EP1287030A1 - Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere - Google Patents

Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere

Info

Publication number
EP1287030A1
EP1287030A1 EP01941363A EP01941363A EP1287030A1 EP 1287030 A1 EP1287030 A1 EP 1287030A1 EP 01941363 A EP01941363 A EP 01941363A EP 01941363 A EP01941363 A EP 01941363A EP 1287030 A1 EP1287030 A1 EP 1287030A1
Authority
EP
European Patent Office
Prior art keywords
cells
insulin
irs
sequence
manufacture
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01941363A
Other languages
German (de)
English (en)
Inventor
Ulf Smith
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Metcon Medicin AB
Original Assignee
Metcon Medicin AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from SE0002189A external-priority patent/SE0002189D0/xx
Application filed by Metcon Medicin AB filed Critical Metcon Medicin AB
Publication of EP1287030A1 publication Critical patent/EP1287030A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

  • IRS-2 INSULIN Regulated Substance induced by Pioglitazone , assay and USE THEREOF :
  • the present invention relates to metabolic disorders or diseases, their prediction, diagnosis, prevention, and treatment.
  • the invention in particular relates to IRS-2 related metabolic disorders or diseases, such diabetes and obesitas, and makes available specific nucleotide sequences and their therapeutic and diagnostic use, as well as their use as research tools, inter alia a novel method and assay for screening drug candidates and for differentiating between and evaluating insulin regulating substances substances.
  • Metabolic disorders or diseases are conditions, where the distribution of nutrients and their use, including the elimination of wastes, in a living body is disturbed or disrupted.
  • IRS-2 related metabolic disorders or diseases are abnormal conditions, where the activation, expression or other function of the IRS-2 gene is involved.
  • Diabetes mellitus is a complex disorder of carbohydrate, fat, and protein metabolism that is primarily a result of a relative or complete lack of insulin secretion by the beta cells of the pancreas or a result of defects of the insulin receptors.
  • the various forms of diabetes are divided in two categories, the most frequent being juvenile-onset diabetes or Type I insulin- dependent diabetes mellitus (IDDM) and adult-onset diabetes or Type II non-insulin- dependent diabetes mellitus (NIDDM). Both diseases, even when correctly diagnosed and medicated, require life-long medication, good patient compliance, a careful diet and frequent medical observation to avoid potentially serious sequelae.
  • IDDM juvenile-onset diabetes
  • NIDDM non-insulin- dependent diabetes mellitus
  • Thiazolidinediones are a recently identified class of antidiabetic agents which act by improving insulin sensitivity in both different animal models of obesity and diabetes as well as in man. In addition to improving the glucose and insulin levels, the circulating free fatty acids (FFA) and triglycerides are also lowered.
  • FFA circulating free fatty acids
  • TZD promote fat cell differentiation and activate several adipocyte-specific genes such as the fatty acid binding protein, aP2, as well as the lipoprotein lipase.
  • aP2 fatty acid binding protein
  • TZD induce their diverse effects by binding to and activating the peroxisome proliferator activated receptor (PPAR) ⁇ (reviewed in Spiegelman, 1998).
  • PPAR ⁇ is mainly expressed in the adipose tissue and exists as two isoforms, PPAR ⁇ l and ⁇ 2.
  • PPAR ⁇ l is the major isoform and accounts for around 85 % of that in the adipose tissue.
  • the isoforms differ in their NH 2 -terminal end, with PPAR ⁇ 2 having additional 30 amino acids, and are generated from the same gene by mRNA splicing.
  • TZD TZD improve insulin sensitivity since known PPAR ⁇ -regulated genes .mainly involve adipocyte differentiation, lipid storage and metabolism. It is also noted, however not yet explained, that a number of patients fail to respond to TZD treatment. The percentage varies between different demographic groups, but may on average amount to as much as 30 % of all patients. Due to the complex nature of the disease, the fact that a certain patient fails to respond to the treatment will not become evident until after several weeks of treatment and re-admission or a repeated visit to the physician.
  • IRS- molecules capable of modulating the activity of IRS- 1 and IRS-2, collectively called IRS- molecules.
  • the methods are characterised in that a candidate bioactive agent is added to a sample of the IRS-molecule, whereafter the binding of said candidate agent to said IRS- molecule is determined. Alternatively, the activity of the IRS-molecules is measured before and after the addition of the candidate agent. Neither coding nor non-coding sequences related to IRS-2 are disclosed.
