FR2774379A1

FR2774379A1 - PROCESS FOR THE PRODUCTION OF ALPHA 1-ANTITRYPSIN AND ITS VARIANTS BY PLANT CELLS, AND PRODUCTS CONTAINING THE ALPHA-ANTITRYPSIN OBTAINED THEREBY

Info

Publication number: FR2774379A1
Application number: FR9801089A
Authority: FR
Inventors: Veronique Gruber; Beatrice Olagnier; Philippe Bournat; Manfred Theisen; Bertrand Merot
Original assignee: Groupe Limagrain Holding SA
Current assignee: Groupe Limagrain Holding SA
Priority date: 1998-01-30
Filing date: 1998-01-30
Publication date: 1999-08-06
Anticipated expiration: 2018-01-30
Also published as: AU2169399A; WO1999038987A8; FR2774379B1; EP1051503A1; WO1999038987A1

Abstract

he invention concerns a method for producing alpha 1-antitrypsin ( alpha 1-AT), or alleles thereof characterised in that it consists in: (i) introducing in the monocotyledon plant cells, a nucleic acid comprising a sequence coding for alpha 1-antitrypsin ( alpha 1-AT) or for an allele thereof, the alleles being differentiated from natural human alpha 1-AT by one or several substitution(s), deletion(s) or insertion(s) of amino acids, and optionally a sequence coding for a selective agent; (ii) selecting the cells having integrated the nucleic acid in stable manner; (iii) propagating the transformed cells in culture, or regeneration of entire chimerical or transgenic plants; (iv) recuperating and optionally purifying the resulting alpha 1-antitrypsin or its alleles.

Description

PROCEDE DE PRODUCTION, PAR DES CELLULES VEGETALES,
D'al-ANTITRYPSINE ET DE SES VARIANTES, ET PRODUITS
CONTENANT L'a-ANTITRYPSINE AINSI OBTENUE
L'invention concerne un procédé de production, par des cellules végétales monocotylédones, d'al- antitrypsine et de ses analogues, et les protéines ainsi obtenues. L'invention vise également les cellules et plantes monocotylédones, génétiquement transformées, capables de produire des analogues d'a1antitrypsine, et les construits d'acides nucléiques impliqués dans la transformation. En outre, l'invention vise des produits pharmaceutiques contenant l'al-antitrypsine et ses variantes, ainsi obtenues.PRODUCTION PROCESS, BY PLANT CELLS,
Al-ANTITRYPSIN AND ITS VARIANTS, AND PRODUCTS
CONTAINING a-ANTITRYPSIN THUS OBTAINED
The invention relates to a process for the production, by monocotyledonous plant cells, of anti-nitrypsin and its analogs, and the proteins thus obtained. The invention also relates to the genetically transformed monocotyledonous cells and plants capable of producing α-antitrypsin analogs, and the nucleic acid constructs involved in the transformation. In addition, the invention relates to pharmaceutical products containing al-antitrypsin and its variants, thus obtained.

L'alpha-l-antitrypsine, a1-AT, également connue sous les désignations d'alpha-l-inhibiteur de protéase (a1-PI), d'antitrypsine et de metserpine, est une protéine plasmatique présente dans le plasma à une concentration de l'ordre de 1,3 grammes par litre. Alpha-1-antitrypsin, a1-AT, also known as alpha-1-protease inhibitor (a1-PI), antitrypsin and metserpine, is a plasma protein found in plasma at a concentration about 1.3 grams per liter.

Synthétisée par le foie, il s'agit d'une glycoprotéine de 51kDa à 54kDa, constituée d'une seule chaîne polypeptidique de 394 acides aminés (Long et al.,
Biochemistry, 1984, vol. 23, pages 4828-4837).Synthesized by the liver, it is a glycoprotein from 51kDa to 54kDa, consisting of a single polypeptide chain of 394 amino acids (Long et al.,
Biochemistry, 1984, vol. 23, pages 4828-4837).

Elle possède 3 sites de N-glycosylation sur les résidus Asn-46, Asn-83 et Asn-247, les trois chaînes glycosidiques ayant une structure core'1 commune de
Asn-(NAc Glc)2-(Man)3, avec 2 ou 3 antennes de NAc Glc
Gal-Sia. La partie glucidique représente 13% de la masse totale de la glycoprotéine. It has 3 N-glycosylation sites on residues Asn-46, Asn-83 and Asn-247, the three glycosidic chains having a common core'1 structure.
Asn- (NAc Glc) 2- (Man) 3, with 2 or 3 antennas of NAc Glc
Gal-Sia. The carbohydrate part represents 13% of the total mass of the glycoprotein.

En raison d'un polymorphisme survenant à 3 positions dans la protéine, il existe 3 formes d'al-AT:
M1, M2, M3
213 376 101
M1 Val/Ala Glu Arg
M2 Val Asp Arg
M3 Val Asp His
L'a1-AT est un inhibiteur de protéase à sérine.Due to a polymorphism occurring at 3 positions in the protein, there are 3 forms of al-AT:
M1, M2, M3
213 376 101
M1 Val / Ala Glu Arg
M2 Val Asp Arg
M3 Val Asp His
A1-AT is a serine protease inhibitor.

Sa fonction biologique principale est d'inhiber ltélastase neutrophile et de protéger ainsi le tissu pulmonaire contre les attaques protéolytiques.Its main biological function is to inhibit the neutrophil elastase and thus protect the lung tissue against proteolytic attacks.

Il existe plusieurs variantes "pathologiques" communes de la protéine : par exemple la forme "Z" dans laquelle Glu-342 est substitué par Lys, et la forme "S" dans laquelle Glu-264 est substitué par Val. There are several common "pathological" variants of the protein: for example, the "Z" form in which Glu-342 is substituted by Lys, and the "S" form in which Glu-264 is substituted by Val.

Des différences au niveau de la glycosylation, et en particulier dans le nombre de résidus d'acide sialique, peuvent aussi être observées.Differences in glycosylation, and in particular in the number of sialic acid residues, can also be observed.

Les mutants Z et S, bien que capables de fonctionner comme agents anti-élastase, sont produits en faible quantité conduisant à une déficience, et surtout dans le cas de la variante "Z", au développement d'emphysème pulmonaire sévère. The Z and S mutants, although capable of functioning as anti-elastase agents, are produced in small quantities leading to deficiency, and especially in the case of the "Z" variant, with the development of severe pulmonary emphysema.

Cette pathologie est actuellement traitée par thérapie substitutive avec des concentrés plasmatiques. Les besoins annuels actuels par patient sont estimés à 200 grammes et la demande mondiale à plusieurs centaines de kilogrammes par an. L'échelle de production de la protéine à partir de sang humain couvre difficilement ces besoins. This pathology is currently treated by replacement therapy with plasma concentrates. Current annual needs per patient are estimated at 200 grams and world demand at several hundred kilograms per year. The scale of protein production from human blood hardly covers these needs.

La production d'a1-AT humaine par voie recombinante a donc été envisagée. L'a1-AT recombinante non-glycosylée a notamment été produite chez E. coli sous forme de protéine de fusion. La protéine, exprimée à un taux d'environ 15% des protéines cellulaires totales, présentait une activité antiélastase caractéristique d'a1-AT, mais était selon les auteurs, susceptible de présenter des propriétés immunologiques modifiées en raison de l'extension Nterminale (Courtney et al., PNAS, 1984, vol. 81, pages 669-673). The production of human A1-AT by recombinant route has therefore been envisaged. The non-glycosylated recombinant a1-AT has in particular been produced in E. coli in the form of fusion protein. The protein, expressed at a rate of approximately 15% of total cellular proteins, exhibited an antielastase activity characteristic of a1-AT, but was according to the authors, capable of exhibiting modified immunological properties due to Nterminal extension (Courtney et al., PNAS, 1984, vol. 81, pages 669-673).

La production chez la levure d'al-AT à des taux élevés (10-38 des protéines cellulaires totales) a également été décrite par Johansen et al. (Mol. The production in yeast of al-AT at high levels (10-38 of total cellular proteins) has also been described by Johansen et al. (Mol.

Biol.Med., 1987, vol. 4, pages 291-305). Le rendement a été augmenté par la délétion des premiers 5, 10 ou 15 acides aminés.Biol. Med., 1987, vol. 4, pages 291-305). The yield was increased by deletion of the first 5, 10 or 15 amino acids.

Travis et al. (J. Biol. Chem., 1985, vol. 260 na 7, pages 4384-4389) ont décrit la production d'al-AT non glycosylée chez la levure. Deux variantes de la protéine ont été obtenues à un rendement d'environ 10% des protéines cellulaires solubles totales, chacune ayant une activité a1-AT mais une stabilité réduite par rapport à l'a1-AT native. Travis et al. (J. Biol. Chem., 1985, vol. 260 na 7, pages 4384-4389) have described the production of non-glycosylated al-AT in yeast. Two variants of the protein were obtained at a yield of approximately 10% of the total soluble cellular proteins, each having an a1-AT activity but a reduced stability compared to the native a1-AT.

L'al-AT glycosylée a été exprimée dans le sang et dans le lait d'animaux transgéniques, notamment des lapins, des souris et des brebis. Glycosylated al-AT has been expressed in the blood and milk of transgenic animals, including rabbits, mice and sheep.

Dans le sang des animaux transgéniques, la protéine était présente à une concentration d'environ 1 mg/ml de plasma. Elle conserve son activité antiélastase (Massoud et al., C. R. Acad. Sci. Paris, 1990, tome 311, série III, pages 275-280). In the blood of transgenic animals, the protein was present at a concentration of approximately 1 mg / ml of plasma. It retains its anti-elastase activity (Massoud et al., C. R. Acad. Sci. Paris, 1990, volume 311, series III, pages 275-280).

Dans le lait de brebis transgéniques, les niveaux d'al-antitrypsine ont atteint 60 g/l. La protéine ainsi produite est entièrement glycosylée (Wright et al.,
Bio/Technology, Septembre 1991, vol. 9, pages 830834). La nature de la glycosylation n'a pas été publiée.In transgenic sheep milk, the levels of al-antitrypsin reached 60 g / l. The protein thus produced is fully glycosylated (Wright et al.,
Bio / Technology, September 1991, vol. 9, pages 830834). The nature of glycosylation has not been published.

La production de protéines recombinantes dans le lait des animaux transgéniques se propose de diminuer les coûts de production. Cependant, il reste des problèmes d'éthique et de contaminations virales et subvirales du même type que ceux rencontrés avec les produits purifiés classiques. The production of recombinant proteins in the milk of transgenic animals is intended to reduce production costs. However, there are still problems of ethics and viral and subviral contamination of the same type as those encountered with conventional purified products.

Le problème technique que se propose de résoudre la présente invention est de produire de l'al-AT recombinante en grande quantité à des coûts faibles, sans risque de contaminations virales ou sub-virales, par exemple par des prions. La protéine présente une activité a1-AT satisfaisante, et doit être stable et adaptée du point de vue immunologique à la forme d'administration choisie. Les présents inventeurs ont résolu ce problème technique en utilisant, comme hôte pour la transformation génétique, des cellules végétales, et plus particulièrement des cellules végétales monocotylédones. The technical problem which the present invention proposes to solve is to produce recombinant al-AT in large quantities at low costs, without the risk of viral or sub-viral contamination, for example by prions. The protein has satisfactory a1-AT activity, and must be stable and immunologically suitable for the form of administration chosen. The present inventors have solved this technical problem by using, as host for the genetic transformation, plant cells, and more particularly monocotyledonous plant cells.

