DE20121978U1 - Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas - Google Patents

Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas Download PDF

Info

Publication number
DE20121978U1
DE20121978U1 DE20121978U DE20121978U DE20121978U1 DE 20121978 U1 DE20121978 U1 DE 20121978U1 DE 20121978 U DE20121978 U DE 20121978U DE 20121978 U DE20121978 U DE 20121978U DE 20121978 U1 DE20121978 U1 DE 20121978U1
Authority
DE
Germany
Prior art keywords
dna
seq
cytosine
oligomer
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
DE20121978U
Other languages
German (de)
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10032529A external-priority patent/DE10032529A1/en
Application filed by Epigenomics AG filed Critical Epigenomics AG
Priority to DE20121978U priority Critical patent/DE20121978U1/en
Priority claimed from EP01962814A external-priority patent/EP1356099A2/en
Publication of DE20121978U1 publication Critical patent/DE20121978U1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

A nucleic acid (I) comprising a sequence of at least 18 bases in length of a segment of chemically pretreated genomic DNA which has any one of the sequences of (S1)-(S120) or its complement, is new. Sequence listing of (S1)-(S120) not provided in the specification. Independent claims are also included for the following: (1) an oligomer (II), in particular an oligonucleotide or peptide nucleic acid (PNA)-oligomer comprising at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to (I); (2) a set of oligomers (III) comprising at least two (II); (3) a set of at least two oligonucleotides used as primer oligonucleotides for amplification of DNA (S1)-(S120) and/or chemically pretreated DNA of gene sequences or complementary to it; (4) use of the set of oligomer probes of at least 10 oligomers to detect the cytosine methylation state and/or single nucleotide polymorphisms (SNPs) in a chemically pretreated genomic DNA; (5) manufacturing (M1) an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of any one of (S1)-(S120) or sequences complementary to it, where at least one (II) is coupled to a solid phase; (6) an arrangement (IV) of different oligomers (array) obtained according to (M1); (7) a DNA- and/or peptide nucleic acid (PNA)-array (V) for analyzing diseases associated with the methylation state of genes, comprising at least one nucleic acid as described above; (8) a kit (VI) comprising a bisulfite (=disulfite, hydrogen sulfite) as well as (II); and (9) (III) for determining genetic and/or epigenetic parameters, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas, or the predisposition to astrocytomas by analyzing cytosine methylations, involves obtaining a biological sample containing genomic DNA e.g., cells or cellular components which contain DNA, sources of DNA comprising, e.g., cell lines, histological slides, biopsies, cerebrospinal fluid, lymphatic fluid, tissue embedded in paraffin; brain or lymphatic tissue and all possible combinations; extracting the genomic DNA; converting cytosine bases which are unmethylated at the 5-position, in the genomic DNA sample, to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior, by chemical treatment; and amplifying chemically pretreated genomic DNA fragments using (III) (preferably comprising two (II) of which at least one oligonucleotide is bound to a solid phase) and a polymerase, where the amplificates carry a detectable label. The method further involves identifying methylation status of one or more cytosine positions, and analyzing methylation status of the cytosine positions by reference to one or more data sets. ACTIVITY : Cytostatic. No supporting data is given. MECHANISM OF ACTION : Gene therapy. No supporting data is given.

Description

Gebiet der ErfindungField of the Invention

Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms.According to the methodological developments levels of observation well studied in molecular biology in recent years are the genes themselves, the translation of these genes in RNA and the resulting proteins. When in In the course of the development of an individual which gene is switched on and how to activate and inhibit certain genes in certain Cells and tissues are controlled with the extent and character of methylation the genes or the genome can be correlated. In this respect, pathogenic conditions express themselves in one changed Methylation patterns of individual genes or the genome.

Die vorliegende Erfindung betrifft Nukleinsäuren, Oligonukleotide, PNA-Oligomere und ein Verfahren für die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung, Therapie und/oder Diagnose oder die Prädisposition von Astrocytomen durch die Analyse der genetischen und/oder epigenetischen Parametern von genomischer DNA und insbesondere dessen Cytosin-Methylierungsstatus.The present invention relates to nucleic acids, Oligonucleotides, PNA oligomers and a method for characterization, Classification, differentiation, grade classification, grading, therapy and / or diagnosis or predisposition of astrocytomas by analyzing the genetic and / or epigenetic parameters of genomic DNA and in particular its cytosine methylation status.

Stand der TechnikState of the art

Es wird vorhergesehen, daß in den Vereinigten Staaten 2001 17,200 Erwachsene Hirntumore entwickeln werden. Von den verschiedenen Klassen an Tumoren sind Gliome die häufigsten, von denen Atrocytome einer der am meisten verbreiteten sind. Diese können gemäß der WHO Klassifikation in vier Kategorien eingestuft werden, pilocytische Astrocytome, niedrig-Grad nichtpilocytische Astrocytome, anaplastische Gliome und Glioblastome multiforme. Pilocytische Astrocytome (WHO Grad I) sind die am meisten benignen und werden gewöhnlich in Kindheitsfällen gefunden. Sie bilden gelegentlich Zysten oder sind in Zysten eingeschlossen und wachsen langsam und im allgemeinen nicht-invasiv. Die Behandlung im ersten Fall erfolgt durch Chirurgie, die in einigen Fällen von Bestrahlungstherapie gefolgt werden kann. Die Effektivität von Chemotherapie und anderen Formen der Behandlung werden augenblicklich untersucht.It is anticipated that in the United States 2001, 17,200 adult brain tumors develop become. Of the different classes of tumors, gliomas are the most common frequently atrocytomas are one of the most common. This can according to the WHO Classification can be classified into four categories, pilocytic Astrocytomas, low-grade non-pilocytic astrocytomas, anaplastic Gliomas and glioblastomas multiforme. Pilocytic astrocytomas (WHO Grade I) are the most benign and are usually in Childhood cases found. They occasionally form cysts or are encased in and grow slowly and generally non-invasively. The treatment in the first case is done by surgery, which in some cases of Radiation therapy can be followed. The effectiveness of chemotherapy and other forms of treatment are being examined immediately.

Grad II Astrocytome schließen fibrilläre, gemistocytische und protoplasmatische Astrocytome ein. Im Gegensatz zu Grad I Tumoren sind sie infiltrativ. Die Behandlung erfolgt idealerweise durch vollständige chirurgische Entfernung, wo möglich. In einigen Fällen kann die Chirurgie durch Bestrahlungstherapie ergänzt werden.Grade II astrocytomas include fibrillar, gemistocytic and protoplasmic astrocytomas. In contrast to grade I tumors they are infiltrative. The treatment is ideally carried out by full surgical removal where possible. In some cases surgery can be supplemented by radiation therapy.

Eine grundlegende Eigenschaft von astrocytotischen Gliomen ist eine Fähigkeit, einer anaplastischen Veränderung unterzogen zu werden. Dies wird mit der Entwicklung von seriellen genetischen Defekten in Zusammenhang gebracht, die für das geordnete Fortschreiten von Eigenschaften der Malignität verantwortlich sind, d.h. Hyperzellularität, Anaplasie. Es ist wichtig, eine Unterscheidung zwischen Grad I pilocytischen Astrocytomen und diffusiv infiltrierenden Grad II Tumoren zu treffen, da nur die zuletzt genannte Gruppe weist eine Neigung auf, sich in die malignen Grad III (z. B. anaplastische Astrocytome) und letztlich Grad IV (z. B. Glioblastom multiforme) Tumore zu entwickeln.A fundamental property of Astrocytotic glioma is an anaplastic change ability to be subjected. This is with the development of serial genetic defects related to the orderly Progression of properties of the malignancy, i.e. hypercellularity, Anaplasia. It is important to distinguish between grade I pilocytic To hit astrocytomas and diffusively infiltrating grade II tumors, since only the latter group has a tendency to itself in malignant grade III (e.g. anaplastic astrocytomas) and ultimately Grade IV (e.g. glioblastoma multiforme) tumors develop.

Anders als für Brustkrebs und die meisten anderen Formen von Krebs gibt es keine etablierten Richtlinien zur Einstufung von Astrocytomen. Die Diagnose erfolgt oftmals durch Scanbildgebende Verfahren (z. B. MRI, CT), die von einer Biopsie für die histologische und cytologische Analyse gefolgt werden kann. Unter der Verwendung solcher Verfahren kann die Unterscheidung zwischen Grad I und Grad II Astrocytomen nicht immer klar sein.Unlike breast cancer and most There are no established guidelines for other forms of cancer Classification of astrocytomas. The diagnosis is often made through Scanning imaging procedures (e.g. MRI, CT) by a biopsy for the histological and cytological analysis can be followed. Under the use of such methods can distinguish between Grade I and Grade II astrocytomas may not always be clear.

Die Diagnose durch solche Verfahren verwendet nicht die molekulare Basis des Fortschreitens der Malignität. Weiterhin bieten molekulare Marker den Vorteil, daß sogar Proben sehr kleiner Größe und Proben, deren Gewebearchitektur nicht erhalten wurde, relativ effizient analysiert werden können. Innerhalb des letzten Jahrzehnts wurde von zahlreichen Genen gezeigt, daß diese zwischen benignen und malignen Tumoren unterschiedlich exprimiert werden. Jedoch wurde von keinem einzelnen Marker gezeigt, daß er für die Unterscheidung zwischen den zwei Tumoren ausreichend ist. Von hoch-dimensionalen mRNA-basierten Ansätzen wurde kürzlich gezeigt, daß sie in der Lage sind, ein besseres Mittel zur Verfügung zu stellen, um zwischen verschiedenen Tumortypen und benignen und malignen Läsionen zu unterscheiden. Die Anwendung als ein Routine diagnostisches Werkzeug in einer klinischen Umgebung wird jedoch durch die extreme Instabilität der mRNA, die im Anschluß an bestimmte auslösende Faktoren (z. B. die Probensammlung) schnell auftretende Expressionsveränderungen und, was am Wichtigsten ist, die große Menge an mRNA, die für die Analyse benötigt wird (Lipshutz, R. J. et al., Nature Genetics 21:20-24, 1999; Bowtell, D. D. L. Nature genetics suppl. 21:25-32, 1999), und die oft nicht von einer Routinebiopsie erhalten werden kann, behindert.Diagnosis through such procedures does not use the molecular basis of malignancy progression. Farther molecular markers offer the advantage that even samples are very small Size and samples whose Tissue architecture has not been preserved, analyzed relatively efficiently can be. Over the past decade, numerous genes have been shown that these differently expressed between benign and malignant tumors become. However, no single marker was shown to be used for differentiation between the two tumors is sufficient. From high-dimensional mRNA-based approaches were used recently shown that they are able to provide a better means to switch between different Differentiate between tumor types and benign and malignant lesions. The Application as a routine diagnostic tool in a clinical setting Environment is characterized by the extreme instability of the mRNA, the following certain triggering Factors (e.g. sample collection) of rapidly occurring changes in expression and, most importantly, the large amount of mRNA needed for analysis needed (Lipshutz, R.J. et al., Nature Genetics 21: 20-24, 1999; Bowtell, D. D. L. Nature genetics suppl. 21: 25-32, 1999), and often not can be obtained from a routine biopsy.

Die aberrante DNA Methylierung innerhalb von CpG Inseln ist in menschlichen malignen Erkrankungen verbreitet, was zu einer Einstellung oder Überexpression eines breiten Spektrums von Genen führt (Jones, P.A. Cancer Res 65:2463-2467, 1996). Von der abnormalen Methylierung wurde auch gezeigt, daß sie in CpG reichen regulatorischen Elementen in intronischen und kodierenden Teilen von Genen von bestimmten Tumoren (Chan, M.F., et al1., Curr Top Microbiol Immunol 249:75-86,2000) auftritt. Hoch charakteristische DNA Methylierungsmuster konnten auch für Brustkrebs Zellinien gezeigt werden (Huang, T. H.-M., et al., Hum Mol Genet 8:459-470, 1999).Aberrant DNA methylation within CpG islets is common in human malignancies, resulting in the setting or overexpression of a wide range of genes (Jones, PA Cancer Res 65: 2463-2467, 1996). The abnormal methylation has also been shown to occur in CpG rich regulatory elements in intronic and coding parts of genes from certain tumors (Chan, MF, et al1., Curr Top Microbiol Immunol 249: 75-86,2000). Highly characteristic DNA Me Methylation patterns could also be shown for breast cancer cell lines (Huang, TH-M., et al., Hum Mol Genet 8: 459-470, 1999).

