 hhhhatcaat hhhh 14<400> 14 hhhhatcaat hhhh 14
<210> 15
<211> 14<210> 15 <211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 15 ddddatcgat dddd 14<400> 15 ddddatcgat dddd 14
<210> 16<210> 16
<211> 14<211> 14
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 16 hhhhatcgat hhhh 14<400> 16 hhhhatcgat hhhh 14
<210> 17 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 17 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 17 dddtgg ttg dddd 14<400> 17 dddtgg ttg dddd 14
<210> 18<210> 18
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 18 ddddtggwtt gddd 14<223> Description of the artificial sequence: oligonucleotide <400> 18 ddddtggwtt gddd 14
<210> 19 <211> 14 <212> DNA<210> 19 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 19 dddcggwttg dddd 14 <210> 20 <211> 14 <212> DNA
<213> Künstliche Sequenz<400> 19 dddcggwttg dddd 14 <210> 20 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 20 ddddcgg tt gddd 14<400> 20 ddddcgg tt gddd 14
<210> 21<210> 21
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz :01ιgonukleotιd <400> 21 dddtggwtcg dddd 14<223> Description of the artificial sequence: 01ιgonucleotιd <400> 21 dddtggwtcg dddd 14
<210> 22 <211> 14 <212> DNA<210> 22 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 22 ddddtggwtc gddd 14 <210> 23 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 22 ddddtggwtc gddd 14 <210> 23 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 23 dddcggwtcg dddd 14<400> 23 dddcggwtcg dddd 14
<210> 24<210> 24
<211> 14<211> 14
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 24 ddddcggwtc gddd 14<400> 24 ddddcggwtc gddd 14
<210> 25 <211> 14 <212> DNA <213> Kunstliche Sequenz
<220><210> 25 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 25 hhhcaascca hhhh 14<400> 25 hhhcaascca hhhh 14
<210> 26 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 26 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 26 hhhhcaascc ahhh 14<400> 26 hhhhcaascc ahhh 14
<210> 27<210> 27
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 27 hhhcaasccg hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 27 hhhcaasccg hhhh 14
<210> 28 <211> 14 <212> DNA<210> 28 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 28 hhhhcaascc ghhh 14 <210> 29 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 28 hhhhcaascc ghhh 14 <210> 29 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 29 hhhcgascca hhhh 14<400> 29 hhhcgascca hhhh 14
<210> 30 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 30 <211> 14 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 30 hhhhcgascc ahhh 14<400> 30 hhhhcgascc ahhh 14
<210> 31<210> 31
<211> 14<211> 14
<212> DNA <213> Kunstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 31 hhhcgasccg hhhh 14<400> 31 hhhcgasccg hhhh 14
<210> 32 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 32 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 32 hhhhcgascc ghhh 14<400> 32 hhhhcgascc ghhh 14
<210> 33<210> 33
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 33 ddddagtgtt dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 33 ddddagtgtt dddd 14
<210> 34 <211> 14 <212> DNA<210> 34 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 34 ddddagcgtt dddd 14 <210> 35 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 34 ddddagcgtt dddd 14 <210> 35 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid
<400> 35 hhhhaacact hhhh 14 <210> 36 <211> 14 <212> DNA <213> Künstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 35 hhhhaacact hhhh 14 <210> 36 <211> 14 <212> DNA <213> artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 36 hhhhaacgct hhhh 14<400> 36 hhhhaacgct hhhh 14
<210> 37 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 37 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 37 ddddtatgtg dddd 14<400> 37 ddddtatgtg dddd 14
<210> 38 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 38 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 38 ddddtacgtg dddd 14<400> 38 ddddtacgtg dddd 14
<210> 39<210> 39
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 39 hhhhcacata hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 39 hhhhcacata hhhh 14
<210> 40 <211> 14 <212> DNA<210> 40 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 40
hhhhcacgta hhhh 14<400> 40 hhhhcacgta hhhh 14
<210> 41 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 41 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<220> <223> Description of the artificial sequence: 01ιgonucleotιd
<400> 41 ddddtatgta dddd 14<400> 41 ddddtatgta dddd 14
<210> 42<210> 42
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 42 hhhhtacata hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 42 hhhhtacata hhhh 14
<210> 43 <211> 14 <212> DNA<210> 43 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 43 ddddtacgta dddd 14 <210> 44 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 43 ddddtacgta dddd 14 <210> 44 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 44 hhhhtacgta hhhh 14<400> 44 hhhhtacgta hhhh 14
<210> 45 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 45 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 45 ddddtttgga dddd 14
<210> 46<400> 45 ddddtttgga dddd 14 <210> 46
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 46 ddddttcgga dddd 14<400> 46 ddddttcgga dddd 14
<210> 47 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 47 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 47 hhhhtccaaa hhhh 14<400> 47 hhhhtccaaa hhhh 14
<210> 48<210> 48
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 48 hhhhtccgaa hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 48 hhhhtccgaa hhhh 14
<210> 49 <211> 14 <212> DNA<210> 49 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz:01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 49 ddddatgtgt dddd 14 <210> 50 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 49 ddddatgtgt dddd 14 <210> 50 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 50 hhhhacacat hhhh 14<400> 50 hhhhacacat hhhh 14
<210> 51
<211 > 14<210> 51 <211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 51 ddddatgtgt dddd 14<400> 51 ddddatgtgt dddd 14
<210> 52 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 52 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 52 hhhhacgcgt hhhh 14<400> 52 hhhhacgcgt hhhh 14
<210> 53 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 53 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 53 dddgtggttg tddd 14<400> 53 dddgtggttg tddd 14
<210> 54<210> 54
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 54 dddgcggttg tddd 14<223> Description of the artificial sequence: oligonucleotide <400> 54 dddgcggttg tddd 14
<210> 55 <211> 14 <212> DNA<210> 55 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 55 dddgcggtcg tddd 14 <210> 56 <211> 14 <212> DNA
<213> Künstliche Sequenz<400> 55 dddgcggtcg tddd 14 <210> 56 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 56 dddgtggtcg tddd 14 <210> 57 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 56 dddgtggtcg tddd 14 <210> 57 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 57 hhhacaacca chhh 14<400> 57 hhhacaacca chhh 14
<210> 58 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 58 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 58 hhhacaaccg chhh 14<400> 58 hhhacaaccg chhh 14
<210> 59 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 59 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 59 hhhacgaccg chhh 14<400> 59 hhhacgaccg chhh 14
<210> 60<210> 60
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 60 hhhacgacca chhh<223> Description of the artificial sequence: oligonucleotide <400> 60 hhhacgacca chhh
<210> 61 <211> 14 <212> DNA <213> Künstliche Sequenz
<220><210> 61 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 61 ddddtgtgta dddd 14<400> 61 ddddtgtgta dddd 14
<210> 62 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 62 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 62 ddddtgcgta dddd 14<400> 62 ddddtgcgta dddd 14
<210> 63<210> 63