Diverses équipes se sont déjà intéressées à la production de protéines recombinantes de mammifères dans des cellules végétales ou dans des plantes transgéniques. Par exemple, l'expression spécifique dans les graines de colza, de la leu-enképhaline a été obtenue avec des niveaux d'expression d'environ 0,1% (Vanderkerckhove et al., Biotechnology, 1989, vol. 7, pages 929-932). Various teams have already taken an interest in the production of recombinant mammalian proteins in plant cells or in transgenic plants. For example, specific expression in rapeseed, leu-enkephalin was obtained with expression levels of about 0.1% (Vanderkerckhove et al., Biotechnology, 1989, vol. 7, pages 929 -932).

En 1990, Simons et al. (Biotechnology, 1990, vol. In 1990, Simons et al. (Biotechnology, 1990, vol.

8, pages 217-221) ont transféré le gène de la sérum albumine humaine dans des cellules de tabac et de pomme de terre. Quelle que soit l'origine des peptides signaux (humaine ou végétale), des taux de sérum albumine humaine de l'ordre de 0,02% des protéines totales ont été obtenus dans les feuilles, les tiges et les tubercules de pomme de terre.8, pages 217-221) transferred the gene for human serum albumin into tobacco and potato cells. Whatever the origin of the signal peptides (human or vegetable), levels of human serum albumin of the order of 0.02% of the total proteins were obtained in the leaves, stems and tubers of potato.

D'autres protéines recombinantes de mammifères ont aussi été produites dans les plantes : l'antigène de surface de l'hépatite B (Mason et al., P.N.A.S, 1992, vol. 89, pages 11745-11749) ; l'interféron humain (Edelbaum, J. of Interferon Res., 1992, vol. Other recombinant mammalian proteins have also been produced in plants: the hepatitis B surface antigen (Mason et al., P.N.A.S, 1992, vol. 89, pages 11745-11749); human interferon (Edelbaum, J. of Interferon Res., 1992, vol.

12, pages 449-453) ; un anticorps de souris anti
Streptococcus mutans, agent de la carie dentaire (Hiatt et Ma, FEBS, 1992, vol. 307, pages 71-75) ; un anticorps anti-Herpès et l'hirudine (Russel, Moloney, respectivement, Intl. Meeting of Production of
Recombinant Proteins in Plants, Leicester, 1994, page 43, pages 36-38).12, pages 449-453); an anti mouse antibody
Streptococcus mutans, agent of dental caries (Hiatt and Ma, FEBS, 1992, vol. 307, pages 71-75); an anti-Herpes antibody and hirudin (Russel, Moloney, respectively, Intl. Meeting of Production of
Recombinant Proteins in Plants, Leicester, 1994, page 43, pages 36-38).

L'ensemble de ces recherches montre que la production de protéines recombinantes de mammifères dans les cellules végétales est possible et que les mécanismes de synthèse de protéines à partir des séquences d'ADN sont similaires chez les cellules animales et les cellules végétales. De plus, il apparaît que la cellule végétale est capable de réaliser la plupart des étapes de maturation posttraductionnelles des protéines comme l'assemblage des sous-unités, le repliement des chaînes, la maturation protéolytique, la formation des ponts-disulfures et le clivage des peptides signaux de manière semblable aux cellules animales. All of this research shows that the production of recombinant mammalian proteins in plant cells is possible and that the mechanisms of protein synthesis from DNA sequences are similar in animal and plant cells. In addition, it appears that the plant cell is capable of carrying out most of the post-translational maturation steps of proteins such as the assembly of subunits, the folding of chains, proteolytic maturation, the formation of disulfide bridges and the cleavage of peptides signal similarly to animal cells.

Quelques différences existent néanmoins au niveau de la glycosylation. Bien que les étapes de glycosylation conduisant aux glycannes polymannosidiques soient réalisées de manière identique chez les plantes et chez les mammifères, la maturation des glycannes polymannosidiques en glycannes complexes est sensiblement différente. Les
N-glycannes des glycoprotéines végétales diffèrent principalement des glycannes de mammifères par l'absence d'acide sialique, également connu sous le nom d'acide N-acétylneuraminique, et par la présence d'un résidu de ss-1,2 xylose et d'un résidu de fucose lié en a-1,3 au résidu de GlcNAc proximal du "core" (Driouich et al., Regard sur la biochimie, 1993, vol.Some differences nevertheless exist at the level of glycosylation. Although the glycosylation steps leading to polymannosidic glycans are carried out in the same way in plants and in mammals, the maturation of polymannosidic glycans into complex glycans is significantly different. The
N-glycans from plant glycoproteins differ mainly from mammalian glycans by the absence of sialic acid, also known as N-acetylneuraminic acid, and by the presence of a residue of ss-1,2 xylose and d 'a fucose residue linked in α-1,3 to the GlcNAc residue proximal to the "core" (Driouich et al., Regard sur la biochemimie, 1993, vol.

3, pages 33-42). Les abréviations signifiant des résidus glucidiques sont celles habituellement utilisées dans l'art (VLIEGENTHART J.F.G and MONTREUIL
J., Chap. II, Glycoproteins, Montreuil J., Schachter
H., Vliegenthart J.F.G., 1995, ELSEVIER SCIENCE B.V., pages 13-28 ; MONTREUIL J., Advances in Carbohydrate
Chemistry and Biochemistry, 1980, Vol. 37, Academic
Press Inc., pages 157-223).3, pages 33-42). The abbreviations meaning carbohydrate residues are those usually used in art (VLIEGENTHART JFG and MONTREUIL
J., Chap. II, Glycoproteins, Montreuil J., Schachter
H., Vliegenthart JFG, 1995, ELSEVIER SCIENCE BV, pages 13-28; MONTREUIL J., Advances in Carbohydrate
Chemistry and Biochemistry, 1980, Vol. 37, Academic
Press Inc., pages 157-223).

La glycosylation joue un rôle important dans la mise en place de la structure spatiale de la protéine, dans la solubilité de la molécule, dans la protection contre les attaques protéolytiques et dans les mécanismes de reconnaissance immunitaire. Le glycanne contrôle aussi la demi-vie de la protéine et peut luimême, dans certains cas, porter la fonction biologique. Compte tenu du rôle important joué par la glycosylation, l'on essaie normalement, pour la fabrication de protéines thérapeutiques, de reproduire le plus fidèlement possible la glycosylation naturelle de la protéine. Ceci n'est pas possible dans des cellules végétales, en raison de la présence du xylose, absent chez les animaux, et de l'absence d'acide sialique chez les plantes. Bien que présentant de nombreux avantages du point de vue économique, les différences au niveau de la glycosylation de la protéine peuvent donc rendre imprévisible le succès de l'utilisation de cellules végétales pour la production de protéines thérapeutiques. Glycosylation plays an important role in the establishment of the spatial structure of the protein, in the solubility of the molecule, in protection against proteolytic attacks and in the mechanisms of immune recognition. Glycan also controls the half-life of the protein and can, in some cases, carry biological function. Given the important role played by glycosylation, we normally try, for the production of therapeutic proteins, to reproduce as faithfully as possible the natural glycosylation of the protein. This is not possible in plant cells, due to the presence of xylose, absent in animals, and the absence of sialic acid in plants. Although having many economic advantages, differences in the glycosylation of the protein can therefore make the success of using plant cells for the production of therapeutic proteins unpredictable.

Malgré ces différences importantes, les présents inventeurs ont réussi à produire dans des plantes monocotylédones transgéniques, à des niveaux d'expression élevés, des protéines ayant une activité d'al-AT. Les protéines ont une stabilité acceptable. De manière surprenante, les inventeurs ont aussi constaté, que dans certaines conditions, la maturation protéolytique de la glycoprotéine est fonction de l'adressage cellulaire, permettant la production d'une série de "variantes" protéiques, de poids moléculaire différent, présentant toutes une activité d'a1-AT. Despite these important differences, the present inventors have succeeded in producing in transgenic monocotyledonous plants, at high expression levels, proteins having an al-AT activity. Proteins have acceptable stability. Surprisingly, the inventors have also found that, under certain conditions, the proteolytic maturation of the glycoprotein is a function of cell addressing, allowing the production of a series of protein "variants", of different molecular weight, all having a A1-AT activity.

L'invention concerne donc un procédé de production d'a1-antitrypsine, ou de variantes de celleci caractérisé par i) l'introduction, dans des cellules végétales provenant d'une espèce monocotylédone, d'un acide nucléique comportant une séquence codant pour l'a1- antitrypsine ou pour une variante de celle-ci, les variantes se différenciant de l'a1-AT humaine naturelle par une ou plusieurs substitution(s), délétion(s) ou insertion(s) d'acides aminés, et éventuellement une séquence codant pour un agent sélectif ii) sélection des cellules ayant intégré de manière stable l'acide nucléique iii) propagation des cellules transformées en culture, ou régénération de plantes entières chimériques ou transgéniques iv) récupération et éventuellement purification de l'a1-antitrypsine ou de ses variantes, ainsi produites. The invention therefore relates to a process for the production of α-antitrypsin, or variants thereof, characterized by i) the introduction, into plant cells originating from a monocotyledonous species, of a nucleic acid comprising a sequence coding for l a1- antitrypsin or for a variant thereof, the variants differentiating from natural human a1-AT by one or more substitution (s), deletion (s) or insertion (s) of amino acids, and optionally a sequence coding for a selective agent ii) selection of cells which have stably integrated the nucleic acid iii) propagation of the transformed cells in culture, or regeneration of chimeric or transgenic whole plants iv) recovery and optionally purification of the α1-antitrypsin or its variants, thus produced.

L'invention concerne également une protéine susceptible d'être produite par le sus-dit procédé, et présentant une activité de protéase à sérine, de préférence une activité de l'a1-AT, caractérisée en ce que
- soit elle est exempte de chaines Nglycosidiques
- soit elle est N-glycosylée par au moins un glycanne de type mannosidique ou polymannosidique, et/ou par au moins un glycanne de type complexe comportant éventuellement au sein de sa structure un ou plusieurs résidus de xylose et éventuellement un ou plusieurs résidus de fucose, le glycanne de type complexe étant normalement dépourvu de résidus d'acide sialique. The invention also relates to a protein capable of being produced by the above-mentioned process, and having a serine protease activity, preferably an α1-AT activity, characterized in that
- either it is free of Nglycosidic chains
- or it is N-glycosylated by at least one glycan of mannosidic or polymannosidic type, and / or by at least one glycan of complex type optionally comprising within its structure one or more xylose residues and optionally one or more fucose residues , the complex type glycan normally being free of sialic acid residues.

