EP1278872A1 - Novel plant glucosidase i and use thereof for producing recombinant proteins with modified glycosylation - Google Patents

Abstract

The invention concerns a novel plant glucosidase I and nucleic acids coding for said enzyme involved in N-glycosylation of proteins during translation. The invention also concerns means for detecting said protein and nucleic acids, such as antibodies or nucleotide probes and primers.

Description

 Title: NOVEL PLANT GLUCOSIDASE I AND ITS APPLICATION TO THE PRODUCTION OF RECOMBINANT PROTEINS WITH MODIFIED GLYCOSYLATION

The present invention relates to a novel plant glucosidase I and to nucleic acids coding for this enzyme participating in the N-glycosylation of proteins during translation. It also relates to means for detecting this protein and these nucleic acids, such as

5 antibodies or probes and nucleotide primers.

The invention also relates to recombinant vectors comprising a nucleic acid encoding the new plant glucosidase I, to host cells transformed with a nucleic acid or a recombinant vector according to the invention, as well as to transgenic plants 10 of which part or all of the cells are transformed with a nucleic acid or a recombinant vector according to the invention.

The invention also relates to means intended to increase or on the contrary to inhibit the expression of a nucleic acid coding for the new glucosidase I in plants, with the aim of producing

15 proteins, especially recombinant proteins, the glycosylation of which is modified.

In plants, as in all eukaryotes, N-glycosylation consists of the covalent attachment of a more or less complex oligosaccharide to a protein, at a glycosylation site consisting of the amino acid sequence NXS / T , X representing any of the amino acids, except proline (P) and aspartic acid (D).

The N-glycosylation process begins in the endoplasmic reticulum with the transfer of a type 25 precursor oligosaccharide (Glc ₃ Mang GlcΝAc ₂ ) to the N residue of a glycosylation site of the protein being translated.

This precursor oligosaccharide undergoes modifications in the endoplasmic reticulum. First, glucosidase I cuts glucose and glucosidase II cuts the following two glucoses, the oligosaccharide attached to the glycosylation site then having the form (Man ₉ GlcNAc ₂ ).

In a second step, the protein is transferred into the apparatus of

Golgi in which the oligosaccharide will undergo numerous additional modifications. In particular, residues α-1, 3 fucose and β-1, 2 xylose can be added. The residues α-1, 3 fucose and β-1, 2 xylose are

35 specific to plants and appear to be present in molluscs, insects and nematodes; they have never been identified in mammals.

Glycans attached to protein glycosylation sites play an important role in many mechanisms. They allow in particular the maintenance of the structure of the protein in a biologically active conformation, they ensure a protection of the peptide chain against the attack of the proteolytic enzymes and can intervene in the phenomena of cellular recognition (Weil et al ., 1989).

Glucosidase I is also designated mannosyl-oligosaccharide glucosidase, the international classification of which is EC: 3.2.1.106.

Glucosidase I is a type 11 endoplasmic reticulum membrane enzyme, the C-terminus of which is found in the lumen of the endoplasmic reticulum.

This enzyme catalyzes the first stage of N-glycosylation, by hydrolyzing the terminal glucose residue of the precursor oligosaccharide. This protein has been purified and characterized in several species.

In yeast, glucosidase I has a size of 95 kDa (Bause et al., 1986). Glucosidase I has also been isolated and characterized from pig liver (Bause et al., 1989), from the bovine mammary gland where it appears to be present in the form of a tetramer (Schailubhai et al., 1987) and from the liver veal (Hettkamp et al., 1984). In these three species, glucosidase I has a size of 85 kDa and the similarities in their respective amino acid sequences show that this protein is fairly well conserved during evolution (Pukkazhenti et al., 1993). A human ADΝc of 2881 bp encoding a glucosidase I has also been isolated (Kalz-Fuller et al., 1995). The amino acid sequence analysis deduced from the AD séquencec sequence revealed a potential glycosylation site on the amino acid at position 655, the presence of a very hydrophobic zone corresponding to the putative transmembrane region ranging from amino acid at position 38 to amino acid at position 58 towards the Ν-terminal end and in the presence of a cytosolic region of 37 amino acids at the Ν-terminal end as well as a region C- terminal terminal located in the lumen of the endoplasmic reticulum. It is a type 11 membrane protein. In plants, glucosidase I was isolated from bean seedlings (Mung Bean) by (Szumilo et al. 1986), this enzyme having been studied in detail by Zeng et al. in 1998. This glucosidase I has a size of 97 kDa and is distinguished from animal glucosidases I by a different sensitivity to agents modifying amino acids.

For example, a histidine modifying agent inactivates bean glucosidase I but not that of pig liver, while a cysteine modifying agent inactivates only glucosidase I of pig liver.

Whether they originate from a yeast, a mammal or a plant, known glucosidases 1 have certain characteristics in common: it is an α-1,2-glucosidase whose catalytic activity does not not require the presence of a metal ion, which is N-glycosylated at a single site.

To date, no genomic DNA or messenger RNA coding for a plant glucosidase I has yet been isolated and characterized.

However, there is currently a very significant need for means making it possible to produce polypeptides of industrial interest in plants, in particular recombinant proteins, and the glycosylation of which is modified. In particular, there is an increased need for proteins produced in plants, which do not have allergenic characteristics conferred by the fucose and xylose residues contained in the complex oligosaccharides fixed at the glycosylation sites of proteins of plant origin. There is also an increased need for proteins originating from cereals lacking an allergenic effect or also from recombinant proteins of food or therapeutic interest which do not cause an allergic phenomenon in the consumer or the patient.

In order to modify the nature of N-glycosylation in plants, it has been envisaged to stop the cascade of enzymatic glycosylation reactions, before the stages of maturation of glycans, or else to make plants produce, by transgenesis, complex oligosaccharides of animal type (Chrispeels and Faye, 1998).

It has also been envisaged to use castanospermine, which is a glucosidase I inhibiting agent, in particular in cultures of plant cells in a fermenter, so as to synthesize proteins carrying an N-glycan with a structure close to the precursor common to all eukaryotes.

The invention made it possible to isolate and characterize for the first time the transcription product of a gene coding for a plant glucosidase I catalyzing the cleavage of the first external glucose residue of the precursor oligosaccharide (Glc ₃ Man ₉ Glc NAc ₂ ) and thus to make accessible to those skilled in the art means making it possible to modulate the expression of the corresponding gene in a plant and in particular to inhibit or block the translation of glucosidase I in a plant, so as to produce in this plant glycosylated proteins containing no allergenic and / or immunogenic osidic residues, such as fucose and xylose residues.

The applicant has thus isolated and characterized a complementary DNA corresponding to the messenger RNA coding for a glucosidase I in Arabidopsis thaliana, the corresponding gene being designated AtGCSI.

The applicant has also shown that the interruption of the genomic sequence of the AtGCSI gene in a plant leads to the production of proteins whose glycosylation is modified. More particularly, it has been shown that blocking the expression of the AtGCSI gene according to the invention provokes the production of proteins whose glycosylation sites were occupied by precursor oligosaccharides and not by mature N-glycans. Analysis of proteins produced by plants in which the expression of the AtGCSI gene has been blocked has made it possible to determine a total absence of allergenic xylose and fucose residues. Blocking the expression of the plant glucosidase I gene AtGCSI causes the development of the seed to stop.

A T-DNA insertion mutant affected in protein N-glycosylation was isolated. T-DNA is inserted into a gene located on BAC T1 F15 from the DNA bank of Arabidopsis thaliana TAMU of the ecotype

Columbia which is listed in the Gen Bank database under access number AC004393.

The sequence listed in the aforementioned database is annotated as being similar to human glucosidase I. The genome sequence of the AtGCSI gene also has a strong similarity (66% identity in nucleic acids) with a sequence from BAC F316 of the IGF database listed in the GenBank database under the access number AC002396. The sequence contained in BAC F3I6 is also annotated as being similar to human glucosidase I. Homologies between the coding sequence of the AtGCSI gene have been found, for example with mouse, rat and human glucosidase 1 (38% identity in nucleic acids) of a putative protein of C. elegans (36 % identity in nucleic acids) or Schizzo. pombe (31% identity in nucleic acids) or yeast (28% identity in nucleic acids).

The gene sequence described in the GenBank database under access number AC004353 would include 20 exons and 19 introns. According to such an analysis, the gene sequence contained in BAC T1 F15 would be transcribed into a messenger RNA coding for a putative protein with a length of 864 amino acids.

The AtGCSI gene according to the invention, which comprises 22 exons and 21 introns, allows the synthesis of a messenger RNA coding for a glucosidase I with a length of 852 amino acids. Thus, a first subject of the invention consists of a nucleic acid comprising at least 20 consecutive nucleotides of a polynucleotide coding for a glucosidase I having the amino acid sequence SEQ ID No. 1, or a nucleic acid of complementary sequence.

Preferably, a nucleic acid according to the invention is in an isolated and / or purified form.

The term "isolated" in the sense of the present invention designates a biological material (nucleic acid or protein) which has been removed from its original environment (the environment in which it is naturally located). For example, a polynucleotide naturally occurring in a plant or animal is not isolated. The same polynucleotide separated from the adjacent nucleic acids within which it is naturally inserted into the genome of the plant or animal is considered to be "isolated".

Such a polynucleotide may be included in a vector and / or such a polynucleotide may be included in a composition and remain nevertheless in the isolated state of the fact that the vector or the composition does not constitute its natural environment.

The term "purified" does not require that the material be present in a form of absolute purity, exclusive of the presence of other compounds. Rather, it is a relative definition.

A polynucleotide is in the "purified" state after purification of the starting material or of the natural material of at least one order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.

For the purposes of the invention, the expression "nucleotide sequence" can be used to denote either a polynucleotide or a nucleic acid. The term "nucleotide sequence" encompasses the genetic material itself and is therefore not limited to information regarding its sequence.

The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide sequence" include RNA, DNA, cDNA sequences or even RNA / DNA hybrid sequences of more than one nucleotide, in single chain form or in duplex form.

The term "nucleotide" designates both natural nucleotides (A, T, G, C) as well as modified nucleotides which comprise at least one modification such as (1) an analogue of a purine, (2) an analogue of 'a pyrimidine, or (3) a similar sugar, examples of such modified nucleotides being described for example in PCT application No. WO 95/04 064.

For the purposes of the present invention, a first polynucleotide is considered to be "complementary" to a second polynucleotide when each base of the first nucleotide is paired with the base complementary to the second polynucleotide whose orientation is reversed.

The complementary bases are A and T (or A and U), or C and G.

The invention also relates to a nucleic acid comprising at least 20 consecutive nucleotides of the cDNA of nucleotide sequence SEQ ID No. 2 coding for the plant glucosidase l according to the invention or a nucleic acid of complementary sequence.

In particular, the invention relates to a nucleic acid comprising the nucleic sequence SEQ ID No. 2, or a nucleic acid of complementary sequence. The subject of the invention is also a nucleic acid having at least 80% nucleotide identity with one of the following nucleic acids: a) a nucleic acid comprising at least 20 consecutive nucleotides of a polynucleotide coding for a glucosidase I having the amino acid sequence SEQ ID No. 1, or a nucleic acid of complementary sequence; b) a nucleic acid comprising at least 20 consecutive nucleotides of the nucleotide sequence SEQ ID No. 2, or a nucleic acid of complementary sequence; c) a nucleic acid comprising the nucleotide sequence SEQ ID No. 2, or a nucleic acid of complementary sequence.

According to the invention, a first nucleic acid having at least 80% identity with a second reference nucleic acid, will have at least 85%, preferably at least 90%, 95%, 98%, 99%, 99.5 % or 99.8% of identity in nucleotides with this second reference polynucleotide, the percentage of identity between two sequences being determined as described below.

The "percentage of identity" between two nucleotide or amino acid sequences, within the meaning of the present invention, can be determined by comparing two optimally aligned sequences, through a comparison window.

The part of the nucleotide or polypeptide sequence in the comparison window can thus include additions or deletions (for example "gaps") with respect to the reference sequence

(which does not include these additions or these deletions) so as to obtain an optimal alignment of the two sequences.