Die abnormale Methylierung von Genen wurde mit dem Auftreten von Gliomen in Zusammenhang gebracht (z.B. Epigenetic silencing of PEG3 gene expression in human glioma cell lines. Maegawa et. al. Mol Carcinog. 2001 May;31(1):1-9. ). Es wurde auch gezeigt, daß die Analyse von Methylierungsmustern mit der Entwicklung von Astrocytomen geringen Grades korreliert werden kann (Aberrant methylation of genes in low-grade Astrocytomen. Costello JF, Plass C, Cavenee WK. Brain Tumor Pathol. 2000;17(2):49-56). Jedoch sind die in solchen Studien verwendeten Techniken (Restriktions-Landmark genomisches Scanning, Imprinting-Analyse) auf die Forschung begrenzt, sie sind für die Verwendung in einem klinischen oder diagnostischen Aufbau ungeeignet und stellen keine Basis für die Entwicklung eines mittleren oder Hochdurchsatz-Verfahren für die Analyse von Gliomen zur Verfügung.The abnormal methylation of genes has been associated with the appearance of gliomas (e.g. Epigenetic silencing of PEG3 gene expression in human glioma cell lines. Maegawa et. al. Mole carcinog. 2001 May; 31 (1): 1-9. ). It was also shown that the Analysis of methylation patterns with the development of astrocytomas low degree can be correlated (aberrant methylation of genes in low-grade astrocytomas. Costello JF, Plass C, Cavenee WK. Brain tumor pathol. 2000; 17 (2): 49-56). However, they are in such Studies used techniques (genomic restriction landmark) Scanning, imprinting analysis) limited to research, they are for use in a clinical setting or diagnostic structure unsuitable and do not provide a basis for development a medium or high throughput method for the analysis of gliomas Available.

5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryontischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR-Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.5-methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. she plays for example a role in the regulation of transcription, in genetic imprinting and tumorigenesis. The identification of 5-methylcytosine as a component of genetic information therefore of considerable interest. However, 5-methylcytosine positions cannot be sequenced can be identified because 5-methylcytosine has the same base pairing behavior has like cytosine. About that In addition, the PCR information amplifies the epigenetic information, which carry the 5-methylcytosine, completely lost.

Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, daß Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch „normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15;24(24):5064-6). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr kleinen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren.A relatively new one and now most frequently method used to examine DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, the after subsequent alkaline hydrolysis is converted into uracil, which in its Base pairing behavior corresponds to the thymidine. 5-methylcytosine however, is not modified under these conditions. So that will the original DNA converted so that methyl cytosine, which originally not distinguished from cytosine by its hybridization behavior can now, through "normal" molecular biological techniques as the only remaining cytosine, for example detected by amplification and hybridization or sequencing can. All of these techniques are based on base pairing, which is now is fully exploited. The state of the art in terms of sensitivity concerns, is defined by a method which the DNA to be examined in an agarose matrix includes, thereby the diffusion and renaturation of the DNA (bisulfite only reacts on single-stranded DNA) prevented and all precipitation and cleaning steps replaced by rapid dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15; 24 (24): 5064-6). With this method you can individual cells are examined, what is the potential of the method illustrated. However, so far only individual regions up to about 3000 base pairs in length examined, a global study of cells for thousands of possible Methylation analysis is not possible. However, it can also this method does not produce very small fragments from small sample amounts reliable analyze. Despite diffusion protection, these pass through the matrix lost.

Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Übersichtsartikel entnommen werden: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.An overview of the other known ones Possibilities, Detecting 5-methylcytosine can be found in the following review article are taken from: Rein, T., DePamphilis, M.L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.

Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z.B. Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr;5(2):94-8) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifiziert und entweder komplett sequenziert (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov;17(3):275-6) oder einzelne Cytosin-Positionen durch eine „Primer-Extension-Reaktion" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15;25(12):2529-31, WO 95/00669) oder einen Enzymschnitt (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15;25(12):2532-4) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99/28498).The bisulfite technique is so far with a few exceptions (e.g. Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5 (2): 94-8) only in applied to research. But short, specific pieces always become one known gene amplified after a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov; 17 (3): 275-6) or single cytosine positions a "primer extension reaction" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotides primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15; 25 (12): 2529-31, WO 95/00669) or an enzyme cut (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15; 25 (12): 2532-4). In addition, the Detection by hybridization has been described (Olek et al., WO 99/28498).

Weitere Publikationen, die sich mit der Anwendung der Bisulfit-Technik zum Methylierungsnachweis bei einzelnen Genen befassen, sind: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar;6(3):387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19;157(1-2):261-4; WO 97/46705, WO 95/15373 und WO 97/45560.Other publications dealing with the use of the bisulfite technique for methylation detection individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioassays. 1994 Jun; 16 (6): 431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi / Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar; 6 (3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25; 22 (4): 695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5 'region of the pS2 gene and its expression in human breast cancer cell lines. Genes. 1995 May 19; 157 (1-2): 261-4; WO 97/46705, WO 95/15373 and WO 97/45560.

Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) und der dort zitierten Literatur entnehmen.An overview of the state of the art in the oligomer array production can be from a special edition of Nature Genetics published in January 1999 (Nature Genetics Supplement, Volume 21, January 1999) and the one there Take cited literature.

Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoreszenzmarkierte Sonden verwendet worden. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'-OH der jeweiligen Sonde. Die Detektion der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.For the scanning of an immobilized DNA array is often fluorescence-labeled Probes have been used. It is particularly suitable for fluorescent labels the simple attachment of Cy3 and Cy5 dyes to the 5'-OH respective probe. Detection of the fluorescence of the hybridized For example, probes are made using a confocal microscope. The dyes are Cy3 and Cy5, among many other, commercially available.

Matrix-assistierte Laser Desorptions/Ionisations-Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15;60(20):2299-301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisa tion des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere.Matrix-assisted laser desorption / ionization mass spectrometry (MALDI-TOF) is a very powerful development for analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60 (20): 2299-301). An analyte is transformed into a light absorbing one Embedded matrix. The matrix is formed by a short laser pulse evaporates and the analyte molecule transported unfragmented into the gas phase. By collisions with matrix molecules the ionization of the analyte is reached. An applied voltage accelerates the ions into a field-free flight tube. Because of their different Masses are accelerated to different extents. Smaller ions reach the detector earlier than bigger ones.

MALDI-TOF Spektrometrie eignet sich ausgezeichnet zur Analyse von Peptiden und Proteinen. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. In der MALDI-TOF Spektrometrie spielt die Wahl der Matrix eine eminent wichtige Rolle. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrizes gefunden worden, die eine sehr feine Kristallisation ergeben. Für DNA gibt es zwar mittlerweile einige ansprechende Matrizes, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, daß sie einem Peptid ähnlicher wird. Phosphorothioatnukleinsäuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25;23(8):1367-73). Die Kopplung eines „charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. Ein weiterer Vorteil von „charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren.MALDI-TOF spectrometry is suitable excellent for the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and future trends. 1995, 1; 147-57). Sensitivity to nucleic acids about 100 times worse than for Peptides and decreases disproportionately with increasing fragment size. For nucleic acids that a often negatively charged backbone have, the ionization process is through the matrix much more inefficient. In MALDI-TOF spectrometry the choice of matrix plays an eminently important role. For desorption some very powerful matrices have been found from peptides, which result in a very fine crystallization. For DNA there is now some appealing matrices, but this made the difference in sensitivity not decreased. The difference in sensitivity can be reduced by chemically modifying the DNA so that it Peptide becomes more similar. Phosphorothioate nucleic acids, where the ordinary Backbone phosphates are substituted by thiophosphates, can be replaced by simple Converting alkylation chemistry into a charge-neutral DNA (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25; 23 (8): 1367-73). The coupling of a “charge tags "on this modified DNA results in the increase in Sensitivity by the same amount found for peptides. On another advantage of “charge tagging "is the heightened stability the analysis against impurities, the detection of unmodified Make substrates very difficult.

Genomische DNA wird durch Standardmethoden aus DNA von Zell-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.Genomic DNA is made by standard methods obtained from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.

Beschreibungdescription

Die offenbarte Erfindung stellt ein Verfahren und Nukleinsäuren zur Einstufung von Astrocytomen zur Verfügung. Sie beschreibt ein Mittel zur Unterscheidung zwischen gesundem Gewebe, pilocytischem Astrocytom (Grad I) und Grad II Astrocytomzellen. Dies stellt ein Mittel für die verbesserte Einstufung und Grad-Einteilung von Hirmtumoren auf einem molekularen Niveau im Gegensatz zu den augenblicklich verwendeten Verfahren relativ subjektiver Natur, wie zum Beispiel histologische Analyse und Scan-Imaging. Dies ist von besonderer Wichtigkeit aufgrund von den verschiedenen Prognose und der Behandlung von Grad I und II Astrocytom-Patienten. Die offenbarte Erfindung stellt die Mittel für die Entwicklung eines standardisiertes Verfahren der Eistufung von Astrocytomen zur Verfügung, das im Augenblick nicht existiert. Weiterhin zeigt die offenbarte Erfindung Verbesserungen über den Stand der Technik, da die augenblicklichen Verfahren der histologischen und cytologischen Analyse erfordern, daß die Biopsie eine ausreichende Menge an Gewebe enthält. Das Verfahren gemäß der vorliegenden Erfindung kann zur Klassifizierung von kleinsten Proben verwendet werden.The disclosed invention ceases Methods and nucleic acids for the classification of astrocytomas. It describes a remedy to distinguish between healthy tissue, pilocytic astrocytoma (Grade I) and Grade II astrocytoma cells. This represents a means for the improved Classification and grading of brain tumors on a molecular basis Level in contrast to the methods currently used relatively subjective in nature, such as histological analysis and scan imaging. This is of particular importance due to the different prognosis and the treatment of grade I and II Astrocytoma patients. The disclosed invention provides the means for the Development of a standardized procedure for the classification of astrocytomas to disposal, that doesn't exist at the moment. Furthermore, the disclosed invention shows Improvements over the state of the art since the current methods of histological and Cytological analysis require that the biopsy be adequate Contains amount of tissue. The method according to the present Invention can be used to classify very small samples become.

Die Erfindung stellt die chemisch modifizierte genomische DNA zur Verfügung, sowie Oligonukleotide und/oder PNA-Oligomere zum Nachweis von Cytosin-Methylierungen, sowie ein Verfahren, das besonders für die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einteilung, Einstufung und Behandlung und/oder der Diagnose von Astrocytomen geeignet ist. Die vorliegende Erfindung basiert auf der Entdeckung, daß genetische und epigenetische Parametern und, insbesondere die Cytosin-Methylierungsmuster von genomischer DNA besonders für die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einteilung, Einstufung und Behandlung und/oder der Diagnose von Astrocytomen geeignet sind.The invention represents the chemical modified genomic DNA available, as well as oligonucleotides and / or PNA oligomers for the detection of cytosine methylations, as well as a Procedure that is especially for the Characterization, classification, differentiation, grading, Classification and treatment and / or diagnosis of astrocytomas suitable is. The present invention is based on the discovery that genetic and epigenetic parameters and, especially the cytosine methylation pattern of genomic DNA especially for the characterization, classification, differentiation, grading, Classification and treatment and / or diagnosis of astrocytomas are suitable.

Diese Aufgabe wird gemäß der vorliegenden Erfindung gelöst, indem eine Nukleinsäure verwendet wird, die eine Sequenz von mindestens 18 Basen Länge der chemisch vorbehandelten genomischen DNA gemäß einer der Seq. ID No.1 bis Seq. ID No.120 enthält.This task is performed according to the present Invention solved, by adding a nucleic acid a sequence of at least 18 bases in length is used chemically pretreated genomic DNA according to one of the Seq. ID No.1 to Seq. ID No.120 contains.

Die chemisch modifizierte Nukleinsäure konnte bisher nicht in Zusammenhang mit der Ermittlung von genetischen und epigenetische Parametern gebracht werden.The chemically modified nucleic acid could so far not in connection with the identification of genetic and epigenetic parameters are brought.

Die Aufgabe der vorliegenden Erfindung wird weiterhin durch ein Oligonukleotid oder Oligomer zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter DNA, umfassend mindestens eine Basensequenz mit einer Länge von mindestens 13 Nukleotiden gelöst, die an eine chemisch vorbehandelte DNA gemäß einer der Seq. ID No. 1 bis Seq. ID No. 120 hybridisiert. Die erfindungsgemäßen Oligomersonden stellen wichtige und effektive Werkzeuge dar, die es zum ersten Mal ermöglichen, spezifische genetische und epigenetische Parameter von Hirntumoren zu ermitteln, insbesondere bei der Charakterisierung, Klassifizierung, Differenzierung, Grad-Einteilung, Einstufung und Behandlung und/oder der Diagnose von Astrocytomen. Bevorzugterweise umfaßt die Basensequenz der Oligomere mindestens ein CpG Dinukleotid. Die Sonden können auch in Form einer PNA (Peptide Nucleic Acid) vorliegen, die besonders bevorzugte Paarungseigenschaften aufweist. Besonders bevorzugt sind erfindungsgemäße Oligonukleotide, bei denen das Cytosin des CpG Dinukleotids das 5. – 9. Nukleotid vom 5'-Ende des 13-mers ist, im Falle von PNA-Oligomeren ist es bevorzugt, daß das Cytosin des CpG Dinukleotids das 4. – 6. Nukleotid vom 5'-Ende des 9-mers ist.The object of the present invention is further detected by an oligonucleotide or oligomer the cytosine methylation state in chemically pretreated DNA, comprising at least one base sequence with a length of at least 13 nucleotides dissolved, the to a chemically pretreated DNA according to one of the Seq. ID No. 1 to Seq. ID No. 120 hybridizes. The oligomer probes according to the invention important and effective tools that make it possible for the first time specific genetic and epigenetic parameters of brain tumors to determine, in particular in the characterization, classification, Differentiation, grading, grading and treatment and / or the diagnosis of astrocytomas. The base sequence preferably comprises the oligomers at least one CpG dinucleotide. The probes can too in the form of a PNA (Peptide Nucleic Acid), which are particularly has preferred mating properties. Are particularly preferred oligonucleotides according to the invention, in which the cytosine of the CpG dinucleotide is the 5th - 9th nucleotide from the 5 'end of the 13-mer, in the case of PNA oligomers it is preferred that Cytosine of the CpG dinucleotide the 4th - 6th nucleotide from the 5 'end of the 9's.