Dans le contexte de l'invention, les termes ciaprès ont les significations suivantes
- une "variante" de l'a1-AT signifie une protéine qui se différencie de l'a1-AT humaine naturelle (mature ou pré-protéine) par une ou plusieurs substitution(s), délétion(s) ou insertion(s) d'acides aminés. De manière générale, les variantes présentent au moins 90% et de préférence au moins 95% d'homologie ou d'identité avec la séquence en acides aminés décrite par Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837), illustrée dans la Figure 1, le pourcentage d'homologie entre deux protéines étant défini tel qu'indiqué ci-dessous. Le terme variante est utilisé, dans le contexte de l'invention, de manière synonyme avec le terme analogue . Les variantes présentent aussi une activité d'inhibiteur de protéase à sérine. Il a été constaté que certaines modifications au niveau de la séquence en acides aminés de l'a1-AT peut conférer à la protéine une activité d'inhibiteur de protéase à sérine autre que celle normalement associée à l'a1-AT, par exemple une activité caractéristique de l'antithrombine III (Jallat et al., Protein Engineering, Vol. 1, NO 1, pp 29-35, 1986). Les variantes d'a1-AT de l'invention présentent une glycosylation identique ou différente de l'a1-AT humaine naturelle. Le terme variante englobe également des fragments de l'a1-AT et ses analogues qui présentent une activité d'inhibiteur de protéase à sérine, de préférence une activité d'a1-AT.In the context of the invention, the terms below have the following meanings
- a "variant" of a1-AT means a protein which differs from natural human a1-AT (mature or pre-protein) by one or more substitution (s), deletion (s) or insertion (s) amino acids. In general, the variants have at least 90% and preferably at least 95% of homology or identity with the amino acid sequence described by Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837), illustrated in FIG. 1, the percentage of homology between two proteins being defined as indicated below. The term variant is used, in the context of the invention, synonymously with the analogous term. The variants also exhibit serine protease inhibitor activity. It has been found that certain modifications in the amino acid sequence of a1-AT can confer on the protein a serine protease inhibitor activity other than that normally associated with a1-AT, for example a characteristic activity of antithrombin III (Jallat et al., Protein Engineering, Vol. 1, NO 1, pp 29-35, 1986). The variants of a1-AT of the invention exhibit an identical or different glycosylation from natural human a1-AT. The term variant also encompasses fragments of α1-AT and its analogs which exhibit serine protease inhibitor activity, preferably α1-AT activity.

- une activité d'inhibiteur de protéase à sérine signifie la capacité d'inhiber partiellement ou totalement toute protéase ayant un résidu sérine au sein de son site actif, par exemple la trypsine, l'élastine, la cathepsine G, la thrombine, la collagénase, la chymotrypsine et la plasmine. - a serine protease inhibitor activity means the capacity to partially or totally inhibit any protease having a serine residue within its active site, for example trypsin, elastin, cathepsin G, thrombin, collagenase , chymotrypsin and plasmin.

- "une activité de l'a1-AT" signifie une activité anti-élastase, déterminée selon la technique de Travis et Johnson, Meth. in Enzymol., 1981, vol. 80, pages 754-765. Cette technique est détaillée dans les exemples. L'activité peut également être déterminée selon la capacité de la protéine à inhiber la trypsine (voir Travis et Johnson, supra). De manière générale, pour les deux techniques, la protéine recombinante présente une activité d'inhibition d'au moins 30% et de préférence au moins 75%, par exemple 85% de celle de l'a1-AT humaine naturelle à molarité égale. Une troisième technique consiste en la détermination de la capacité de la protéine recombinante à hydrolyser le substrat Methoxy-L-Alanyl-L-Prolyl-L-Valine-Pnitroanilide (Massoud et al., supra). La capacité de la protéine à inhiber l'activité de chacune des protéases à sérine mentionnées ci-dessus peut aussi être utilisée comme indice de l'activité des protéines de l'invention (The Plasma Proteins", Second Edition,
Ed. Pulnam, Academic Press, 1975, p.241-242).- "an activity of a1-AT" means an anti-elastase activity, determined according to the technique of Travis and Johnson, Meth. in Enzymol., 1981, vol. 80, pages 754-765. This technique is detailed in the examples. Activity can also be determined based on the protein's ability to inhibit trypsin (see Travis and Johnson, supra). In general, for both techniques, the recombinant protein has an inhibition activity of at least 30% and preferably at least 75%, for example 85% of that of natural human A1-AT with equal molarity. A third technique consists in determining the capacity of the recombinant protein to hydrolyze the substrate Methoxy-L-Alanyl-L-Prolyl-L-Valine-Pnitroanilide (Massoud et al., Supra). The ability of the protein to inhibit the activity of each of the serine proteases mentioned above can also be used as an index of the activity of the proteins of the invention (The Plasma Proteins ", Second Edition,
Ed. Pulnam, Academic Press, 1975, p.241-242).

- monocotylédone signifie un végétal phanérogame angiosperme dont la tige et la racine sont (presque toujours) dépourvues de cambiums et donc de formations secondaires; la feuille est presque toujours pourvue de nervures parallèles; la graine renferme un embryon à un seul cotylédon. - monocotyledon means an angiosperm phanerogamous plant whose stem and root are (almost always) devoid of cambiums and therefore of secondary formations; the leaf is almost always provided with parallel veins; the seed contains an embryo with a single cotyledon.

- le pourcentage d'homologie entre deux séquences d'acides aminés est calculé comme étant le nombre d'acides aminés identiques plus le nombre d'acides aminés similaires dans l'alignement des deux séquences, divisé par la longueur des séquences entre deux positions données. Si, entre les deux positions données, les deux séquences n'ont pas la même longueur, le pourcentage d'homologie est le nombre d'acides aminés identiques et similaires, divisé par la longueur de la séquence la plus longue. Les acides aminés considérés comme étant "similaires" sont connus dans l'art, voir par exemple R.F. Feng, M.S. Jobson and R.F. Doolittle ; J. Mol. Evol. ; 1985 ; vol. 21 pages 112-115. Ils sont normalement considérés comme étant ceux qui, au sein d'une matrice de permutation, ont un coefficient de substitution positif. - the percentage of homology between two amino acid sequences is calculated as the number of identical amino acids plus the number of similar amino acids in the alignment of the two sequences, divided by the length of the sequences between two given positions . If, between the two given positions, the two sequences do not have the same length, the percentage of homology is the number of identical and similar amino acids, divided by the length of the longest sequence. Amino acids considered to be "similar" are known in the art, see for example R.F. Feng, M.S. Jobson and R.F. Doolittle; J. Mol. Evol. ; 1985; flight. 21 pages 112-115. They are normally considered to be those who, within a permutation matrix, have a positive substitution coefficient.

Selon une première variante de l'invention, la protéine recombinante à activité al-AT est nonglycosylée. Ce type de protéine peut être obtenu dans une cellule végétale en utilisant la séquence d'acide nucléique codant pour le polypeptide mature, c'est-àdire sans le peptide signal N-terminal de 24 acides aminés (voir par exemple Figure 1). Aucun autre signal n'est ajouté. Le polypeptide ainsi produit s'accumule dans le cytoplasme de la cellule. Il aura normalement un poids moléculaire inférieur d'environ l0kD à celui de l'al-AT humaine naturelle, c'est-à-dire autour de 45kDa, et une stabilité moindre dans le plasma. According to a first variant of the invention, the recombinant protein with al-AT activity is nonglycosylated. This type of protein can be obtained in a plant cell using the nucleic acid sequence coding for the mature polypeptide, that is to say without the N-terminal signal peptide of 24 amino acids (see for example Figure 1). No other signal is added. The polypeptide thus produced accumulates in the cytoplasm of the cell. It will normally have a molecular weight about 10kD lower than that of natural human al-AT, i.e. around 45kDa, and less stability in plasma.

Selon une variante préférée, la protéine de l'invention est glycosylée à l'un au moins des 3 sites naturels de glycosylation : Asn-46, Asn-83 ou Asn-247. According to a preferred variant, the protein of the invention is glycosylated at at least one of the 3 natural glycosylation sites: Asn-46, Asn-83 or Asn-247.

La glycosylation est de type mannosidique, polymannosidique ou de type complexe, ou un mélange des deux. L'expression entièrement glycosylée signifie, dans le contexte de l'invention, que la molécule en question est glycosylée aux 3 sites naturels de glycosylation.Glycosylation is of mannosidic, polymannosidic or complex type, or a mixture of both. The expression entirely glycosylated means, in the context of the invention, that the molecule in question is glycosylated at the 3 natural glycosylation sites.

Le ou les glucanne(s) de type mannosidique ont la structure GlcNAc2-Manl. Le ou les glucanne(s) polymannosidique(s) ont la structure GîcNAc2-Man2-9, par exemple GlcNAc2-Mang, GlcNAc2-Mana, GlcNAc2-Man6 ou
GlcNAc2-Man5, ou GlcNAc2-Man3.The mannosidic glucan (s) has the GlcNAc2-Manl structure. The polymannosidic glucan (s) has the structure GîcNAc2-Man2-9, for example GlcNAc2-Mang, GlcNAc2-Mana, GlcNAc2-Man6 or
GlcNAc2-Man5, or GlcNAc2-Man3.

Le ou les glucanne(s) de type complexe sont biantennés et ont une structure de base GlcNAc2-Man3 à laquelle sont éventuellement associés des résidus de xylose (Xyl), fucose (Fuc) et éventuellement galactose (Gal) ou N-acétylglucosamine (GlcNAc). Ils sont normalement exempts de résidus d'acide sialique, ce composé n'ayant pas jusqu'alors été mis en évidence dans les cellules végétales. The glucan (s) of complex type are biantennary and have a basic structure GlcNAc2-Man3 with which are possibly associated residues of xylose (Xyl), fucose (Fuc) and possibly galactose (Gal) or N-acetylglucosamine (GlcNAc ). They are normally free of sialic acid residues, this compound having not hitherto been detected in plant cells.

De préférence, le glycanne complexe est de type "phytohémagglutinine" (PHA) constitué d'une structure "core" GlcNAc2Man3 dont le mannose lié en ss porte un résidu de ss 1,2-xylose et dont le GlcNAc proximal porte un résidu d'a 1,3 fucose (GlcNAc2 (Fuc) Man3 (Xyl)). Ce genre de structure est fréquent pour les glycoprotéines de localisation vacuolaire ou extracellulaire. Le résidu de fucose a 1,3-lié peut éventuellement être absent. Preferably, the complex glycan is of the "phytohemagglutinin" (PHA) type consisting of a "core" structure GlcNAc2Man3 in which the mannose linked in ss carries a residue of ss 1,2-xylose and in which the proximal GlcNAc carries a residue of a 1.3 fucose (GlcNAc2 (Fuc) Man3 (Xyl)). This kind of structure is frequent for glycoproteins of vacuolar or extracellular localization. The 1,3-linked a fucose residue may possibly be absent.

Le glycanne complexe peut aussi être du type "Laccase" (Driouich et al, Regard sur la Biochimie, 1993, n"3, pp33-42) composé d'une structure de base
GlcNAc2 (Fuc) Man3 (Xyl) associée à deux chaînes latérales. Chaque chaîne latérale est constituée d'un résidu de ss 1,2 GlcNAc auquel est lié un résidu d'a 1,6 fucose et un résidu de ss 1,4 galactose.The complex glycan can also be of the "Laccase" type (Driouich et al, Regard sur la Biochimie, 1993, n "3, pp33-42) composed of a basic structure
GlcNAc2 (Fuc) Man3 (Xyl) associated with two side chains. Each side chain consists of a residue of ss 1.2 GlcNAc to which is linked a residue of a 1.6 fucose and a residue of ss 1.4 galactose.

La glycoprotéine de l'invention peut être glycosylée aux trois sites naturels (Asn-46, Asn-83 et
Asn-247) ou seulement à l'un ou deux d'entre eux.The glycoprotein of the invention can be glycosylated at three natural sites (Asn-46, Asn-83 and
Asn-247) or only one or two of them.