The percentage is calculated by determining the number of positions at which an identical nucleic base or amino acid residue is observed for the two sequences (nucleic or peptide) compared, then by dividing the number of positions at which there is identity between the two bases or amino acid residues by the total number of positions in the comparison window, then multiplying the result by one hundred to obtain the percentage of sequence identity. The optimal alignment of the sequences for the comparison can be achieved by computer using known algorithms contained in the software tool of the company WISCONSIN GENETICS SOFTWARE

PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, Wisconsin.

Most preferably, the percentage of identity between two sequences is carried out using BLAST software (BLAST version 2.06 of

September 1998), using only the default settings (S.F.

ALTSCHUL et al., 1990); SF ALTSCHUL et al., 1997). Each of the nucleic acids according to the invention which comprises all or part of the mRNA or of the cDNA corresponding to the transcription products of the AtGCSI gene coding for a plant glucosidase I can be easily obtained by a person skilled in the art who knows its nucleotide sequence disclosed in the present description. Those skilled in the art can also reproduce any of the nucleic acids according to the invention by constructing, on the basis of the sequences disclosed in the present description, oligonucleotide primers capable of amplifying all or part of these nucleic acids, for example by extracting the total RNAs from different plant tissues, then synthesizing the complementary DNAs using a reverse transcriptase enzyme before carrying out several amplification cycles of the cDNAs obtained using one or more primers hybridizing specifically with the target sequences whose obtaining is sought. Such a mode of reproduction of nucleic acids according to the invention is for example described in Example 1.

After specific amplification of a nucleic acid according to the invention using the appropriate primers, the different amplified nucleic acids can then be subjected to a ligation step in a vector according to techniques well known to those skilled in the art.

In general, a nucleic acid having at least 20 consecutive nucleotides of a sequence according to the invention advantageously has at least 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, 500 , 1000, 2000 or 2500 consecutive nucleotides of the sequence of reference, the length of consecutive nucleotides being naturally limited by the length of the reference sequence.

Those skilled in the art can also reproduce a nucleic acid according to the invention by direct chemical synthesis, such as the phosphodiester method described by Narang et al. (1979), the phosphodiester method described by Brown et al. (1979), the diethylphosphoramidite method described by Beaucage et al. (1981), as well as the solid support method described in European patent application No. EP 0 707 792, the content of these documents being incorporated here by reference.

A nucleic acid according to the invention can also be synthesized, from the reference polynucleotide sequence information SEQ ID No. 2 and SEQ ID No. 5, using the techniques described by Wheeler et al. (1996, Gene, Vol. 10. 251-255), by Wade et al. (1996, Biomedical Peptides, Proteins and nucleic acids, Vol. 2: 27-32), by Martinez et al. (1996, Taxicon, Vol. 34 (11): 1413-1419), by Prapunwattana et al. (1996, Molecular and Biochemical Parasitoly, vol. 83: 93-106) and by Skopek et al. (1996, Mutation Research, vol. 349: 163-172).

As already mentioned, the applicant has also isolated and characterized, in an Arabidopsis thaliana ecotype, the Wassilevskja ecotype, a plant in the genome of which the AtGCSI gene coding for glucosidase I according to the invention has been artificially interrupted, by inserting a construct containing T-DNA from Agrobacterium tumefaciens.

After sequencing the AtGCSI gene at the T-DNA level, it was established that exogenous DNA was inserted at the start of the eighth intron

The insertion of exogenous T-DNA further created a 30 bp deletion of genomic DNA as well as an insertion of two nucleotide fragments with a length of 26 and 22 bp respectively, on either side T-DNA.

Thus, the applicant has isolated and characterized an Atgcsl gene comprising, relative to the sequence of the ArGCS gene) found naturally, several additions and deletions of nucleotides in the coding sequence.

It has been shown according to the invention that plants carrying a mutated Atgcsl gene could be characterized in particular by the phenotype of their seeds which, for a quarter of them, are wrinkled and unable to germinate.

It has also been shown that a mutation in the AtGCSI gene, when present in the homozygous state in the genome, is lethal to the plant.

In addition, it has been shown according to the invention that the glycosylation of proteins expressed in plants in which the expression of the Atgcsl gene is greatly altered, even completely blocked or nonexistent was profoundly modified and that in particular the glycans present at the level glycosylation sites of these proteins were completely devoid of allergenic oligosaccharide residues such as fucose and xylose.

Consequently, the genomic sequence of the Atgcsl gene as well as the nucleotide sequence SEQ ID No. 2 according to the invention are useful in particular for the development of various means intended to inhibit or block the synthesis of glucosidase I encoded by the AtGCSI gene. . The nucleotide sequence SEQ ID No. 2 according to the invention is also useful for the development of various means of specific detection of the Atgcsl gene or of its transcription product, such means of detection allowing the person skilled in the art to determine if a plant of interest contains in its genome a functional AtGCSI gene or on the contrary a mutated Atgcsl gene, it being understood that the detection of the presence of at least one copy of the mutated Atgcsl gene in the genome of a plant makes it possible to select this plant for the production of non-allergenic proteins for humans.

A nucleic acid as defined above codes for at least part of the glucosidase I according to the invention and can in particular be inserted into a recombinant vector intended for the expression of the corresponding translation product in a host cell or in a plant transformed with this recombinant vector.

Such a nucleic acid can also be used for the synthesis of nucleotide probes and primers intended for the detection or the amplification of nucleotide sequences included in genomic DNA, messenger RNA or even the cDNA of the AtGCSI gene in a sample. For the purposes of detection, it is also possible to use nucleic acids of sequence complementary to those defined above.

Also included in the invention are the nucleic acid probes and primers hybridizing, under high stringency hybridization conditions, with a nucleic acid of nucleotide sequence SEQ ID No. 2.

By high stringency hybridization conditions within the meaning of the invention means the following hybridization conditions:

- The DNA test is immobilized on type membranes GenScreenPlus ^® ™ NEN Life Science Product according to the manufacturer's instructions in the presence of 0.4 M NaOH; a night.

- The membranes are washed with a 2 x SSC buffer (1 x SSC ... idem) then are prehybridized at least 30 min at 65 ° C in a hybridization buffer (Buffer: 7% SDS, 0.25M Na ₂ HP0 ₄ , pH 7.4, 2 mM EDTA, 20 mg / l heparin, 0.1 mg / l single-stranded DNA from calf thymus). - Respondents. are added to the membranes and incubated at 65 ° C overnight;

- After the hybridization step, the membranes are washed in a 2 x SSC buffer, 0.5% sarcosyl, 0.2% sodium pyrophosphate for 30 min at 65 ° C - A second washing is carried out in a tapon 0 , 2 x SSC, 0.5% sarcosyl, 0.2% sodium pyrophosphate for 10 min at 65 ° C.

The hybridization conditions described above are suitable for hybridization under high stringency conditions of a nucleic acid molecule with a length of 300 to 400 nucleotides. It goes without saying that the hybridization conditions described above can be adapted as a function of the length of the nucleic acid for which hybridization is sought or of the type of labeling chosen, according to techniques known to those skilled in the art. .

The suitable hybridization conditions can for example be adapted according to the teaching contained in the work of HAMES and HIGGINS (1985) or even in the work of AUSUBEL et al; (1989).

The nucleotide probes or primers according to the invention comprise at least 15 consecutive nucleotides of a nucleic acid according to the invention, in particular of a nucleic acid of sequence SEQ ID No. 2 or of its complementary sequence, of an acid nucleic acid having at least 80% nucleotide identity with the sequence SEQ ID No. 2 or of its complementary sequence or of a nucleic acid hybridizing, under high stringency hybridization conditions, with the sequence SEQ ID No. 2 or its complementary sequence. Preferably, nucleotide probes or primers according to the invention have a length of at least 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive nuciéotides of a nucleic acid according to the invention, in particular nucleic acid of nucleotide sequence SEQ ID No 2, or of a nucleic acid of complementary sequence.

According to another aspect, a probe or a nucleotide primer according to the invention will consist and / or include fragments with a length of 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300 , 400 or 500 consecutive nucleotides of a nucleic acid according to the invention, more particularly of the nucleic acid of sequence SEQ ID No. 2, or of a nucleic acid of complementary sequence.

Examples of primers and primer pairs are, for example, the sequences SEQ ID No. 3 and SEQ ID No. 4, which make it possible to amplify the entire open reading frame of the messenger RNA of the Atgcsl gene.

It can also be primers of sequences SEQ ID No. 5 to SEQ ID No. 15 according to the invention.

A primer or a nucleotide probe according to the invention can be prepared by any suitable method well known to those skilled in the art, including by cloning and action of restriction enzymes or also by direct chemical synthesis according to techniques, such as phosphodiester methods of Narang et al. (1979) or Brown et al. (1979) cited above.

Each of the nucleic acids according to the invention, as well as the oligonucleotide probes and primers described above, can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical or even chemical means.

For example, such markers can consist of radioactive isotopes ( ³² P, ³ H, ³⁵ S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or even ligands such as biotin.

The labeling of a nucleic acid is preferably carried out by incorporating labeled molecules within these nucleotides by extension of primers, or else by adding to the 5 ′ or 3 ′ ends.

Examples of non-radioactive labeling of nucleic acid fragments are described in particular in patent FR 78 19 175 or also in the articles of URDEA et al. (1988), or SANCHEZ-PESCADOR et al.

(1988). Advantageously, the probes according to the invention can have structural characteristics such as to allow amplification of the signal, such as the probes described by URDEA et al;

(1991) or in European patent No. EP 0 225 807 (Chiron).

The oligonucleotide probes according to the invention can be used in particular in Southern hybridizations with genomic DNA, or in hybridizations with messenger RNA of the gene

Atgcsl, when a visualization of the expression of the corresponding transcript is sought in a sample.

The probes according to the invention can also be used for the detection of PCR amplification products or even for the detection of mismatches.

Nucleotide probes or primers according to the invention can be immobilized on a solid support. Such solid supports are well known to those skilled in the art and include surfaces of the microtiter plate wells, polystyrene beads, magnetic beads, nitrocellulose strips or even microparticles such as latex particles.

The present invention also relates to a method for detecting the presence of a nucleic acid of the AtGCSI gene in a sample, said method comprising the steps consisting in:

- contacting a probe or a plurality of nucleotide probes according to the invention with the sample to be tested, capable of containing a nucleic acid of the AtGCSI gene; - detect the hybrid possibly formed between the probe (s) and the nucleic acid present in the sample.

According to a particular embodiment of the detection method according to the invention, the oligonucleotide probe (s) are immobilized on a support.

In another aspect, the oligonucleotide probes include a detectable marker.

The invention further relates to a kit or kit for detecting the presence of a nucleic acid of the AfGCS 7 gene (gDNA, cDNA, mRNA) in a sample, said kit comprising:

a) one or more nucleotide probes, as described above;

b) where appropriate, the reagents necessary for the hybridization reaction.

According to a first aspect, the detection kit or kit is characterized in that the probe or probes are immobilized on a support. According to a second aspect, the detection kit or kit is characterized in that the oligonucleotide probes comprise a detectable marker.

According to a particular embodiment of the detection kit described above, such a kit will comprise a plurality of oligonucleotide probes in accordance with the invention which can be used to detect target sequences of interest of the AtGCSI gene or even to detect mutations in the coding regions of the AtGCSI gene, more particularly in the nucleic acid of sequence SEQ ID No. 2 where a nucleic acid of complementary sequence. The nucleotide primers according to the invention can be used to amplify any nucleotide fragment (gDNA, cDNA, mRNA) of AtGCSI, and more particularly all or part of a nucleic acid of sequence SEQ ID No. 2.

Another subject of the invention relates to a method for the amplification of a nucleic acid of the AtGCSI gene, and more particularly a nucleic acid of sequence SEQ ID No. 2 or a fragment or also a nucleic acid of sequence complementary to the latter, contained in a sample, said method comprising the steps consisting in:

a) contacting the sample in which the presence of the target nucleic acid is suspected with a pair of nucleotide primers according to the invention;

b) performing at least one amplification cycle of the nucleic acid contained in the sample;

c) detecting possibly amplified nucleic acid.