Die erfindungsgemäßen Oligomere werden normalerweise in sogenannten „Sets" eingesetzt, die für jedes der CpG Dinukleotide eine der Sequenzen der Seq. ID No. 1 bis Seq. ID No. 120 mindestens ein Oligomer umfassen. Bevorzugt ist ein Set, das für jedes der CpG Dinukleotide aus einer der Seq ID No. 1 bis Seq ID No. 120 mindestens ein Oligomer umfaßt.The oligomers of the invention are normally in so-called "sets" used for each the CpG dinucleotide is one of the sequences of Seq. ID No. 1 to Seq. ID No. 120 comprise at least one oligomer. A set is preferred, that for each of the CpG dinucleotides from one of the Seq ID No. 1 to Seq ID No. 120 comprises at least one oligomer.

Darüber hinaus stellt die Erfindung ein Set von mindestens zwei Oligonukleotiden zur Verfügung, die als sogenannte „Primer-Oligonukleotide" zur Amplifikation von DNA-Sequenzen einer der Seq. ID No. 1 bis Seq. ID No. 120 oder Abschnitten davon eingesetzt werden können.The invention also provides a set of at least two oligonucleotides is available that are available as so-called "primer oligonucleotides" for the amplification of DNA sequences of one of the Seq. ID No. 1 to Seq. ID No. 120 or sections thereof can be used.

Im Falle der erfindungsgemäßen Sets von Oligonukleotiden ist es bevorzugt, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist. Es ist weiter bevorzugt, daß alle der Oligonukleotide eines Sets an eine Festphase gebunden sind.In the case of the sets according to the invention of oligonucleotides it is preferred that at least one oligonucleotide is bound to a solid phase. It is further preferred that all of the Oligonucleotides of a set are bound to a solid phase.

Die vorliegende Erfindung betrifft weiterhin einen Satz von mindestens 10 n (Oligonukleotiden und/oder PNA-Oligomeren), die zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter genomischer DNA (Seq. ID No. 1 bis Seq. ID No. 120) dienen. These Sonden ermöglichen die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einteilung, Einstufung und/oder Diagnose von genetischen und epigenetischen Parametern von Hirntumoren, genauer gesagt Astrocytomen. Weiterhin ermöglichen die Sonden die Diagnose der Prädisposition gegenüber Astrocytomen. Das Set von Oligomeren kann auch zur Detektion von Single Nucleotide Polymorphismen (SNPs) in der chemisch vorbehandelten DNA gemäß einer der Seq. ID No. 1 bis Seq. ID No. 120 verwendet werden.The present invention relates to furthermore a set of at least 10 n (oligonucleotides and / or PNA oligomers) used to detect the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No. 1 to Seq. ID No. 120) serve. These probes enable characterization, Classification, differentiation, grading, grading and / or diagnosis of genetic and epigenetic parameters of brain tumors, more precisely said astrocytomas. The probes also enable diagnosis the predisposition across from Astrocytomas. The set of oligomers can also be used to detect Single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA according to a the Seq. ID No. 1 to Seq. ID No. 120 can be used.

Gemäß der vorliegenden Erfindung ist es bevorzugt, daß eine von der Erfindung zur Verfügung gestellte Anordnung aus unterschiedlichen Oligonukleotiden und/oder PNA-Oligomeren (ein sogenanntes "Array") ebenfalls an eine Festphase gebunden vorliegt. Dieses Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen kann dadurch gekennzeichnet sein, daß es auf der Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet ist. Bevorzugterweise besteht die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold. Möglich sind jedoch auch Nitrocellulose sowie Kunststoffe wie zum Beispiel Nylon, die in Form von Kugeln oder auch als Harz-Matrizes vorliegen können.According to the present invention it is preferred that a available from the invention posed arrangement of different oligonucleotides and / or PNA oligomers (a so-called "array") also attached to a solid phase is bound. This array of different oligonucleotide and / or PNA oligomer sequences can be characterized by: the solid phase in the form of a rectangular or hexagonal grid is arranged. The solid phase surface preferably consists of Silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, Silver or gold. Possible but are also nitrocellulose and plastics such as Nylon, which is available in the form of spheres or as resin matrices can.

Ein weiterer Gegenstand der vorliegenden Erfindung ist daher ein Verfahren zur Herstellung eines auf einem Trägermaterial fixierten Arrays zur Analyse in Zusammenhang mit der Genregulation assoziierten Erkrankungen, bei dem mindestens ein Oligomer gemäß der Erfindung an eine feste Phase gekoppelt wird. Verfahren zur Herstellung von solchen Arrays sind zum Beispiel aus der US 5,744,305 mittels Festphasenchemie und photolabilen Schutzgruppen bekannt.The present invention therefore furthermore relates to a method for producing an array fixed on a carrier material for analysis in connection with diseases associated with gene regulation, in which at least one oligomer according to the invention is coupled to a solid phase. Methods for producing such arrays are, for example, from US Pat US 5,744,305 known by solid-phase chemistry and photolabile protecting groups.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft einen DNA-Chip zur Charakterisierung, Klassifizierung, Differenzierung, Grad-Einteilung, Einstufung, Behandlung und/oder Diagnose von genetischen und epigenetischen Parametern von Astrocytomen. Weiterhin ermöglicht der Chip die Diagnose der Prädisposition gegenüber Astrocytomen. Der Chip enthält mindestens eine Nukleinsäure gemäß der vorliegenden Erfindung. DNA-Chips sind zum Beispiel aus der US 5,837,832 bekannt.The present invention further relates to a DNA chip for characterizing, classifying, differentiating, grading, grading, treating and / or diagnosing genetic and epigenetic parameters of astrocytomas. The chip also enables diagnosis of the predisposition to astrocytomas. The chip contains at least one nucleic acid according to the present invention. DNA chips are, for example, from the US 5,837,832 known.

Gegenstand der vorliegenden Erfindung ist zudem ein Kit, das zum Beispiel aus einer Bisulfit enthaltenden Reagenz, einem Satz von Primeroligonukleotiden umfassend mindestens zwei Oligonukleotide, deren Sequenzen jeweils mindestens einen 18 Basenpaaren langen Abschnitt der im Anhang aufgeführten Basensequenzen (Seq. ID No. 1 bis Seq. ID No. 120), Oligonukleotiden und/oder PNA-Oligomeren sowie einer Anleitung zur Durchführung und Auswertung des beschriebenen Verfahrens bestehen kann. Ein Kit im Sinne der Erfindung kann jedoch auch nur Teile der vorgenannten Bestandteile enthalten.Object of the present invention is also a kit that, for example, contains a bisulfite Reagent, comprising at least one set of primer oligonucleotides two oligonucleotides, the sequences of which each have at least one 18th Base pair long section of the base sequences listed in the appendix (Seq. ID No. 1 to Seq. ID No. 120), oligonucleotides and / or PNA oligomers as well as instructions for implementation and evaluation of the described method can exist. A kit Within the meaning of the invention, however, only parts of the abovementioned can Components included.

Die Erfindung stellt weiterhin ein Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von genomischer DNA zur Verfügung. Das Verfahren dient der Grad- Einstufung, Einstufung, Behandlung und/oder der Diagnose von Astrocytomen, insbesondere der Unterscheidung von Grad I und Grad II Tumoren. Das Verfahren ermöglicht die Analyse von Cytosin-Methylierungen und Single Nucleotide Polymorphismen, wobei die folgenden Schritte enthalten sind:The invention further provides a method for determining genetic and / or epigenetic parameters of genomic DNA. The method is used to grade, classify, treat and / or diagnose astrocytomas, in particular to differentiate between grade I and grade II tumors. The method enables the analysis of cytosine methylation and single nucleotide polymor phisms, including the following steps:

In einem ersten Verfahrensschritt muß die genomische DNA-Probe aus Gewebe oder zellulären Quellen isoliert werden. Such Quellen können Zellinien, histologische Objektträger, Körperflüssigkeiten, zum Beispiel cerebrospinale Flüssigkeit oder lymphatischer Flüssigkeit, oder in Paraffin eingebettetes Gewebe; zum Beispiel, Hirn, zentrales Nervensystem oder lymphatisches Gewebe einschließen. Die Extraktion kann durch Mittel erfolgen, die Standard für den Fachmann sind, diese schließen die Verwendung von Detergenzlysaten, die Beschallung und Vortexen mit Glasperlen ein. Sobald die Nukleinsäuren extrahiert wurden, wird die genomische doppelsträngige DNA in er Analyse verwendet.In a first step must the genomic DNA sample can be isolated from tissue or cellular sources. Search sources can Cell lines, histological slides, body fluids, for example cerebrospinale liquid or lymphatic fluid, or tissue embedded in paraffin; for example, brain, central Include nervous system or lymphoid tissue. The extraction can be done by means done, the standard for are skilled in the art to conclude these the use of detergent lysates, sonication and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double-stranded DNA used in he analysis.

In einer bevorzugten Ausführungsform kann die DNA vor der chemischen Behandlung gespalten werden, dies kann durch jedes Standardmittel im Stand der Technik erfolgen, insbesondere mit Restriktionsendonukleasen.In a preferred embodiment the DNA can be cleaved before chemical treatment, this can be done by any standard means in the art, particularly with restriction endonucleases.

Im zweiten Verfahrensschritt wird eine genomische DNA-Probe derart chemisch behandelt, daß an der 5'-Position unmethylierte Cytosinbasen in Uracil, Thymin oder eine andere vom Hybridisierungsverhalten her dem Cytosin unähnliche Base umgewandelt werden. Dies wird im folgenden unter „chemischer Vorbehandlung" verstanden.The second step is chemically treated a genomic DNA sample such that at the 5 'position unmethylated cytosine bases in uracil, thymine or another of Hybridization behavior from the cytosine dissimilar base to be converted. This is referred to below as “chemical Pretreatment "understood.

Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bisulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse angewendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil oder eine andere vom Basenpaarungsverhalten her dem Cytosin unähnliche Base führt.For this purpose, the one described above is preferred Treatment of genomic DNA with bisulfite (hydrogen sulfite, disulfite) and then alkaline hydrolysis applied, which does not lead to a conversion methylated cytosine nucleobases in uracil or another of Base pairing behavior leads to base that is not similar to cytosine.

Aus dieser chemisch vorbehandelten genomischen DNA werden Fragmente unter Verwendung von Sätzen von erfindungsgemäßen Primer-Oligonukleotiden und einer bevorzugterweise hitzestabilen Polymerase amplifiziert. Aus statistischen und praktikablen Erwägungen werden bevorzugterweise mehr als zehn unterschiedliche Fragmente amplifiziert, die 100 – 2000 Basenpaare lang sind. Die Amplifikation von mehreren DNA-Abschnitten kann simultan in ein und demselben Reaktionsgefäß durchgeführt werden. Üblicherweise wird die Amplifikation mittels der Polymerasekettenreaktion (PCR) durchgeführt.From this chemically pretreated genomic DNA are fragments using sets of primer oligonucleotides according to the invention and a preferably heat-stable polymerase is amplified. Statistical and practical considerations are preferred amplified more than ten different fragments, the 100 - 2000 base pairs are long. The amplification of several DNA sections can be carried out simultaneously be carried out in one and the same reaction vessel. Usually the amplification was carried out by means of the polymerase chain reaction (PCR).