Parmi les variantes préférées, l'on peut citer des glycoprotéines portant exclusivement des glycannes polymannosidiques. Ces glycoprotéines présentent une très faible immunogénicité chez l'animal parce que ce type de glycosylation existe sous forme identique chez la plante et chez l'animal.Among the preferred variants, mention may be made of glycoproteins carrying exclusively polymannosidic glycans. These glycoproteins have very low immunogenicity in animals because this type of glycosylation exists in identical form in plants and animals.

On peut aussi citer les glycoprotéines portant exclusivement des glycannes de type complexe, par exemple deux ou trois glycannes de type PHA GlcNAc2 (Fuc) Man3 (Xyl)
La partie glucidique représente, normalement, entre 2 et 30%, par exemple 5 à 20% de la masse totale de la glycoprotéine de l'invention. Mention may also be made of glycoproteins carrying exclusively glycans of complex type, for example two or three glycans of PHA type GlcNAc2 (Fuc) Man3 (Xyl)
The carbohydrate part normally represents between 2 and 30%, for example 5 to 20% of the total mass of the glycoprotein of the invention.

La partie protéique de la glycoprotéine correspond à la partie protéique de toute protéine ou fragment de protéine présentant une activité a1-AT. il s'agit normalement du polypeptide mature d'al-AT humaine, mais peut également être celui d'animaux tels que le lapin ou le singe. The protein part of the glycoprotein corresponds to the protein part of any protein or protein fragment exhibiting a1-AT activity. it is normally the mature human al-AT polypeptide, but can also be that of animals such as rabbits or monkeys.

La séquence en acides aminés complète de l'a1-AT humaine, y compris le peptide signal N-terminal (Type M1 ), est décrite par Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837). En plus du type M1, il existe également les types M2 ou M3 (Val 213 - Asp 376 - Arg 101 ; Val 213 - Asp 376 - His 101, respectivement), ou une variante de M1, M2 ou M3 dans laquelle Val 213 est remplacé par Ala. Les protéines de l'invention peuvent comporter les séquences en acide aminés des types M1, M2 ou M3. The complete amino acid sequence of human a1-AT, including the N-terminal signal peptide (Type M1), is described by Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837). In addition to type M1, there are also types M2 or M3 (Val 213 - Asp 376 - Arg 101; Val 213 - Asp 376 - His 101, respectively), or a variant of M1, M2 or M3 in which Val 213 is replaced by Ala. The proteins of the invention can contain the amino acid sequences of types M1, M2 or M3.

La séquence en acides aminés peut aussi être celle des variantes Z ou S, associées à certains troubles pulmonaires. Ces variantes se distinguent du type M1 décrit par Long et al par Glu-342 o Lys (variante Z) et Glu-264 o Val (variante S). The amino acid sequence can also be that of the Z or S variants, associated with certain pulmonary disorders. These variants are distinguished from the type M1 described by Long et al by Glu-342 o Lys (variant Z) and Glu-264 o Val (variant S).

De manière générale, la protéine de l'invention peut comporter toute séquence en acides aminés se différenciant de la séquence naturelle par une ou plusieurs substitution(s), délétion(s) ou insertion(s) d'acides aminés. Normalement, ces variantes présentent une homologie, ou une identité, d'au moins 90% par exemple 95%, avec la séquence décrite par Long et al.(Biochemistry, 1984, vol. 23, pages 4828-4837
Figure 1).In general, the protein of the invention can comprise any amino acid sequence differentiating from the natural sequence by one or more substitution (s), deletion (s) or insertion (s) of amino acids. Normally, these variants exhibit homology, or identity, of at least 90%, for example 95%, with the sequence described by Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837
Figure 1).

Parmi les variantes préférées, l'on peut citer des séquences d'a1-AT dont la Met358 du site actif, a été modifié, par exemple remplacé par un acide aminé différent, tel que Arg, Leu, Ala, Ile ou Val. De plus,
Asp2 et Asp6 peuvent être remplacés par Asn. Among the preferred variants, there may be mentioned sequences of a1-AT in which the Met358 of the active site has been modified, for example replaced by a different amino acid, such as Arg, Leu, Ala, Ile or Val. Moreover,
Asp2 and Asp6 can be replaced by Asn.

Les variantes de la protéine de l'invention peuvent aussi comporter des fragments de la séquence décrite par Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837) et de ses analogues définis ci-dessus à condition que l'activité d'inhibiteur de protéase à sérine, et particulièrement celle de l'a1-AT, soit conservée. Ces fragments sont constitués d'environ 200 à 393 acides aminés consécutifs de la séquence d'a1AT, de préférence entre 250 et 390 acides aminés. Parmi les fragments préférés, on peut citer 1' l'a1AT mature humaine dont l'extrémité N terminale a été tronquée par la délétion d'environ 1 à 10 acides aminés. Variants of the protein of the invention may also include fragments of the sequence described by Long et al. (Biochemistry, 1984, vol. 23, pages 4828-4837) and its analogs defined above, provided that the activity of serine protease inhibitor, and in particular that of α1-AT, is preserved. These fragments consist of approximately 200 to 393 consecutive amino acids of the α1AT sequence, preferably between 250 and 390 amino acids. Among the preferred fragments, mention may be made of a mature human α1AT, the N terminal end of which has been truncated by the deletion of approximately 1 to 10 amino acids.

L'extrémité C terminale peut aussi être tronquée d'environ 1 à 20 acides aminés. Le site actif de la protéine se trouvant autour des acides aminés Met-358 à Glu-363, il est important de ne pas effectuer de délétion C terminale de longueur trop importante afin de ne pas affecter le site actif. The C-terminus can also be truncated by about 1 to 20 amino acids. Since the active site of the protein is located around amino acids Met-358 to Glu-363, it is important not to carry out too long a C terminal deletion in order not to affect the active site.

Outre la séquence en acides aminés responsable de l'activité a1-AT proprement dite, la protéine de l'invention peut comprendre différents signaux peptidiques responsables de l'adressage de la protéine vers les différents compartiments cellulaires où sont effectuées les modifications co- et posttraductionnelles. Ces signaux sont le peptide signal
N-terminal, également connu sous le nom de prépeptide, le signal de type KDEL responsable de la rétention de la protéine dans le réticulum endoplasmique et le signal d'adressage vacuolaire, ou propeptide.In addition to the amino acid sequence responsible for the a1-AT activity proper, the protein of the invention can include various peptide signals responsible for addressing the protein to the various cellular compartments where co- and post-translational modifications are carried out. . These signals are the signal peptide
N-terminal, also known as prepeptide, the KDEL type signal responsible for the retention of the protein in the endoplasmic reticulum and the vacuolar addressing signal, or propeptide.

En effet, dans la cellule végétale, l'adressage des protéines est basé sur le même principe que dans les cellules animales. A partir de l'ADN chromosomique, le gène est transcrit en ARN messager, puis traduit en protéine au niveau des ribosomes. Si la protéine naissante possède un peptide signal Nterminal ou prépeptide, elle pénètre dans le réticulum endoplasmique où ont lieu un certain nombre de maturations post-traductionnelles, notamment le clivage du peptide signal, les N-glycosylations conduisant aux glycannes polymannosidiques, et la formation des ponts disulfures. La présence d'un peptide KDEL, HEKDEL ou SEKDEL à l'extrémité C terminale provoque la rétention de la protéine dans le réticulum endoplasmique et, dans certains cas, l'accumulation de protéines dans des vésicules du réticulum endoplasmique. Lors de la rétention d'une protéine dans le réticulum endoplasmique, le signal
KDEL (HDEL ou SEKDEL) n'est pas clivé et il subsiste sur la protéine mature.In fact, in the plant cell, the addressing of proteins is based on the same principle as in animal cells. From chromosomal DNA, the gene is transcribed into messenger RNA, then translated into protein at the ribosome level. If the nascent protein has an Nterminal signal peptide or prepeptide, it enters the endoplasmic reticulum where a number of post-translational maturations take place, in particular the cleavage of the signal peptide, the N-glycosylations leading to polymannosidic glycans, and the formation of disulfide bridges. The presence of a KDEL, HEKDEL or SEKDEL peptide at the C-terminus causes the retention of the protein in the endoplasmic reticulum and, in some cases, the accumulation of proteins in vesicles of the endoplasmic reticulum. When a protein is retained in the endoplasmic reticulum, the signal
KDEL (HDEL or SEKDEL) is not cleaved and it remains on the mature protein.

En l'absence d'un signal de rétention du type
KDEL, la protéine est transportée vers l'appareil de
Golgi et subit, au cours de ce transport, une première modification de ses chaînes de glycannes (suppression des glucoses terminaux). Dans l'appareil de Golgi, la maturation des glycannes se poursuit par la suppression des résidus et l'addition de résidus xylose et fucose pour former les glycannes complexes.In the absence of a retention signal of the type
KDEL, the protein is transported to the
Golgi and undergoes, during this transport, a first modification of its glycan chains (suppression of terminal glucoses). In the Golgi apparatus, the maturation of the glycans continues by the removal of the residues and the addition of xylose and fucose residues to form the complex glycans.

En l'absence d'un signal d'adressage vacuolaire ou "propeptide", la protéine est alors sécrétée et s accumule dans l'espace intercellulaire. Lorsque la protéine possède à l'extrémité N-terminale ou Cterminale un propeptide, la proprotéine est dirigée vers la vacuole. A l'entrée dans la vacuole, le propeptide est clivé et certaines maturations finales de glycannes sont réalisées.In the absence of a vacuolar or "propeptide" addressing signal, the protein is then secreted and accumulates in the intercellular space. When the protein has a propeptide at the N-terminal or Cterminal end, the proprotein is directed to the vacuole. At the entrance to the vacuole, the propeptide is cleaved and certain final maturation of glycans are carried out.

Parmi ces différents signaux, le prépeptide, responsable de l'adressage de la protéine dans le réticulum endoplasmique, est toujours présent. Il s'agit normalement d'un peptide signal N-terminal hydrophobe ayant entre 10 et 40 acides aminés. il est normalement d'origine animale ou végétale. il peut en effet s'agir du prépeptide naturellement associé à l'a1-AT humaine (PA), ou d'un prépeptide provenant d'une autre protéine humaine, par exemple celui de la sérum albumine humaine. Par exemple, il s'agit d'un prépeptide d'origine végétale, par exemple celui de la sporamine (PS), de la lectine d'orge, de l'extensine végétale (pEXT), de l'a-mating factor, des protéines végétales impliquées dans la défense contre les microorganismes (PRla et PRS, "pathogenesis related proteins"). Among these different signals, the prepeptide, responsible for addressing the protein in the endoplasmic reticulum, is always present. It is normally a hydrophobic N-terminal signal peptide having between 10 and 40 amino acids. it is normally of animal or vegetable origin. it may indeed be the prepeptide naturally associated with human A1-AT (PA), or a prepeptide originating from another human protein, for example that of human serum albumin. For example, it is a vegetable prepeptide, for example that of sporamine (PS), barley lectin, vegetable extensin (pEXT), a-mating factor, plant proteins involved in defense against microorganisms (PRla and PRS, "pathogenesis related proteins").