According to the above amplification method, at least one amplification cycle of the nucleic acid contained in the sample is carried out before the detection of the optionally amplified nucleic acid, preferably at least 10, and so quite preferred at least 20, amplification cycles. To implement the above amplification method, advantageously use will be made of any of the nucleotide primers previously described, the hybridization position of which is located respectively on the 5 ′ side and on the 3 ′ side of the region of l target nucleic acid of AtGCSI whose amplification is sought, in the presence of the reagents necessary for the amplification reaction.

The subject of the invention is also a kit or kit for the amplification of a nucleic acid of the AtGCSI gene (gDNA, cDNA or mRNA) according to the invention, and more particularly all or part of a nucleic acid of sequence SEQ ID No. 2, said kit or kit comprising:

a) a pair of nucleotide primers in accordance with the invention;

b) where appropriate, the reagents necessary for the amplification reaction. Such an amplification kit or kit will advantageously comprise at least one pair of nucleotide primers as previously described, the hybridization position of which is located respectively on the 5 ′ side and on the 3 ′ side of the target nucleic acid of the AtGCSI gene, of which amplification is sought.

According to a preferred embodiment, primers according to the invention comprise all or part of a polynucleotide chosen from nucleotide sequences SEQ ID No. 3 and SEQ ID No. 4.

The invention also relates to methods for inhibiting or blocking the expression of the AtGCSI gene in plant tissue cells, for the production of glycosylated proteins by non-allergenic glycans, by suitable techniques well known in the art. skilled in the art.

In order to inhibit or block the expression of the AtGCSI gene in a plant, a person skilled in the art may in particular have recourse to the use of antisense polynucleotides, or even to co-suppression techniques.

Thus, the invention also relates to an antisense polynucleotide capable of specifically targeting a determined region of the AtGCSI gene and more particularly to a determined region of the nucleotide sequence SEQ ID No. 2, capable of inhibiting or blocking its transcription and / or its translation. Such a polynucleotide meets the general definition of probes and primers according to the invention.

According to a first aspect, an antisense polynucleotide according to the invention hybrid with a sequence corresponding to a sequence localized in a region of the 5 ′ end of the messenger RNA of the AtGCSI gene, and very preferably close to the codon translation initiation

(ATG) of the AfGCS7 \ gene

To construct such an antisense polynucleotide, a person skilled in the art may advantageously refer to the cDNA sequence of the AtGCSI gene referenced as the nucleotide sequence SEQ ID No. 2.

According to a second aspect, an antisense polynucleotide according to the invention comprises a sequence corresponding to one of the sequences located at the exon / intron junctions of the AtGCSI gene and preferably to the sequences corresponding to a splicing site, which can be determined according to techniques well known to man of the trade, on the basis of the description of the sequences of the invention, very particularly of the sequences SEQ ID No. 5 and SEQ ID No. 2.

According to a third aspect, an antisense polynucleotide according to the invention comprises all of the cDNA corresponding to the transcript of the AtGCSI gene. Most preferably, an antisense polynucleotide according to the invention comprises the nucleotide sequence SEQ ID No 2, or consists of the sequence SEQ ID No 2.

To synthesize antisense polynucleotides as defined above, a person skilled in the art may refer to the positions of the various exons and introns of the AtGCSI gene in the nucleotide sequence SEQ ID No. 5.

In general, the antisense polynucleotides must have a sufficient length and melting temperature to allow the formation of an intracellular duplex hybrid having sufficient stability to inhibit the expression of the mRNA of AtGCSI.

Strategies for constructing antisense polynucleotides are notably described by GREEN et al. (1986) and IZANT and WEINTRAUB (1984), the content of these two articles being incorporated here by reference.

Methods of constructing antisense polynucleotides are also described by ROSSl et al. (1991) as well as in the applications

PCT No. WO 94/23 026, WO 95/04141, WO 92/18522 and in European patent application No. EP 0 572 287, the content of these documents being incorporated by reference.

Advantageously, an antisense polynucleotide according to the invention has a length of 15 to 4000 nucleotides. An antisense polynucleotide of the invention preferably has a length of 15, 20, 25, 30, 35, 40, 45 or 50 to 75, 100, 200, 500, 1000, 2000, 3000 or 4000 nucleotides.

Among the antisense polynucleotides according to the invention, those having a length of approximately 300 nucleotides or a length of approximately 4000 nucleotides are preferred respectively.

In order to inhibit or block the expression of the AtGCSI gene, it is also possible to use simultaneously a plurality of antisense polynucleotides as defined above, each of the antisense polynucleotides hybridizing with a distinct region of the AtGCSI gene or of its messenger RNA . Other methods of implementing the antisense polynucleotides are for example those described by SCZAKIEL et al. (1995).

The subject of the invention is also any process well known to those skilled in the art making it possible to create modifications, for example one or more additions, deletions or substitutions of at least one nucleotide in the sequence of the AtGCSI gene, such modifications having as a consequence either an inhibition or a blocking of the transcription of the AtGCSI gene, or a defect in the splicing of the messenger pre-RNA, or an inhibition or a blocking of the translation of the mature messenger RNA, in glucosidase I according to l invention, either in the production of a mutated glucosidase 1 having reduced or zero catalytic activity.

Techniques for mutagenesis of the genome sequence of the AtGCSI gene are described, for example, by Hohn and Puchta (1999). A plant whose genome has been modified as described above is capable of synthesizing non-allergenic and / or non-immunogenic glycosylated modified proteins, in particular all of the proteins produced naturally by the plant and intended for human consumption or animals, such as those described by Zeng et al. (1997). In addition, such a plant affected in the expression of the catalytic activity of glucosidase I according to the invention can be used in order to produce specific recombinant proteins which are non-allergenic and / or non-immunogenic and intended for use in humans. or the animal.

Preferably, the plants made deficient in the catalytic activity of glucosidase I according to the invention are used for the production of immunogenic proteins and non-allergenic antigenic proteins intended for the preparation of vaccines for human immunization or animal. Any type of recombinant immunogenic or antigenic peptide or protein can thus be produced by a plant whose AtGCSI gene has undergone at least one addition, deletion or substitution of one or more consecutive nucleotides.

According to another aspect, the N-glycans having undergone a partial maturation process due to the absence, or at a reduced level, of catalytically active glucosidase 1 in plants in which the A.GCS7 gene has been modified as described above. above, and which basically include the structure (Glc ₃ Man ₇ GlcNAc ₂ ) can be used, after separation and purification, as vectors of compounds of therapeutic interest towards specific target cells in mammals and in particular in humans. Indeed, these partially modified glycans have a particular affinity for lectins expressed specifically on the membrane surface of certain cell categories and have already enabled the targeting of antiviral agents to hepatocytes and macrophages (Murray et al., 1987).

According to another preferred embodiment according to the invention, an overexpression of the AtGCSI gene or of its transcription product, or of the protein glucosidase I according to the invention will be sought.

High expression of the AtGCSI gene in a plant can be achieved either by overexpression of the AtGCSI gene, or by the insertion of multiple copies of a polynucleotide coding for glucosidase I according to the invention in the plant, or even by a combination of these two strategies.

For the insertion of multiple copies of a polynucleotide coding for glucosidase I according to the invention into the genome of a plant, use will be advantageously made of a recombinant vector according to the invention. The invention also relates to a recombinant vector comprising a nucleic acid according to the invention.

Advantageously, such a recombinant vector comprises a nucleic acid chosen from the following nucleic acids:

a) a nucleic acid comprising at least 20 consecutive nucleotides of a polynucleotide encoding a glucosidase I having the amino acid sequence SEQ ID No. 1; or a nucleic acid of complementary sequence;

b) a nucleic acid comprising at least 20 consecutive nucleotides of the nucleotide sequence SEQ ID No. 2, or a nucleic acid of complementary sequence; c) a nucleic acid comprising a sequence having at least 80% nucleotide identity with the nucleotide sequence SEQ ID No. 2, or a nucleic acid of complementary sequence;

d) an antisense polynucleotide or a homopurine or homopyrimidine polynucleotide, as defined above, useful for inhibiting the expression of the Atgcsl gene.

By "vector" in the sense of the present invention, is meant a circular or linear DNA or RNA molecule which is either in the form of single strand or double strand.

A recombinant vector according to the invention is either a cloning vector, an expression vector, or more specifically an insertion vector, a transformation vector or an integration vector. It can be a vector of bacterial or viral origin.

According to a first embodiment, a recombinant vector according to the invention is used for the purpose of amplifying the nucleic acid which is inserted therein after transformation or transfection of the desired cellular host.

According to a second embodiment, it is an expression vector comprising, in addition to a nucleic acid coding for a polypeptide in accordance with the invention, in particular the polypeptide of amino acid sequence SEQ ID No. 1, regulatory sequences for directing transcription and / or translation.

In addition, the recombinant vectors according to the invention may include one or more origins of replication in cellular hosts in which their amplification or expression is sought as well as selection markers.

In a particular embodiment, a recombinant vector according to the invention comprises an antisense polynucleotide or a homopurine or homopyridine polynucleotide, as defined above, if necessary placed under the control of appropriate regulatory sequences making it possible to ensure expression thereof. in a selected host cell or plant. Such a recombinant vector is preferably used to inhibit the expression of the Atgcsl gene in the cell or in the plant. According to another particular embodiment, a recombinant vector according to the invention comprises a polynucleotide coding for the ATGCS1 polypeptide or a polypeptide having at least 80% amino acid identity with the latter and retaining the biological activity of ATGCS1, placed under the control of regulatory sequence (s) allowing high level expression of ATGCS1 or its homolog in a host cell or in a chosen plant. Such a recombinant vector is useful for allowing a high level of expression of ATGCS1 in a plant.

According to an advantageous aspect, such a recombinant vector is an integrative vector allowing the insertion of multiple copies of the coding sequence of ATGCS1 in the genome of a plant.

By way of example, the bacterial promoters could be the Lacl, LacZ promoters, the RNA polymerase promoters of bacteriophage T3 or T7, the PR or PL promoters of phage lambda. Promoters for the expression of a nucleic acid encoding a glucosidase I according to the invention in plants are the CaMV 35 S promoter of the cauliflower mosaic virus (Odell et al., 1985) or also the promoter of the actin 1 gene from rice (McEIroy et al. 1990).

One can also use the promoter of FAH (Patent number: Fn ° 9907362) which makes it possible to express a gene in a strong and constitutive way in all the parts of the plant except in the seeds, usable for the strategies sense and antisense, or still inducible promoters of the two-component system (ref McNellis TW et al. 1998, "Glucocorticoid-inducible expression of bacterial avirulence gene in transgenic arabidopsis induces hypersensitive cell death." Plant Journal, 14 (2): 247-257

Other promoters useful for the expression of a polynucleotide of interest in plants are described in patents No. US 5,750,866 and US No. 5,633,363, incorporated herein by reference. In general, for choosing a suitable promoter, those skilled in the art can advantageously refer to the work by Sambrook et al. (1989) cited above or to the techniques described by Fuller et al. (1996), and Ausubel et al. (1989).

The preferred bacterial vectors according to the invention are for example the vectors pBR 322 (ATCC No. 37017) or also vectors such as pAA223- 3 (Pharmacia Uppsala, Sweden) and pGEMI, pBSSK and pGEM-T (Promega Biotech, Madison, WU, USA) and pUC19 (marketed by Boehringer Mannheim, Germany).

Mention may also be made of other commercial vectors such as the vectors pQE70, pQE60, pQE9 (Qiagen, psuX 174, pBluescript SA, pNH8A, pMH16A, pMH18A, pMH46A, pWLNEO, pSG2CAT, pOG44, pXTI, pSG (Stratagene).

They can also be baculovirus type vectors such as the vector pVL1392 / 1393 (Pharmingen) used to transfect the cells of the line Sf9 (ATC No. CRL 1711) derived from Spodoptera frugidera.