  • the IRS-protein itself and its corresponding coding sequence has been studied and used as the marker, either directly by measuring its activity or concentration, or indirectly, by studying its interaction with other molecules.
  • the non-coding sequences have however, to the best knowledge of the present inventor, hitherto not been identified as such neither suggested for use for research, screening, diagnostic nor therapeutic purposes.
  • IRS-2 related disorders such as diabetes and in particular to develop new pharmaceuticals for this purpose, e.g. improved methods for differentiating between insulin regulating, i.e. insulin sensitizing or inhibiting substances.
  • new, specific, and reliable markers for IRS-2 transcription are needed.
  • One problem to be solved is therefor how to efficiently, and accurately screen candidate drugs, e.g. the class of TZD compounds in respect of insulin regulating, i.e. insulin sensitizing or inhibiting properties in different cells.
  • Another problem is to find genetic markers with wide applicability, useful for the diagnosis of diseases related to abnormal IRS- 2 transcription and for the determination of the risk of developing such diseases.
  • Fig. 1 (A) top - shows the IRS-2 mRNA expression (Northern blots) in differentiated 3T3-L1 adipocytes cultured for 48 hrs with no additions (bas), 100 nM insulin (ins) or 10 ⁇ M pioglitazone (pio) in combination with 100 nM insulin. Actin mRNA is also shown for the same cells, bottom - shows IRS-2 mRNA levels from cells cultured for 48 hrs with no additions (bas), with lO ⁇ M pioglitazone (pio) with or without 100 nM insulin (pio + ins).
  • FIG. 1 shows individual data from 5 experiments where LRS-2 mRNA was related to ⁇ -actin gene expression in the same cells (arbitrary units). Bars represent mean values, bottom - IRS- 2 protein expression in differentiated 3T3-L1 cells cultured for 48 hrs with no additions (bas), with 100 nM insulin (ins) or with 10 ⁇ M pioglitazone (pio). The scanned data are also shown below (arbitrary units).
  • C Time-course for IRS-2 mRNA expression in differentiated 3T3- Ll adipocytes cultured with 10 ⁇ M pioglitazone for the indicated times. The values represent % increase over non-stimulated control cells and are the means of two experiments.
  • Fig. 2 top - shows LRS-2 mRNA in differentiated 3T3-L1 adipocytes cultured for 48 hrs with 100 nM insulin (ins) alone or with 10 ⁇ M darglitazone (dar).
  • middle - shows LRS-2 mRNA in cells cultured with 100 nM insulin (ins),10 ⁇ M of the PPAR ⁇ agonist WY14643 (WY), with or without 100 nM insulin, and 10 ⁇ M pioglitazone (pio).
  • bottom - shows IRS-2 mRNA from differentiated cells that had been cultured for 48 hrs with no additions (bas), 100 nM progesterone (prog) with or without 10 ⁇ M pioglitazone (pio) or 200 ⁇ M 8-BrcAMP with or without pioglitazone.
  • FIG. 3 shows IRS-1 and PKB/Akt mRNA in differentiated 3T3-L1 adipocytes cultured for 48 hrs with no additions (bas), 100 nM insulin (ins) or 10 ⁇ M pioglitazone (pio) with insulin.
  • B top - Individual data from 5 experiments (same as shown in Fig. IB) where IRS-1 mRNA was related to ⁇ -actin gene expression in the same cells (arbitrary units). Bars represent mean values, bottom - IRS-1 protein expression in differentiated 3T3-L1 cells cultured for 48 hrs with no addition (bas), 100 nM insulin, 10 ⁇ M pioglitazone (pio) with or without 100 nM " insulin. The scanned data are also shown below (arbitrary units).
  • Fig. 4 shows an immunoblot of serine- or threonine-phosphorylated PKB. Lysates were prepared from cells that had been cultured for 48 hrs as in Fig.3A, serum-starved for 3 hrs, and then stimulated with 100 nM insulin for 10 min. Following separation on 7.5 % SDS- PAGE, the proteins were immunoblotted with antibodies recognizing insulin-stimulated phosphoserine (PS-PKB) and phosphothreonine (PThr-PKB) PKB/Akt.
  • PS-PKB insulin-stimulated phosphoserine
  • PThr-PKB phosphothreonine
  • Fig. 5 shows an alignment chart of the inventive sequences, SEQ. ID. NO. 1 through 12, based on an alignment of the PPAR binding site, AGGTCA, contained in each sequence.
  • metabolic disorder is intended to encompass any pathophysiologic dysfunction that results in a loss of metabolic control of homeostasis in the human or animal body.
  • disorders or diseases include, but are not limited to, e.g. diabetes and obesitas.
  • metabolic LRS-2 related disorder encompass any disorder involving the insulin receptor substrate molecule IRS-2, the protein and its corresponding nucleotide sequences, their activation, expression or inhibition.