Normalement, le peptide signal est clivé par un signal peptidase dès l'introduction co-traductionnelle du polypeptide naissant dans la lumière du réticulum endoplasmique (RER) . La protéine mature ne comporte plus cette extension N-terminale. Normally, the signal peptide is cleaved by a signal peptidase upon the co-translational introduction of the nascent polypeptide into the lumen of the endoplasmic reticulum (RER). The mature protein no longer has this N-terminal extension.

La protéine de l'invention peut, outre le prépeptide, aussi comporter un signal de rétention endoplasmique, consistant en les peptides KDEL, SEKDEL ou HDEL. Ces signaux se trouvent normalement à l'extrémité C-terminale de la protéine et subsistent sur la protéine mature. La présence de ce signal sur les protéines de l'invention est avantageuse pour plusieurs raisons : d'une part, la rétention de la protéine dans le réticulum endoplasmique a tendance à augmenter les rendements en protéines recombinantes. The protein of the invention may, in addition to the prepeptide, also include an endoplasmic retention signal, consisting of the peptides KDEL, SEKDEL or HDEL. These signals are normally found at the C-terminus of the protein and remain on the mature protein. The presence of this signal on the proteins of the invention is advantageous for several reasons: on the one hand, the retention of the protein in the endoplasmic reticulum tends to increase the yields of recombinant proteins.

D'autre part, la maturation de la glycosylation polymannosique en glycannes complexes n'aura pas lieu ; la protéine conserve donc la glycosylation polymannosique, minimisant le risque de réactions immunologiques indésirables lorsque la protéine sera administrée à l'homme comme médicament. Selon cette variante de l'invention, le glycoprotéine comporte donc la séquence en acides aminés d'a1-AT, un signal du type KDEL, au moins un glycanne de type polymannosique, et est exempt de glycannes de type complexe. Selon l'invention, ce type de protéine peut aussi être obtenu en utilisant des mutants de plantes incapables de fabriquer la N-acétyl glucosaminyl transférase (von Schaewen et al., Plant Physiol. 1993 102: 1109-1118), et donc incapables de produire des glycannes complexes.On the other hand, the maturation of polymannosic glycosylation into complex glycans will not take place; the protein therefore retains polymannosic glycosylation, minimizing the risk of undesirable immunological reactions when the protein is administered to humans as a medicine. According to this variant of the invention, the glycoprotein therefore comprises the amino acid sequence of a1-AT, a signal of the KDEL type, at least one glycan of the polymannosic type, and is free of glycans of the complex type. According to the invention, this type of protein can also be obtained by using plant mutants incapable of manufacturing N-acetyl glucosaminyl transferase (von Schaewen et al., Plant Physiol. 1993 102: 1109-1118), and therefore incapable of produce complex glycans.

La protéine de l'invention peut, outre le prépeptide, comporter aussi un signal d'adressage vacuolaire ou "propeptide". En présence d'un tel signal, la protéine est adressée aux vacuoles des tissus aqueux, par exemple les feuilles, ainsi qu'aux corps protéiques des tissus de réserve, par exemple les graines, tubercules et racines. L'adressage de la protéine vers les corps protéiques de la graine est particulièrement intéressant en raison de la capacité de la graine à accumuler des protéines, jusqu'à 40% des protéines par rapport à la matière sèche, dans des organites cellulaires dérivés des vacuoles, appelés corps protéiques et en raison de la possibilité de stocker plusieurs années les graines contenant les protéines recombinantes à l'état déshydraté. The protein of the invention can, in addition to the prepeptide, also include a vacuolar addressing signal or "propeptide". In the presence of such a signal, the protein is addressed to the vacuoles of the aqueous tissues, for example the leaves, as well as to the protein bodies of the reserve tissues, for example the seeds, tubers and roots. The targeting of the protein to the protein bodies of the seed is particularly interesting because of the capacity of the seed to accumulate proteins, up to 40% of the proteins relative to the dry matter, in cellular organelles derived from vacuoles. , called protein bodies and because of the possibility of storing for several years the seeds containing the recombinant proteins in the dehydrated state.

Comme propeptide, on peut utiliser un signal d'origine animale ou végétale, les signaux végétaux étant préférés, par exemple la pro-sporamine, ou la lectine d'orge. Le propeptide peut être N-terminal ("N-terminal targeting peptide" ou NTTP), ou C terminal (CTTP) ou peut consister en une séquence interne à la protéine. Dans la mesure où le propeptide est normalement clivé dès l'entrée de la protéine dans la vacuole, il n'est pas présent dans la protéine mature. Pour un adressage vacuolaire, on peut utiliser une combinaison peptide signal et propeptide Nterminal de sporamine de patate douce (PPS). As propeptide, a signal of animal or vegetable origin can be used, plant signals being preferred, for example pro-sporamine, or barley lectin. The propeptide can be N-terminal ("N-terminal targeting peptide" or NTTP), or C terminal (CTTP) or can consist of a sequence internal to the protein. Since the propeptide is normally cleaved upon entry of the protein into the vacuole, it is not present in the mature protein. For vacuolar addressing, a combination of signal peptide and Nterminal propeptide of sweet potato sporamine (PPS) can be used.

Selon une autre variante de l'invention, la protéine de l'invention peut être sous forme de protéine de fusion, en particulier avec une protéine végétale. La protéine végétale peut être choisie afin d'augmenter le rendement ou de faciliter la sécrétion et la purification. La protéine de fusion peut aussi être choisie afin de permettre le ciblage de l'al-AT ou de faciliter son transport. According to another variant of the invention, the protein of the invention can be in the form of a fusion protein, in particular with a vegetable protein. The vegetable protein can be chosen in order to increase the yield or to facilitate secretion and purification. The fusion protein can also be chosen in order to allow targeting of the al-AT or to facilitate its transport.

L'objectif principal de l'invention étant de produire l'a1-AT recombinante dans des cellules végétales monocotylédones, 1 invention vise également les acides nucléiques codant pour les protéines, et pour les signaux d'adressage, éventuellement en association avec des séquences régulatrices adéquates, permettant l'expression de l'al-AT dans la cellule végétale. The main objective of the invention being to produce recombinant A1-AT in monocotyledonous plant cells, the invention also relates to the nucleic acids coding for the proteins, and for the addressing signals, possibly in association with regulatory sequences. adequate, allowing expression of al-AT in the plant cell.

La séquence d'acide nucléique codant pour l'a1-
AT, ou pour ses variantes ou les fragments définis cidessus, peut être de l'ADNc ou de l'ADN génomique avec ses introns. Normalement, il s'agit d'ADNc, une séquence appropriée est illustrée la Figure 1 (Long et al, Biochemistry, 1984, vol. 23, pages 4828-4837).The nucleic acid sequence encoding a1-
AT, or for its variants or the fragments defined above, can be cDNA or genomic DNA with its introns. Normally, this is cDNA, an appropriate sequence is illustrated in Figure 1 (Long et al, Biochemistry, 1984, vol. 23, pages 4828-4837).

Toute séque d'autre part, des séquences régulatrices de transcription reconnues par une cellule végétale monocotylédone. Les séquences régulatrices comprennent un ou plusieurs promoteurs d'origine végétale plus particulièrement d'origine monocotylédone, ou virale ou provenant d'Agrobacterium tumefaciens. il peut s'agir d'un promoteur constitutif, par exemple le promoteur actine de riz, ou des promoteurs spécifiques de certains tissus comme le grain, ou spécifiques de certaines phases de développement de la plante monocotylédone.On the other hand, any transcriptional regulatory sequences recognized by a monocotyledonous plant cell. The regulatory sequences include one or more promoters of plant origin, more particularly of monocotyledonous, or viral or from Agrobacterium tumefaciens origin. it can be a constitutive promoter, for example the rice actin promoter, or promoters specific for certain tissues such as grain, or specific for certain phases of development of the monocotyledonous plant.

Comme promoteurs spécifiques de graines, on peut citer le promoteur du gène gamma (g) zéine de maïs (Reina et al, 1990).
il peut être envisagé d'utiliser des "enhancers" pour améliorer l'efficacité d'expression.As specific seed promoters, there may be mentioned the promoter of the gamma (g) zein gene from corn (Reina et al, 1990).
it can be envisaged to use "enhancers" to improve the efficiency of expression.

Les séquences régulatrices de terminaison sont d'origine végétale ou virale ou provenant d'Agrobacterium tumefaciens, et sont fonctionnelles dans des cellules végétales monocotylédones. The termination regulatory sequences are of plant or viral origin or from Agrobacterium tumefaciens, and are functional in monocotyledonous plant cells.

Selon une variante, le gène chimérique de l'invention comprend en outre une séquence codant pour un peptide signal permettant la sécrétion de la protéine, et éventuellement une séquence codant pour un signal de rétention endoplasmique ou pour un signal d'adressage vacuolaire. According to a variant, the chimeric gene of the invention further comprises a sequence coding for a signal peptide allowing the secretion of the protein, and optionally a sequence coding for an endoplasmic retention signal or for a vacuolar addressing signal.

Les promoteurs semences spécifiques sont particulièrement avantageux en association avec un signal d'adressage vacuolaire (prépropeptide). Specific seed promoters are particularly advantageous in combination with a vacuolar addressing signal (prepropeptide).

Dans le cas où des introns hétérologues sont utilisés en combinaison avec 1'ADNc d'al-AT, bien entendu, le gène chimérique comprend également ces introns. In the case where heterologous introns are used in combination with the al-AT cDNA, of course, the chimeric gene also includes these introns.

L'invention vise également des plasmides ou vecteurs caractérisés en ce qu'ils contiennent au moins l'une des séquences d'acide nucléique, de préférence un gène chimérique, selon l'invention. De préférence, les plasmides et vecteurs permettent la transformation stable de la plante, par exemple les plasmides Ti d'Agrobacterium, des vecteurs viraux tels que les Geminivirus. The invention also relates to plasmids or vectors characterized in that they contain at least one of the nucleic acid sequences, preferably a chimeric gene, according to the invention. Preferably, the plasmids and vectors allow the stable transformation of the plant, for example the Ti plasmids of Agrobacterium, viral vectors such as the Geminiviruses.

Tous les moyens connus pour introduire de l'ADN étranger dans les cellules végétales peuvent être utilisés, par exemple Agrobacterium, électroporation, transformation de protoplastes, bombardement avec canon à particules, ou pénétration d'ADN dans des cellules comme le pollen, la microspore, la graine et l'embryon immature, suspensions cellulaires embryogènes et non embryogènes, inflorescence immature et vecteurs viraux tels que les Geminivirus. La séquence de l'invention est introduite dans un vecteur approprié avec toutes les séquences régulatrices nécessaires tels que promoteurs, terminateurs, etc... ainsi que toute séquence nécessaire pour sélectionner les transformants. All known means for introducing foreign DNA into plant cells can be used, for example Agrobacterium, electroporation, transformation of protoplasts, bombardment with a particle gun, or penetration of DNA into cells such as pollen, microspore, seed and immature embryo, embryogenic and non-embryogenic cell suspensions, immature inflorescence and viral vectors such as Geminiviruses. The sequence of the invention is introduced into an appropriate vector with all the necessary regulatory sequences such as promoters, terminators, etc. as well as any sequence necessary for selecting the transformants.