Preferably, use will be made of vectors specially adapted for the expression of sequences of interest in plant cells, such as the following vectors:

• vector pBIN19 (Bevan et al., Nucleic Acids Research,

Vol. 12: 8711-8721, marketed by Clontech, Palo Alto, California, USA);

• vector pB101 (Jefferson 1987, Plant Molecular Biology Reporter, vol. 5: 387-405, sold by the Clotench company);

• vector pBH21 (Jefferson et al. 1987, Plant Molecular Biology Reporter, vol. 5: 387: 405, sold by the Clotench company);

• vector pEGFP (Cormack BP et al., 1996, marketed by the

Clotench Company);

• vectors pAOV, pOV2, pSOV, pSOV2, pkMB and pSMB (Mylne et al., 1996).

To allow the expression of the polynucleotides according to the invention, these vectors must be introduced into a host cell. The introduction of the polynucleotides according to the invention into a host cell can be carried out in vitro, according to techniques well known to those skilled in the art for transform or transfect cells, either in primary culture or in the form of cell lines.

The invention further relates to a host cell transformed with a nucleic acid or with a recombinant vector according to the invention. Such a transformed host cell is preferably of prokaryotic or eukaryotic origin, in particular bacterial, fungal or vegetable origin.

Thus, in particular, bacterial cells of different strains of E. coli or of Agrobacterium tumefaciens can be used.

Preferably, the transformed host cell is a plant cell or also a plant protoplast.

Most preferably, it is a cell or a protoplast of rapeseed, tobacco, corn, barley, wheat, alfalfa, tomato, potato, banana or of Arabidopsis thaliana.

The invention also relates to a transformed plant multicellular organism, characterized in that it comprises a transformed host cell or a plurality of host cells transformed with a nucleic acid according to the invention or with a recombinant vector according to the invention.

According to a first aspect, the plant multicellular organism is transformed with one or more antisense nucleotides and / or one or more homopurine or homopyrimidine polynucleotides in order to inhibit or block the expression of the AtGCSI gene in this organism.

According to a second aspect, the plant multicellular organism is transformed with one or more copies of a polynucleotide coding for glucosidase I according to the invention or for a polypeptide having at least 80% amino acid identity with glucosidase I and retaining the biological activity allowing the normal maturation of the glycans attached to the glycosylation sites of the proteins being synthesized.

The subject of the invention is also a transgenic plant, that is to say a transformed plant comprising, preferably in a form integrated into its genome, a nucleic acid of the Atgcsl gene and preferably an antisense polynucleotide or also a nucleic acid coding for the ATGCS1 polypeptide or a homologous polypeptide, said nucleic acid having been inserted into the genome of the plant by transformation with a nucleic acid of AtGCSI or a recombinant vector according to the invention. Preferably, a plant transformed according to the invention is rapeseed, tobacco, corn, soybeans, wheat, barley, alfalfa, tomato, potato, a fruit plant such as banana or Arabidopsis thaliana. According to a first aspect, the transgenic plants as defined above exhibit reduced expression, undetectable expression or absence of expression of the AtGCSI gene and are thus capable of allowing the production of proteins with modified glycosylation and non-allergens and / or not immunogenic for humans or animals. According to a particular embodiment, such plants synthesize a protein of interest whose coding sequence has been introduced artificially, this coding sequence possibly being in a form not integrated into the genome of the plant, or on the contrary in a form integrated into the plant genome. The protein of interest can be of any kind, preferably a protein intended for food or for human or animal therapy, in particular immunotherapy or vaccination.

The invention thus also relates to a modified glycosylation protein, characterized in that it is produced by a plant transformed according to the invention, or also by a host cell transformed according to the invention, in which the expression of the AtGCSI gene is inhibited or blocked, or characterized in that it is contained in a seed of a plant transformed according to the invention. Preferably, the modified glycosylation protein is a recombinant protein. It may be a recombinant protein intended for food or for human or animal therapy. Such a recombinant protein can be an antigen or an immunogen useful in a vaccine composition.

The invention also relates to the addition of one or more N-glycosylation site (s) in a recombinant protein of interest in order to modify its targeting and / or its stability, in plant cells, plant tissue or a plant transformed according to the invention.

According to a second aspect, the transgenic plants as defined above have the property of strongly expressing a glucosidase I according to the invention. The subject of the invention is also a process for obtaining a transgenic plant transformed with a nucleic acid according to the invention, characterized in that it comprises the following steps:

a) obtaining a transformed plant host cell as defined above;

b) regeneration of an entire plant from the transformed plant host cell obtained in step a);

c) selection of the plants obtained in step b) having integrated the nucleic acid of interest.

The invention also relates to a process for obtaining a transgenic plant, transformed with a nucleic acid according to the invention, characterized in that it comprises the steps consisting in:

a) transforming a plant cell with a nucleic acid of the AtGCSI gene or with a recombinant vector according to the invention;

b) regenerating an entire plant from transformed plant cells obtained in step a);

c) select the plants having integrated the nucleic acid of the AtGCSI gene of interest.

The invention also relates to a process for obtaining a transformed plant, characterized in that it comprises the following steps:

a) obtaining a host cell of Agrobacterium tumefaciens transformed with a nucleic acid or a recombinant vector according to the invention;

b) transformation of the chosen plant by infection with Agrobacterium tumefaciens cells obtained in step a); c) selection of plants having integrated the nucleic acid according to the invention.

Any of the methods for obtaining a transgenic plant described above can also comprise the following additional steps:

d) crossing between them of the two transformed plants as obtained in step c);

e) selection of heterozygous plants for the transgene.

According to another aspect, any of the methods described above may further comprise the following steps:

d) crossing a transformed plant obtained in step c) with a plant of the same species;

e) selection of the plants resulting from the crossing of step d) having conserved the transgene.

A person skilled in the art is capable of implementing numerous methods of the state of the art in order to obtain plants transformed with a nucleic acid of the AtGCSI gene according to the invention. Those skilled in the art may advantageously refer to the technique described by BECHTOLD et al. (1993) in order to transform a plant using the bacterium Agrobacterium tumefaciens.

The techniques used in other types of vectors can also be used such as the techniques described by BOUCHEZ et al. (1993) or by HORSCH et al. (1984).

Those skilled in the art can also refer to the technique described by Gomord et al. (1998).

The invention further relates to a transformed plant as obtained according to any one of the production methods described above. The invention also relates to a plant seed, part or all of the constituent cells of which comprise a nucleic acid of the AtGCSI gene according to the invention which has been artificially inserted into their genome. The invention also relates to a seed of a transgenic plant as defined above.

The invention also relates to a plant cell comprising a nucleic acid of the AtGCSI gene. Preferably, the nucleic acid of the AtGC1 gene is in a form integrated into the genome of said plant cell.

The invention also relates to a plant tissue consisting of a set of transformed plant cells as defined above.

Another subject of the invention consists in the use of a nucleic acid of the AtGCSt gene according to the invention for the expression in vitro or in vivo, preferably in planta, of glucosidase I according to the invention or of a peptide fragment thereof.

The invention also relates to the use of an antisense nucleic acid according to the invention for inhibiting or blocking the expression of the gene coding for glucosidase I according to the invention. Preferably, the above uses are characterized in that it is an expression in vivo in a plant transformed with such a nucleic acid.

The invention also relates to the use of an antisense nucleic acid according to the invention for inhibiting or blocking the expression in vitro or in vivo of the gene coding for glucosidase I according to the invention, and very particularly glucosidase I having the amino acid sequence SEQ

ID # 1.

The antisense nucleic acid or the homopurine or homopyrimidine nucleic acid is preferably used to inhibit or block the expression of the AtGCSI gene in vivo, in the plant transformed with such a nucleic acid.

The glucosidase I according to the invention having the amino acid sequence SEQ ID No. 1 has a length of 852 amino acids. This protein has a calculated molecular weight of 97.5 kDa. After analyzing the sequence, the Applicant has identified a hydrophilic region containing several arginines including the N-terminal part of the polypeptide of sequence SEQ ID No. 1, this hydrophilic region containing the consensus signal for retention in the endoplasmic reticulum of type II membrane proteins, the C end of which -terminal is in the lumen.

This hydrophilic region consists of the region ranging from the amino acid in position I to the amino acid in position 38 of the amino acid sequence SEQ ID No. 1.

The glucosidase 1 according to the invention also comprises a hydrophobic region corresponding to a transmembrane domain, this hydrophobic region ranging from the amino acid in position 38 to the amino acid in position 17 of the amino acid sequence SEQ ID No. 1.

The glucosidase I according to the invention comprises a unique site for attachment to the localized glycan from the amino acid in position 598 to the amino acid in position 606 of the amino acid sequence SEQ ID No. 1. A unique glycosylation site has also been identified, which extends from the amino acid at position 662 to the amino acid at position 664 of the amino acid sequence SEQ ID No. 1.

In addition, the glucosidase I according to the invention comprises a large hydrophilic region, probably localized in the lumen of the endoplasmic reticulum, extending from the amino acid at position 68 to the C-terminal amino acid at position 852 of the amino acid sequence SEQ ID No. 1.

As already mentioned, the applicant has shown that mutations in the sequence of the AtGCSI gene coding for glucosidase I of sequence SEQ ID No. 1 according to the invention lead to the absence of glucosidase I activity in the plant thus mutated and simultaneously to the expression of a modified glycosylation phenotype in the proteins produced by this mutated plant. According to another aspect, the invention also relates to a polypeptide encoded by a nucleic acid of the AtGCSI gene, and preferably a polypeptide comprising at least 7 consecutive amino acids of glucosidase I of amino acid sequence SEQ ID No. 1.

Preferably, such a polypeptide comprises at least 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, or 800 consecutive amino acids of the ATGCS1 polypeptide of amino acid sequence SEQ ID N ° 1

The invention also relates to a polypeptide comprising the amino acid sequences having at least 80% amino acid identity with the sequence of the ATGCS1 SEQ ID No. 1 polypeptide, or to a peptide fragment of the latter.

Advantageously, part of the invention is a polypeptide having at least 60%, 80%, 85%, 90%, 95% or 99% of amino acid identity with the sequence of the ATGCS1 polypeptide of sequence SEQ ID No. 1, or a peptide fragment thereof.

In general, the polypeptides according to the invention are in an isolated or purified form.

The invention also relates to a process for the production of the ATGCS1 polypeptide of sequence SEQ ID No. 1, or a peptide fragment of the latter.

A preferred process for the production of the ATGCS1 polypeptide of sequence SEQ ID No. 1, the following steps consisting in:

a) inserting a nucleic acid coding for the ATGCS1 polypeptide or a peptide fragment thereof, into an appropriate vector;

b) cultivating, in an appropriate culture medium, a host cell previously transformed or transfected with the recombinant vector of step a);

c) recovering the conditioned culture medium or lysing the transformed host cell, for example by sonication or by osmotic shock;

d) separating and purifying from the culture medium or from the cell lysates obtained in step c), said polypeptide;

e) where appropriate, characterize the recombinant polypeptide produced.

The peptides according to the invention can be characterized by fixation on an immunoaffinity chromatography column on which the antibodies directed against these polypeptides in which a fragment or a variant thereof has been immobilized beforehand.

According to another aspect, a recombinant polypeptide according to the invention can be purified by passage through a chromatography column according to the methods known to those skilled in the art and described for example by AUSUBEL F. et al. (1989) cited above.

A polypeptide according to the invention can also be prepared by conventional techniques of chemical synthesis either in homogeneous solution or in solid phase. As an illustration, a polypeptide according to the invention could be prepared by the technique in homogeneous solution described in HOUBEN WEYL (1974) or also the technique of synthesis in solid phase described by MERRIFIELD (1965a, 1965b).

Also part of the invention are polypeptides called "homologous" to ATGCS1 polypeptides, or their fragments.

Such homologous polypeptides have amino acid sequences having one or more substitutions of an amino acid with an equivalent amino acid, relative to the reference polypeptide.