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 63 hhhhtacaca hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 63 hhhhtacaca hhhh 14
<210> 64 <211> 14 <212> DNA<210> 64 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 64 hhhhtacgca hhhh 14 <210> 65 <211> 14 <212> DNA <213> Kunstliche Sequenz <220><400> 64 hhhhtacgca hhhh 14 <210> 65 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 65 ddddgtgtgt dddd 14<400> 65 ddddgtgtgt dddd 14
<210> 66 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 66 <211> 14 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<220> <223> Description of the artificial sequence: 01ιgonucleotιd
<400> 66 hhhhacacac hhhh 14<400> 66 hhhhacacac hhhh 14
<210> 67 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 67 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 67 ddddgcgcgt dddd 14<400> 67 ddddgcgcgt dddd 14
<210> 68 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 68 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<220> <223> Description of the artificial sequence: 01ιgonucleotιd
<400> 68 hhhhacgcgc hhhh 14<400> 68 hhhhacgcgc hhhh 14
<210> 69<210> 69
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 69 ddddtgtatg dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 69 ddddtgtatg dddd 14
<210> 70 <211> 14 <212> DNA<210> 70 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 70 ddddcgtatg dddd 14 <210> 71 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 70 ddddcgtatg dddd 14 <210> 71 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 71 ddddtgtacg dddd 14 <210> 72 <211> 14 <212> DNA <213> Künstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 71 ddddtgtacg dddd 14 <210> 72 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 72 ddddcgtacg dddd 14<400> 72 ddddcgtacg dddd 14
<210> 73 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 73 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 73 hhhhcataca hhhh 14<400> 73 hhhhcataca hhhh 14
<210> 74 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 74 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 74 hhhhcatacg hhhh 14<400> 74 hhhhcatacg hhhh 14
<210> 75<210> 75
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 75 hhhhcgtaca hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 75 hhhhcgtaca hhhh 14
<210> 76 <211> 14 <212> DNA<210> 76 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 76
hhhhcgtacg hhhh 14<400> 76 hhhhcgtacg hhhh 14
<210> 77 <211> 14 <212> DNA<210> 77 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 77 ddddaatgtt dddd 14 <210> 78 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 77 ddddaatgtt dddd 14 <210> 78 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 78 hhhhaacatt hhhh 14<400> 78 hhhhaacatt hhhh 14
<210> 79 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 79 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 79 ddddaacgtt dddd 14<400> 79 ddddaacgtt dddd 14
<210> 80 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 80 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 80 hhhhaacgtt hhhh 14<400> 80 hhhhaacgtt hhhh 14
<210> 81<210> 81
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 81 ddddtgattg dddd 14
<210> 82<400> 81 ddddtgattg dddd 14 <210> 82
<211 > 14<211> 14
<212 > DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 82 ddddtgatcg dddd 14<400> 82 ddddtgatcg dddd 14
<210> 83 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 83 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 83 ddddcgattg dddd 14<400> 83 ddddcgattg dddd 14
<210> 84<210> 84
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 84 ddddcgatcg dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 84 ddddcgatcg dddd 14
<210> 85 <211> 14 <212> DNA<210> 85 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01igonukleotid<223> Description of the artificial sequence: 01igonucleotide
<400> 85 hhhhcaatca hhhh 14 <210> 86 <211> 14 <212> DNA <213> Kunstliche Sequenz <220><400> 85 hhhhcaatca hhhh 14 <210> 86 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 86 hhhhcgatca hhhh 14<400> 86 hhhhcgatca hhhh 14
<210> 87
<211 > 14<210> 87 <211> 14
<212 > DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 87 hhhhcaatcg hhhh 14<400> 87 hhhhcaatcg hhhh 14
<210> 88<210> 88
<211> 14<211> 14
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 88 hhhhcgatcg hhhh 14<400> 88 hhhhcgatcg hhhh 14
<210> 89 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 89 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 89 ddddgttgat dddd 14<400> 89 ddddgttgat dddd 14
<210> 90<210> 90
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 90 ddddgtcgat dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 90 ddddgtcgat dddd 14
<210> 91 <211> 14 <212> DNA<210> 91 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 91 hhhhatcaac hhhh 14 <210> 92 <211> 14 <212> DNA
<213> Kunstliche Sequenz<400> 91 hhhhatcaac hhhh 14 <210> 92 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 92 hhhhatcgac hhhh 14 <210> 93<400> 92 hhhhatcgac hhhh 14 <210> 93
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 93 dddtggtatt gddd 14<400> 93 dddtggtatt gddd 14
<210> 94<210> 94
<211> 14<211> 14
<212> DNA <213> Kunstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 94 dddcggtatc gddd 14<400> 94 dddcggtatc gddd 14
<210> 95 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 95 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 95 dddtggtatc gddd 14<400> 95 dddtggtatc gddd 14
<210> 96<210> 96
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 96 dddcggtatt gddd 14<223> Description of the artificial sequence: oligonucleotide <400> 96 dddcggtatt gddd 14
<210> 97 <211> 14 <212> DNA<210> 97 <211> 14 <212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 97 hhhcaatacc ahhh 14<223> Description of the artificial sequence: oligonucleotide <400> 97 hhhcaatacc ahhh 14
<210> 98 <211> 14 <212> DNA<210> 98 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 98 hhhcgatacc ghhh 14 <210> 99 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 98 hhhcgatacc ghhh 14 <210> 99 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 99 hhhcgatacc ahhh 14<400> 99 hhhcgatacc ahhh 14
<210> 100 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 100 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 100 hhhcaatacc ghhh 14<400> 100 hhhcaatacc ghhh 14
<210> 101 <211> 14 <212> DNA <213> Künstliche Sequenz <220><210> 101 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 101 ddddtgtttt dddd 14<400> 101 ddddtgtttt dddd 14
<210> 102 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 102 <211> 14 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 102 ddddcgtttt dddd 14<400> 102 ddddcgtttt dddd 14
<210> 103 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 103 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 103 hhhhaaaaca hhhh 14<400> 103 hhhhaaaaca hhhh 14
<210> 104 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 104 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 104 hhhhaaaacg hhhh 14<400> 104 hhhhaaaacg hhhh 14
<210> 105<210> 105
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 105 dddgtgtatg dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 105 dddgtgtatg dddd 14
<210> 106 <211> 14 <212> DNA<210> 106 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 106 ddddgtgtat gddd 14 <210> 107 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 106 ddddgtgtat gddd 14 <210> 107 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 107 dddgtgtacg dddd 14 <210> 108 <211> 14 <212> DNA <213> Kunstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 107 dddgtgtacg dddd 14 <210> 108 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 108 ddddgtgtac gddd 14<400> 108 ddddgtgtac gddd 14
<210> 109 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 109 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 109 hhhcatacac hhhh 14<400> 109 hhhcatacac hhhh 14
<210> 110 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 110 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 110 hhhhcataca chhh 14<400> 110 hhhhcataca chhh 14