L'intégration de l'acide nucléique dans le génome peut éventuellement avoir lieu par recombinaison homologue. Dans ce cas, l'acide nucléique transformant comporte, sur chaque extrémité, une séquence homologue aux séquences qui jouxtent le site d'insertion souhaité dans le génome. Integration of the nucleic acid into the genome can possibly take place by homologous recombination. In this case, the transforming nucleic acid comprises, on each end, a sequence homologous to the sequences which adjoin the desired site of insertion into the genome.

L'invention concerne également les cellules végétales monocotylédones transformées avec les séquences de l'invention, et capable de produire une ou plusieurs protéine(s) ayant une activité d'inhibiteur de protéase à serine et, en particulier, de l'a1-AT.
il peut s'agir de cultures de cellules végétales in vitro, par exemple en milieu liquide. Différents modes de culture ("batch", "fed batch" ou en continu) pour ce type de cellules sont actuellement à l'étude.The invention also relates to monocotyledonous plant cells transformed with the sequences of the invention, and capable of producing one or more protein (s) having a serine protease inhibitor activity and, in particular, of α1-AT .
it can be cultures of plant cells in vitro, for example in a liquid medium. Different culture modes ("batch", "fed batch" or continuous) for this type of cells are currently being studied.

Les cultures en "batch" sont comparables à celles effectuées en erlenmeyer dans la mesure où le milieu n' est pas renouvelé, les cellules ne disposent ainsi que d'une quantité limitée d'éléments nutritifs. La culture en "fed batch" correspond quant à elle à une culture en "batch" avec une alimentation programmée en substrat. Pour une culture en continu, les cellules sont alimentées en permanence avec du milieu nutritif.The batch cultures are comparable to those carried out in an Erlenmeyer flask insofar as the medium is not renewed, the cells thus have only a limited quantity of nutritive elements. The "fed batch" culture corresponds to a "batch" culture with a programmed substrate feed. For a continuous culture, the cells are continuously supplied with nutritive medium.

Un volume égal du mélange biomasse-milieu est ôté afin de maintenir le volume du réacteur constant. Les quantités de biomasse végétale envisageables avec des cultures en bioréacteurs sont variables selon l'espèce végétale, le mode de culture et le type de bioréacteur.An equal volume of the biomass-medium mixture is removed in order to keep the volume of the reactor constant. The quantities of plant biomass that can be envisaged with cultures in bioreactors vary according to the plant species, the culture method and the type of bioreactor.

Les cellules de l'invention peuvent aussi être immobilisées, ce qui permet d'obtenir une production constante et prolongée d'al-AT. La séparation de l'al
AT et la biomasse végétale est aussi facilitée. Comme méthode d'immobilisation, on peut citer l'immobilisation en billes d'alginate, d'agar, à l'intérieur de mousse de polyuréthane, ou bien encore dans des fibres creuses.The cells of the invention can also be immobilized, which makes it possible to obtain a constant and prolonged production of al-AT. The separation of al
AT and plant biomass is also facilitated. As immobilization method, mention may be made of immobilization in alginate or agar beads, inside polyurethane foam, or even in hollow fibers.

Au lieu de produire l'a1-AT de l'invention par culture de cellules végétales, on peut régénérer des plantes chimériques ou transgéniques à partir d'explants transformés, en ayant recours à des techniques connues en soi. Instead of producing the α1-AT of the invention by culturing plant cells, it is possible to regenerate chimeric or transgenic plants from transformed explants, using techniques known per se.

Comme plantes préférées, on peut citer toutes les plantes monocotylédones. On peut citer les céréales telles que le blé, le maïs, le riz, l'orge, le sorgho et l'avoine, mais aussi la canne à sucre, l'asperge et la banane. As preferred plants, mention may be made of all monocotyledonous plants. Cereals such as wheat, corn, rice, barley, sorghum and oats, but also sugar cane, asparagus and bananas can be mentioned.

L'invention concerne également les graines des plantes transgéniques capables de produire l'al-AT ainsi que leurs descendances. The invention also relates to the seeds of transgenic plants capable of producing al-AT and their progeny.

Selon le procédé de l'invention, les protéines sont récupérées, et éventuellement purifiées, afin de permettre leur utilisation dans un grand nombre d'applications. According to the process of the invention, the proteins are recovered, and possibly purified, in order to allow their use in a large number of applications.

Les méthodes de récupération (extraction) et de purification des protéines sont choisies en fonction de la méthode de production, c'est-à-dire cellules en culture ou plantes entières, et éventuellement de l'adressage mis en oeuvre. The methods of recovery (extraction) and purification of proteins are chosen according to the production method, that is to say cells in culture or whole plants, and optionally the addressing used.

L'extraction est normalement faite par broyage des tissus, par exemple feuilles ou grains, dans un tampon approprié, filtrage du broyat, précipitation des protéines dans le surnageant, centrifugation et reprise du culot dans un tampon approprié avec dialyse. Une étape de purification partielle peut aussi être effectuée à ce stade par chromatographie sur colonne d'échangeuse d'ions. The extraction is normally carried out by grinding the tissues, for example leaves or grains, in an appropriate buffer, filtering the ground material, precipitation of the proteins in the supernatant, centrifugation and resumption of the pellet in an appropriate buffer with dialysis. A partial purification step can also be carried out at this stage by chromatography on an ion exchange column.

L'invention vise aussi des anticorps monoclonaux ou polyclonaux capables de reconnaître spécifiquement la protéine de l'invention. Ces anticorps peuvent être utilisés dans la purification des protéines de l'invention et dans le suivi des patients. The invention also relates to monoclonal or polyclonal antibodies capable of specifically recognizing the protein of the invention. These antibodies can be used in the purification of the proteins of the invention and in the monitoring of patients.

L'invention vise en outre un produit pharmaceutique comprenant une ou plusieurs protéine(s) de l'invention en association avec un excipient acceptable du point de vue physiologique. The invention further relates to a pharmaceutical product comprising one or more protein (s) of the invention in association with a physiologically acceptable excipient.

La composition pharmaceutique de l'invention peut être administrée sous forme d'aérosol (particulièrement appropriée, s'il s'agit de l'al-AT non-glycosylée) pour injection nasale, ou par voie intraveineuse, sous-cutanée, topique ou percutanée.
il est également possible d'utiliser un implant sous-cutané des cellules végétales transformées sans purification de l'a1-AT, isolées dans une membrane semi-perméable laissant passer la protéine active. La ou les protéine(s) de l'invention peut ou peuvent être administrée(s) en forme de liposome(s), encapsidée(s) ou conjuguée(s) à une molécule de ciblage. The pharmaceutical composition of the invention can be administered in the form of an aerosol (particularly suitable, if it is non-glycosylated al-AT) for nasal injection, or by intravenous, subcutaneous, topical or percutaneous.
it is also possible to use a subcutaneous implant of transformed plant cells without purification of the a1-AT, isolated in a semi-permeable membrane allowing the active protein to pass. The protein (s) of the invention can or can be administered in the form of a liposome (s), encapsidated (s) or conjugated (s) to a targeting molecule.

L'invention vise également l'utilisation de la protéine de l'invention pour la préparation d'un médicament pour le traitement de conditions liées à une déficience en al-antitrypsine. Les maladies qui sont susceptibles d'être traitées comprennent la mucoviscidose, le choc septique, et l'emphysème pulmonaire. La composition pharmaceutique de l'invention peut aussi être utilisée comme antirhumatoïde grâce à son effet anti-collagénase. The invention also relates to the use of the protein of the invention for the preparation of a medicament for the treatment of conditions linked to a deficiency in al-antitrypsin. Diseases that are susceptible to treatment include cystic fibrosis, septic shock, and pulmonary emphysema. The pharmaceutical composition of the invention can also be used as an anti-rheumatoid thanks to its anti-collagenase effect.

Les protéines de l'invention peuvent également être utilisées en cosmétologie. Leur activité anticollagénase empêche la dégradation du tissu conjonctif et en particulier, du collagène et de l'élastine. The proteins of the invention can also be used in cosmetology. Their anticollagenase activity prevents the breakdown of connective tissue and in particular, collagen and elastin.

Selon cette variante de l'invention, les protéines peuvent être purifiées ou peuvent être utilisées sous forme d'extraits de toute ou partie de la plante ou de la graine ou d'extraits de culture cellulaire.According to this variant of the invention, the proteins can be purified or can be used in the form of extracts of all or part of the plant or of the seed or extracts of cell culture.

L'invention vise l'utilisation de la protéine de l'invention dans une application industrielle. The invention relates to the use of the protein of the invention in an industrial application.

Les protéines de l'invention peuvent aussi être utilisées comme réactifs anti-protéases sous forme de préparations enzymatiques industrielles. The proteins of the invention can also be used as anti-protease reagents in the form of industrial enzymatic preparations.

L'invention concerne également un extrait de plante contenant 1 à 90% environ d'une protéine selon l'invention, et notamment l'al-antitrypsine. Cet extrait peut être utilisé comme médicament, notamment en thérapie de conditions liées à une déficience en a1-
AT, notamment l'emphysème pulmonaire, la mucoviscidose, le choc septique ou comme antirhumatoïde. L'invention concerne également une composition pharmaceutique comprenant un tel extrait de plante en association avec un excipient acceptable du point de vue physiologique, de préférence pour l'administration par voie orale ou nasale, par exemple sous forme d'aérosol. The invention also relates to a plant extract containing approximately 1 to 90% of a protein according to the invention, and in particular al-antitrypsin. This extract can be used as a medicament, in particular in therapy of conditions linked to a deficiency in a1-
AT, including pulmonary emphysema, cystic fibrosis, septic shock or as an anti-rheumatoid. The invention also relates to a pharmaceutical composition comprising such a plant extract in combination with an excipient which is physiologically acceptable, preferably for administration by the oral or nasal route, for example in the form of an aerosol.

La Figure 1 illustre l'ADNc et la séquence en acide aminés de l'al-AT humaine (type M). L'extrémité NH2 de la protéine mature (Glu) est indiqué comme +1. Les acides aminés -1 à -24 représentent le peptide signal
N-terminal de la protéine immature. Le site réactif (Met) est indiqué par un cercle solide (i). Quatre sites de glycosylation potentiels sont présents dans la protéine, indiqués par des diamants noirs (+), mais seulement trois d'entre eux portent des chaînes glycosidiques (Long et al Supra).Figure 1 illustrates the cDNA and amino acid sequence of human al-AT (type M). The NH2 end of the mature protein (Glu) is indicated as +1. Amino acids -1 to -24 represent the signal peptide
N-terminal of the immature protein. The reactive site (Met) is indicated by a solid circle (i). Four potential glycosylation sites are present in the protein, indicated by black diamonds (+), but only three of them carry glycosidic chains (Long et al Supra).

La Figure 2 illustre la carte schématique du plasmide pUC-AAT. L'ADNc de AAT est inséré au site PstI de pUC18. PA (boîte en pointillés) correspond à la séquence du peptide signal AAT. AAT (boîte en noir) correspond à la séquence codant l'al-antitrypsine humaine. Ap (boîte en blanc) correspond au gène conférant la résistance à l'ampicilline.Figure 2 illustrates the schematic map of the plasmid pUC-AAT. The AAT cDNA is inserted at the PstI site of pUC18. PA (dotted box) corresponds to the sequence of the AAT signal peptide. AAT (black box) corresponds to the sequence encoding human al-antitrypsin. Ap (white box) corresponds to the gene conferring resistance to ampicillin.