The equivalent amino acids according to the present invention will be understood, for example the replacement of a residue in the L form with a residue in the D form or else the replacement of a glutamic acid (E) by a pyro-glutamic acid according to techniques well known to those skilled in the art.

By way of illustration, the synthesis of peptides containing at least one residue in the D form is described by KOCH et al. (1977).

According to another aspect, two amino acids belonging to the same class are also considered to be equivalent amino acids, that is to say two acid amino acids, basic, non-polar or even uncharged polar. Also part of the invention is a polypeptide comprising amino acid modifications of 1, 2, 3, 4, 5, 10 to 20 substitutions, additions or deletions of an amino acid with respect to the amino acid sequence of the ATGCS1 polypeptide according to the invention.

Preferably, the polypeptides according to the invention comprising one or more additions, deletions, substitutions of at least one amino acid retain their ability to catalyze the cleavage of the first glucose residue of the structure precursor Λ / -glycan (Glc ₃ Man _g GlcNAc ₂ ), which can be easily determined by a person skilled in the art, for example using the techniques described by Sambrook and al., (1989). According to another preferred embodiment, the polypeptides according to the invention comprising one or more additions, deletions, substitutions of at least one amino acid retain their ability to be recognized by antibodies directed against the ATGCS1 polypeptide of sequence SEQ ID No. 1. The invention also relates to a nucleic acid coding for a polypeptide as defined above.

A polypeptide derived from the ATGCS1 protein is useful in particular for the preparation of antibodies intended for the detection of the presence of this polypeptide or of a peptide fragment of the latter in a sample.

In addition to detecting the presence of the ATGCS1 polypeptide or of a peptide fragment of the latter in a sample, antibodies directed against these polypeptides are used to quantify the synthesis of glucosidase I, for example in the cells of a plant, and thus determining the capacity of this plant to synthesize mature glycans at the glycosylation sites produced by the cells of said plant.

Preferred antibodies according to the invention are the antibodies specifically recognizing the amino acid sequence ranging from the amino acid in position 1 to the amino acid in position 38 (N-terminal hydrophilic region) of the sequence of the ATGCS1 polypeptide with sequence SEQ ID N ° 1.

A second class of preferred antibodies according to the invention are the antibodies specifically recognizing the amino acid sequence ranging from the amino acid at position 39 to the amino acid at position 67 (transmembrane domain) of the sequence of the ATGCS1 polypeptide of SEQ ID N ° 1.

A third class of preferred antibodies according to the invention are antibodies which specifically recognize the amino acid sequence ranging from the amino acid at position 68 to the amino acid at position 852 (region hydrophilic comprising the catalytic site) of the ATGCS1 polypeptide of sequence SEQ ID No. 1.

A fourth class of preferred antibodies according to the invention are the antibodies specifically recognizing the glycan binding site of the ATGCS1 protein, and more particularly those recognizing a peptide of sequence "ERHVDLRCW".

By “antibody” within the meaning of the present invention, is meant in particular polyclonal or monoclonal antibodies or fragments

(for example fragments F (ab) ' ₂ , F (ab) or also any polypeptide comprising a domain of the initial antibody recognizing the polypeptide or the fragment of target polypeptide according to the invention.

Monoclonal antibodies can be prepared from hybridomas using the technique described by KOHLER and MILSTEIN (1975).

The present invention also relates to antibodies directed against a polypeptide as described above or a fragment or a variant thereof, as produced in the triome technique or also the hybridoma technique described by KOZBOR et al. (1983).

The invention also relates to fragments of single chain Fv antibody (ScFv) as described in US Patent No. 4,946,768 or by MARTINEAU et al. (1998).

The antibodies according to the invention also include fragments of antibodies obtained using phage libraries (RIDDER et al., 1995), REINMANN K.A. et al., 1997).

The antibody preparations according to the invention are useful in immunological detection tests intended for the identification of the presence and / or of the amount of glucosidase I according to the invention or of a peptide fragment of this protein, present in a sample.

An antibody according to the invention may also comprise an isotopic or non-isotopic detectable marker, for example fluorescent, or else be coupled to a molecule such as biotin, according to techniques well known to those skilled in the art.

Thus, the subject of the invention is also a method for detecting the presence of a plant glucosidase I or also of a peptide fragment of one of these polypeptides according to the invention, in a sample, said method comprising the stages consisting of: a) bringing the test sample into contact with an antibody as defined above;

b) detecting the antigen / antibody complex formed.

The invention also relates to a diagnostic kit or kit for detecting the presence of a polypeptide according to the invention in a sample, said kit comprising:

a) an antibody as defined above; b) if necessary, a reagent necessary for the detection of the antigen / antibody complex formed.

The invention is further illustrated, without being limited, by the following figures and examples.

FIG. 1 illustrates gel electrophoresis of proteins extracted from Arabidopsis thaliana seed cells of wild type (wild Ws ecotype) and of ecotype seed cells in which the AtGCSI gene has been interrupted by the insertion of a sequence T-DNA from

Agrobacterium tumefaciens (M), also from the Ws ecotype.

Gel No. 1 on the left is an SDS-PAGE electrophoresis gel on which the proteins which have migrated have been stained using silver nitrate. Gel No. 2 was incubated in the presence of an anti-xylose antibody. Gel No. 3 was incubated in the presence of an anti-fucose antibody.

Gel No. 4 was incubated in the presence of concanavalin A. Figure 2. HPAEC-PAD chromatograms of N-glycans released from wild seeds (A) and the mutant atgcsl (B) by treatment with Endo H. The numbers 5 to 9 refer to the structures of the oligomannosidic N-glycans Man ₅ GlcNAc to MangGlcNAc represented in Table 1.

Figure 3: MALDI-TOF mass spectra of N-glycans isolated from wild seeds (Fig. 3A) and from seeds carrying the mutated AtGCSI gene (Fig 3B). On the abscissa, value m / z representing the mass / load ratio. EXAMPLE 1 Isolation of the cDNA Encoding Glucosidase I from Arabidopsis thaliana

1. Extraction of RNA from different plant tissues

The total RNA of 8-day-old seedlings is extracted using the RNeasy Plant Minikit kit from QUIAGEN (Germany), according to the protocol provided by the manufacturer. A DNA degradation step was systematically carried out on the extraction column (RNase free DNase, QIAGEN, Germany), according to the manufacturer's instructions. All the manipulations are carried out with Rnase-free material and DEPC water is used (0.1% of diethyl pyrocarbonate autoclave after stirring for 12 hours).

8-day-old seedlings cultivated in vitro are removed and directly put in liquid nitrogen and stored at -80 ° C, until extraction. The pipettes and the material used for the extraction of the RNAs are previously treated with 0.4M sodium hydroxide to destroy any RNases. The water is treated with DEPC (1 ml of DEPC in 11 of water, homogenization overnight under a fume cupboard), then autoclaved to remove this agent. Centrifugations in a column plus collecting tube are carried out in a "Centaur" type centrifuge (MSE, UK). The plant material is ground in liquid nitrogen, in

Eppendorfs sterile using an electric grinder. The ground material is immediately immersed in liquid nitrogen after grinding. The actual extraction is carried out with the "RNAeasy Plant Mini Extraction Kit", (QIAGEN, Germany). Briefly, 450 μl of the "RLT" lysis buffer supplemented with β-mercaptoethanol (10 μl / 1 ml) are vortexed with 100 mg of ground tissue.

The following steps are exactly those described in the kit manual provided by QUIAGEN. The lysate, placed in a column and its 2 ml collecting tube, is centrifuged for 2 min. The filtrate is collected and washed with 0.5 volume of 96-100% ethanol.

The sample is then placed on a column and its 2 ml collecting tube to be centrifuged for 15 sec at 10,000 rpm, the RNAs are retained by the column. 350 μl of RW1 washing buffer are added to this column to wash the RNAs by centrifugation for 15 sec at 10,000 rpm. A DNase treatment is then carried out (10 μl of Dnase and 70 μl of buffer, QIAGEN) for 15 min at room temperature. Wash buffer RW1 (350μl) is again applied to complete the wash. The column is then installed in a new 2ml collecting tube and two successive washes are carried out with 500 μl of the RPE washing buffer added with ethanol. Finally, the RNAs are eluted from the column with 30 to 50 μl of water treated with DEPC after a centrifugation for 1 min at 10,000 rpm. The RNAs are stored at -80 ° C.

2. Reverse PCR (Reverse Transcriptase-PCR)

The cDNAs, single strands, as well as the amplification products are obtained with the "Enhanced avian RT-PCR kit" system (SIGMA, USA). The reverse transcription takes place under the following conditions: - 10 μl of the RNA extraction

- 1 μl of a mixture of deoxynucleotides

- 1 μl of oligonucleotide dT - 4.5 μl H2O (qsp16.5 μl) for 10 min at 70 ° C., to denature the RNAs, are then added thereto:

- 2μl of 10X AMV-RT buffer

- 1 μl of the Enhancer avian RT enzyme

- 0.5μl of Rnase inhibitor

The mixture is incubated for 15 min at 25 ° C. to allow the hybridization of the oligonucleotide dT, and then the retrotranscription is carried out for 50 min at 42 ° C. The synthesized cDNAs are then amplified by PCR.

The PCR reaction was carried out on a thermocycler (MJ Research PTC100 -96, Prolabo, France), in 0.2 ml tubes (Prolabo, France) containing the following mixture:

- 2μl / 20μl of the RT product

- 5U of enzyme PfuTurbo ™ AD Polymerase (Stratagene, USA)

- 10μl 10x Pfu buffer

- 4μl 5mM dNTP (GIBCO BRL, Scotland) - 2μl of each 10μM oligonucleotide (GENSET, France). qs 100 μl H2O

Oligonucleotides specific for AtGCSI were chosen to amplify the coding sequence. This is "ATG"

(5'ATGACCGGAGCTAGCCGTCG) and "F0" (5'AAGTTTCGTTCCCGAAGAGG), located respectively on the putative ATG and 30 bp downstream of the putative stop of T1F15.4.

The reaction was carried out under the following conditions:

1 initial denaturation step at 94 ° C for 3 min then 35 cycles, each cycle being composed of the following steps:

- 94 ° C: 30 sec

- 60 ° C: 1 min

- 72 ° C: 3 min - an elongation step at 72 ° C for 10 min

EXAMPLE 2 Identification of the AtGCSI gene

The identification of the interrupted atgcsl gene was carried out by isolating the genomic borders of the T-DNA originating from the A. thalmiana atgcsl ecotype (insertion mutant), by the “walking by PCR” technique ( walk-PCT) described by Devic et al. (1997).

The sequences of the DNA fragments thus cloned were compared with those contained in the databases. These sequences have a very strong similarity with the T1F15 bac sequence from the DNA library of Arabidopsis thaliana TAMU and listed in the database.

Gen Bank under the reference AC004393.

The DNA insert of Arabidopsis thaliana contained in the T1 F15 tray is a portion of chromosome 1 and has been mapped as being between the positions cM98 and cM99 of chromosome 1, that is to say on a region of the chromosome 1 at the opposite end of the centromere.

A second fairly strong similarity of around 66% in nucleotide identity was also identified with the DNA insert of Arabidopsis thaliana contained in BAC F3I6 from the IGF library. The tray F316 insert a also been mapped on chromosome 1, between positions cM30 and cM40.

The exact intron / exon structure of the Atgcsl gene could be established by aligning the cDNA sequence with that of the genomic clone listed in the Gen Bank database under the reference AC004393. Differences should be noted compared to the predicted coding sequence of the T1 F15.4 gene in the databases. The Atgcsl gene actually has 22 exons and 21 introns. Exons n ° 4 and 16 have been added and exons n ° 5, 6, 15 and 17 shortened compared to the base predictions. The AG splice sites at the end of the intron and GT at the start are found each time, except for the ninth intron which begins with GC. There are also some point differences. They may be due to the difference in ecotypes used to make the BAC bank (Columbia) and or to amplify the cDNA (Wassilevskija).

Example 3: Analysis of the structure of the glucosidase I of Arabidopsis thaliana encoded by the AtGCSI gene.