<210> 111<210> 111
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 111 hhhcgtacac hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 111 hhhcgtacac hhhh 14
<210> 112 <211> 14 <212> DNA<210> 112 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz :01ιgonukleotid<223> Description of the artificial sequence: 01ιgonucleotide
<400> 112
hhhhcgtaca chhh 14<400> 112 hhhhcgtaca chhh 14
<210> 113 <211> 14 <212> DNA<210> 113 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 113 ddddgattgd dddd 14 <210> 114 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 113 ddddgattgd dddd 14 <210> 114 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 114 dddddgattg dddd 14<400> 114 dddddgattg dddd 14
<210> 115 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 115 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 115 ddddgatcgd dddd 14<400> 115 ddddgatcgd dddd 14
<210> 116 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 116 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 116 dddddgatcg dddd 14<400> 116 dddddgatcg dddd 14
<210> 117<210> 117
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 117 hhhhcaatch hhhh 14
<210> 118 <211> 14 <212> DNA<223> Description of the artificial sequence: oligonucleotide <400> 117 hhhhcaatch hhhh 14 <210> 118 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 118 hhhhhcaatc hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 118 hhhhhcaatc hhhh 14
<210> 119 <211> 14 <212> DNA<210> 119 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 119 hhhhctagch hhhh 14 <210> 120 <211> 14 <212> DNA <213> Kunstliche Sequenz <220><400> 119 hhhhctagch hhhh 14 <210> 120 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 120 hhhhhctagc hhhh 14<400> 120 hhhhhctagc hhhh 14
<210> 121 <211> 14 <212> DNA<210> 121 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 121 dddtgtatat gddd 14 <210> 122<400> 121 dddtgtatat gddd 14 <210> 122
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 122 dddtgtatac gddd 14<400> 122 dddtgtatac gddd 14
<210> 123
<211> 14<210> 123 <211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 123 dddcgtatat gddd 14<400> 123 dddcgtatat gddd 14
<210> 124 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 124 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 124 dddcgtatac gddd 14<400> 124 dddcgtatac gddd 14
<210> 125 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 125 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 125 hhhcatatac ahhh 14<400> 125 hhhcatatac ahhh 14
<210> 126<210> 126
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 126 hhhcgtatac ahhh 14<223> Description of the artificial sequence: oligonucleotide <400> 126 hhhcgtatac ahhh 14
<210> 127<210> 127
<211> 14 <212> DNA<211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 127 hhhcatatac ghhh 14 <210> 128 <211> 14 <212> DNA
<213> Künstliche Sequenz<400> 127 hhhcatatac ghhh 14 <210> 128 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 128 hhhcgtatac ghhh 14 <210> 129 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 128 hhhcgtatac ghhh 14 <210> 129 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz :Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 129 dddtgagttt gddd 14<400> 129 dddtgagttt gddd 14
<210> 130 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 130 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 130 dddtgagttc gddd 14<400> 130 dddtgagttc gddd 14
<210> 131 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 131 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 131 dddcgagttt gddd 14<400> 131 dddcgagttt gddd 14
<210> 132<210> 132
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd <400> 132 dddcgagttc gddd<223> Description of the artificial sequence: 01ιgonucleotιd <400> 132 dddcgagttc gddd
<210> 133 <211> 14 <212> DNA<210> 133 <211> 14 <212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 133 hhhcaaactc ahhh 14<223> Description of the artificial sequence: oligonucleotide <400> 133 hhhcaaactc ahhh 14
<210> 134 <211> 14 <212> DNA<210> 134 <211> 14 <212> DNA
<213> K nstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 134 hhhcgaactc ahhh 14 <210> 135 <211> 14 <212> DNA <213> Kunstliche Sequenz <220><400> 134 hhhcgaactc ahhh 14 <210> 135 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 135 hhhcaaactc ghhh 14<400> 135 hhhcaaactc ghhh 14
<210> 136 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 136 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 136 hhhcgaactc ghhh 14<400> 136 hhhcgaactc ghhh 14
<210> 137 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 137 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 137 dddtgttaat gddd 14<400> 137 dddtgttaat gddd 14
<210> 138<210> 138
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen
Sequenz : Oligonukleotid<223> Description of the artificial Sequence: oligonucleotide
<400> 138 dddcgttaat gddd 14<400> 138 dddcgttaat gddd 14
<210> 139<210> 139
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 139 dddtgttaac gddd 14<223> Description of the artificial sequence: oligonucleotide <400> 139 dddtgttaac gddd 14
<210> 140 <211> 14 <212> DNA<210> 140 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 140 dddcgttaac gddd 14<400> 140 dddcgttaac gddd 14
<210> 141<210> 141
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 141 hhhcattaac ahhh 14<223> Description of the artificial sequence: oligonucleotide <400> 141 hhhcattaac ahhh 14
<210> 142 <211> 14 <212> DNA<210> 142 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 142 hhhcattaac ghhh 14 <210> 143 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 142 hhhcattaac ghhh 14 <210> 143 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 143 hhhcgttaac ahhh 14 <210> 144 <211> 14 <212> DNA <213> Künstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 143 hhhcgttaac ahhh 14 <210> 144 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 144 hhhcgttaac ghhh 14<400> 144 hhhcgttaac ghhh 14
<210> 145 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 145 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 145 ddddtgtatg dddd 14<400> 145 ddddtgtatg dddd 14
<210> 146 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 146 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 146 ddddtgtacg dddd 14<400> 146 ddddtgtacg dddd 14
<210> 147<210> 147
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 147 ddddcgtatg dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 147 ddddcgtatg dddd 14
<210> 148 <211> 14 <212> DNA<210> 148 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 148
ddddcgtacg dddd 14<400> 148 ddddcgtacg dddd 14
<210> 149 <211> 14 <212> DNA<210> 149 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 149 hhhhcataca hhhh 14 <210> 150 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 149 hhhhcataca hhhh 14 <210> 150 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 150 hhhhcgtaca hhhh 14<400> 150 hhhhcgtaca hhhh 14
<210> 151 <211> 14 <212> DNA <213> Kunstliche Sequenz<210> 151 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 151 hhhhcatacg hhhh 14<400> 151 hhhhcatacg hhhh 14
<210> 152 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 152 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 152 hhhhcgtacg hhhh 14<400> 152 hhhhcgtacg hhhh 14
<210> 153<210> 153
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 153 dddggtcggt tddd 14
<210> 154 <211> 14 <212> DNA<223> Description of the artificial sequence: oligonucleotide <400> 153 dddggtcggt tddd 14 <210> 154 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 154 dddggttggt tddd 14<223> Description of the artificial sequence: oligonucleotide <400> 154 dddggttggt tddd 14
<210> 155 <211> 14 <212> DNA<210> 155 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 155 hhhaaccgac chhh 14 <210> 156 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 155 hhhaaccgac chhh 14 <210> 156 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 156 hhhaaccaac chhh 14<400> 156 hhhaaccaac chhh 14