EXEMPLES
I. CONSTRUCTIONS
L'al-antitrypsine humaine (AAT), une glycoprotéine de 53 kDa, est naturellement synthétisée sous forme d'un précurseur de 418 acides aminés. La protéine mature AAT est constituée de 394 acides aminés et est clivée au site Ala - Glu de son peptide signal de 24 acides aminés. La séquence complète du cDNA ainsi que la séquence peptidique sont décrites par Long et ai. al.(Biochemistry, 1984, vol. 23, pages 4828-4837).EXAMPLES
I. CONSTRUCTIONS
Human al-antitrypsin (AAT), a 53 kDa glycoprotein, is naturally synthesized as a precursor of 418 amino acids. The mature protein AAT consists of 394 amino acids and is cleaved at the Ala - Glu site of its 24 amino acid signal peptide. The complete sequence of cDNA as well as the peptide sequence are described by Long et al. al. (Biochemistry, 1984, vol. 23, pages 4828-4837).

La séquence complète de l'ADNc est renfermée dans le plasmide pUC18 commercialisé par Clontech. Ce plasmide est appelé pUC-AAT (Figure 2). The complete sequence of the cDNA is contained in the plasmid pUC18 marketed by Clontech. This plasmid is called pUC-AAT (Figure 2).

L'ADNc de AAT, fragment d'ADN digéré par StuI et
SalI et isolé à partir de pUC18, a été cloné aux sites
XbaI traité à la Klenow et SalI du vecteur pBSIISK+ commercialisé par Stratagene Cloning Systems. Le plasmide résultant a été appelé pBIOC30. AAT cDNA, a DNA fragment digested with StuI and
SalI and isolated from pUC18, was cloned at the sites
XbaI treated with Klenow and SalI with the vector pBSIISK + marketed by Stratagene Cloning Systems. The resulting plasmid was called pBIOC30.

A. CONSTRUCTION DES VECTEURS pBIOC31 ET pBIOC32.A. CONSTRUCTION OF THE pBIOC31 AND pBIOC32 VECTORS.

MODIFICATION DE L'EXTREMITE 3' DU cDNA CODANT POUR
L'al-ANTITRYPSINE
A.1. CONSTRUCTION DU PLASMIDE pBIOC31 NE
CONTENANT QUE LE PREMIER CODON STOP DE L'1-
ANTITRYPSINE
Pour favoriser l'expression dans les plantes, seul le premier codon stop (TAA) de la protéine alantitrypsine humaine (AAT) a été préservé. Le vecteur pBIOC30 a donc été modifié à l'extrémité 3' du cDNA codant pour AAT.MODIFICATION OF THE 3 'END OF THE cDNA CODING FOR
Al-ANTITRYPSIN
A.1. CONSTRUCTION OF THE pBIOC31 NE PLASMID
CONTAINING THE FIRST CODON STOP FROM 1-
ANTITRYPSIN
To promote expression in plants, only the first stop codon (TAA) of the human alantitrypsin protein (AAT) was preserved. The vector pBIOC30 was therefore modified at the 3 'end of the cDNA coding for AAT.

Le fragment EcoRV-SalI de pBIOC30 a été remplacé par le fragment EcoRV-SalI issu de l'amplification PCR réalisée sur pBIOC30 à l'aide des 2 oligodésoxynucléotides, 5' CCACGATATCATCACCAAGTTCC 3' (contenant le site unique EcoRV) et 5' cggtcgacgaattcCAGTTATTTTTGGGTGGGATTC 3' (contenant les sites SalI et EcoRi, et le premier codon stop de l'AAT) . L'amplification PCR du fragment EcoRV-SalI a été réalisée dans 100 ul de milieu réactionnel comprenant 10 ul de tampon Taq DNA polymérase x10 (500 mM KCl, 100 mM Tris-HCl, pH9,0 et 1% Triton x100), 6 p1 de 25 mM MgCl2, 3 ul de 10 mM dNTP (dATP, dCTP, dGTP et dTTP), 100 pM de chacun des 2 oligodésoxynucléotides décrits ci-dessus, 5 ng d'ADN matrice (vecteur pBIOC30), 2,5 U de Taq DNA polymérase (Promega) et 2 gouttes d'huile de vaseline. L'ADN a été dénaturé à 940C pendant 5 min., soumis à 30 cycles constitués chacun de 1 min. de dénaturation à 94"C, 1 min. d'hybridation à 70"C et de 1 min. d'élongation à 72"C, puis l'élongation à 72"C a été poursuivie pendant 5 min. Cette réaction PCR a été réalisée dans la machine "DNA Thermal Cycler" de PERKIN ELMER CETUS. The EcoRV-SalI fragment of pBIOC30 was replaced by the EcoRV-SalI fragment resulting from the PCR amplification carried out on pBIOC30 using the 2 oligodeoxynucleotides, 5 'CCACGATATCATCACCAAGTTCC 3' (containing the unique site EcoRV) and 5 'cggtcgacgaattcCAGTTATTTTTGGTG '(containing the SalI and EcoRi sites, and the first stop codon of the AAT). The PCR amplification of the EcoRV-SalI fragment was carried out in 100 μl of reaction medium comprising 10 μl of Taq DNA polymerase x10 buffer (500 mM KCl, 100 mM Tris-HCl, pH9.0 and 1% Triton x100), 6 p1 25 mM MgCl2, 3 μl of 10 mM dNTP (dATP, dCTP, dGTP and dTTP), 100 μM of each of the 2 oligodeoxynucleotides described above, 5 ng of template DNA (vector pBIOC30), 2.5 U of Taq DNA polymerase (Promega) and 2 drops of petrolatum oil. The DNA was denatured at 940C for 5 min., Subjected to 30 cycles each consisting of 1 min. denaturation at 94 "C, 1 min. hybridization at 70" C and 1 min. elongation at 72 "C, then the elongation at 72" C was continued for 5 min. This PCR reaction was carried out in the "DNA Thermal Cycler" machine from PERKIN ELMER CETUS.

L'huile a été éliminée par extraction au chloroforme. The oil was removed by extraction with chloroform.

Puis, les fragments d'ADN du milieu réactionnel ont été précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés et digérés par les 2 enzymes de restriction EcoRV et
SalI. Les fragments d'ADN digérés issus de PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à ltéthanol 70%, séchés, puis ligués à l'ADN plasmidique pBIOC30 digéré par EcoRV et SalI, purifié par électrophorèse sur gel d'agarose 0,8%, électroélué, soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 pl en présence de 1 p1 de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bacteries, Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983). L'ADN plasmidique des clones obtenus, sélectionnés sur 50 ,ug/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et
Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit de séquençage T7 commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977). Le plasmide résultant a été appelé pBIOC31.Then, the DNA fragments of the reaction medium were precipitated in the presence of 1/10 of volume of 3M sodium acetate pH 4.8 and 2.5 volumes of absolute ethanol at -80 C for 30 min., Centrifuged at 12000g for 30 min., Washed with 70% ethanol, dried and digested with the 2 restriction enzymes EcoRV and
SalI. The digested DNA fragments from PCR were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 of volume of 3M sodium acetate pH4.8 and 2.5 volumes of absolute ethanol at -80 ° C for 30 min., centrifuged at 12000 g for 30 min., washed with 70% ethanol, dried, then ligated to plasmid DNA pBIOC30 digested with EcoRV and SalI, purified by 0.8% agarose gel electrophoresis, electroeluted, subjected to alcoholic precipitation, dried and dephosphorylated by the enzyme calf intestine alkaline phosphatase (Boehringer Mannheim) according to the manufacturer's recommendations. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments resulting from the PCR amplification described above in a 10 μl reaction medium in the presence of 1 μl of T4 DNA buffer. ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. The bacteria, Escherichia coli DH5a, made competent beforehand, were transformed (Hanahan, 1983). Plasmid DNA of the clones obtained, selected from 50, μg / ml ampicillin, was extracted according to the alkaline lysis method (Birnboim and
Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones retained was verified by sequencing using the T7 sequencing kit marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977). The resulting plasmid was called pBIOC31.

A.2. CONSTRUCTION DU PLASMIDE pBIOC32 CONTENANT
LE PREMIER CODON STOP DE L'g-ANTITRYPSINE PRECEDE DU
SIGNAL KDEL
La séquence codant le signal KDEL (Lys-Asp-Glu
Leu) placée à l'extrémité C-terminale de la séquence codant la protéine mature al-antitrypsine humaine en amont du codon stop combinée à la présence de la séquence codant le peptide signal N-terminal de la sporamine A des racines tubérisées de patate douce permet un adressage dans le réticulum endoplasmique.A.2. CONSTRUCTION OF THE pBIOC32 PLASMID CONTAINING
THE FIRST STOP CODON OF g-ANTITRYPSIN PRECEDED BY
SIGNAL KDEL
The sequence coding for the KDEL signal (Lys-Asp-Glu
Leu) placed at the C-terminus of the sequence coding for the mature protein human al-antitrypsin upstream of the stop codon combined with the presence of the sequence coding for the N-terminal signal peptide of sporamine A of the tuberous roots of sweet potato allows addressing in the endoplasmic reticulum.

Pour insérer la séquence codant le signal KDEL avant le premier codon stop (TAA) de la protéine mature al-antitrypsine humaine (AAT) qui seul sera préservé, le vecteur pBIOC30 a été modifié à l'extrémité 3' de l'ADNc codant pour AAT. La présence d'un codon Lys juste avant le codon stop de AAT, s'est soldée par l'introduction de la séquence codant le signal DEL uniquement. To insert the sequence coding for the KDEL signal before the first stop codon (TAA) of the mature human al-antitrypsin protein (AAT) which alone will be preserved, the vector pBIOC30 was modified at the 3 ′ end of the cDNA coding for AAT. The presence of a Lys codon just before the AAT stop codon resulted in the introduction of the sequence encoding the LED signal only.

Le fragment EcoRV-SalI de pBIOC30 a été remplacé par le fragment EcoRV-SalI issu de l'amplification PCR réalisée sur pBIOC30 à l'aide des 2 oligodésoxynucléotides commandés chez Genset, 5'
CCACGATATCATCACCAAGTTCC 3' (contenant le site unique
EcoRV) et 5' cggtcgacgaattcCAGTTAtagctcatcTTTTTGGGTGGG 3' (contenant les sites SalI et EcoRi, et la séquence
KDEL et le premier codon stop de AAT mature), en suivant le protocole d'amplification PCR décrit cidessus dans le paragraphe a.1. Après double digestion enzymatique par EcoRV et SalI, les fragments d'ADN issus de l'amplification PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés, puis ligués à l'ADN plasmidique de pBIOC30 doublement digéré par EcoRV et SalI, purifié par électrophorèse sur gel d'agarose 0,8t, électroélué (Sambrook et al., 1989), soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 ul en présence de 1 ul de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 140C pendant 16 heures. Les bactéries,
Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983).The EcoRV-SalI fragment of pBIOC30 was replaced by the EcoRV-SalI fragment resulting from the PCR amplification carried out on pBIOC30 using the 2 oligodeoxynucleotides ordered from Genset, 5 '
CCACGATATCATCACCAAGTTCC 3 '(containing the unique site
EcoRV) and 5 'cggtcgacgaattcCAGTTAtagctcatcTTTTTGGGTGGG 3' (containing the SalI and EcoRi sites, and the sequence
KDEL and the first stop codon of mature AAT), following the PCR amplification protocol described above in paragraph a.1. After double enzymatic digestion with EcoRV and SalI, the DNA fragments resulting from the PCR amplification were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 volume of 3M sodium acetate pH 4.8 and 2.5 volumes of absolute ethanol at -80 ° C for 30 min., centrifuged at 12000 g for 30 min., washed with 70% ethanol, dried, then ligated to the plasmid DNA of pBIOC30 doubly digested with EcoRV and SalI, purified by electrophoresis on 0.8t agarose gel, electroeluted (Sambrook et al., 1989), subjected to alcoholic precipitation, dried and dephosphorylated by the enzyme alkaline phosphatase calf intestine (Boehringer Mannheim) according to the manufacturer's recommendations. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments resulting from the PCR amplification described above in a reaction medium of 10 μl in the presence of 1 μl of T4 DNA buffer. ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 140C for 16 hours. Bacteria,
Escherichia coli DH5a, made previously competent, have been transformed (Hanahan, 1983).