1. Sequence similarities with other real or putative glucosidases. The AtGCSI protein has a size of 852 amino acids and an estimated molecular mass of 97.5 kDa. This corresponds well to the data in the bibliography, the glucosidases I purified up to now having a molecular mass of between 85 and 95 kDa. (Pukazhenthi et al., 1993) Based on this new protein sequence, research on databases has been deepened. The table below shows the similarity between the AtGCSI proteins and the already characterized glucosidases I.

The percentages of identity (38%) and similarity (54%) obtained between the sequence of AtGCSI and the human protein are insufficient to conclude that the glucosidase I activity of AtGCSI. The percentages of identity and similarity were obtained using DNA STRIDER T'M 1.3 software.

2. Comparison with peptide fragments of a purified vegetable glucosidase I

Glucosidase I from bean seedlings (Vigna radiata, Zeng and

Albein, 1998), was purified and the sequencing of four peptides was carried out. The sequences of these four peptides align with the protein sequence of ATGCS1 and human glucosidase I.

peptide 1 NYQQSGFLWEQYDQIK

ATGCS1 810 NYYETGYIWEQYDQVK peptide3 DFG.QVLVDIGM

MAN 800 QYQATGFLWEQYSDRD ATGCS1 168 DYGRQELVEND

MAN 155 SFGRQHIQDGAL peptide 2 SLLWTNYGLR peptide4 EDIGDWQLRFK

ATGCS1 741 SILWSDYGLV ATGCS1 253 EDVGDWQIHLK

MAN 719 RHLWSPFGLR MAN 178 QHGGDWSWRVT The peptide 1 identified in the bean makes it possible to find in the databases the homologous sequence in Arabidopsis. However, these data alone are not sufficient to demonstrate that the gene thus identified (T1 F15.4) codes for the functional homolog of bean glucosidase I. This data is of the same level as the indications of the databases on T1 F15.4 (putative gene), which moreover do not make it possible to obtain the true coding sequence.

3. Reason for retention in the endoplasmic reticulum

Glucosidase I is a type II membrane protein (the C-terminal end is in the lumen), and should have, like the proteins located in the lumen, a consensus signal of retention in the RE of the type: two arginines in the first AA in N-Term (Shϋtze ef al., 1994). The N-terminal protein sequence (MTGASRR), has two arginines in the first amino acids, (for humans, the sequence begins with: MARGER).

4. Hydrophobicity profile

A hydrophilic zone extends from residues 1 to 38, which could correspond to the cytoplasmic domain of the human protein (1 to 39). Then a hydrohobe domain extends to AA 67, which corresponds to the transmembrane domain of the human protein (39 to 5). The rest of the protein is quite hydrophilic, the part that is probably in the lumen.

5. N-glycosylation site

The glucosidases I characterized at the biochemical level all present a unique site of N-glycosylation, which is found in an equivalent position in the human protein (NHT 657-659), and in the Arabidopsis protein (NHT 662-664).

6. Site for attachment to the substrate

The glycan binding site has been described in the human protein as the peptide ERHLDLRCW (Romaniouk and Vijay, 1997). This peptide is located in position 594. In the ATGCS1 protein, there is a similar peptide (ERHVDLRCW) in position 598. EXAMPLE 4: Analysis of the tissues and seeds of Arabidopsis thaliana plants, the AtGCSI gene of which is interrupted by the T-DNA of Airobacterium tumefaciens,

Preliminary observations have shown that, up to the heart stage of the embryo, one cannot observe phenotypic differences between the seeds. Then wild and heterozygous embryos (which are identical) differentiate and continue their development, while the plant homozygous for the mutation on the Atgcsl gene remains in the heart stage and increases in volume. The mutated plant absolutely does not differentiate, its hypocotyle is very small, its cotyledons and its root are not elongated. The sections made during the development of the embryo in the mutant plant show that the endosperm is cellularized normally. The cells appear larger and less numerous than those of the wild plant of an identical age, especially at the level of the outermost layer, the protoderm. In the mature homozygous embryo, one can distinguish vascular bundles in the reduced hypocotyle and a small apical meristem. The epidermis is very altered, the cells are huge and have "empty" spaces. The radicle seems very little developed, it is absolutely not differentiated.

A transmission electron microscopy approach made it possible to better visualize the disorganization of the cells of the homozygous mutant. Observations were made in the cotyledons and in the protodermis. Protein bodies in the wild, non-mutated plant have organized, circular structures with sparse areas. We can visualize 2 to 5 per cell. Lipid bodies fill the entire cell, a nucleus can be observed in each cell. In the mutant plant, the lipid bodies are not altered, they are present in large numbers and fill almost the entire cell. Protein bodies, on the other hand, are altered. They are not present in all cells, and when one can be observed, it is not circular and usually surrounds a vacuole. In each cell there are one or more vacuoles, with more or less dense content, which is never observed in the wild non-mutated plant. EXAMPLE 5 Biochemical analysis: demonstration of the absence of glucosidase 1 activity in the seeds of the plant mutated on the Atgcsl gene. 5.1. Materials and methods.

The methods used are described in Fichette-Lainé et al., (1998) Methods in Biotechnology 3: 271-290.

Protein electrophoresis

The extraction and transfer of proteins from the electrophoresis gel onto a nitrocellulose membrane (Schleicher & Schuell, BA 85, 0.45 μm) is carried out according to the technique described by Towbin et al. (1979, Proc. Natl. Acad. Sci. USA, 76: 4350-4354). During the electrophoresis, the material used for the transfer (nitrocellulose membrane, Whatmann 3 MM paper, scotch brite) is balanced 15 to 30 min in the transfer buffer (Tris 25 mM; glycine 120 mM; methanol 10%). At the end of the electrophoresis, the transfer cassette is placed in a transfer tank containing 600 ml of the buffer described above. A satisfactory transfer of the proteins from the electrophoresis gel to the nitrocellulose membrane is obtained in 2 h under an electrophoretic field of 10 V.cm ⁻¹ . A control of the efficiency of the transfer is carried out by reversible staining of the nitrocellulose membrane with Ponceau S red (1% (w / v) in TCA 3%) Discoloration of the nitrocellulose membrane after treatment with Ponceau S red is obtained after rinsing with a TBS buffer (500 mM NaCl; 20 mM Tris-HCl , pH 7.4) All these steps for treating the nitrocellulose membrane, called the imprint after transfer, are carried out with gentle stirring at room temperature.

immunodetection

Once the membrane is balanced in the TBS, the nitrocellulose coupling sites still available after the transfer of the proteins are saturated by an incubation of one hour in a saturation solution. (3% gelatin dissolved in TBS buffer). After saturation of the membrane, the proteins are immunodetected. The impression is incubated for 90 min in the presence of a polyclonal rabbit immunum diluted to 1/1000 ^th in a solution of gelatin at 1% (w / v) in TBS buffer. After this incubation, the unbound antibodies are removed by a series of 4 washes of 15 min in TTBS buffer (TBS buffer + 0.1% Tween 20). The impression is then subjected to an incubation in the presence of a second antibody coupled to horseradish peroxidase (goat IgG, anti-rabbit IgG, coupled to horseradish peroxidase, Bio-Rad). This second antibody is diluted 1/3000 ^ee in a 1% (w / v) gelatin solution in TBS buffer for 90 min. The excess of second conjugated antibody is removed by 4 washes of 15 min in TTBS buffer. Tween 20 is removed at the end of the treatment by washing the impression in the TBS buffer for 15 min. The proteins recognized by the rabbit IgG immunoglobulins are revealed by incubating the membrane in a mixture containing 30 mg of 4-chloro-1-naphthol (HRP color reagent, Bio-Rad) dissolved in 10 ml of methanol and added with 50 ml. of TBS buffer containing 30 μL of H ₂ O ₂ 30%.

Affinodetection of proteins on a membrane by concanavalin A.

Concanavalin A (ConA) is a lectin from the legume seed Canavalia ensiformis which specifically recognizes β-linked mannose residues of oligomannosidic glycans associated with proteins and also peroxidase. Once the membrane is balanced in the TBS, the nitrocellulose coupling sites still available after the transfer are saturated by an incubation of at least one hour in TTBS buffer. The membrane is then incubated for 90 min in TTBS buffer supplemented with salts (CaCl ₂ 1 mM, MgCl ₂ 1 mM) for the activation of the lectin and containing 25 microg x mL ^"1 ConA (Sigma) After this incubation. , the membrane is washed by 4 baths of 15 min in TTBS supplemented with salts, in order to remove the ConA which is not fixed or fixed at non-specific sites The membrane is then incubated for 60 min in TTBS supplemented with salts in the presence of 50 μg.mL ^"1 of horseradish peroxidase. The excess peroxidase is removed by 4 successive washes of 15 min in TTBS supplemented with salts. Washing the imprint in TBS buffer supplemented with salts allows the elimination of Tween 20. The revelation of the peroxidase activity is carried out as described for the immunoetection.

5.2. Results

Analysis of the N-glycosylation of proteins in homozygous seeds was carried out and the results obtained are presented in FIG. 1. The detection of the precursors: the N-glycans, was carried out by concanavalin A: it is a lectin which specifically binds to unripe glycans. Many additional bands appear in the mutant, so there is a strong accumulation of precursors. The detection of complex oligosaccharides is carried out using anti-xylose and anti-fucose antibodies; all the bands disappear in the mutant, there is no complex N-glycan. The mutated plant is therefore clearly affected in the maturation of N-glycans, at the level of glucosidase 1.

The above results clearly illustrate that the Atgcsl mutant is incapable of catalyzing the addition reaction of a xylose residue in position β 1-2 or a fucose residue in position α 1-3 on the glycans of the glycoproteins that he produces.

In addition, the profile of the glycoproteins presenting the oligomannosidic type glycans (imprint 4) is strongly modified in the mutant.

Example 6: Analysis of glycans attached to proteins synthesized in plants mutated on the AtGCSI gene.

6.1 Materials and Methods

Preparation of N-glycans from Arabidopsis thaliana seeds:

Crude protein extracts were obtained by grinding 100 mg of A. seeds. thaliana in 10 mL of 50 mM Hepes buffer, pH 7.5 containing 2 mM sodium bisulfite and 0.1% SDS. The insoluble material was removed by centrifugation and then the proteins were precipitated by the addition of two volumes of ethanol at -20 ° C. The base has then heated for 3 min in 2 mL of 50 mM Tris HCl buffer pH 7.5 containing 0.1% SDS. After the solution had cooled, 0.1 U of Endo H was added and the solution was incubated for 18 h at 37 ° C. The N-glycans were then purified by successive elutions on columns C18 (Bond Elut), of AG 50W-X2 and of carbograph as described previously in the literature (Bardor et al., 1999).

HPAE-PAD chromatography

HPAE-PAD chromatographies were performed on a device

Dionex DX500 equipped with a GP50 pumping system, an ED40 detector and a Carbopac PA1 column (4.6x250 mm). The N-glycans were eluted by means of a linear gradient of 60 min ranging from 0 to 200 mM of sodium acetate in 100 mM sodium hydroxide.

MALDI-TOF mass spectrometry The MALDI-TOF mass spectrum were recorded on a Micromass Tof spec E device. The spectra were performed in positive and reflectron mode with an acceleration voltage of 20 kV, a pressure of 10 ^"7 mbar in the source and 10 ^"6 mbar in the analyzer. The nitrogen laser was set to 337 nm with a pulse duration of 4 ns. The device was calibrated with substance P (1347.7 Da) and human adrenocorticotropic hormone (2465.2 Da). The solution containing the sample was prepared at an approximate concentration of 10 pmole.μL ^"1 in water. Two μL of this solution were dissolved in the same volume of a matrix solution obtained by dissolving 2 mg d 5.5-dihydroxybenzoic acid in 200 μL of 70% acetonitrile containing 0.1% TFA The matrix sample mixture was then homogenized then deposited on the target and dried under vacuum.