  • insulin regulating substance encompasses any substance capable of interfering or interacting with insulin in its role in the regulation of the metabolism of glucose, fats, carbohydrates, and proteins.
  • regulating encompasses both sensitization and inhibition of insulin, the potentiation and the blocking of the effects of insulin in the human or animal body.
  • treatment encompass both human and animal or veterinary applications.
  • the present inventor has examined in differentiated 3T3-L1 adipocytes the effect of PPAR ⁇ and ⁇ ligands on the expression of several key molecules for insulin signaling and action; IRS- 1, LRS-2, PKB/Akt and GLUT4. It was surprisingly and unexpectedly found, that the only gene, which was rapidly and reproducibly increased was IRS-2, and this was also associated with an increased protein expression. Pioglitazone was found to induce transcription of the IRS -2 gene, resulting in a major transcript having a molecular weight of 7.2 kb. A minor transcript having a molecular weight of 8.2 kb was also frequently detected.
  • the present inventor demonstrates for the first time that PP AR ⁇ activation, but not PPAR ⁇ , rapidly turns on the gene of the key signaling molecule IRS-2.
  • This effect was initiated after 4 hrs, peaked after 24 hrs and remained elevated throughout the 48 hrs study. Furthermore, this effect appeared specific since, under the same conditions and in the same cells, no effects on IRS-1, PKB/Akt or GLUT4 were seen. Thus, it was not related to a general effect on cell differentiation by the PPAR ⁇ ligands.
  • IRS-2 protein expression was also increased ( ⁇ 40 %) after 48 hrs and its signaling through the PI3-kinase and PKB/Akt pathway also tended to be increased.
  • IRS-1 is then degraded through the proteasomal pathway probably as a result of ubiquination.
  • IRS-1 is the major docking protein for PI3- kinase in response to insulin in both 3T3-L1 cells (Sun et al., 1997) as well as in human fat cells and that IRS-2 functions as a true "back-up" protein.
  • the present data show for the first time a clear link between PPAR ⁇ ligands and the insulin signaling cascade in that TZD rapidly increase IRS-2 gene (and protein) expression in 3T3-L1 cells. Since IRS-2 appears to play a profound role in diabetes-, these data suggest that the antidiabetic effect of TZD may be mediated through this effect. It will also be of great interest to see if TZD can influence ⁇ -cell growth and/or apoptosis since a sturming effect of LRS-2 gene disruption is seen on pancreatic ⁇ -cell development. Thus, although LRS-2 can also be used by insulin as a docking protein for PI3-kinase activation, itmay play an even more profound role in the signaling and effect of cytokines and growth factors.
  • TRS-2 mRNA included a major ⁇ 7.2 Kb band but a minor band at ⁇ 8.2 Kb was also frequently seen.
  • the disclosed sequences are understood to encompass closely homologous sequences, that is sequences exhibiting 70, 80, 90, 95, or 98 % homology to any one of the sequences disclosed as SEQ. ID. NO. 1 through 12.
  • the invention also encompasses sequences capable of hybridising under stringent conditions to any one of the sequences disclosed as SEQ. ID. NO. 1 through 12.
  • the invention also encompasses the complementary sequences corresponding to SEQ. ID. NO. 1 through 12.
  • LRS-2 related disorders or diseases e.g. diabetes or obesitas.
  • the present inventor has isolated and sequenced specific non-coding sequences immediately upstream of the human LRS-2 gene, which can be used as markers for the diagnosis or prediction of LRS-2 related disorders or diseases, or for the prevention and/or treatment thereof.
  • the findings disclosed above constitute a basis for finding such regulating substances, not only for human or mammalian adipocytes but also for other, specific human or mammalian cells such as hepatic cells, pancreatic cells or muscle tissue cells.
  • the findings also constitute a basis for finding insulin regulating compounds, i.e. sensitizing or inhibiting compounds for veterinary use, e.g. for the treatment of animals kept for economical or emotional reasons, such as livestock, cattle, horses and pets.
  • the treatment of animals in this context includes both the treatment in the sense of improving health or preventing disease, and also any treatment aiming at changing growth parameters, such as meat production.
  • At least one of SEQ. ID. NO. 1 through 12, or homologues thereof is used as a marker or as markers to screen and find compounds possessing insulin regulating, i.e. sensitizing or inhibiting properties in different cells.
  • the detection of the sequence(s) may be done directly, e.g. using PCR, or indirectly, using a suitable reporter system.
  • the detection is facilitated by coupling said at least one of SEQ. ID. NO. 1 through 12, or a homologue thereof, to a suitable reporter, e.g. a fluorescent reporter molecule.