In einer bevorzugten Ausführungsform des Verfahrens umfaßt der Satz von Primer-Oligonukleotiden mindestens zwei Oligonukleotide, deren Sequenzen jeweils revers komplementär oder identisch zu einem mindestens 18 Basenpaare langen Abschnitt der im Anhang (Seq. ID No. 1 bis Seq. ID No. 120) aufgelisteten Basensequenzen sind. Die Primer-Oligonukleotide sind vorzugsweise dadurch gekennzeichnet, daß sie kein CpG Dinukleotid enthalten. In einer besonders bevorzugten Ausführungsform des Verfahrens ist die Sequenz der Primer Oligonukleotide so aufgebaut, daß sie nur an die Astrocytom und/oder Hirngewebe spezifische DNA von Interesse selektiv an hybridisiert und diese amplifiziert, wodurch die Amplifikation von Hintergrund- oder nicht relevanter DNA minimiert wird. Im Zusammenhang der vorliegenden Erfindung wird Hintergrund DNA als genomische DNA bedeutend angenommen, die kein relevantes Gewebe-spezifisches Methylierungsmuster aufweist, wobei in diesem Fall das relevante Gewebe Hirngewebe ist, genauer gesagt Astrocyten- oder Astrocytomgewebe. Beispiele von solchen in den Beispielen verwendeten Primern sind in Tabelle 1 enthalten.In a preferred embodiment of the procedure includes the set of primer oligonucleotides at least two oligonucleotides, the sequences of which are reversely complementary or identical to a section of at least 18 base pairs long in the Appendix (Seq. ID No. 1 to Seq. ID No. 120) listed base sequences are. The primer oligonucleotides are preferably characterized in that they are not a CpG dinucleotide contain. In a particularly preferred embodiment of the method the sequence of the primer oligonucleotides so constructed that they only DNA of interest to the astrocytoma and / or brain tissue selectively hybridized to and amplified, thereby amplifying of background or irrelevant DNA is minimized. In connection The present invention uses background DNA as genomic DNA Significantly assumed that has no relevant tissue-specific methylation pattern, in which case the relevant tissue is brain tissue, more precisely said astrocyte or astrocytoma tissue. Examples of such Primers used in the examples are contained in Table 1.

Erfindungsgemäß bevorzugt ist es, daß bei der Amplifikation mindestens ein Primer-Oligonukleotid an eine Festphase gebunden ist. Die unterschiedlichen Oligonukleotid und/oder PNA-Oligomersequenzen können auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sein, wobei die Festphasenoberfläche bevorzugt aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht, wobei auch andere Materialien, wie Nitrocellulose oder Kunststoffe verwendet werden können.According to the invention it is preferred that the Amplification at least one primer oligonucleotide bound to a solid phase is. The different oligonucleotide and / or PNA oligomer sequences can on a flat solid phase in the form of a rectangular or hexagonal Grid may be arranged, the solid phase surface being preferred made of silicon, glass, polystyrene, aluminum, steel, iron, copper, Nickel, silver or gold, but other materials, such as nitrocellulose or plastics can be used.

Die mittels der Amplifikation erhaltenen Fragmente können eine direkt oder indirekt nachweisbare Markierung tragen. Bevorzugt sind Markierungen in Form von Fluoreszenzmarkierungen, Radionukliden oder ablösbaren Molekülfragmenten mit typischer Masse, die in einem Massenspektrometer nachgewiesen werden können, wobei bevorzugt ist, dass die erzeugten Fragmente zur besseren Detektierbarkeit im Massenspektrometer eine einzelne positive oder negative Nettoladung aufweisen. Der Nachweis kann mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchgeführt und visualisiert werden.The ones obtained by amplification Fragments can bear a directly or indirectly detectable marking. Prefers are labels in the form of fluorescent labels, radionuclides or removable molecular fragments with typical mass, detected in a mass spectrometer can be it is preferred that the fragments generated for better detectability a single positive or negative net charge in the mass spectrometer exhibit. The detection can be done using matrix assisted laser desorption / ionization Mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI) carried out and be visualized.

Die im zweiten Verfahrensschritt erhaltenen Amplifikate werden anschließend an einen Satz von Oligonukleotiden und/oder PNA- Sonden der oder an ein Array hybridisiert. Die Hybridisierung erfolgt dabei auf die unten angegebene Art und Weise. Der bei der Hybridisierung verwendete Satz besteht bevorzugterweise aus mindestens 10 Oligonukleotid oder PNA-Oligomersonden. Die Amplifikate dienen dabei als Sonden, die an vorher an einer Festphase gebundene Oligonukleotide hybridisieren. Die nicht hybridisierten Fragmente werden anschließend entfernt. Die besagten Oligonukleotide umfassen mindestens eine Basensequenz mit einer Länge von 13 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 5. bis 9. Nukleotid vom 5'-Ende des 13-mers aus betrachtet. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden. Die besagten PNA-Oligomere umfassen mindestens eine Basensequenz mit einer Länge von 9 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 4. bis 6. Nukleotid vom 5'-Ende des 9-mers aus gesehen. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden.The amplificates obtained in the second process step are then hybridized to a set of oligonucleotides and / or PNA probes or to an array. The hybridization is carried out in the manner specified below. The set used in the hybridization preferably consists of at least 10 oligonucleotide or PNA oligomer probes. The amplificates serve as probes that hybridize to oligonucleotides previously bound to a solid phase. The non-hybridized fragments are then removed. Said oligonucleotides comprise at least one base sequence with a length of 13 nucleotides, which is reverse complementary or identical to a section of the base sequences listed in the appendix, which contains at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to 9th nucleotide viewed from the 5 'end of the 13-mer. There is one oligonucleotide for each CpG dinucleotide. Said PNA oligomers comprise at least one base sequence with a length of 9 nucleotides, which are reverse complementary or identical to a section of the appendix is base sequences containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 4th to 6th nucleotide as seen from the 5 'end of the 9-mer. There is one oligonucleotide for each CpG dinucleotide.

Im fünften Verfahrensschritt entfernt man die nicht hybridisierten Amplifikate.Removed in the fifth step the non-hybridized amplificates.

Im letzten Verfahrensschritt detektiert man die hybridisierten Amplifikate. Dabei ist bevorzugt, daß an den Amplifikaten angebrachte Markierungen an jeder Position der Festphase, an der sich eine Oligonukleotidsequenz befindet, identifizierbar sind.Detected in the last step the hybridized amplificates. It is preferred that the Markings placed at each position of the solid phase, at which an oligonucleotide sequence is located, can be identified are.

Erfindungsgemäß bevorzugt ist es, daß die Markierungen der Amplifikate Fluoreszenzmarkierungen, Radionuklide oder ablösbare Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden können. Der Nachweis der Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer ist bevorzugt, wobei man die Detektion mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchführen und visualisieren kann. Zur besseren Detektierbarkeit im Massenspektrometer können die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen.It is preferred according to the invention that the markings of the amplicons fluorescent labels, radionuclides or removable molecular fragments with typical mass, are detected in a mass spectrometer can be. The detection of the amplificates, fragments of the amplificates or to complementary to the amplificates Probes in the mass spectrometer is preferred, taking the detection using matrix-assisted laser desorption / ionization mass spectrometry (MALDI) or using electrospray mass spectrometry (ESI) and can visualize. For better detectability in the mass spectrometer can the fragments generated a single positive or negative net charge exhibit.

Bevorzugt wird das vorgenannte Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von genomischer DNA verwendet.The aforementioned method is preferred for the determination of genetic and / or epigenetic parameters of genomic DNA used.

Die erfindungsgemäßen Oligomere oder Arrays derselben sowie ein erfindungsgemäßes Kit sollen zur Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung und/oder der Diagnose von Astrocytomen verwendet werden. Weiter bevorzugt für die Differenzierung von Grad I und II Astrocytomen oder der Diagnose der Prädisposition gegenüber Astrocytomen. Gemäß der vorliegenden Erfindung wird das Verfahren bevorzugterweise für die Analyse von wichtigen genetischen und/oder epigenetischen Parametern innerhalb genomischer DNA verwendet, insbesondere für die Verwendung bei der Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung und/oder der Diagnose von Astrocytomen und der Prädisposition gegenüber Astrocytomen.The oligomers or arrays thereof according to the invention and a kit according to the invention for characterization, classification, differentiation, Grade classification, grading and / or diagnosis of astrocytomas be used. Further preferred for the differentiation of degrees I and II astrocytomas or the diagnosis of predisposition to astrocytomas. According to the present Invention, the method is preferably used for the analysis of important genetic and / or epigenetic parameters within genomic DNA used, especially for use in characterization, classification, differentiation, Grade classification, grading and / or diagnosis of astrocytomas and predisposition across from Astrocytomas.

Das erfindungsgemäße Verfahren wird zum Beispiel für die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung und/oder die Diagnose von Astrocytomen verwendet.The method according to the invention is for example for the Characterization, classification, differentiation, grade classification, Classification and / or diagnosis of astrocytomas used.

Die erfindungsgemäßen Nukleinsäuren der Seq. ID No. 1 bis Seq. ID No. 120 können für die Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung und/oder der Diagnose von genetischen und/oder epigenetischen Parametern von genomischer DNA verwendet werden, insbesondere zur Verwendung zur Differenzierung von Grad I und II Astrocytomen.The nucleic acids of the invention Seq. ID No. 1 to Seq. ID No. 120 can be used for characterization, classification, Differentiation, grade classification, grading and / or diagnosis of genetic and / or epigenetic parameters of genomic DNA can be used, especially for use in differentiation of grade I and II astrocytomas.

Die vorliegende Erfindung betrifft weiterhin ein Verfahren zur Herstellung eines Diagnostikums und/oder Therapeutikums zur Charakterisierung, Klassifizierung, Differenzierung, Grad-Einstufung, Einstufung und/oder der Diagnose von Astrocytomen durch Analyse von Methylierungsmustern von genomischer DNA. Das Diagnostikum und/oder das Therapeutikum ist dadurch gekennzeichnet, daß mindestens eine Nukleinsäure, gemäß der vorliegenden Erfindung (Seq. ID No. 1 bis Seq. ID No. 120), gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen, zu dessen Herstellung verwendet wird.The present invention relates to furthermore a method for producing a diagnostic agent and / or Therapeutic agent for characterization, classification, differentiation, Grade classification, grading and / or diagnosis of astrocytomas by analyzing methylation patterns of genomic DNA. The Diagnostic agent and / or therapeutic agent is characterized in that that at least a nucleic acid, according to the present Invention (Seq. ID No. 1 to Seq. ID No. 120), optionally together with suitable additives and auxiliaries used for its production becomes.

Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Diagnostikum und/oder Therapeutikum für Astrocytome durch Analyse von Methylierungsmustern von genomischer DNA, insbesondere zur Verwendung zur Differenzierung von Grad I und II Astrocytomen oder der Diagnose der Prädisposition gegenüber Hirntumoren, wobei das Diagnostikum und/oder Therapeutikum dadurch gekennzeichnet ist, das es mindestens eine Nukleinsäure gemäß der Erfindung (Seq. ID No. 1 bis Seq. ID No. 120), gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen enthält.Another subject of the present The invention relates to a diagnostic and / or therapeutic agent for astrocytomas by analyzing methylation patterns of genomic DNA, in particular for use in differentiating Grade I and II astrocytomas or the diagnosis of predisposition towards brain tumors, the diagnostic and / or therapeutic characterized is that it is at least one nucleic acid according to the invention (Seq. ID No. 1 to Seq. ID No. 120), if necessary together with suitable additional and contains auxiliaries.

Die vorliegende Erfindung betrifft weiterhin die Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, bei dem die mittels der Erfindung erhaltenen bedeutenden genetischen und/oder epigenetischen Parameter innerhalb genomischer DNA, wobei die Parameter mittels der vorliegenden Erfindung erhalten wurden mit einem anderen Satz genetischen und/oder epigenetischen Parameter verglichen werden können und die so erhaltenen Unterschiede als Basis für eine Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen dienen.The present invention relates to continue to diagnose and / or predict adverse events for patients or individuals in which the significant obtained by the invention genetic and / or epigenetic parameters within genomic DNA, the parameters obtained by means of the present invention were using a different set of genetic and / or epigenetic Parameters can be compared and the differences thus obtained as the basis for a diagnosis and / or prognosis adverse events for Serve patients or individuals.

Unter dem Begriff "Hybridisierung" im Sinne der vorliegenden Erfindung ist eine Bindung unter Ausbildung einer Duplex-Struktur eines Oligonukleotids an eine vollständig komplementäre Sequenz im Sinne der Watson-Crick Basenpaarungen in der Proben DNA zu verstehen.Under the term "hybridization" in the sense of the present invention is a bond under training a duplex structure of an oligonucleotide to a completely complementary sequence to be understood in the sense of the Watson-Crick base pairings in the sample DNA.

Mit dem Begriff "funktionelle Varianten" sind alle DNA-Sequenzen bezeichnet, die komplementär zu einer DNA-Sequenz sind, die unter stringenten Bedingungen mit der Referenzsequenz hybridisieren.With the term "functional variants" are all DNA sequences that are complementary to one DNA sequence are those under stringent conditions with the reference sequence hybridize.

"Genetische Parameter" im Sinne dieser Erfindung sind Mutationen und Polymorphismen von Genen, die mit der Genregulation assoziiert sind und zu deren Regulation weiterhin erforderlicher Sequenzen. Insbesondere sind als Mutationen Insertionen, Deletionen, Punktmutationen, Inversionen und Polymorphismen und besonders bevorzugt SNPs (Single Nucleotide Polymorphisms) zu bezeichnen."Genetic parameters" in the sense of this Invention are mutations and polymorphisms of genes related to are associated with gene regulation and continue to regulate them required sequences. In particular, inserts as mutations are Deletions, point mutations, inversions and polymorphisms and especially preferably to refer to SNPs (Single Nucleotide Polymorphisms).