Abbreviations: Endo H, endoglycosidase F / HPAEC-PAD, High pH Anion Exchange Chromatography with Pulsed Amperometric Detection / MALDI- TOF, Matrix-Assisted Laser Desorption lonization-Time of Flight / 6.2 Results

The N-glycans were released from the protein extracts of seeds by treatment with Endo H. This endoglycosidase specifically cleaves the glycosidic bond between the two GIcNAc of the chitobiose unit of the oligomannosidic N-glycans. The HPAE-PAD chromatographic profile of N-glycans released from wild seeds (Figure 2A) shows six major peaks. These peaks were attributed to the Man ₅ GlcNAc to MangGlcNAc structures (see Table I) by comparison of their retention times with standard structures as previously described in the literature (Rayon et al., 1996). These oligomannosidic structures were previously characterized from wild Arabidopsis plants by Rayon et al. (1999). The structures of these compounds could be confirmed by MALDI-TOF mass spectrometry analysis (Figure 3A). The spectrum shows five ions (M + Na ⁺ ) at m / z = 1054, 1216, 1378, 1540 and 1702 corresponding to the masses expected for the sodium adducts of the Man ₅ GlcNAc to MangGlcNAc oligosaccharides.

The N-glycans associated with the proteins of the mutant seeds were analyzed according to the same principle from the mixture of homozygous and heterozygous seeds. The HPAE-PAD profile (Figure 2B) shows a set of peaks between 16 and 22 min, similar to those detected from wild seeds (Figure 2A). These peaks were attributed to the oligomannosidic N-glycans Man ₅ GlcNAc to MangGlcNAc. In addition to these structures, a peak at 29 min was detected. The nature of the oligosaccharide (s) contained in this peak was first studied by comparison of its retention time in HPAE-PAD with compounds of known structures. It has been established (not illustrated) that the peak eluted at 29 min has the same retention time as the Glc ₃ Man GlcNAc structure (Table I) isolated in the laboratory during a previous study on the effect of the inhibitor castanospermine of α-glucosidase I, on the maturation of N-glycans in sycamore cell cultures (Lerouge et al., 1996). The MALDI-TOF spectrum of N-glycans isolated from the mutant seeds (Figure 3B) also shows the presence of additional structures to those identified from wild seeds. In addition of the ions (M + Na ⁺ ) at m / z = 1054, 1216, 1378, 1540 and 1702 corresponding to the species Man ₅ GlcNAc to MangGlcNAc, two ions at m / z = 1864 and 2026 were detected. These molecular ions correspond to structures having one and two additional hexoses. In order to confirm that these two ions are attributable to the additional peak observed in the profile presented in FIG. 2B, this peak was collected, desalted on a carbograph column (Parker et al., 1998) and then analyzed by MALDI-TOF spectrometry. Only the ions at m / z = 1864 and 2026 were detected, thus confirming that the chromatographic peak at 29 min (Figure 2B) results from the coelution of two oligosaccharides consisting of an N-acetylglucosamine residue and ten and eleven hexose residues respectively. . These data allow us to propose that in mutant seeds, two oligosaccharides, not observed in wild seeds, are accumulated and have the structures Glc ₃ Man GlcNAc and Glc ₃ Man ₈ GlcNAc (Table I). The first structure was previously characterized from sycamore cells after treatment with castanospermine (Lerouge et al., 1996), the second structure carries an additional mannose residue probably resulting from the partial action of α-mannosidase I at level of the Golgi apparatus.

(Man ^α l-2) Man ^α l ^

Man ^α l \

(Manα _{1. 2)} Maπ l ^{/ 3} _{Man βl} _ _4GkNAc

(Man ^α l-2Man ^α l-2) Man ^α l?

Man ₅ GlcNAc to MangGlcNAc

Man ^α l \ 6

Man ^α l _/ 3 g

^Ma " ^αi Manβl-4GlcNAc

3

Glc ^α l-2Glc ^α l-3Glc ^α l-3Man ^α l-2Man ^α l-2Man ^α l

Glc ₃ Man ₇ GlcNAc

Man ^α l-2Man ^α l \

Man ^α l

Man ^α 1 ^ D

ManPl-4GlcNAc

3

Glc ^α l-2 Glc l-3Glc ^α l-3Man l-2Man ^α l-2Man ^α l

Glc ₃ Man ₈ GlcNAc

Table I: Structures and designations of oligosaccharides Bibliographical references

• ALTSCHUL, S.F., Gish, W, Miller, W., Myers, E.W., and Lipman, D. 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403-410.

• ALTSHUL S.F et al., (1997), Nucleic Acids Research, vol.25: 33896-3402.

• AUSUBEL et al., (1989), Current Protocols in Molecular Biology, Green Publishing Associates and WLILEY Interscience, New-York.

• BAUSE, E. SCHWEDEN, J., GROSS, A. AND ORTHEN, B. (1989) Purification and characterization of trimming glucosidase 1 from pig liver. Eur. J. Biochem. 183: 661-669.

• BAUSE, E., ERKENS, R., SCHWEDEN, J. AND JAENIK, L (1986) Purification and characterization of trimming glucosidase 1 from Saccharomyces cerevisiae. FEBS 206 (2): 206-212.

. BECHTOLD, N. ELLIS, J. PELLETIER, G. (1993). In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants, C.R. Acad. Sci. Paris, 316: 1194-1199.

• BOUCHEZ, D. CAMILLERl, C. CABOCHE, M. (1993). A binary vector based on Basta resistance for in planta transformation of Arabidopsis thaliana. C.R. Acad. Sci. Paris. 316: 1188-1193.

• BEAUCAGE et al., (1981), Tetrahedron Lett, vol.22: 1859-1862

• BROWN EL. et al., (1979) Methods Enzymol., 68: 109-151.

• BEVAN et al., (1984) Nucleic Acids Research, 12: 8711-8721.

• BOUCHEZ et al., 1993, CR Acad. Sci. Paris, Science de la Vie / Life Sciences, 316: 1188-1193. • BARDOR M., LOUTELIER-BOURHIS C, MARVIN L., CABANES- MACHETEAU M, LANGE C, LEROUGE P. AND FAYE L. (1999) Analysis of plant glycoproteins by Matrix-Assisted Laser Desorption onization Mass Spectrometry: Application to the N -glycosylation analysis of bean phytohemagglutinin. Plant Physiol. Biochem., 37, 319-325.

. CHO R.J. et al. (1998), Proc. Natl. Acad. Sci. USA, Vol. 95 (7): 3752

• CORMACK B, VALDIVIA R.H. FALKOW S. 1996. Gene 173, 33-38.

• CHRISPEELS, M. AND FAYE, L. (1998) Nothing is used to produce, glycosylation is necessary. Biofutur, 184: 53-57.

• DEVIC, M. ALBERT, S. DELSENY, M., ROSCOE, J. (1997). Efficient PCR walking on plant genomic DNA. Plant Physiol. Biochem. 35 (4): 331-339.

• FULLER S.A. et al. (1996), Immunology in Current Protocols in Molecular Biology.

• JEFFERSON R.A., KAVANACH, T.A., and BEVAN, M.W. (1987). Embo J. 3901-3907.

• FICHETTE-LAINE et al., 1998, Methods in Biotechnology, 3: 271-290

• GREEN et al. , (1986), Ann. Rev. Biochem., Vol. 55: 569-597.

• GRIFFIN et al. (1989), Science, vol. 245: 967-971.

• GARCIA-CASADO, G. SANCHEZ-MONGE, R. CHRISPEELS, M. ARMANTIA, A., SALCEDO, G. AND GOMEZ, L. (1996) Rôle of complex asparagine-linked glycans in the allergenicity of plant glycoprotein. Glycobiology, 6 (4): 471-477.

• GOMORD, V., FITCHETTE-LA1NE, AC, DENMAT, LA., MICHAUD, D. AND FAYE, L. (1998) Production of Foreign Proteins in Tobacco Cell Culture suspension. Methods in Biotechnology. Cunningam, C and Porter, A (Eds) Humana Press Inc, Totwa, NJ. 3:15.

• HAMES B.D. and HIGGINS S.J., (1985), Nucleic Acid Hybridization: The Practical Approach, HANES and HIGGINS Ed., IRL Press, Oxford.

• HAQ, T., MANSON, H., CLEMENTS, J. AND ARNTZEN, C. (1995) Oral Immunization with a recombinant bacterial antigen produced in transgenic plants. Science, 268 (5211): 714-716.

• HETTKAMP, H., LEGLER, G. AND BAUSE, E. (1984). Purification by affinity chromatography of glucosidase 1, an endoplasmic reticulum hydrolase involved in the processing of asparagine-linked oligosaccharides. Eur. J. Biochem. 142 (1): 85-90.

• HOHN AND PUCHTA, 1999, Gene Therapy in Plant, Proc. Natl. Acad. Sci. USA, 96: 8321-8323

• HOUBEN WEYL, (1974), In Methoder Organischen Chemie, E.Wunsch Ed. Vol.15-1 and 15-11, Thieme, Stuttgart.

• HORSCH et al., (1984).

• IZANT JJ, WEINTRAUB H., (1984), Cell, Vol.36 (4): 1007-1015

• KOCH Y. (1977), Biochem. Biophys. Res. Common. Vol.74: 488-491.

• KOHLER G. and MILSTEIN C, (1975) Nature, vol. 256: 495.

KOZBOR et al. (1983), Hybridoma, vol. 2 (1): 7-16.

• KALZ-FULLER, B., BIEBERICH, E. AND BAUSE, E. (1995). Cloning and expression of glucosidase 1 from human hippocampus. Eur. J. Biochem 231: 344-351.

• KHAN, F., Varma, G. and Vijay, l. (1999). Genomic organization and promoter activity of glucosidase 1 gene. Glycobiology, 9 (8): 797-806. • LEROUGE, P., CABANES-MACHETEAU, M., RAYON, C, FISCHETTE-LAINE, AC, GOMORD, V. AND FAYE, L. (1998) N-Glycoprotein biosynthesis in plants -.recent developments and future trends. Plant Molecular Biology, 38: 31-48.

• LEROUGE P., FITCHETTE-LAINE A.C., CHEKKAFI A., AV1DGOR V. AND FAYE L. (1996). Castanospermine inhibits the processing of N- glycans in sycamore cells without affecting the secretion of glycoproteins. Plant J., 10, 713-719.

• MARTINEAU et al. , JOHNS P. WINTER G. (1998), J. Mol. Biol., Vol. 280 (1): 117-127.

• MERR1FIELD RB, (1965a), Nature, vol. 207 (1996: 522-523)

• MERRIFIELD R.B., (1965b), Science, vol. 150 (693): 178-185.

• MYLNE, J., and BOTELLA, J., R. (1998). Binary vectors for sensé and antisense expression of Arabidopsis ESTs. Plant Molecular. Biology

Reporter 16, p257-262.

• McELROY D., ZHANG W, CAO J, WU R (1990) Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2, p 163-171.

• MANSFIELD, S. AND BRIARTY, L. 1991, Early embryogenesis in Arabidopsis thaliana II. The Developing embryo; Can. J. Biol., 69: 461-476.

• MURRAY ET AL. 1987, Lectin-specific targeting of lysosomal enzymes to reticuloendothelial cells. Methods Enzymol; 149: 25-42.

• NARANG SA et al., (1979), Methods Enzymol., Vol. 68, 90-98. • ODELL JT, NAGY F. CHUA NH. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, p. 810-812.

• PALACPAC, N., Yoshida, S. Sakai, H., Kimura, Y., Fujiyama, K. Yoshid, T. and Seki, T. (1999) Stable expression of human β-1, 4-galactosyltransferase in plant cell modified N-linked glycosyltion patterns. Proc. Natl. Acad. Sci :. USA, 96: 4692-4697.

• PACKER H. N., MARGARET A. L., JARDINE D. R., REDMOND J. W.

(1998) A gênerai approach to desalting oligosaccharides released from glycoproteins, Glycoconjugate J., 15, 563-570.

• PUKAZHENTHI, B., VARMA, G. AND VIJAY, I. (1993) Conserved structural features in glycoprotein processing glucosidase 1 from several tissues and species. Indian J Biochem Biophys. 30 (6): 333-40.