<210> 157 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 157 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 157 ddddgacgtd dddd 14<400> 157 ddddgacgtd dddd 14
<210> 158 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 158 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 158 dddddgacgt dddd 14<400> 158 dddddgacgt dddd 14
<210> 159 <211> 14
<212> DNA<210> 159 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 159 ddddgatgtd dddd 14<400> 159 ddddgatgtd dddd 14
<210> 160<210> 160
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 160 dddddgatgt dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 160 dddddgatgt dddd 14
<210> 161 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 161 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 161 hhhhacgtch hhhh 14<400> 161 hhhhacgtch hhhh 14
<210> 162<210> 162
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 162 hhhhhacgtc hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 162 hhhhhacgtc hhhh 14
<210> 163 <211> 14 <212> DNA<210> 163 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 163 hhhhacatch hhhh 14 <210> 164<400> 163 hhhhacatch hhhh 14 <210> 164
<211> 14 <212> DNA
<213> Künstliche Sequenz<211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 164 hhhhhacatc hhhh 14 <210> 165 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 164 hhhhhacatc hhhh 14 <210> 165 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 165 ddddggcgtt dddd 14<400> 165 ddddggcgtt dddd 14
<210> 166 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 166 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 166 ddddggtgtt dddd 14<400> 166 ddddggtgtt dddd 14
<210> 167 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 167 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 167 hhhhaacgcc hhhh 14<400> 167 hhhhaacgcc hhhh 14
<210> 168<210> 168
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 168 hhhhaacacc hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 168 hhhhaacacc hhhh 14
<210> 169 <211> 14 <212> DNA<210> 169 <211> 14 <212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 169 ddddgtcggt dddd 14<223> Description of the artificial sequence: oligonucleotide <400> 169 ddddgtcggt dddd 14
<210> 170 <211> 14 <212> DNA<210> 170 <211> 14 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 170 ddddgttggt dddd 14 <210> 171 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 170 ddddgttggt dddd 14 <210> 171 <211> 14 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 171 hhhhaccgac hhhh 14<400> 171 hhhhaccgac hhhh 14
<210> 172 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 172 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 172 hhhhaccaac hhhh 14<400> 172 hhhhaccaac hhhh 14
<210> 173 <211> 13 <212> DNA <213> Kunstliche Sequenz<210> 173 <211> 13 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 173 ddddtgcggd ddd 13<400> 173 ddddtgcggd ddd 13
<210> 174<210> 174
<211> 14<211> 14
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen
Sequenz : Oligonukleotid<223> Description of the artificial Sequence: oligonucleotide
<400> 174 ddddttgtgg dddd 14<400> 174 ddddttgtgg dddd 14
<210> 175<210> 175
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 175 hhhhccgcga hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 175 hhhhccgcga hhhh 14
<210> 176 <211> 14 <212> DNA<210> 176 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 176 hhhhccacaa hhhh 14 <210> 177 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 176 hhhhccacaa hhhh 14 <210> 177 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 177 ddddttcggg dddd 14<400> 177 ddddttcggg dddd 14
<210> 178<210> 178
<211> 14<211> 14
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 178 ddddtttggg dddd 14<400> 178 ddddtttggg dddd 14
<210> 179 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 179 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz: Oligonukleotid
<400> 179 hhhhcccgaa hhhh 14<220><223> Description of the artificial sequence: oligonucleotide <400> 179 hhhhcccgaa hhhh 14
<210> 180<210> 180
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 180 hhhhcccaaa hhhh 14<400> 180 hhhhcccaaa hhhh 14
<210> 181 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 181 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 181 ddddttcgag dddd 14<400> 181 ddddttcgag dddd 14
<210> 182 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 182 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 182 ddddtttgag dddd 14<400> 182 ddddtttgag dddd 14
<210> 183<210> 183
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 183 hhhhctcgaa hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 183 hhhhctcgaa hhhh 14
<210> 184 <211> 14 <212> DNA<210> 184 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 184
hhhhctcaaa hhhh 14<400> 184 hhhhctcaaa hhhh 14
<210> 185 <211> 14 <212> DNA<210> 185 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 185 ddddcggtcg dddd 14 <210> 186 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 185 ddddcggtcg dddd 14 <210> 186 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 186 ddddtggttg dddd 14<400> 186 ddddtggttg dddd 14
<210> 187 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 187 <211> 14 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 187 ddddcggttg dddd 14<400> 187 ddddcggttg dddd 14
<210> 188 <211> 14 <212> DNA <213> Künstliche Sequenz<210> 188 <211> 14 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 188 ddddtggtcg dddd 14<400> 188 ddddtggtcg dddd 14
<210> 189<210> 189
<211> 14<211> 14
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 189 hhhhcgaccg hhhh 14
<210> 190 <211> 14 <212> DNA<223> Description of the artificial sequence: oligonucleotide <400> 189 hhhhcgaccg hhhh 14 <210> 190 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 190 hhhhcaacca hhhh 14<223> Description of the artificial sequence: oligonucleotide <400> 190 hhhhcaacca hhhh 14
<210> 191 <211> 14 <212> DNA<210> 191 <211> 14 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 191 hhhhcaaccg hhhh 14 <210> 192 <211> 14 <212> DNA <213> Künstliche Sequenz <220><400> 191 hhhhcaaccg hhhh 14 <210> 192 <211> 14 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 192 hhhhcgacca hhhh 14<400> 192 hhhhcgacca hhhh 14
<210> 193 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 193 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 193 ddgatgttdd 10<400> 193 ddgatgttdd 10
<210> 194 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 194 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz: Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 194 ddgacgttdd 10<400> 194 ddgacgttdd 10
<210> 195 <211> 10
<212> DNA<210> 195 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 195 hhaacatchh 10<400> 195 hhaacatchh 10
<210> 196<210> 196
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 196 hhaacgtchh 10<223> Description of the artificial sequence: oligonucleotide <400> 196 hhaacgtchh 10
<210> 197 <211> 10 <212> DNA<210> 197 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 197 ddttgtgadd 10 <210> 198 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 197 ddttgtgadd 10 <210> 198 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 198 ddttgcgadd 10<400> 198 ddttgcgadd 10
<210> 199<210> 199
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 199 hhtcacaahh 10<400> 199 hhtcacaahh 10
<210> 200 <211> 10 <212> DNA <213> Künstliche Sequenz
<220><210> 200 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 200 hhtcgcaahh 10<400> 200 hhtcgcaahh 10
<210> 201 <211> 10 <212> DNA <213> Künstliche Sequenz <220><210> 201 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 201 ddtttgaadd 10<400> 201 ddtttgaadd 10
<210> 202 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 202 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 202 hhttcaaahh 10<400> 202 hhttcaaahh 10
<210> 203 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 203 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 203 ddttcgaadd 10<400> 203 ddttcgaadd 10