  • At least one of SEQ. ID. NO. 1 through 12, or homologues thereof is used as a marker or as markers to screen the class of TZD compounds in respect of insulin regulating, i.e. insulin sensitizing or inhibiting properties in different cells.
  • the detection of the sequence(s) maybe done directly, e.g. using PCR, or indirectly, using a suitable reporter system.
  • the detection is facilitated by coupling said at least one of SEQ. ID. NO. 1 through 12, or a homologue thereof, to a suitable reporter, e.g. a fluorescent reporter molecule.
  • At least one of the above SEQ. ID. NO. 1 through 12 is used as a specific marker to screen and find adipocyte specific insulin regulating substances, i.e. insulin sensitizers or inhibitors using appropriate mammalian cells and subsequent detection of the at least one sequence.
  • the detection of the sequence(s) may be done directly, e.g. using PCR, or indirectly, using a suitable reporter system.
  • the detection is facilitated by coupling said at least one of SEQ. ID. NO. 1 through 12, or a homologue thereof, to a suitable reporter, e.g. a fluorescent reporter molecule.
  • suitable screening systems include, but are not limited to Northern blots, RT-PCR using specific primers and probes for IRS-2, solution hybridisation and RNA'ase protection assays.
  • HTS high throughput screening
  • a reporter system adapted for specific sequences of the IRS-2 promoter, in particular a sequence chosen among SEQ. ID. NO. 1 - 12, or homologues thereof.
  • Useful reporter sequences are luciferase or similar, sensitive assays.
  • this at least one marker as disclosed above is used in a screening system to find and discriminate between insulin regulating substances, i.e. insulin sensitizers or inhibitors acting on different cells, such as blood cells, hepatic cells, muscle tissue cells and adipocytes.
  • insulin regulating substances i.e. insulin sensitizers or inhibitors acting on different cells, such as blood cells, hepatic cells, muscle tissue cells and adipocytes.
  • the detection of the above at least one sequence chosen from SEQ. ID. NO. 1 through 12 is performed either qualitatively or quantitatively.
  • Qualitative detection methods comprise any method where the presence or absence of a marker is determined, e.g. based on radiation, fluorescence, etc.
  • Quantitative methods comprise any method where the amount of marker .is determined, e.g. qualitative PCR or RT-PCR.
  • the at least one sequence chosen from SEQ. ID. NO.. 1 through 12 or information derived therefrom is/are used for the production of an assay for the screening of drug candidates in respect of their insulin regulating properties.
  • said assay is constructed as an assay suitable for high throughput (HTP) screening, for example an assay adapted for the commonly used 96-well format, the 384- well format or denser formats, such as micro arrays or chips, carrying immobilised reagents on their surface.
  • HTP high throughput
  • the invention also encompasses novel compounds exhibiting therapeutic properties, e.g. insulin regulating, e.g. insulin sensitizing or inhibiting properties, identified using the methods disclosed above.
  • novel compounds exhibiting therapeutic properties e.g. insulin regulating, e.g. insulin sensitizing or inhibiting properties, identified using the methods disclosed above.
  • the invention also encompasses the medical use of compounds identified as compounds exhibiting therapeutic properties in the treatment of IRS-2 related metabolic disorders or diseases, e.g. insulin regulating, e.g. insulin sensitizing or inhibiting properties, identified using the methods disclosed above.
  • the present invention comprises a method, wherein the regulating elements regulating and/or contained in IRS-2 transcripts, in particular the sequences SEQ. ID. NO. 1 through 12, are used as drug targets to prevent or treat metabolic LRS-2 related disorders or diseases, e.g. diabetes and obesitas, in humans and/or animals.
  • the regulating elements regulating and/or contained in IRS-2 transcripts in particular the sequences SEQ. ID. NO. 1 through 12 are used as drug targets to prevent or treat metabolic LRS-2 related disorders or diseases, e.g. diabetes and obesitas, in humans and/or animals.
  • an LRS-2 transcript is used for the manufacture of a medicament.
  • a sequence chosen from SEQ. ID. NO. 1 through 12 or information derived therefrom is used for the manufacture of a medicament.
  • an LRS-2 transcript is used for the manufacture of a medicament for the treatment of diabetes.
  • a sequence chosen from SEQ. ID. NO. 1 through 12 or information derived therefrom is used for the manufacture of a medicament for the treatment of metabolic, LRS-2 related disorders or diseases, e.g. diabetes or obesitas.