"Epigenetische Parameter" im Sinne dieser Erfindung sind insbesondere Cytosin-Methylierungen und weitere chemische Modifikationen von DNA-Basen von Genen, die mit der Genregulation assoziiert sind und zu deren Regulation weiterhin erforderliche Sequenzen. Weitere epigenetische Parameter sind beispielsweise die Acetylierung von Histonen, die jedoch mit dem beschriebenen Verfahren nicht direkt analysiert werden kann, sondern wiederum mit der DNA-Methylierung korreliert.“Epigenetic parameters” in the sense of this invention are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes which are associated with gene regulation and sequences which are also required for their regulation. Other epigenetic parameters are, for example the acetylation of histones, which, however, cannot be analyzed directly with the method described, but in turn correlates with DNA methylation.

Im Kontext der vorliegenden Erfindung wird der Begriff „Behandlung", wie auf Astrocytome angewendet, als die Planung von geeigneten Verfahren der Behandlung der Patienten (z.B. Chirurgie, Bestrahlungstherapie, Chemotherapie) einschließend angenommen.In the context of the present invention the term "treatment", as applied to astrocytomas when planning appropriate procedures the treatment of patients (e.g. surgery, radiation therapy, Including chemotherapy) accepted.

Die Erfindung soll nun im folgenden anhand der Sequenzen und Beispiele unter Bezug auf die beigefügte Figuren weiter verdeutlicht werden, ohne hierauf eingeschränkt zu werden.The invention is now intended to be as follows based on the sequences and examples with reference to the accompanying figures are further clarified without being restricted to this.

11

1 zeigte die Hybridisierung von Fluoreszenz-markierten Amplifikaten an ein Oberflächengebundenes Oligonukleotid. Probe I stammt von Grad I Astrocytom (Hirntumor)-Gewebe und Probe II stammt von Grad II Astrocytom (Hirntumor)-Gewebe. Die Fluoreszenz an einem Punkt zeigt die Hybridisierung des Amplifikats an. Die Hybridisierung an ein CG Oligonukleotid zeigt an, daß die Methylierung an der Cytosin-Position analysiert wird, die Hybridisierung an ein TG Oligonukleotid zeigt an, daß keine Methylierung an der Cytosin-Position analysiert wird. Es kann gesehen werden, daß Probe I für die CG Positionen (wie in Beispiel (1-4) gezeigt) der Amplifikate der Gene TGF-alpha (vergl. 1A), MLH1 (vergl. 1B), NF1 (vergl. 1C) und CSKN2B (1D) nicht methyliert war, wohingegen im Vergleich Probe II ein höheres Ausmaß an Methylierung an denselben Positionen aufwies. 1 showed the hybridization of fluorescence-labeled amplificates to a surface-bound oligonucleotide. Sample I is from grade I astrocytoma (brain tumor) tissue and sample II is from grade II astrocytoma (brain tumor) tissue. The fluorescence at one point indicates the hybridization of the amplificate. Hybridization to a CG oligonucleotide indicates that methylation at the cytosine position is being analyzed, hybridization to a TG oligonucleotide indicates that no methylation at the cytosine position is being analyzed. It can be seen that Sample I for the CG positions (as shown in Example (1-4)) of the amplificates of the TGF-alpha genes (cf. 1A ), MLH1 (cf. 1B ), NF1 (cf. 1C ) and CSKN2B ( 1D ) was not methylated, whereas sample II showed a higher degree of methylation at the same positions.

22

Differenzierung von gesunden Kontrollproben (markiert I) und Astrocytom Grad I (markiert II) (2A), und gesunden Kontrollproben und Astrocytom Grad II (markiert III) (2B). Hohe Wahrscheinlichkeit von Methylierung entspricht rot, Unsicherheit schwarz und geringe Wahrscheinlichkeit grün. Die Marker auf der linken Seite des Plots sind Gen Identifizierer, wobei die ersten 3 Ziffern sich auf die Tabelle 1 beziehen. Die Hybridisierung wurde mit Cy5 markierten Amplifikaten durchgeführt, die durch Multiplex PCR Reaktionen erzeugt wurden, wie in Tabelle 1 gezeigt. Die Marker auf der rechten Seite geben die Signifikanz (p-Wert, T-Test) des Unterschieds zwischen dem Mittel der beiden Gruppen an. Jede Reihe entspricht einem einzelnen CpG und jede Spalte den Methylierungsniveaus einer Probe. Die CpGs sind nach ihrem Beitrag zu der Unterscheidung für die differenzielle Diagnose der zwei Läsionen geordnet, mit zunehmendem Beitrag von oben nach unten.Differentiation of healthy control samples (marked I) and astrocytoma grade I (marked II) ( 2A ), and healthy control samples and grade II astrocytoma (marked III) ( 2 B ). High probability of methylation corresponds to red, uncertainty to black and low probability to green. The markers on the left side of the plot are gene identifiers, the first 3 digits refer to Table 1. Hybridization was performed with Cy5 labeled amplificates generated by multiplex PCR reactions as shown in Table 1. The markers on the right indicate the significance (p-value, t-test) of the difference between the mean of the two groups. Each row corresponds to a single CpG and each column corresponds to the methylation levels of a sample. The CpGs are ordered according to their contribution to the differentiation for the differential diagnosis of the two lesions, with increasing contribution from top to bottom.

3 Differenzierung von Astrocytom Grad I (1) und Astrocytom Grad II (2). Hohe Wahrscheinlichkeit von Methylierung entspricht rot, Unsicherheit schwarz und geringe Wahrscheinlichkeit grün. Die Marker auf der linken Seite des Plots sind Gen und CpG Identifizierer. Die Hybridisierung wurde mit Cy5 markierten Amplifikaten durchgeführt, die durch Multiplex PCR Reaktionen erzeugt wurden, wie in Tabelle 1 gezeigt. Die Marker auf der rechten Seite geben die Signifikanz (p-Wert, T-Test) des Unterschieds zwischen dem Mittel der beiden Gruppen an. Jede Reihe entspricht einem einzelnen CpG und jede Spalte den Methylierungsniveaus einer Probe. Die CpGs sind nach ihrem Beitrag zu der Unterscheidung für die differenzielle Diagnose der zwei Läsionen geordnet, mit zunehmendem Beitrag von oben nach unten. 3 Differentiation of astrocytoma grade I (1) and astrocytoma grade II (2). High probability of methylation corresponds to red, uncertainty to black and low probability to green. The markers on the left side of the plot are gene and CpG identifiers. Hybridization was performed with Cy5 labeled amplificates generated by multiplex PCR reactions as shown in Table 1. The markers on the right indicate the significance (p-value, t-test) of the difference between the mean of the two groups. Each row corresponds to a single CpG and each column corresponds to the methylation levels of a sample. The CpGs are ordered according to their contribution to the differentiation for the differential diagnosis of the two lesions, with increasing contribution from top to bottom.

44

Trennung von Astrocytom Grad I (I) und Astrocytom Grad II (II). Hohe Wahrscheinlichkeit von Methylierung entspricht rot, Unsicherheit schwarz und geringe Wahrscheinlichkeit grün. Die Marker auf der linken Seite des Plots sind Gen und CpG Identifizierer. Die Hybridisierung wurde mit Cy5 markierten Amplifikaten der Gene MLHI, TGF-alpha und NF1 durchgeführt, die alle durch Einzelgen-PCR Reaktionen erzeugt wurden. Jede Reihe entspricht einem einzelnen CpG und jede Spalte den Methylierungsniveaus einer Probe. Die CpGs sind nach ihrem Beitrag zu der Unterscheidung für die differenzielle Diagnose der zwei Läsionen geordnet, mit zunehmendem Beitrag von oben nach unten.Separation of astrocytoma grade I (I) and Grade II (II) astrocytoma. High probability of methylation corresponds to red, uncertainty black and low probability green. The Markers on the left side of the plot are gene and CpG identifiers. Hybridization was done with Cy5 labeled amplificates of the genes MLHI, TGF-alpha and NF1 performed which were all generated by single gene PCR reactions. Every row corresponds to a single CpG and each column corresponds to the methylation levels a sample. The CpGs are based on their contribution to the distinction for the differential diagnosis of the two lesions ordered, with increasing Post top down.

Sequenz ID Nos. 1 bis 120Sequence ID Nos. 1 to 120

Die Sequenz ID Nos. 1 bis 120 zeigen Sequenzen von Genen, die mit der Genregulation assoziiert sind, gemäß der Erfindung. Sequenzen, die ungerade Sequenznummern haben (z.B., Seq. ID No. 1, 3, 5,...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit der Genregulation assoziiert sind. Sequenzen, die gerade Sequenznummern aufweisen (z.B., Seq. ID No. 2, 4, 6,...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit der Genregulation assoziiert sind, die komplementär zu den voranstehenden Sequenzen sind (z.B., die komplementäre Sequenz zu Seq. ID No. 1 ist Seq. ID No. 2, die komplementäre Sequenz zu Seq. ID No. 3 ist Seq. ID No. 4, usw.)The sequence ID Nos. Showing 1 to 120 Sequences of genes associated with gene regulation according to the invention. Sequences that have odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, ...) show sequences of the chemically pretreated in each case genomic DNAs from different genes involved in gene regulation are associated. Sequences that have even sequence numbers (e.g., Seq. ID No. 2, 4, 6, ...) show sequences of the chemically pretreated genomic DNAs from different genes, that are associated with gene regulation, that are complementary to that preceding sequences are (e.g., the complementary sequence to Seq. ID No. 1 is Seq. ID No. 2, the complementary sequence to Seq. ID No. 3 is Seq. ID No. 4, etc.)

Seq. ID No. 121 bis Seq. ID No. 136 Seq. ID No. 121 to Seq. ID No. 136

Seq. ID No. 121 bis Seq. ID No. 136 zeigen spezifische Oligonukleotid-Sequenzen, wie in den folgenden Beispielen verwendet.Seq. ID No. 121 to Seq. ID No. 136 show specific oligonucleotide sequences as in the following Examples used.

Beispiel 1: Methylierungsanalyse des Gens TGF-alphaExample 1: Methylation analysis of the TGF-alpha gene

Das folgende Beispiel betrifft ein Fragment des Gens TGF-alpha, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of the TGF-alpha gene, in which a specific CG position on its Methylation status is analyzed.

Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The first step is a genomic Sequence using bisulfite (hydrogen sulfite, disulfite) treated in such a way that everyone not be changed at the 5-position of the base methylated cytosine so that a different base arises with regard to the base pairing behavior, while the cytosines methylated in the 5-position remain unchanged.

Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Die chemisch umgewandelte DNA dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wäßrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens TGF-alpha analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden GGTTTGTTTGGGAGGTAAG (Seq. ID No. 121) und CCCCCTAAAAACACAAAA (Seq. ID No. 122) ein definiertes Fragment der Länge 533 bp amplifiziert. Die Einzelgen-PCR Reaktion wurde auf einem Thermocycler (Epperdorf GmbH) unter der Verwendung von Bisulfit DNA 10 ng, Primer jeweils 6 pmol, dNTP jeweils 200 μM, 1,5 mM MgC12 und 1 U HotstartTaq (Qiagen AG) durchgeführt. Die anderen Bedingungen waren wie durch den Hersteller der Taq Polymerase empfohlen. In der Multiplex PCR wurden bis zu 16 Primerpaare in der PCR Reaktion verwendet. Die Multiplex PCR wurde gemäß der Einzelgen-PCR mit den folgenden Modifikationen durchgeführt: Primer jeweils 0,35 pmol, dNTP jeweils 800 μM und 4,5 mM MgC12. Das Zyklusprogramm für die Einzelgen-PCR und die Multiplex-PCR war wie folgt: Schritt 1, 14 min 96 °C; Schritt 2, 60 sec 96°C; Schritt 3, 45 sec 55 °C; Schritt 4 ,75 sec 72 °C; Schritt 5, 10 min 72 °C; die Schritte 2 bis 4 wurden 39fach wiederholt.If bisulfite is used for the reaction, so there is an addition to the unmethylated cytosine bases. Also have to a denaturing reagent or solvent and a radical scavenger must be present. A subsequent one leads to alkaline hydrolysis then to convert unmethylated cytosine nucleobases to Uracil. The chemically converted DNA then serves to be methylated Detect cytosines. In the second process step, the mixture is diluted the treated DNA sample with water or an aqueous solution. Subsequently, one is preferred Desulfonation of the DNA carried out at alkaline pH. In the third Step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. In the present case, cytosines of the TGF-alpha gene analyzed. To do this, use the specific primer oligonucleotides GGTTTGTTTGGGAGGTAAG (Seq. ID No. 121) and CCCCCTAAAAACACAAAA (Seq. ID No. 122) amplified a defined fragment with a length of 533 bp. Single gene PCR The reaction was carried out on a thermal cycler (Epperdorf GmbH) under the Use of bisulfite DNA 10 ng, primer each 6 pmol, dNTP each 200 μM, 1.5 mM MgC12 and 1 U HotstartTaq (Qiagen AG). The other conditions were as by the manufacturer of the Taq polymerase recommended. In the multiplex PCR up to 16 primer pairs were in PCR reaction. The multiplex PCR was carried out according to the single gene PCR carried out with the following modifications: primer in each case 0.35 pmol, dNTP each 800 μM and 4.5 mM MgC12. The cycle program for single gene PCR and Multiplex PCR was as follows: Step 1, 14 min 96 ° C; step 2.60 sec 96 ° C; Step 3, 45 sec 55 ° C; Step 4, 75 sec 72 ° C; Step 5, 10 min 72 ° C; steps 2 to 4 were repeated 39 times.

Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise AAGTTAGGCGTTTTTTGT (Seq. ID No. 123), wobei sich das nachzuweisende Cytosin an Position 382 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.This amplificate serves as a sample, which is bound to an oligonucleotide previously bound to a solid phase Formation of a duplex structure hybridized, for example AAGTTAGGCGTTTTTTGT (Seq. ID No. 123), with the cytosine to be detected at position 382 of the amplificate is located. Evidence of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides, the for the amplification was used. Only if treated in the bisulfite DNA has a methylated cytosine at this point it leads to a hybridization reaction of the amplified DNA with the Oligonucleotide. Thus the methylation status of each to be examined via the hybridization product can be derived.

Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz AAGTTAGGTGTTTTTTGT (Seq. ID No. 124). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist.To the methylation status of the position will check a sample of the amplificate continues to another oligonucleotide hybridized, which was previously bound to a solid phase. This Oligonucleotide is identical to the oligonucleotide used previously was used to analyze the methylation status of the sample the exception of the position in question. At the position to be analyzed comprises the oligonucleotide is a thymine base, in contrast to a cytosine base i.e. the sequence AAGTTAGGTGTTTTTTGT (Seq. ID No. 124). Therefore takes place the hybridization reaction only takes place if an unmethylated Cytosine is present at the positions to be analyzed.

Beispiel 2: Methylierungsanalyse des Gens NF1Example 2: Methylation analysis of the NF1 gene

Das folgende Beispiel betrifft ein Fragment des Gens NF1, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of the gene NF1, which has a specific CG position on its methylation status is analyzed.

Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The first step is a genomic Sequence using bisulfite (hydrogen sulfite, disulfite) treated in such a way that everyone not be changed at the 5-position of the base methylated cytosine so that a different base arises with regard to the base pairing behavior, while the cytosines methylated in the 5-position remain unchanged.

Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Die chemisch umgewandelte DNA dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrens schritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wäßrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens NF-1 analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden TTGGGAGAAAGGTTAGTTTT (Seq. ID No. 129) und ATACAAACTCCCAATATTCC (Seq. ID No. 130) ein definiertes Fragment der Länge 600 bp amplifiziert. Die Einzelgen-PCR Reaktion wurde auf einem Thermocycler (Epperdorf GmbH) unter der Verwendung von Bisulfit DNA 10 ng, Primer jeweils 6 pmol, dNTP jeweils 200 μM, 1,5 mM MgC12 und 1 U HotstartTaq (Qiagen AG) durchgeführt. Die anderen Bedingungen waren wie durch den Hersteller der Taq Polymerase empfohlen. In der Multiplex PCR wurden bis zu 16 Primerpaare in der PCR Reaktion verwendet. Die Multiplex PCR wurde gemäß der Einzelgen-PCR mit den folgenden Modifikationen durchgeführt: Primer jeweils 0,35 pmol, dNTP jeweils 800 μM und 4,5 mM MgCl2. Das Zyklusprogramm für die Einzelgen-PCR und die Multiplex-PCR war wie folgt: Schritt 1, 14 min 96 °C; Schritt 2, 60 sec 96°C; Schritt 3, 45 sec 55 °C; Schritt 4 ,75 sec 72 °C; Schritt 5, 10 min 72 °C; die Schritte 2 bis 4 wurden 39fach wiederholt.If bisulfite is used for the reaction, an addition takes place on the unmethylated cytosine bases. In addition, a denaturing reagent or solvent and a radical scavenger must be present. Subsequent alkaline hydrolysis then leads to the conversion of unmethylated cytosine nucleobases into uracil. The chemically converted DNA then serves to detect methylated cytosines. In the second process step, the treated DNA sample is diluted with water or an aqueous solution. Desulfonation of the DNA is then preferably carried out at an alkaline pH. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. In the present case, cytosines of the NF-1 gene are analyzed. For this purpose, a defined fragment of length 600 bp is amplified with the specific primer oligonucleotides TTGGGAGAAAGGTTAGTTTT (Seq. ID No. 129) and ATACAAACTCCCAATATTCC (Seq. ID No. 130). The Single gene PCR reaction was carried out on a thermal cycler (Epperdorf GmbH) using bisulfite DNA 10 ng, primer each 6 pmol, dNTP each 200 μM, 1.5 mM MgC12 and 1 U HotstartTaq (Qiagen AG). The other conditions were as recommended by the manufacturer of the Taq polymerase. In the multiplex PCR up to 16 primer pairs were used in the PCR reaction. The multiplex PCR was carried out in accordance with the single gene PCR with the following modifications: primer in each case 0.35 pmol, dNTP in each case 800 μM and 4.5 mM MgCl2. The cycle program for single gene PCR and multiplex PCR was as follows: Step 1, 14 min 96 ° C; Step 2, 60 sec 96 ° C; Step 3, 45 sec 55 ° C; Step 4, 75 sec 72 ° C; Step 5, 10 min 72 ° C; steps 2 to 4 were repeated 39 times.

Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise AATTAAAACGCCCTAAAA (Seq. ID No. 131), wobei sich das nachzuweisende Cytosin an Position 24 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.This amplificate serves as a sample, which is bound to an oligonucleotide previously bound to a solid phase Formation of a duplex structure hybridized, for example AATTAAAACGCCCTAAAA (Seq. ID No. 131), with the cytosine to be detected at position 24 of the amplificate is located. Evidence of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides, the for the amplification was used. Only if treated in the bisulfite DNA has a methylated cytosine at this point it leads to a hybridization reaction of the amplified DNA with the Oligonucleotide. Thus the methylation status of each to be examined via the hybridization product can be derived.

Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz AATTAAAACACCCTAAAA (Seq. ID No. 132). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist.To the methylation status of the position will check a sample of the amplificate continues to another oligonucleotide hybridized, which was previously bound to a solid phase. This Oligonucleotide is identical to the oligonucleotide used previously was used to analyze the methylation status of the sample the exception of the position in question. At the position to be analyzed comprises the oligonucleotide is a thymine base, in contrast to a cytosine base i.e. the sequence AATTAAAACACCCTAAAA (Seq. ID No. 132). Therefore takes place the hybridization reaction only takes place if an unmethylated Cytosine is present at the positions to be analyzed.

Beispiel 3: Methylierungsanalyse des Gens MLH1.Example 3: Methylation analysis of the MLH1 gene.

Das folgende Beispiel betrifft ein Fragment des Gens MLH1, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of the MLH1 gene, in which a specific CG position on its Methylation status is analyzed.

Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The first step is a genomic Sequence using bisulfite (hydrogen sulfite, disulfite) treated in such a way that everyone not be changed at the 5-position of the base methylated cytosine so that a different base arises with regard to the base pairing behavior, while the cytosines methylated in the 5-position remain unchanged.

Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Die chemisch umgewandelte DNA dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wäßrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens MLH1 analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden TTTAAGGTAAGAGAATAGGT (Seq. ID No. 133) und TTAACCCTACTCTTATAACC (Seq. ID No. 134) ein definiertes Fragment der Länge 568 bp amplifiziert. Die Einzelgen-PCR Reaktion wurde auf einem Thermocycler (Epperdorf GmbH) unter der Verwendung von Bisulfit DNA 10 ng, Primer jeweils 6 pmol, dNTP jeweils 200 μM, 1,5 mM MgC12 und 1 U HotstartTaq (Qiagen AG) durchgeführt. Die anderen Bedingungen waren wie durch den Hersteller der Taq Polymerase empfohlen. In der Multiplex PCR wurden bis zu 16 Primerpaare in der PCR Reaktion verwendet. Die Multiplex PCR wurde gemäß der Einzelgen-PCR mit den folgenden Modifikationen durchgeführt: Primer jeweils 0,35 pmol, dNTP jeweils 800 μM und 4,5 mM MgCl2. Das Zyklusprogramm für die Einzelgen-PCR und die Multiplex-PCR war wie folgt: Schritt 1, 14 min 96 °C; Schritt 2, 60 sec 96°C; Schritt 3, 45 sec 55 °C; Schritt 4 ,75 sec 72 °C; Schritt 5, 10 min 72 °C; die Schritte 2 bis 4 wurden 39fach wiederholt.If bisulfite is used for the reaction, so there is an addition to the unmethylated cytosine bases. Also have to a denaturing reagent or solvent and a radical scavenger must be present. A subsequent one leads to alkaline hydrolysis then to convert unmethylated cytosine nucleobases to Uracil. The chemically converted DNA then serves to be methylated Detect cytosines. In the second process step, the mixture is diluted the treated DNA sample with water or an aqueous solution. Subsequently, one is preferred Desulfonation of the DNA carried out at alkaline pH. In the third Step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. In the present case, cytosines of the MLH1 gene analyzed. To do this, use the specific primer oligonucleotides TTTAAGGTAAGAGAATAGGT (Seq. ID No. 133) and TTAACCCTACTCTTATAACC (Seq. ID No. 134) amplified a defined fragment of length 568 bp. The Single gene PCR reaction was carried out on a thermal cycler (Epperdorf GmbH) using bisulfite DNA 10 ng, primer each 6 pmol, dNTP each 200 μM, 1.5 mM MgC12 and 1 U HotstartTaq (Qiagen AG). The other conditions were as by the manufacturer of the Taq polymerase recommended. In the multiplex PCR up to 16 primer pairs were in PCR reaction. The multiplex PCR was carried out according to the single gene PCR carried out with the following modifications: primer in each case 0.35 pmol, dNTP each 800 μM and 4.5 mM MgCl2. The cycle program for single gene PCR and Multiplex PCR was as follows: Step 1, 14 min 96 ° C; step 2.60 sec 96 ° C; Step 3, 45 sec 55 ° C; Step 4, 75 sec 72 ° C; Step 5, 10 min 72 ° C; steps 2 to 4 were repeated 39 times.

Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise TTGTAGGACGTTTATATG (Seq. ID No. 135), wobei sich das nachzuweisende Cytosin an Position 125 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.This amplificate serves as a sample, which is bound to an oligonucleotide previously bound to a solid phase Formation of a duplex structure hybridized, for example TTGTAGGACGTTTATATG (Seq. ID No. 135), with the cytosine to be detected at position 125 of the amplificate is located. Evidence of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides, the for the amplification was used. Only if treated in the bisulfite DNA has a methylated cytosine at this point it leads to a hybridization reaction of the amplified DNA with the Oligonucleotide. Thus the methylation status of each to be examined via the hybridization product can be derived.

Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz TTGTAGGATGTTTATATG (Seq. ID No. 136). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist.To check the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide that was previously bound to a solid phase. This oligonucleotide otide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, except for the position in question. At the position to be analyzed, the oligonucleotide comprises a thymine base, in contrast to a cytosine base, ie the sequence TTGTAGGATGTTTATATG (Seq. ID No. 136). The hybridization reaction therefore only takes place if an unmethylated cytosine is present at the positions to be analyzed.

Beispiel 4: Methylierungsanalyse des Gens CSNK2B.Example 4: Methylation analysis of the CSNK2B gene.

Das folgende Beispiel betrifft ein Fragment des Gens CSNK2B, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.The following example concerns one Fragment of the gene CSNK2B, in which a specific CG position on its Methylation status is analyzed.

Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The first step is a genomic Sequence using bisulfite (hydrogen sulfite, disulfite) treated in such a way that everyone not be changed at the 5-position of the base methylated cytosine so that a different base arises with regard to the base pairing behavior, while the cytosines methylated in the 5-position remain unchanged.

Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Die chemisch umgewandelte DNA dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrens schritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wäßrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens CSNK2B analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden GGGGAAATGGAGAAGTGTAA (Seq. ID No. 125) und CTACCAATCCCAAAATAACC (Seq. ID No. 126) ein definiertes Fragment der Länge 524 bp amplifiziert. Die Einzelgen-PCR Reaktion wurde auf einem Thermocycler (Epperdorf GmbH) unter der Verwendung von Bisulfit DNA 10 ng, Primer jeweils 6 pmol, dNTP jeweils 200 μM, 1,5 mM MgC12 und 1 U HotstartTaq (Qiagen AG) durchgeführt. Die anderen Bedingungen waren wie durch den Hersteller der Taq Polymerase empfohlen. In der Multiplex PCR wurden bis zu 16 Primerpaare in der PCR Reaktion verwendet. Die Multiplex PCR wurde gemäß der Einzelgen-PCR mit den folgenden Modifikationen durchgeführt: Primer jeweils 0,35 pmol, dNTP jeweils 800 μM und 4,5 mM MgC12. Das Zyklusprogramm für die Einzelgen-PCR und die Multiplex-PCR war wie folgt: Schritt 1, 14 min 96 °C; Schritt 2, 60 sec 96°C; Schritt 3, 45 sec 55 °C; Schritt 4 ,75 sec 72 °C; Schritt 5, 10 min 72 °C; die Schritte 2 bis 4 wurden 39fach wiederholt.If bisulfite is used for the reaction, so there is an addition to the unmethylated cytosine bases. Also have to a denaturing reagent or solvent and a radical scavenger must be present. A subsequent one leads to alkaline hydrolysis then to convert unmethylated cytosine nucleobases to Uracil. The chemically converted DNA then serves to be methylated Detect cytosines. In the second process step one dilutes the treated DNA sample with water or an aqueous solution. Subsequently, one is preferred Desulfonation of the DNA carried out at alkaline pH. In the third Step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase. In the present case, cytosines of the CSNK2B gene analyzed. To do this, use the specific primer oligonucleotides GGGGAAATGGAGAAGTGTAA (Seq. ID No. 125) and CTACCAATCCCAAAATAACC (Seq. ID No. 126) amplified a defined fragment with a length of 524 bp. The Single gene PCR reaction was carried out on a thermal cycler (Epperdorf GmbH) using bisulfite DNA 10 ng, primer each 6 pmol, dNTP each 200 μM, 1.5 mM MgC12 and 1 U HotstartTaq (Qiagen AG). The other conditions were as by the manufacturer of the Taq polymerase recommended. In the multiplex PCR up to 16 primer pairs were in PCR reaction. The multiplex PCR was carried out according to the single gene PCR carried out with the following modifications: primer 0.35 pmol each, dNTP 800 μM each and 4.5 mM MgC12. The cycle program for single gene PCR and Multiplex PCR was as follows: Step 1, 14 min 96 ° C; step 2.60 sec 96 ° C; Step 3, 45 sec 55 ° C; Step 4, 75 sec 72 ° C; step 5, 10 min 72 ° C; steps 2 to 4 were repeated 39 times.

Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise TAGGTTAGCGTATTGGGA (Seq. ID No. 127), wobei sich das nachzuweisende Cytosin an Position 50 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.This amplificate serves as a sample, which is bound to an oligonucleotide previously bound to a solid phase Formation of a duplex structure hybridized, for example TAGGTTAGCGTATTGGGA (Seq. ID No. 127), with the cytosine to be detected at position 50 of the amplificate is located. Evidence of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides, the for the amplification was used. Only if treated in the bisulfite DNA has a methylated cytosine at this point it leads to a hybridization reaction of the amplified DNA with the Oligonucleotide. Thus the methylation status of each to be examined via the hybridization product can be derived.

Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz TAGGTTAGTGTATTGGGA (Seq. ID No. 128). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist.To the methylation status of the position will check a sample of the amplificate continues to another oligonucleotide hybridized, which was previously bound to a solid phase. This Oligonucleotide is identical to the oligonucleotide used previously was used to analyze the methylation status of the sample the exception of the position in question. At the position to be analyzed comprises the oligonucleotide is a thymine base, in contrast to a cytosine base i.e. the sequence TAGGTTAGTGTATTGGGA (Seq. ID No. 128). Therefore takes place the hybridization reaction only takes place if an unmethylated Cytosine is present at the positions to be analyzed.

Beispiel 5: Differenzierung von gesunden Proben und Astrocytom Grad I und Grad II, isoliert von CerebrumExample 5: Differentiation from healthy specimens and grade I and grade II astrocytoma isolated from Cerebrum

Um einen Bezug der Methylierungsmuster zu einem bestimmten Tumortyp herzustellen, bedarf es zunächst der vergleichenden Untersuchung der DNA-Methylierungsmuster von zwei Gruppen von Patienten mit alternativen Formen eines Tumors, in diesem Fall eine Gruppe von Astrocytom Grad I und einer anderen Gruppe von Astrocytom Grad II, mit denjenigen von gesundem Gewebe (2A und B). Diese Untersuchungen wurden analog den Beispielen 1-4 durchgeführt. Die so erhaltenen Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. Dies kann durch Bestimmung einzelner CpG Methylierungsraten erfolgen, wie dies z. B. durch Sequenzieren relativ ungenau oder aber durch eine Methylierungssensitive „Primer-Extension-Reaktion" sehr genau möglich ist. Auch gleichzeitige Analyse des gesamten Methylierungsstatus ist möglich, und die Muster können z.B. mittels Clustering-Analysen, die z.B. durch einen Rechner durchgeführt werden können, verglichen werden.In order to relate the methylation pattern to a certain tumor type, it is first necessary to compare the DNA methylation pattern of two groups of patients with alternative forms of a tumor, in this case a group of astrocytoma grade I and another group of astrocytoma grade II, with those of healthy tissue ( 2A and B ). These investigations were carried out analogously to Examples 1-4. The results obtained in this way are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be done by determining individual CpG methylation rates. B. is relatively inaccurate by sequencing or very precise by a methylation-sensitive "primer extension reaction". Simultaneous analysis of the entire methylation status is also possible, and the patterns can be done, for example, by means of clustering analyzes, which can be carried out, for example, by a computer , compare will be.

Alle klinischen Proben wurden zur Zeit der Chirurgie entnommen, d.h. in einer Routine klinischen Situation (Santourlidis, S., Prostate 39:166-174, 1999, Florl, A.R., Br. J. Cancer 80:1312-1321, 1999). Ein Panel von genomischen Fragmenten von 64 verschiedenen Genen (aufgelistet in Tabelle 1) wurden Bisulphit-behandelt und durch 6 Sets von Multiplex PCRs (mPCR) gemäß Beispiel 1 amplifiziert. Die mPCR Reaktionen (I, J, K, L, M, N) der genomischen, Bisulphit-behandelten DNA wurde unter Verwendung der Kombination von Primerpaaren wie in Tabelle 1 gezeigt, durchgeführt. Jedoch, wie dem Fachmann ersichtlich sein wird, ist es auch möglich, andere Primer zu verwenden, die die genomische, Bisulphitbehandelte DNA auf eine geeignete Weise amplifizieren. Jedoch sind die Primerpaare, wie in Tabelle 1 aufgelistet, besonders bevorzugt. Um Astrocytome Grad I von gesunden Kontrollproben zu differenzieren, wurden optimale Ergebnisse durch Aufnahme von mindestens 6 CpG Dinukleotiden erhalten, wobei die am meisten informativen CpG Positionen für diese Unterscheidung innerhalb der Gene OAT, GP1B, cMyc, UNG, TIMP3 und cABL (vergl. 2A, Tab. 1) lokalisiert sind. Um Astrocytome Grad I von gesunden Kontrollproben zu differenzieren, wurden optimale Ergebnisse durch Aufnahme von mindestens 6 CpG Dinukleotiden erhalten, wobei die am meisten informativen CpG Positionen für diese Unterscheidung innerhalb der Gene cMyc, EGR4, ApoA1, AR und den Hitzeschockgenen (vergl. 2B, Tab. 1) lokalisiert sind. Zusätzlich zeigte die Hauptzahl der analysierten CpG Dinukleotide des Panels verschieden Methylierungsmuster zwischen den zwei Phänotypen. Die Ergebnisse belegen, daß Methylierungs-Fingerprints in der Lage sind, eine differenzielle Diagnose von soliden malignen Tumoren zur Verfügung zu stellen und daher bei einer großen Zahl von klinischen Situationen angewendet werden könnten.All clinical samples were taken at the time of surgery, ie in a routine clinical situation (Santourlidis, S., Prostate 39: 166-174, 1999, Florl, AR, Br. J. Cancer 80: 1312-1321, 1999). A panel of genomic fragments from 64 different genes (listed in Table 1) were bisulphite-treated and amplified by 6 sets of multiplex PCRs (mPCR) according to Example 1. The mPCR reactions (I, J, K, L, M, N) of the genomic bisulfite-treated DNA were carried out using the combination of primer pairs as shown in Table 1. However, as will be apparent to those skilled in the art, it is also possible to use other primers that appropriately amplify the genomic bisulfite-treated DNA. However, the primer pairs as listed in Table 1 are particularly preferred. To differentiate grade I astrocytomas from healthy control samples, optimal results were obtained by ingesting at least 6 CpG dinucleotides, the most informative CpG positions for this distinction within the OAT, GP1B, cMyc, UNG, TIMP3 and cABL genes (cf. 2A , Tab. 1) are localized. To differentiate grade I astrocytomas from healthy control samples, optimal results were obtained by ingesting at least 6 CpG dinucleotides, the most informative CpG positions for this distinction within the genes cMyc, EGR4, ApoA1, AR and the heat shock genes (cf. 2 B , Tab. 1) are localized. In addition, the majority of the panel's analyzed CpG dinucleotides showed different methylation patterns between the two phenotypes. The results demonstrate that methylation fingerprints are able to provide a differential diagnosis of solid malignant tumors and could therefore be used in a large number of clinical situations.

Beispiel 6: Differenzierung von Astrocytom Grad I und Grad II TumorenExample 6: Differentiation of grade I and grade II astrocytoma tumors

Um einen Bezug der Methylierungsmuster zu einem bestimmten Tumortyp herzustellen, bedarf es zunächst der Analyse der DNA-Methylierungsmuster von zwei Gruppen von Patienten mit alternativen Formen eines Tumors, in diesem Fall eine Gruppe von Astrocytom Grad I und einer anderen Gruppe von Astrocytom Grad II. Diese Untersuchungen wurden analog zu Beispiel 1 durchgeführt. Die so erhaltenen Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. Dies kann durch Bestimmung einzelner CpG Methylierungsraten erfolgen, wie dies z. B. durch Sequenzieren relativ ungenau oder aber durch eine Methylierungssensitive „Primer-Extension-Reaktion" sehr genau möglich ist. In einer besonders bevorzugten Variante, wie in Beispielen 1 bis 4 verdeutlicht, kann der Methylierungsstatus von Hunderten oder Tausenden von CpGs auf einem Oligomerarray analysiert werden. Es ist auch möglich, daß die Muster durch zum Beispiel Clustering-Analysen, die z.B. durch einen Rechner durchgeführ werden können, verglichen werden.To reference the methylation pattern To produce a certain type of tumor, the first is required Analysis of DNA methylation patterns from two groups of patients with alternative forms of a tumor, in this case a group of astrocytoma grade I and another group of astrocytoma grade II. These tests were carried out analogously to Example 1. The Results obtained in this way are stored in a database and identified the CpG dinucleotides between the two Groups are methylated differently. This can be done by determination individual CpG methylation rates take place, as z. B. by Sequencing is relatively imprecise or due to a methylation-sensitive "primer extension reaction" very precisely possible is. In a particularly preferred variant, as in examples 1 to 4 clarifies the methylation status of hundreds or thousands of CpGs are analyzed on an oligomer array. It is also possible, that the Patterns through, for example, clustering analyzes, e.g. through a Computer performed can be be compared.

Alle klinischen Proben wurden zur Zeit der Chirurgie entnommen, d.h. in einer Routine klinischen Situation (Santourlidis, S., Prostate 39:166-174, 1999, Florl, A.R., Br. J. Cancer 80:1312-1321, 1999). Ein Panel von genomischen Fragmenten von 56 verschiedenen Genen (aufgelistet in Tabelle 1) wurden Bisulphit-behandelt und durch 6 Sets von Multiplex PCRs (mPCR), genannt I, J, K, L, M und N in Tabelle 1, gemäß Beispiel 1 amplifiziert. Die mPCR Reaktionen der genomischen, Bisulphit-behandelten DNA wurde unter Verwendung der Kombination von Primerpaaren wie in Tabelle 1 gezeigt, durchgeführt. Wie dem Fachmann ersichtlich sein wird, ist es auch möglich, andere Primer zu verwenden, die die genomische, Bisulphit-behandelte DNA auf eine geeignete Weise amplifizieren. Jedoch sind die Primerpaare, wie in Tabelle 1 aufgelistet, besonders bevorzugt. Optimale Ergebnisse wurden durch Aufnahme von mindestens 8 CpG Dinukleotiden erhalten, wobei die am meisten informativen CpG Positionen für diese Unterscheidung innerhalb der Gene CSKNB2, NF1, M1H1, EGR4, AR; TGF-alpha und APOC2 (vergl. 3) lokalisiert sind. Zusätzlich zeigte die Hauptzahl der analysierten CpG Dinukleotide des Panels verschieden Methylierungsmuster zwischen den zwei Phänotypen. Die Ergebnisse belegen, daß Methylierungs-Fingerprints in der Lage sind, eine differenzielle Diagnose von soliden malignen Tumoren zur Verfügung zu stellen und daher bei einer großen Zahl von klinischen Situationen angewendet werden könnten.All clinical samples were taken at the time of surgery, ie in a routine clinical situation (Santourlidis, S., Prostate 39: 166-174, 1999, Florl, AR, Br. J. Cancer 80: 1312-1321, 1999). A panel of genomic fragments from 56 different genes (listed in Table 1) were bisulphite-treated and amplified according to Example 1 by 6 sets of multiplex PCRs (mPCR), called I, J, K, L, M and N in Table 1 , The mPCR reactions of the genomic bisulfite-treated DNA were carried out using the combination of primer pairs as shown in Table 1. As will be apparent to those skilled in the art, it is also possible to use other primers that appropriately amplify the genomic bisulfite-treated DNA. However, the primer pairs as listed in Table 1 are particularly preferred. Optimal results were obtained by ingestion of at least 8 CpG dinucleotides, the most informative CpG positions for this distinction within the genes CSKNB2, NF1, M1H1, EGR4, AR; TGF-alpha and APOC2 (see 3 ) are localized. In addition, the majority of the panel's analyzed CpG dinucleotides showed different methylation patterns between the two phenotypes. The results demonstrate that methylation fingerprints are able to provide a differential diagnosis of solid malignant tumors and could therefore be used in a large number of clinical situations.