<210> 204<210> 204
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 204 hhttcgaahh 10<223> Description of the artificial sequence: oligonucleotide <400> 204 hhttcgaahh 10
<210> 205 <211> 10 <212> DNA<210> 205 <211> 10 <212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 205 ddattgatdd 10<223> Description of the artificial sequence: oligonucleotide <400> 205 ddattgatdd 10
<210> 206 <211> 10 <212> DNA<210> 206 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 206 hhatcaathh 10 <210> 207 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 206 hhatcaathh 10 <210> 207 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 207 ddatcgatdd 10<400> 207 ddatcgatdd 10
<210> 208 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 208 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 208 hhatcgathh 10<400> 208 hhatcgathh 10
<210> 209 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 209 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 209 dtgg ttgdd 10<400> 209 dtgg ttgdd 10
<210> 210<210> 210
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen
Sequenz : Oligonukleotid<223> Description of the artificial Sequence: oligonucleotide
<400> 210 ddtggwttgd 10<400> 210 ddtggwttgd 10
<210> 211<210> 211
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 211 dcggwttgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 211 dcggwttgdd 10
<210> 212 <211> 10 <212> DNA<210> 212 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 212 ddcggwttgd 10 <210> 213 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 212 ddcggwttgd 10 <210> 213 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 213 dtgg tcgdd 10<400> 213 dtgg tcgdd 10
<210> 214<210> 214
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 214 ddtgg tcgd 10<400> 214 ddtgg tcgd 10
<210> 215 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 215 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 215 dcggwtcgdd 10<220><223> Description of the artificial sequence: oligonucleotide <400> 215 dcggwtcgdd 10
<210> 216 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 216 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 216 ddcgg tcgd 10<400> 216 ddcgg tcgd 10
<210> 217 <211> 10 <212> DNA<210> 217 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 217 hcaasccahh 10<223> Description of the artificial sequence: oligonucleotide <400> 217 hcaasccahh 10
<210> 218 <211> 10 <212> DNA<210> 218 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 218 hhcaasccah 10 <210> 219 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 218 hhcaasccah 10 <210> 219 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 219 hcaasccghh 10<400> 219 hcaasccghh 10
<210> 220 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 220 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 220 hhcaasccgh 10
<210> 221<400> 220 hhcaasccgh 10 <210> 221
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 221 hcgasccahh 10 <210> 222 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 221 hcgasccahh 10 <210> 222 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 222 hhcgasccah 10<400> 222 hhcgasccah 10
<210> 223 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 223 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 223 hcgasccghh 10<400> 223 hcgasccghh 10
<210> 224 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 224 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 224 hhcgasccgh 10<400> 224 hhcgasccgh 10
<210> 225<210> 225
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 225 ddagtgttdd 10
<210> 226 <211> 10 <212> DNA<223> Description of the artificial sequence: oligonucleotide <400> 225 ddagtgttdd 10 <210> 226 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 226 ddagcgttdd 10<223> Description of the artificial sequence: oligonucleotide <400> 226 ddagcgttdd 10
<210> 227 <211> 10 <212> DNA<210> 227 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 227 hhaacacthh 10 <210> 228 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 227 hhaacacthh 10 <210> 228 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 228 hhaacgcthh 10<400> 228 hhaacgcthh 10
<210> 229 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 229 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 229 ddtatgtgdd 10<400> 229 ddtatgtgdd 10
<210> 230 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 230 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 230 ddtacgtgdd 10<400> 230 ddtacgtgdd 10
<210> 231 <211> 10
<212> DNA<210> 231 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 231 hhcacatahh 10<400> 231 hhcacatahh 10
<210> 232<210> 232
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 232 hhcacgtahh 10<223> Description of the artificial sequence: oligonucleotide <400> 232 hhcacgtahh 10
<210> 233 <211> 10 <212> DNA<210> 233 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 233 ddtatgtadd 10 <210> 234<400> 233 ddtatgtadd 10 <210> 234
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 234 hhtacatahh 10<400> 234 hhtacatahh 10
<210> 235 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 235 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 235 ddtacgtadd 10<400> 235 ddtacgtadd 10
<210> 236 <211> 10 <212> DNA <213> Kunstliche Sequenz
<220><210> 236 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 236 hhtacgtahh 10<400> 236 hhtacgtahh 10
<210> 237 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 237 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 237 ddtttggadd 10<400> 237 ddtttggadd 10
<210> 238<210> 238
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 238 ddttcggadd 10<223> Description of the artificial sequence: oligonucleotide <400> 238 ddttcggadd 10
<210> 239 <211> 10 <212> DNA<210> 239 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 239 hhtccaaahh 10 <210> 240 <211> 10 <212> DNA <213> Kunstliche Sequenz <220><400> 239 hhtccaaahh 10 <210> 240 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 240 hhtccgaahh 10<400> 240 hhtccgaahh 10
<210> 241<210> 241
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Kunstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 241 ddatgtgtdd 10<223> Description of the artificial sequence: oligonucleotide <400> 241 ddatgtgtdd 10
<210> 242<210> 242
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 242 hhacacathh 10 <210> 243 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 242 hhacacathh 10 <210> 243 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz :Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 243 ddatgtgtdd 10<400> 243 ddatgtgtdd 10
<210> 244 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 244 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 244 hhacgcgthh 10<400> 244 hhacgcgthh 10
<210> 245 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 245 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 245 dgtggttgtd 10<400> 245 dgtggttgtd 10
<210> 246<210> 246
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen
Sequenz : Oligonukleotid<223> Description of the artificial Sequence: oligonucleotide
<400> 246 dgcggttgtd 10<400> 246 dgcggttgtd 10
<210> 247 <211> 10 <212> DNA<210> 247 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 247 dgcggtcgtd 10<223> Description of the artificial sequence: oligonucleotide <400> 247 dgcggtcgtd 10
<210> 248 <211> 10 <212> DNA<210> 248 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 248 dgtggtcgtd 10 <210> 249<400> 248 dgtggtcgtd 10 <210> 249
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 249 hacaaccach 10<400> 249 hacaaccach 10
<210> 250<210> 250
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 250 hacaaccgch 10<400> 250 hacaaccgch 10
<210> 251 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 251 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 251 hacgaccgch 10<220><223> Description of the artificial sequence: oligonucleotide <400> 251 hacgaccgch 10