  • sequence mformation derived from an LRS-2 transcript and in particular the information contained in at least one of the sequences SEQ. ID. NO. 1 - 12, can be used for the manufacture of a medicament, in particular a medicament for the treatment of diabetes or obesitas.
  • sequence information derived from an IRS-2 transcript and in particular the information contained in at least one of the sequences SEQ. ID. NO. 1 - 12, can be used in an assay for diagnosing diabetes and/or differentiating between various types or stages of the disease.
  • the present invention makes available a method for determining if a patient in need of treatment with an insulin regulating, e.g. insulin sensitizing substance has the predisposition to respond to the treatment, wherein the activation of LRS-2 is measured, e.g. by deterniining the amount or relative increase/decrease of the LRS-2 protein, or the corresponding mRNA when administering the insulin regulating substance in question to a sample of cells taken from the patient.
  • the cells taken from the patient are chosen among blood cells, adipocyte cells, muscle cells or liver cells, preferably blood cells or adipocyte cells.
  • the present invention makes available a method for determining if a patient in need of treatment with an insulin regulating, e.g. insulin sensitizing substance has the predisposition to respond to the treatment, wherein at least one sequence chosen among SEQ.ID.NO. 1 - 12 is used as a marker when administering the insulin regulating substance in question to a sample of cells taken from the patient.
  • the cells taken from the patient are chosen among blood cells, adipocyte cells, muscle cells or liver cells, preferably blood cells or adipocyte cells.
  • the results also support the conclusion that thiazolidinediones, such as pioglitazone, have new specific modes of action and that they thus can be used as medicaments with specific therapeutic actions.
  • the present invention thus comprises the use of thiazolidinediones, such as pioglitazone, for the manufacture of a medicament specifically for regulating the insulin sensitivity of particular cells, e.g. for increasing the insulin sensitivity of adipocytes.
  • 3T3-L1 fibroblasts were grown and differentiated into adipocytes according to Rubin et al, 1977). At least 90 % of the cells had acquired the adipocyte phenotype 6 days after initiating differentiation. Eight days after differentiation, the medium was changed and the various agents added for the times indicated in the Results.
  • AGGCGGCCGCACATCATCTCGTA were used as PCR primers (SEQ. ID. NO. 13 and 14, respectively).
  • the 10 Kb genomic sequence hrrmediately upstream of the open reading frame of the human LRS-2 gene was sequenced using ABI PRISM ® BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) according to the manufacturers instructions.
  • Fig. 3B shows the chronic effects of pioglitazone and/or insulin on LRS-1 protein expression after 48 hrs. Pioglitazone alone did not change LRS-1 protein expression. However, in contrast to IRS-2 (Fig. IB - bottom), IRS-1 protein expression was reduced by chronic stimulation with the high insulin concentration and this was not altered by the presence of pioglitazone (Fig. 3B - bottom).
  • the present inventor also examined the acute effect of insulin on down-stream activation of PKB/Akt in cells that had been cultured with pioglitazone for 48 hrs, washed and serum- starved for 3 hrs in fresh medium. Similar to the gene (Fig. 3 A), PKB/Akt protein expression was not changed by the presence of either pioglitazone and/or insulin for 48 hrs (not shown). Insulin (100 nM) was then added for 10 min to the serum-starved cells. As shown in fig. 4, the acute effect of insulin on PKB/Akt phosphorylation tended to be increased in cells cultured with pioglitazone alone.
  • the inventor has performed experiments with human adipocytes, which indicate that the results obtained with the 3T3-L1 adipocytes are transferable to human cells.
  • the present inventor has shown that TZD increase IRS-2 expression in human adipocytes after 24 hrs in culture.
  • the results available at the priority date support a broad application of the invention.
  • LRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent , diabetes mellitus. Proc Natl Acad Sci US A 94, 4111-4115.
  • the LRS-2 gene on murine chromosome 8 encodes a unique signaling adapter for insulin and cytokine action. Mol Endocrinol 11, 251-262.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Endocrinology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • Obesity (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Emergency Medicine (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)