• ROSSl et al. (1991), Pharmacol. Ther., Vol.5O: 245-254

• RIDDER R. et al., (1995), Biotechnology (NY), vol.13 (3): 255-260 or humanized antibodies

• REINMANN K.A. et al., (1997), Aids, Res. Hmm. Retroviruses, vol.13 (11): 933-943

• RAYON R., GOMORD V., FAYE L., LEROUGE P. (1996). N-glycosylation of phytohemagglutinin expressed in bean cotyledons or in transgenic tobacco plants, Plant Physiol. Biochem., 34, 273-281.

• RAYON C, CABANES-MACHETEAU M., LOUTELIER-BOURHIS C, SALIOT-MAIRE I., LEMOINE J., REITER W.D., LEROUGE P. AND FAYE

L. (1999) Characterization of N-glycans from Arabidopsis thaliana. Application to a mutant fucose-deficient. Plant Physiol., 119, 725-733. • ROMANIOUK, A. AND VIJAY, I. (1997) Structure-function relashionships in glucosidase I: amino-acids invoved in binding the substrate to the enzyme. Glycobiology. 7 (3) 399-404.

• SHAILUBHAI, K. PRATTA, M. AND VIJAY, I (1987). Purification and characterization of glucosidase 1 involved in N-linked glycoprotein processing in bovi: ne mammary gland. Biochem. J. 247 (3): 555-562.

• SHAILUBHAI, K. PUKAZHENTI, B. SEXENA, E., VARMA, G. AND VIJAY, I. (1991) Glucosidase 1, a transmembrane endoplasmic reticular glycoprotein with a luminal catalytic domain. J. Biol. Chem. 266 (25): 16587-93.

• SAMBROOK J., FRITSCH E.F. and T. MANIATIS, (1989), Molecular Cloning: A Laboratory Manual 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor NEW YORK.

• SCZAKIEL G. et al. (1995) Trends. Microbiol., Vol.3 (6): 213-217.

• SANCHEZ-PESCADOR R., (1988), J. Clin. Microbiol. , vol. 26 (10): 1934, 1938.

• SCHUTZE, M., PETERSON, P., AND JACKSON, M. (1994) An N-terminal double arginine motif maintains type II membrane proteins in the endoplasmic reticulum. EMBO Journal 13 (7): 1696-1705.

• SZUMILO, T. KAUSHAL, G. AND ELBEIN, A. (1986). Purification and properties of Glucosidase 1 from Mung Bean Seddlings. Archives of Biochemistry and Biophysics (247): 261-271.

• URDEA NS et al. (1988), Nucleic Acids Research, vol.11: 4937-4957.

• URDEA NS et al., (1991), Nucleic Acids Symp. Ser., Vol. 24: 197-200.

• WEIL, JH BONNET, J. BOULANGER, Y., CHAMBON, P. DUBERTET, G. GAUTHERON, D. KEDINGER, C, LADZUNSKI, M., MONTREUIL, J., PATTE, JC, REBEL, G., ROSSIGNOL, JM AND WRIGHT, M. (1989) General Biochemistry, 5th edition. Eds Masson, PARIS.

• WABIKO H. et al., (1986), DBA, vol.5. (4): 305-314. WOO, S.-S, Jiang J., Gill, B.S., Paterson, A.H. and Wing, R.A. 1994. Nude. Acid Res. 22, p 4922-4931.

• ZENG, Y-C. AND ELBEIN, A. (1998) Purification to homogeneity and properties of plant glucosidase I. Arch Biochem Biophys. 355 (1): 26-34.

• ZENG ET AL, 1997: ZENG Y, BANNON G, THOMAS V., RICE K., DRAKE R AND ELBEIN, A. (1997) Purification and Specificity of 1, 2- Xylosyltransferase, an Enzyme That Contributes to the Allergenicity of Some Plant Proteins. J. Biol. Chem. 272 (50): 31340-31347.

Claims

1. Nucleic acid comprising at least 20 consecutive nucleotides of a polynucleotide encoding a type I glucosidase of amino acid sequence SEQ ID No. 1, or a nucleic acid of complementary sequence.

2. Nucleic acid according to claim 1, comprising at least 20 consecutive nucleotides of the nucleotide sequence SEQ ID No. 2, or a nucleic acid of complementary sequence.

3. Nucleic acid according to claim 2, characterized in that it is the nucleotide sequence SEQ ID No. 2 or the nucleic acid of complementary sequence.

4. Nucleic acid having at least 80% nucleotide identity with a nucleic acid according to one of claims 1 to 3.

5. Nucleic acid hybridizing, under conditions of high stringency hybridization, with a nucleic acid according to any one of claims 1 to 3.

6. Nucleic acid according to claim 5, characterized in that it is an oligonucleotide probe.

7. Nucleic acid according to claim 5, characterized in that it is an oligonucleotide primer.

8. Nucleic acid according to claim 5, characterized in that it is chosen from polynucleotides of sequences SEQ ID No. 3 to SEQ ID

# 15.

9. Antisense nucleotide sequence comprising at least 20 consecutive nucleotides of a nucleic acid according to any one of claims 1 to 8.

10. Recombinant vector, characterized in that it comprises a nucleic acid according to one of claims 1 to 5.

1 1. Recombinant vector according to claim 10, characterized in that it is a functional expression vector in a plant host cell.

12. Recombinant vector according to one of claims 9 and 10, characterized in that it is a vector of fungal, bacterial or viral origin.

13. Host cell transformed with a nucleic acid according to one of claims 1 to 5 and 9 or with a recombinant vector according to one of claims 10 to 12.

14. A transformed host cell according to claim 13, characterized in that it is a cell of prokaryotic or eukaryotic origin.

15. A transformed host cell according to claim 13, characterized in that it is an Agrobacterium tumefaciens cell.

16. transformed host cell according to claim 13, characterized in that it is a plant cell.

17. Recombinant plant multicellular organism, characterized in that it comprises at least one transformed host cell according to one of claims 13 to 16.

18. Plant transformed with a nucleic acid according to one of claims 1 to 5 and 9 or a recombinant vector according to one of claims 10 to 12.

19. A transformed plant comprising, in a form integrated into its genome, a nucleic acid according to one of claims 1 to 5 and 9 or a recombinant vector according to one of claims 10 to 12.

20. Method for obtaining a transformed plant, characterized in that it comprises the following steps: a) obtaining a transformed plant host cell according to one of claims 13 or 16; b) regeneration of an entire plant from the transformed host cell obtained in step a); c) selection of the plants obtained in step b) having integrated a polynucleotide of interest chosen from the nucleic acids according to one of claims 1 to 5 and 9.

21. Method for obtaining a transformed plant, characterized in that it comprises the following steps: a) obtaining a host cell of Agrobacterium tumefaciens transformed according to claim 15; b) transformation of the plant by infection with Agrobactium tumefaciens cells obtained in step a); c) selection of plants having integrated a polynucleotide of interest chosen from the nucleic acids according to one of claims 1 to 5 and 9.

22. Method for obtaining a transformed plant, characterized in that it comprises the steps consisting in: a) transforming a plant cell with a nucleic acid according to one of claims 1 to 5 and 7 or a recombinant vector according to one of claims 10 to 12; b) regenerating an entire plant from the cells of recombinant plants obtained in step a); c) selecting the plants having integrated the nucleic acid according to one of claims 1 to 5 and 9 or the recombinant vector according to one of claims 10 to 12.

23. Method for obtaining a transformed plant according to one of claims 20 to 22, characterized in that it further comprises the steps of: d) crossing between them of two transformed plants as obtained from step c); e) selection of heterozygous plants for the nucleic acid of interest.

24. Method for obtaining a transformed plant according to one of claims 20 to 22, characterized in that it further comprises the steps of: d) crossing a transformed plant obtained in step c) with a plant of the same species; e) selection of the plants resulting from the crossing of step d) having conserved the nucleic acid of interest.

25. A transformed plant as obtained according to any one of claims 20 to 24.

26. Seed of a transformed plant according to any one of claims 18, 19 and 25.

27. Plant seed of which part or all of the constituent cells comprise a nucleic acid according to one of claims

1 to 5 and 9.

28. Use of a nucleic acid according to one of claims 1 to 5 for the expression in vitro or in vivo of a plant glucosidase I.

29. Use according to claim 28, characterized in that it involves expression in vivo in a plant transformed with such a nucleic acid.

30. Use of a nucleotide sequence according to claim 9, or of a recombinant vector comprising a nucleotide sequence according to claim 9, for inhibiting or blocking the expression of the gene coding for the glucosidase I of Arabidopsis thaliana.

31. A method of detecting a nucleic acid constituting the messenger RNA, the cDNA or the genomic DNA of the glucosidase 1 gene of Arabidopsis thaliana in a sample, comprising the steps consisting in: a) putting in contact a probe or a plurality of probes according to claim 6 with the nucleic acid capable of being contained in the sample; b) detecting the hybrid possibly formed between the nucleic acid of the sample and the probe (s).

32. Kit or kit for the detection of a nucleic acid constituting the messenger RNA, the cDNA or the genomic DNA of the glucosidase 1 gene of Arabidopsis thaliana in a sample, comprising: a) a probe or a plurality of probes according to claim 6; b) where appropriate, the reagents necessary for the hybridization reaction.

33. A method for amplifying a nucleic acid constituting the messenger RNA, the cDNA or the genomic DNA of the glucosidase 1 gene of Arabidopsis thaliana in a sample, comprising the steps consisting in: a) bringing into contact a pair of primers according to one of claims 7 and 8 with the nucleic acid capable of being contained in the sample; b) performing at least one amplification cycle of the nucleic acid contained in the sample; c) detecting the possibly amplified nucleic acid.

34. Kit or kit for the amplification of a nucleic acid constituting the messenger RNA, the cDNA or the genomic DNA of the glucosidase 1 gene of Arabidopsis thaliana in a sample, comprising: a) a pair of primers according to one of claims 7 or 8; b) where appropriate, the reagents necessary for carrying out the amplification reaction.

35. A polypeptide encoded by a nucleic acid according to any one of claims 1 to 5.

36. Polypeptide according to claim 35, characterized in that it comprises an amino acid sequence SEQ ID No 1 or a polypeptide having at least 80% amino acid identity with the sequence SEQ ID No 1, or a peptide fragment of this polypeptide.

37. Polypeptide comprising amino acid modifications of

1, 2, 3, 4, 5, 10 to 20 substitutions, additions or deletions of at least one amino acid with respect to the amino acid sequence of a polypeptide according to one of claims 35 or 36.

38. A polypeptide comprising at least 7 consecutive amino acids of a polypeptide according to one of claims 35 to 37.

39. Nucleic acid coding for a polypeptide according to one of claims 35 to 38.

40. Antibody directed against a polypeptide according to one of claims 35 to 38.

41. A method for detecting the presence of a polypeptide according to one of claims 35 to 38 in a sample, comprising the steps of: a) contacting the sample with an antibody according to claim 40; b) detecting the antigen / antibody complex possibly formed.

42. Kit or diagnostic kit for detecting the presence of a polypeptide according to one of claims 35 to 38 in a sample, characterized in that it comprises: a) an antibody according to claim 40; b) if necessary, a reagent necessary for the detection of the antigen / antibody complex possibly formed.

43. Kit or diagnostic kit for detecting the presence of a polypeptide according to one of claims 35 to 38 in a sample, characterized in that it comprises: a) an antibody according to claim 40; b) where appropriate, the reagents necessary for the detection of the antigen / antibody complexes which may have formed.

44. A protein with modified glycosylation, characterized in that it is produced by a transformed plant according to one of claims 18, 19 and 25, or by a transformed host cell according to one of claims 13 to 16.

45. Protein with modified glycosylation, characterized in that it is contained in a plant seed transformed according to one of claims 26 or 27.

46. Modified glycosylation protein according to one of claims

44 and 45, characterized in that it is a recombinant protein.

47. A modified glycosylation protein according to claim 46, characterized in that it is an antigen or an immunogen.