<210> 252 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 252 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 252 hacgaccach 10<400> 252 hacgaccach 10
<210> 253<210> 253
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 253 ddtgtgtadd 10<223> Description of the artificial sequence: oligonucleotide <400> 253 ddtgtgtadd 10
<210> 254 <211> 10 <212> DNA<210> 254 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 254 ddtgcgtadd 10 <210> 255 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 254 ddtgcgtadd 10 <210> 255 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 255 hhtacacahh 10<400> 255 hhtacacahh 10
<210> 256 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 256 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 256 hhtacgcahh 10
<210> 257<400> 256 hhtacgcahh 10 <210> 257
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 257 ddgtgtgtdd 10<400> 257 ddgtgtgtdd 10
<210> 258 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 258 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 258 hhacacachh 10<400> 258 hhacacachh 10
<210> 259<210> 259
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 259 ddgcgcgtdd 10<223> Description of the artificial sequence: oligonucleotide <400> 259 ddgcgcgtdd 10
<210> 260 <211> 10 <212> DNA<210> 260 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 260 hhacgcgchh 10<400> 260 hhacgcgchh 10
<210> 261<210> 261
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 261 ddtgtatgdd 10
<210> 262 <211> 10 <212> DNA<223> Description of the artificial sequence: oligonucleotide <400> 261 ddtgtatgdd 10 <210> 262 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 262 ddcgtatgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 262 ddcgtatgdd 10
<210> 263 <211> 10 <212> DNA<210> 263 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 263 ddtgtacgdd 10 <210> 264 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 263 ddtgtacgdd 10 <210> 264 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 264 ddcgtacgdd 10<400> 264 ddcgtacgdd 10
<210> 265 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 265 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 265 hhcatacahh 10<400> 265 hhcatacahh 10
<210> 266 <211> 10<210> 266 <211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 266 hhcatacghh 10<400> 266 hhcatacghh 10
<210> 267 <211> 10
<212> DNA<210> 267 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 267 hhcgtacahh 10<400> 267 hhcgtacahh 10
<210> 268<210> 268
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 268 hhcgtacghh 10<223> Description of the artificial sequence: oligonucleotide <400> 268 hhcgtacghh 10
<210> 269 <211> 10 <212> DNA<210> 269 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 269 ddaatgttdd 10 <210> 270 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 269 ddaatgttdd 10 <210> 270 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 270 hhaacatthh 10<400> 270 hhaacatthh 10
<210> 271 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 271 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 271 ddaacgttdd 10<400> 271 ddaacgttdd 10
<210> 272 <211> 10 <212> DNA <213> Künstliche Sequenz
<220><210> 272 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 272 hhaacgtthh 10<400> 272 hhaacgtthh 10
<210> 273 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 273 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz :Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 273 ddtgattgdd 10<400> 273 ddtgattgdd 10
<210> 274<210> 274
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 274 ddtgatcgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 274 ddtgatcgdd 10
<210> 275 <211> 10 <212> DNA<210> 275 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 275 ddcgattgdd 10 <210> 276 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 275 ddcgattgdd 10 <210> 276 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 276 ddcgatcgdd 10<400> 276 ddcgatcgdd 10
<210> 277 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 277 <211> 10 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 277 hhcaatcahh 10<400> 277 hhcaatcahh 10
<210> 278 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 278 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 278 hhcgatcahh 10<400> 278 hhcgatcahh 10
<210> 279 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 279 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 279 hhcaatcghh 10<400> 279 hhcaatcghh 10
<210> 280<210> 280
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 280 hhcgatcghh 10<223> Description of the artificial sequence: oligonucleotide <400> 280 hhcgatcghh 10
<210> 281 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 281 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 281 ddgttgatdd 10<400> 281 ddgttgatdd 10
<210> 282<210> 282
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen
Sequenz : Oligonukleotid<223> Description of the artificial Sequence: oligonucleotide
<400> 282 ddgtcgatdd 10<400> 282 ddgtcgatdd 10
<210> 283<210> 283
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 283 hhatcaachh 10<223> Description of the artificial sequence: oligonucleotide <400> 283 hhatcaachh 10
<210> 284 <211> 10 <212> DNA<210> 284 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 284 hhatcgachh 10 <210> 285 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 284 hhatcgachh 10 <210> 285 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz :Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 285 dtggtattgd 10<400> 285 dtggtattgd 10
<210> 286<210> 286
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 286 dcggtatcgd 10<400> 286 dcggtatcgd 10
<210> 287 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 287 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 287 dtggtatcgd 10<220><223> Description of the artificial sequence: oligonucleotide <400> 287 dtggtatcgd 10
<210> 288 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 288 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 288 dcggtattgd 10<400> 288 dcggtattgd 10
<210> 289 <211> 10 <212> DNA<210> 289 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 289 hcaataccah 10<223> Description of the artificial sequence: oligonucleotide <400> 289 hcaataccah 10
<210> 290 <211> 10 <212> DNA<210> 290 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 290 hcgataccgh 10 <210> 291<400> 290 hcgataccgh 10 <210> 291
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 291 hcgataccah 10<400> 291 hcgataccah 10
<210> 292 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 292 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 292 hcaataccgh 10
<210> 293<400> 292 hcaataccgh 10 <210> 293
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 293 ddtgttttdd 10<400> 293 ddtgttttdd 10
<210> 294 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 294 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 294 ddcgttttdd 10<400> 294 ddcgttttdd 10
<210> 295<210> 295
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 295 hhaaaacahh 10<223> Description of the artificial sequence: oligonucleotide <400> 295 hhaaaacahh 10
<210> 296 <211> 10 <212> DNA<210> 296 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 296 hhaaaacghh 10 <210> 297 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 296 hhaaaacghh 10 <210> 297 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 297 dgtgtatgdd 10<400> 297 dgtgtatgdd 10
<210> 298
<211> 10<210> 298 <211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 298 ddgtgtatgd 10<400> 298 ddgtgtatgd 10
<210> 299<210> 299
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 299 dgtgtacgdd 10<400> 299 dgtgtacgdd 10
<210> 300 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 300 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 300 ddgtgtacgd 10<400> 300 ddgtgtacgd 10
<210> 301 <211> 12 <212> DNA <213> Künstliche Sequenz<210> 301 <211> 12 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 301 hhhcatacac hh 12<400> 301 hhhcatacac hh 12
<210> 302 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 302 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 302 hhcatacach 10<400> 302 hhcatacach 10