Abstract

L'invention concerne de nouvelles séquences non codantes isolées en amont du gène IRS-2 de l'homme, utilisées comme marqueurs pour prévenir et/ou diagnostiquer les troubles ou maladies métaboliques liés à l'IRS-2, comme le diabète. Ces séquences fonctionnent comme marqueurs dans un procédé et un dosage permettant d'évaluer les propriétés d'inhibition, de régulation ou de sensibilisation de l'insuline dans des substances pouvant être utilisées comme médicaments, c'est-à-dire, dans un procédé et un dosage de haute efficacité. Les informations et/ou les séquences ainsi dérivées peuvent permettre d'influencer l'expression du gène IRS-2, par exemple dans la thérapie des troubles métaboliques liés à l'IRS-2, comme le diabète.
EP01941363A 2000-06-08 2001-06-08 Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere Withdrawn EP1287030A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US21020700P 2000-06-08 2000-06-08
US210207P 2000-06-08
SE0002189 2000-06-09
SE0002189A SE0002189D0 (sv) 2000-06-09 2000-06-09 New method and assay
PCT/SE2001/001308 WO2001094410A1 (fr) 2000-06-08 2001-06-08 Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere

Publications (1)

Publication Number Publication Date
EP1287030A1 true EP1287030A1 (fr) 2003-03-05

Family

ID=26655145

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01941363A Withdrawn EP1287030A1 (fr) 2000-06-08 2001-06-08 Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere

Country Status (3)

Country Link
EP (1) EP1287030A1 (fr)
AU (1) AU2001274722A1 (fr)
WO (1) WO2001094410A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1876448A1 (fr) * 2005-09-30 2008-01-09 DIGILAB BioVisioN GmbH Méthodes et réactifs analytiques pour identifier des médicaments à l'aide de marqueurs biologiques sensibles aux thiazolidinediones