Beispiel 7: Differenzierung von Astrocytom Grad I und Grad II Tumoren unter der Verwendung von DNA Fragmenten, die vom Gen TGF-alpha, NF1 und M1H1 abgeleitet sind.Example 7: Differentiation of Grade I and Grade II Astrocytoma Tumors Using DNA fragments derived from the TGF-alpha, NF1 and M1H1 genes.

Die Methylierungsmuster von CpG Inseln, abgeleitet von den Genen TGF-alpha, NF1 und M1H1 wurden analysiert. Um die Gene zu evaluieren, wurden bereits identifizierte differenzierende Astrocytom Grad I und Grad II Tumore im Klassen-Vorhersage-Ansatz (vergl. Beispiel 6) verwendet. Die Gene TGF-alpha, NF1 und M1H1 wurden aus genomischer Bisulfit behandelter DNA wie in Beispielen 1, 2 und 3 beschrieben, amplifiziert. Die DNA wurde aus Gewebeproben von zwei Gruppen von Patienten mit alternativen Formen eines Tumors, in diesem Fall eine Gruppe von Astrocytom Grad I und eine andere Gruppe von Astrocytom Grad II. Optimale Ergebnisse wurden durch die Aufnahme von mindestens 6 CpG Dinukleotiden erhalten, wobei die am meisten informativen CpG Positionen für diese Unterscheidung innerhalb der Gene TGF-alpha und NF1 und M1H1 (vergl. 4) lokalisiert sind. Die Ergebnisse validieren die Ergebnisse der in Beispiel 6 gezeigten Methylierungs-Fingerprints weiter.The methylation patterns of CpG islands derived from the TGF-alpha, NF1 and M1H1 genes were analyzed. In order to evaluate the genes, previously identified differentiating grade I and grade II astrocytoma tumors were used in the class prediction approach (see Example 6). The TGF-alpha, NF1 and M1H1 genes were amplified from genomic bisulfite-treated DNA as described in Examples 1, 2 and 3. The DNA was obtained from tissue samples from two groups of patients with alternative forms of a tumor, in this case a group of astrocytoma grade I and another group of astrocytoma grade II. Optimal results were obtained by the inclusion of at least 6 CpG dinucleotides, the am most informative CpG positions for this distinction within the TGF-alpha and NF1 genes and M1H1 (see 4 ) are localized. The results further validate the results of the methylation fingerprints shown in Example 6.

Tabelle 1Table 1

Liste der Gene, Referenznummern und Primer Oligonukleotide gemäß Beispielen 1-7 und 1-4.List of genes, reference numbers and primers oligonucleotides according to Examples 1-7 and 1 - 4 ,

Figure 00250001
Figure 00250001

Figure 00260001
Figure 00260001

Figure 00270001
Figure 00270001

Claims (13)

Nukleinsäure, umfassend einen mindestens 18 Basen langen Sequenzabschnitt der chemisch vorbehandelten genomischen DNA gemäß einer der Sequenzen ausgewählt aus der Gruppe von Seq. ID No. 1 bis Seq. ID No. 120 und dazu komplementärer Sequenzen.Nucleic acid, comprising an at least 18 base long sequence section of the chemically pretreated genomic DNA selected from one of the sequences the group of Seq. ID No. 1 to Seq. ID No. 120 and complementary sequences. Oligomer, insbesondere Oligonukleotid oder Peptide Nucleic Acid (PNA)-Oligomer, wobei das Oligomer in jedem Fall mindestens eine Basensequenz mit einer Länge von mindestens 9 Nukleotiden umfaßt, die an eine chemisch vorbehandelte genomische DNA gemäß einer der Seq. ID No. 1 bis Seq. ID No. 120 nach Anspruch 1 hybridisiert oder dazu identisch ist.Oligomer, especially oligonucleotide or peptide nucleic acid (PNA) oligomer, the oligomer in each case at least one Base sequence with a length of at least 9 nucleotides that are chemically pretreated to one genomic DNA according to a the Seq. ID No. 1 to Seq. ID No. 120 hybridized according to claim 1 or is identical to it. Oligomer nach Anspruch 2, wobei die Basensequenz mindestens ein CpG Dinukleotid umfaßt.The oligomer of claim 2, wherein the base sequence is at least comprises a CpG dinucleotide. Oligomer nach Anspruch 2, dadurch gekennzeichnet, daß sich das Cytosin des CpG Dinukleotids in etwa im mittleren Drittel des Oligomers befindet.Oligomer according to claim 2, characterized in that the Cytosine of the CpG dinucleotide in approximately the middle third of the oligomer located. Satz von Oligomeren, umfassend mindestens zwei Oligomere nach einem der Ansprüche 3 bis 4.Set of oligomers comprising at least two oligomers after one of the claims 3 to 4. Satz von Oligomeren nach Anspruch 5, umfassend Oligomere zur Detektion des Methylierungszustandes aller CpG Dinukleotide innerhalb einer der Sequenzen gemäß Seq. ID No. 1 bis Seq. ID No. 120 nach Anspruch 1 und dazu komplementärer Sequenzen.A set of oligomers according to claim 5, comprising oligomers for Detection of the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID No. 1 to Seq. ID No. 120 according to claim 1 and sequences complementary thereto. Satz von mindestens zwei Oligonukleotiden nach Anspruch 2, die als Primer-Oligonukleotide zur Amplifikation von DNA-Sequenzen einer der Seq. ID No. 1 bis Seq. ID No. 120 und dazu komplementären Sequenzen und Abschnitten davon eingesetzt werden können.Set of at least two oligonucleotides according to claim 2, which as primer oligonucleotides for the amplification of DNA sequences of one of the Seq. ID No. 1 to Seq. ID No. 120 and complementary sequences zen and sections thereof can be used. Satz von Oligonukleotiden nach Anspruch 7, dadurch gekennzeichnet, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist.Set of oligonucleotides according to claim 7, characterized in that that at least an oligonucleotide is bound to a solid phase. An eine Festphase gebundene Anordnung von unterschiedlichen Oligomeren (Array), zur Analyse von in Zusammenhang mit dem Methylierungszustand der CpG Dinukleotide einer der Seq. ID No. 1 bis Seq. ID No. 120 und dazu komplementärer Sequenzen stehenden Erkrankungen, wobei mindestens ein Oligomer nach einem der Ansprüche 2 bis 4 an eine feste Phase gekoppelt vorliegt.Arrangement of different bound to a solid phase Oligomers (array), for analysis in connection with the methylation state the CpG dinucleotide one of the Seq. ID No. 1 to Seq. ID No. 120 and more complementary Sequences related diseases, with at least one oligomer after one of the claims 2 to 4 is coupled to a fixed phase. Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen nach Anspruch 9, dadurch gekennzeichnet, daß diese auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sind.Array of different oligonucleotide and / or PNA oligomer sequences according to claim 9, characterized in that this on a flat solid phase arranged in the form of a rectangular or hexagonal grid are. Array nach einem der Ansprüche 9 oder 10, dadurch gekennzeichnet, daß die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht.Array according to one of the claims 9 or 10, characterized in that the solid phase surface Silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, There is silver or gold. DNA- und/oder PNA-Array zur Analyse von in Zusammenhang mit dem Methylierungszustand von Genen stehenden Erkrankungen, der mindestens eine Nukleinsäure nach einem der voranstehenden Ansprüche umfaßt.DNA and / or PNA array for analysis related to the methylation state of genes related diseases, the minimum a nucleic acid according to one of the preceding claims. Kit, umfassend ein Bisulfit (= Disulfit, Hydrogensulfit) Reagenz sowie Oligonukleotide und/oder PNA-Oligomere nach einem der Ansprüche 2 bis 4.Kit comprising a bisulfite (= disulfite, hydrogen sulfite) reagent as well as oligonucleotides and / or PNA oligomers according to one of claims 2 to 4th
DE20121978U 2000-06-30 2001-07-02 Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas Expired - Lifetime DE20121978U1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE20121978U DE20121978U1 (en) 2000-06-30 2001-07-02 Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DE10032529A DE10032529A1 (en) 2000-06-30 2000-06-30 Diagnosis of major genetic parameters within the Major Histocompatibility Complex (MHC)
DE10032529.7 2000-06-30
DE10043826 2000-09-01
DE10043826.1 2000-09-01
EP01962814A EP1356099A2 (en) 2000-06-30 2001-07-02 Method and nucleic acids for the analysis of astrocytomas
DE20121978U DE20121978U1 (en) 2000-06-30 2001-07-02 Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas

Publications (1)

Publication Number Publication Date
DE20121978U1 true DE20121978U1 (en) 2004-01-15

Family

ID=30773210

Family Applications (1)

Application Number Title Priority Date Filing Date
DE20121978U Expired - Lifetime DE20121978U1 (en) 2000-06-30 2001-07-02 Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas

Country Status (1)

Country Link
DE (1) DE20121978U1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1693468A1 (en) 2005-02-16 2006-08-23 Epigenomics AG Method for determining the methylation pattern of a polynucleic acid
EP2481810A1 (en) 2005-04-15 2012-08-01 Epigenomics AG A method for providing DNA fragments derived from a remote sample

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1693468A1 (en) 2005-02-16 2006-08-23 Epigenomics AG Method for determining the methylation pattern of a polynucleic acid
EP2481810A1 (en) 2005-04-15 2012-08-01 Epigenomics AG A method for providing DNA fragments derived from a remote sample
US10731215B2 (en) 2005-04-15 2020-08-04 Epigenomics Ag Method for determining the presence or absence of methylation in a sample

Similar Documents

Publication Publication Date Title
DE60126593T2 (en) DIAGNOSIS OF DISEASES ASSOCIATED WITH APOPTOSIS BY MEANS OF DETERMINATION OF THE METHYLATION STATE OF APOPTOSIS-ASSOCIATED GENES
EP1423533B1 (en) Method for high sensitivity detection of cytosine-methylation
EP1423528B1 (en) Method for determining the degree of methylation of defined cytosines in genomic dna in the sequence context 5'-cpg-3'
DE10151055B4 (en) Method for detecting cytosine methylation in CpG islands
DE60317045T2 (en) METHOD AND NUCLEIC ACIDS FOR ANALYZING PROBLEMS OF PROLIFERATION OF COLORECTAL CELLS
DE10056802B4 (en) Method for the detection of methylation conditions for toxicological diagnostics
DE10154317B4 (en) Method for the detection of cytosine methylations in immobilized DNA samples
DE10132212B4 (en) Method for the detection of cytosine methylation by comparative analysis of the single strands of amplicons
DE10348407A1 (en) Prognostic and diagnostic markers for cell proliferative disorders of breast tissues
DE10128508A1 (en) Methods and nucleic acids for the differentiation of prostate tumors
DE10161625A1 (en) Methods and nucleic acids for the analysis of a pulmonary cell division disorder
DE20121960U1 (en) New nucleic acid derived from chemically treated metastasis genes, useful for diagnosis of cancers by analysis of cytosine methylation, also for treatment
DE10139283A1 (en) Methods and nucleic acids for the analysis of colon cancer
DE10061338A1 (en) Diagnosis of diseases associated with angiogenesis
EP1332228A2 (en) Diagnosis of diseases associated with cdk4 by determining the methylation state of the cdk4 gene
EP1339873B1 (en) Diagnosis of diseases associated with the human c-mos gene
DE10128509A1 (en) Methods and nucleic acids for the differentiation of prostate and kidney carcinomas
DE10037769A1 (en) Diagnosis of diseases associated with CD24
DE20121978U1 (en) Novel chemically modified genomic DNA sequences, useful in the characterization, classification, differentiation, grading, staging, treatment and/or diagnosis of astrocytomas or predisposition to astrocytomas
DE20121975U1 (en) Oligonucleotide for diagnosing and treating tumors and cancer especially gliomas, astrocytomas and oligodendromas, comprises chemically modified genomic sequences of genes associated with tumors and cancers
DE10230692A1 (en) Methods and nucleic acids for the analysis of methylation patterns within the DD3 gene
DE20121967U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10164501A1 (en) Methods and nucleic acids for the analysis of a lymphoid cell division disorder
DE20121965U1 (en) Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10255104A1 (en) Methods and nucleic acids for the analysis of proliferative diseases of breast cells

Legal Events

Date Code Title Description
R207 Utility model specification

Effective date: 20040219

R150 Term of protection extended to 6 years

Effective date: 20040115

R151 Term of protection extended to 8 years

Effective date: 20070930

R158 Lapse of ip right after 8 years

Effective date: 20100202