<210> 303 <211> 10
<212> DNA<210> 303 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 303 hcgtacachh 10<400> 303 hcgtacachh 10
<210> 304 <211> 10 <212> DNA<210> 304 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 304 hhcgtacach 10<223> Description of the artificial sequence: oligonucleotide <400> 304 hhcgtacach 10
<210> 305 <211> 10 <212> DNA<210> 305 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 305 ddgattgddd 10 <210> 306 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 305 ddgattgddd 10 <210> 306 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 306 dddgattgdd 10<400> 306 dddgattgdd 10
<210> 307<210> 307
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 307 ddgatcgddd 10<400> 307 ddgatcgddd 10
<210> 308 <211> 10 <212> DNA <213> Künstliche Sequenz
<220><210> 308 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 308 dddgatcgdd 10<400> 308 dddgatcgdd 10
<210> 309 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 309 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 309 hhcaatchhh 10<400> 309 hhcaatchhh 10
<210> 310<210> 310
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 310 hhhcaatchh 10<223> Description of the artificial sequence: oligonucleotide <400> 310 hhhcaatchh 10
<210> 311 <211> 10 <212> DNA<210> 311 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 311 hhctagchhh 10 <210> 312<400> 311 hhctagchhh 10 <210> 312
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 312 hhhctagchh 10<400> 312 hhhctagchh 10
<210> 313 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 313 <211> 10 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 313 dtgtatatgd 10<400> 313 dtgtatatgd 10
<210> 314 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 314 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 314 dtgtatacgd 10<400> 314 dtgtatacgd 10
<210> 315 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 315 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 315 dcgtatatgd 10<400> 315 dcgtatatgd 10
<210> 316<210> 316
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 316 dcgtatacgd 10<223> Description of the artificial sequence: oligonucleotide <400> 316 dcgtatacgd 10
<210> 317 <211> 10 <212> DNA<210> 317 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 317 hcatatacah 10 <210> 318 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 317 hcatatacah 10 <210> 318 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 318 hcgtatacah 10 <210> 319<223> Description of the artificial sequence: oligonucleotide <400> 318 hcgtatacah 10 <210> 319
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 319 hcatatacgh 10<400> 319 hcatatacgh 10
<210> 320 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 320 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 320 hcgtatacgh 10<400> 320 hcgtatacgh 10
<210> 321<210> 321
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 321 dtgagtttgd 10<400> 321 dtgagtttgd 10
<210> 322 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 322 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 322 dtgagttcgd 10<400> 322 dtgagttcgd 10
<210> 323 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 323 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 323 dcgagtttgd 10<220><223> Description of the artificial sequence: oligonucleotide <400> 323 dcgagtttgd 10
<210> 324<210> 324
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 324 dcgagttcgd 10<400> 324 dcgagttcgd 10
<210> 325<210> 325
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 325 hcaaactcah 10<223> Description of the artificial sequence: oligonucleotide <400> 325 hcaaactcah 10
<210> 326 <211> 10 <212> DNA<210> 326 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 326 hcgaactcah 10 <210> 327<400> 326 hcgaactcah 10 <210> 327
<211> 10<211> 10
<212> DNA<212> DNA
<213> Kunstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 327 hcaaactcgh 10<400> 327 hcaaactcgh 10
<210> 328<210> 328
<211> 10<211> 10
<212> DNA <213> Kunstliche Sequenz<212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 328 hcgaactcgh 10
<210> 329<400> 328 hcgaactcgh 10 <210> 329
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 329 dtgttaatgd 10<400> 329 dtgttaatgd 10
<210> 330 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 330 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 330 dcgttaatgd 10<400> 330 dcgttaatgd 10
<210> 331<210> 331
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 331 dtgttaacgd 10<223> Description of the artificial sequence: oligonucleotide <400> 331 dtgttaacgd 10
<210> 332 <211> 10 <212> DNA<210> 332 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 332 dcgttaacgd 10 <210> 333 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 332 dcgttaacgd 10 <210> 333 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 333 hcattaacah 10<400> 333 hcattaacah 10
<210> 334
<211> 10<210> 334 <211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 334 hcattaacgh 10<400> 334 hcattaacgh 10
<210> 335 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 335 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 335 hcgttaacah 10<400> 335 hcgttaacah 10
<210> 336 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 336 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 336 hcgttaacgh 10<400> 336 hcgttaacgh 10
<210> 337<210> 337
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 337 ddtgtatgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 337 ddtgtatgdd 10
<210> 338 <211> 10 <212> DNA<210> 338 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 338 ddtgtacgdd 10 <210> 339 <211> 10 <212> DNA
<213> Künstliche Sequenz<400> 338 ddtgtacgdd 10 <210> 339 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 339 ddcgtatgdd 10 <210> 340<400> 339 ddcgtatgdd 10 <210> 340
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 340 ddcgtacgdd 10<400> 340 ddcgtacgdd 10
<210> 341 <211> 10 <212> DNA<210> 341 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz:01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 341 hhcatacahh 10 <210> 342 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 341 hhcatacahh 10 <210> 342 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 342 hhcgtacahh 10<400> 342 hhcgtacahh 10
<210> 343 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 343 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 343 hhcatacghh 10<400> 343 hhcatacghh 10
<210> 344 <211> 10<210> 344 <211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 344 hhcgtacghh 10<400> 344 hhcgtacghh 10
<210> 345 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 345 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 345 dggtcggttd 10<400> 345 dggtcggttd 10
<210> 346<210> 346
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 346 dggttggttd 10<223> Description of the artificial sequence: oligonucleotide <400> 346 dggttggttd 10
<210> 347 <211> 10 <212> DNA<210> 347 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 347 haaccgacch 10 <210> 348 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 347 haaccgacch 10 <210> 348 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 348 haaccaacch 10<400> 348 haaccaacch 10
<210> 349<210> 349
<211> 10<211> 10
<212> DNA <213> Künstliche Sequenz<212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 349 ddgacgtddd 10<400> 349 ddgacgtddd 10
<210> 350 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 350 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 350 dddgacgtdd 10<400> 350 dddgacgtdd 10
<210> 351 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 351 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 351 ddgatgtddd 10<400> 351 ddgatgtddd 10
<210> 352<210> 352
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 352 dddgatgtdd 10<223> Description of the artificial sequence: oligonucleotide <400> 352 dddgatgtdd 10
<210> 353 <211> 10 <212> DNA<210> 353 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 353 hhacgtchhh 10 <210> 354<400> 353 hhacgtchhh 10 <210> 354