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5578444A (en) * 1991-06-27 1996-11-26 Genelabs Technologies, Inc. Sequence-directed DNA-binding molecules compositions and methods
US5478852C1 (en) * 1993-09-15 2001-03-13 Sankyo Co Use of thiazolidinedione derivatives and related antihyperglycemic agents in the treatment of impaired glucose tolerance in order to prevent or delay the onset of noninsulin-dependent diabetes mellitus
US5858701A (en) * 1994-10-03 1999-01-12 Joslin Diabetes Center, Inc. DNA encoding an insulin receptor substrate
WO1998021592A1 (fr) * 1996-11-13 1998-05-22 Receptron Corporation Dosages relatifs au diabete non insulinodependant
JP2002504822A (ja) * 1997-06-11 2002-02-12 ジェネティックス・インスチチュート・インコーポレーテッド 分泌蛋白およびそれらをコードするポリヌクレオチド

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0194410A1 *

Also Published As

Publication number Publication date
WO2001094410A1 (fr) 2001-12-13
AU2001274722A1 (en) 2001-12-17

Similar Documents

Publication Publication Date Title
Smith et al. Thiazolidinediones (PPARγ agonists) but not PPAR α agonists increase IRS‐2 gene expression in 3T3‐L1 and human adipocytes 1
Way et al. Comprehensive messenger ribonucleic acid profiling reveals that peroxisome proliferator-activated receptor γ activation has coordinate effects on gene expression in multiple insulin-sensitive tissues
JP6175172B2 (ja) 筋萎縮を阻害するための方法
Harris et al. Transcriptional regulation of the thyrotropin-releasing hormone gene by leptin and melanocortin signaling
JP3888998B2 (ja) ＰＰＡＲδ活性化作用を測定することを特徴とする物質の選択方法及び薬剤
US20080146540A1 (en) Methods of diagnosis and treatment for asthma, allergic rhinitis and other respiratory diseases based on haplotype association
US6110672A (en) Peripheral nervous system specific sodium channels, DNA encoding therefor, crystallization, X-ray diffraction, computer molecular modeling, rational drug design, drug screening, and methods of making and using thereof
US20050136429A1 (en) SIRT1 modulation of adipogenesis and adipose function
Navas et al. Functional characterization of the MODY1 gene mutations HNF4 (R127W), HNF4 (V255M), and HNF4 (E276Q).
JP2003514538A (ja) 哺乳動物毒物学的反応マーカー
Hung et al. The protective role of peroxisome proliferator-activated receptor-gamma in seizure and neuronal excitotoxicity
US20130085169A1 (en) Methods and compositions comprising ampk activator (metformin/troglitazone) for the treatment of myotonic dystrophy type 1 (dm1)
US20060178307A1 (en) Modulation of NMDA receptor currents via orexin receptor and/or CRF receptor
WO2005007144A2 (fr) Methodes de diagnostic et de traitement de l'asthme et d'autres maladies respiratoires reposant sur une association d'haplotypes
JP2008531710A (ja) 神経変性疾患の調節
US20080027052A1 (en) Methods for treating cystic kidney disease
US6835819B2 (en) Sequences and their use
US20160166541A1 (en) Methods For Identifying Analgesic Agents
Higgins et al. Studies to examine potential tolerability differences between the 5-HT2C receptor selective agonists lorcaserin and CP-809101
Panegyres The effects of excitotoxicity on the expression of the amyloid precursor protein gene in the brain and its modulation by neuroprotective agents
Duplus et al. Expression of phosphoenolpyruvate carboxykinase gene in human adipose tissue: induction by rosiglitazone and genetic analyses of the adipocyte-specific region of the promoter in type 2 diabetes
WO2001094410A1 (fr) Substance regulee par l'insuline (irs-2) induite par la pioglitazone, dosage et utilisation de cette derniere
AT500646A1 (de) Behandlung und diagnose von insulinbeständigen zuständen
Smith Novel sequences and their use
Jahn et al. Increased β2-adrenergic signaling promotes fracture healing through callus neovascularization in mice

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20021118

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SMITH, ULF

17Q First examination report despatched

Effective date: 20031023

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061221