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 354 hhhacgtchh 10 <210> 355 <211> 10 <212> DNA <213> Kunstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 354 hhhacgtchh 10 <210> 355 <211> 10 <212> DNA <213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 355 hhacatchhh 10<400> 355 hhacatchhh 10
<210> 356 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 356 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 356 hhhacatchh 10<400> 356 hhhacatchh 10
<210> 357 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 357 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 357 ddggcgttdd 10<400> 357 ddggcgttdd 10
<210> 358<210> 358
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 358 ddggtgttdd 10<223> Description of the artificial sequence: oligonucleotide <400> 358 ddggtgttdd 10
<210> 359 <211> 10 <212> DNA<210> 359 <211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 359
hhaacgcchh 10<400> 359 hhaacgcchh 10
<210> 360<210> 360
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 360 hhaacacchh 10<400> 360 hhaacacchh 10
<210> 361<210> 361
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 361 ddgtcggtdd 10<223> Description of the artificial sequence: oligonucleotide <400> 361 ddgtcggtdd 10
<210> 362 <211> 10 <212> DNA<210> 362 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 362 ddgttggtdd 10 <210> 363<400> 362 ddgttggtdd 10 <210> 363
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 363 hhaccgachh 10<400> 363 hhaccgachh 10
<210> 364 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 364 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 364 hhaccaachh 10
<210> 365<400> 364 hhaccaachh 10 <210> 365
<211> 9<211> 9
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 365 ddtgcggdd<400> 365 ddtgcggdd
<210> 366 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 366 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 366 ddttgtggdd 10<400> 366 ddttgtggdd 10
<210> 367<210> 367
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :Oligonukleotid <400> 367 hhccgcgahh 10<223> Description of the artificial sequence: oligonucleotide <400> 367 hhccgcgahh 10
<210> 368 <211> 10 <212> DNA<210> 368 <211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 368 hhccacaahh 10 <210> 369 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 368 hhccacaahh 10 <210> 369 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz :Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 369 ddttcgggdd 10<400> 369 ddttcgggdd 10
<210> 370
<211> 10<210> 370 <211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 370 ddtttgggdd 10<400> 370 ddtttgggdd 10
<210> 371 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 371 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 371 hhcccgaahh 10<400> 371 hhcccgaahh 10
<210> 372 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 372 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 372 hhcccaaahh 10<400> 372 hhcccaaahh 10
<210> 373<210> 373
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 373 ddttcgagdd 10<223> Description of the artificial sequence: oligonucleotide <400> 373 ddttcgagdd 10
<210> 374<210> 374
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz :01ιgonukleotιd<223> Description of the artificial sequence: 01ιgonucleotιd
<400> 374 ddtttgagdd 10 <210> 375 <211> 10 <212> DNA
<213> Künstliche Sequenz<400> 374 ddtttgagdd 10 <210> 375 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 375 hhctcgaahh 10 <210> 376 <211> 10 <212> DNA <213> Künstliche Sequenz <220><400> 375 hhctcgaahh 10 <210> 376 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 376 hhctcaaahh 10<400> 376 hhctcaaahh 10
<210> 377 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 377 <211> 10 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 377 ddcggtcgdd 10<400> 377 ddcggtcgdd 10
<210> 378 <211> 10 <212> DNA <213> Künstliche Sequenz<210> 378 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 378 ddtggttgdd 10<400> 378 ddtggttgdd 10
<210> 379<210> 379
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 379 ddcggttgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 379 ddcggttgdd 10
<210> 380 <211> 10 <212> DNA<210> 380 <211> 10 <212> DNA
<213> Künstliche Sequenz
<220><213> Artificial sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid <400> 380 ddtggtcgdd 10<223> Description of the artificial sequence: oligonucleotide <400> 380 ddtggtcgdd 10
<210> 381 <211> 10 <212> DNA <213> Kunstliche Sequenz<210> 381 <211> 10 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 381 hhcgaccghh 10<400> 381 hhcgaccghh 10
<210> 382<210> 382
<211> 10<211> 10
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 382 hhcaaccahh 10<223> Description of the artificial sequence: oligonucleotide <400> 382 hhcaaccahh 10
<210> 383<210> 383
<211> 10 <212> DNA<211> 10 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 383 hhcaaccghh 10 <210> 384 <211> 10 <212> DNA <213> Kunstliche Sequenz <220><400> 383 hhcaaccghh 10 <210> 384 <211> 10 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der kunstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 384 hhcgaccahh 10<400> 384 hhcgaccahh 10
<210> 385 <211> 20 <212> DNA <213> Künstliche Sequenz<210> 385 <211> 20 <212> DNA <213> Artificial sequence
<220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 385 gtttagaagt ttaagattag 20<400> 385 gtttagaagt dtaagattag 20
<210> 386 <211> 20 <212> DNA <213> Künstliche Sequenz<210> 386 <211> 20 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 386 caaaaactca acctctatct 20<400> 386 caaaaactca acctctatct 20
<210> 387 <211> 18 <212> DNA <213> Künstliche Sequenz<210> 387 <211> 18 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 387 tttttagtcg attttaga 18<400> 387 tttttagtcg attttaga 18th
<210> 388<210> 388
<211> 18<211> 18
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 388 tttttagttg attttaga 18<223> Description of the artificial sequence: oligonucleotide <400> 388 tttttagttg attttaga 18
<210> 389 <211> 20 <212> DNA<210> 389 <211> 20 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 389 atttggagtt gaagtatttg 20 <210> 390<400> 389 atttggagtt gaagtatttg 20 <210> 390
<211> 20<211> 20
<212> DNA<212> DNA
<213> Künstliche Sequenz <220><213> Artificial sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid
<400> 390 aactataccc aaacacctac 20 <210> 391 <211> 18 <212> DNA <213> Künstliche Sequenz <220><223> Description of the artificial sequence: oligonucleotide <400> 390 aactataccc aaacacctac 20 <210> 391 <211> 18 <212> DNA <213> Artificial Sequence <220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 391 tgtttatgcg tatttgtt 18<400> 391 tgtttatgcg tatttgtt 18
<210> 392 <211> 18 <212> DNA <213> Künstliche Sequenz<210> 392 <211> 18 <212> DNA <213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 392 tgtttatgtg tatttgtt<400> 392 tgtttatgtg tatttgtt
<210> 393 <211> 28 <212> DNA <213> Künstliche Sequenz<210> 393 <211> 28 <212> DNA <213> Artificial sequence
<220> <223> Beschreibung der künstlichen Sequenz : Oligonukleotid<220> <223> Description of the artificial sequence: oligonucleotide
<400> 393 agggagtttt ttttagggaa tagaggga 28<400> 393 agggagtttt ttttagggaa tagaggga 28
<210> 394<210> 394
<211> 28<211> 28
<212> DNA<212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz : Oligonukleotid <400> 394 taatcccaaa acctctccac tacaacaa 28<223> Description of the artificial sequence: oligonucleotide <400> 394 taatcccaaa acctctccac tacaacaa 28
<210> 395 <211> 11 <212> DNA<210> 395 <211> 11 <212> DNA
<213> Künstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der künstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 395
caaacgttca a 11<400> 395 caaacgttca a 11
<210> 396 <211> 11 <212> DNA<210> 396 <211> 11 <212> DNA
<213> Kunstliche Sequenz<213> Artificial sequence
<220><220>
<223> Beschreibung der kunstlichen Sequenz: Oligonukleotid<223> Description of the artificial sequence: oligonucleotide
<400> 396 caaacattca a 11
<400> 396 caaacattca a 11