L'ADN plasmidique des clones obtenus, sélectionnés sur 50 ug/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit de séquençage T7 M commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977).The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones selected was verified by sequencing using the T7 M sequencing kit marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977).

Le plasmide résultant a été appelé pBIOC32.The resulting plasmid was called pBIOC32.

B. CONSTRUCTION DES VECTEURS pBIOC33, pBIOC34, pBIOC35
ET pBIOC74. MODIFICATION DE L'EXTREMITE 5' DU cDNA
CODANT POUR L'al-ANTITRYPSINE
Dans l'une des constructions, la séquence contenant l'al-antitrypsine humaine mature précédée d'une partie de celle de son peptide signal naturel PA (11 derniers codons des 24 nécessaires) est contenue dans pBIOC31. Le clone modifié résultant a été appelé pBIOC74.B. CONSTRUCTION OF THE VECTORS pBIOC33, pBIOC34, pBIOC35
AND pBIOC74. MODIFICATION OF THE 5 'END OF THE cDNA
CODING FOR al-ANTITRYPSIN
In one of the constructions, the sequence containing the mature human al-antitrypsin preceded by a part of that of its natural signal peptide PA (last 11 codons of the 24 required) is contained in pBIOC31. The resulting modified clone was named pBIOC74.

Par ailleurs, la séquence codant pour le peptide signal naturel PA de l'al-antitrypsine humaine (24 premiers codons) a été remplacé par celle codant pour un signal d'adressage d'origine végétale en respectant les phases ouvertes de lecture des séquences codant pour le signal d'adressage apporté et la protéine mature al-antitrypsine humaine. Ce signal d'adressage est soit un peptide signal (PS) qui permettrait une sécrétion de la protéine dans le milieu extracellulaire de l'espace intercellulaire, soit un prépropeptide c'est-à-dire un peptide signal suivi des séquences N-terminales d'adressage vacuolaire (PPS) qui adresserait la protéine dans la vacuole. Les séquences PS et PPS constituées respectivement de 23 et 37 acides aminés, sont celles d'une protéine de réserve des racines tubérisées de patate douce : la sporamine A (Murakami et al., 1986 ; Matsuoka et
Nakamura, 1991). Le plasmide pBIOC31 modifié contenant la séquence codant pour l'al-antitrypsine humaine (AAT) fusionnée soit à PS (PS-AAT), soit à PPS (PPS
AAT) a été appelé pBIOC33 et pBIOC34 respectivement.Furthermore, the sequence coding for the natural signal peptide PA of human al-antitrypsin (first 24 codons) has been replaced by that coding for an addressing signal of plant origin while respecting the open reading phases of the coding sequences. for the addressing signal provided and the mature protein human al-antitrypsin. This addressing signal is either a signal peptide (PS) which would allow a secretion of the protein in the extracellular medium of the intercellular space, or a prepropeptide that is to say a signal peptide followed by the N-terminal sequences d vacuolar addressing (PPS) which would address the protein in the vacuole. The PS and PPS sequences, consisting respectively of 23 and 37 amino acids, are those of a reserve protein of the tuberous roots of sweet potato: sporamine A (Murakami et al., 1986; Matsuoka and
Nakamura, 1991). The modified plasmid pBIOC31 containing the sequence coding for human al-antitrypsin (AAT) fused either to PS (PS-AAT) or to PPS (PPS
AAT) was called pBIOC33 and pBIOC34 respectively.

Le plasmide pBIOC32 modifié contenant la séquence codant pour l'al-antitrypsine humaine (AAT) fusionnée à PS (PS-AAT-KDEL) a été appelé pBIOC35.The modified plasmid pBIOC32 containing the sequence coding for human al-antitrypsin (AAT) fused to PS (PS-AAT-KDEL) was called pBIOC35.

B.1. CONSTRUCTION DU PLASMIDE pBIOC74 CONTENANT
PA-AAT.B.1. CONSTRUCTION OF THE PLASMID pBIOC74 CONTAINING
PA-AAT.

Le plasmide pBIOC31 a été digéré doublement par
SacI et BamHI pour supprimer les 11 derniers codons de la séquence codant pour le peptide signal naturel PA et le premier codon de l'al-antitrypsine humaine mature. Cette séquence a été remplacée par la séquence entière codant pour le peptide signal naturel PA de 24 acides aminés (ATG CCG TCT TCT GTC TCG TGG GGC ATC CTC
CTG CTG GCA GGC CTG TGC TGC CTG GTC CCT GTC TCC CTG
GCT) fusionnée au premier codon de la protéine AAT mature (Glu). La séquence "PS - 3 premiers codons de la protéine AAT mature" a été amplifiée par PCR à partir du plasmide pUC18-AAT à l'aide des 2 oligodésoxynucléotides, 5' gggagctcgaattcaacaATG CCG
TCT TCT GTC TCG TG 3' (contenant les sites EcoRI et
SacI et le signal traductionnel de Kozack) et 5' G GGG
ATC CTC AGC CAG GG3' (contenant le site BamHI de la séquence codant pour la protéine AAT mature), en suivant le protocole d'amplification PCR décrit cidessus dans le paragraphe a.l. Après double digestion enzymatique par SacI et BamHI, les fragments d'ADN issus de l'amplification PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés, puis ligués à l'ADN plasmidique de pBIOC31 doublement digéré par SacI et BamHI, purifié par électrophorèse sur gel d'agarose 0,8%, électroélué (Sambrook et al., 1989), soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 ul en présence de 1 ul de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bactéries,
Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983).The plasmid pBIOC31 was digested twice by
SacI and BamHI to delete the last 11 codons of the sequence coding for the natural signal peptide PA and the first codon of mature human al-antitrypsin. This sequence has been replaced by the entire sequence coding for the natural signal peptide PA of 24 amino acids (ATG CCG TCT TCT GTC TCG TGG GGC ATC CTC
CTG CTG GCA GGC CTG TGC TGC CTG GTC CCT GTC TCC CTG
GCT) fused to the first codon of the mature AAT protein (Glu). The sequence "PS - first 3 codons of the mature AAT protein" was amplified by PCR from the plasmid pUC18-AAT using the 2 oligodeoxynucleotides, 5 ′ gggagctcgaattcaacaATG CCG
TCT TCT GTC TCG TG 3 '(containing the EcoRI and
SacI and Kozack's translational signal) and 5 'G GGG
ATC CTC AGC CAG GG3 '(containing the BamHI site of the sequence coding for the mature AAT protein), following the PCR amplification protocol described above in paragraph a. After double enzymatic digestion with SacI and BamHI, the DNA fragments from PCR amplification were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 of the volume of 3M sodium acetate pH 4.8 and 2, 5 volumes of absolute ethanol at -80 ° C. for 30 min., Centrifuged at 12000 g for 30 min., Washed with 70% ethanol, dried, then ligated to the plasmid DNA of pBIOC31 doubly digested with SacI and BamHI, purified by electrophoresis on 0.8% agarose gel, electroeluted (Sambrook et al., 1989), subjected to alcoholic precipitation, dried and dephosphorylated by the enzyme calf intestine alkaline phosphatase (Boehringer Mannheim) according to the recommendations of maker. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments resulting from the PCR amplification described above in a reaction medium of 10 μl in the presence of 1 μl of T4 DNA buffer. ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. Bacteria,
Escherichia coli DH5a, made previously competent, have been transformed (Hanahan, 1983).

L'ADN plasmidique des clones obtenus, sélectionnés sur 50 ug/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit TM de séquençage T7 commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977). Les séquences du PA et de AAT mature ont été clonées en maintenant leurs phases de lecture ouverte.The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones retained was verified by sequencing using the TM sequencing kit T7 marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977). The PA and mature AAT sequences were cloned while keeping their reading phases open.

La séquence de clivage entre les séquences PA et AAT mature est Ala-Glu. Le plasmide résultant a été appelé pBIOC74.The cleavage sequence between the PA and mature AAT sequences is Ala-Glu. The resulting plasmid was called pBIOC74.

B.2. CONSTRUCTION DU PLASMIDE pBIOC33 CONTENANT
PS-AAT.B.2. CONSTRUCTION OF THE pBIOC33 PLASMID CONTAINING
PS-AAT.

Le plasmide pBIOC31 a été digéré doublement par
SacI et BamHI pour supprimer la séquence codant pour le peptide signal naturel de l'al-antitrypsine humaine. Cette séquence a été remplacée par celle codant pour le peptide signal PS de 23 acides aminés (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA GCT CTT TCC
CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC) fusionnée aux 3 premiers codons de la protéine AAT mature (Glu-Asp
Pro). La séquence "PS - 3 premiers codons de la protéine AAT mature" a été amplifiée par PCR à partir du plasmide pMAT103 (Matuoka et Nakamura, 1991) à l'aide des 2 oligodésoxynucléotides, 5' gcgagctcgaattcaacaATG AAA GCC TTC ACA CTC GC 3' (contenant les sites EcoRI et SacI et le signal traductionnel de Kozack) et 5' CT GGG ATC CTC GGA ATG
GGC TGG ATT GGG CAG G 3' (contenant le site BamHI de la séquence codant pour la protéine AAT mature), en suivant le protocole d'amplification PCR décrit cidessus dans le paragraphe a.1. Après double digestion enzymatique par SacI et BamHI, les fragments d'ADN issus de l'amplification PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés, puis ligués à l'ADN plasmidique de pBIOC31 doublement digéré par SacI et BamHI, purifié par électrophorèse sur gel d'agarose 0,8%, électroélué (Sambrook et al., 1989), soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 ,ul en présence de 1 ul de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bactéries,
Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983).The plasmid pBIOC31 was digested twice by
SacI and BamHI to suppress the sequence coding for the natural signal peptide of human al-antitrypsin. This sequence has been replaced by that coding for the signal peptide PS of 23 amino acids (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA GCT CTT TCC
CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC) fused to the first 3 codons of the mature AAT protein (Glu-Asp
Pro). The sequence "PS - first 3 codons of the mature AAT protein" was amplified by PCR from the plasmid pMAT103 (Matuoka and Nakamura, 1991) using the 2 oligodeoxynucleotides, 5 'gcgagctcgaattcaacaATG AAA GCC TTC ACA CTC GC 3' (containing the EcoRI and SacI sites and the Kozack translational signal) and 5 'CT GGG ATC CTC GGA ATG
GGC TGG ATT GGG CAG G 3 '(containing the BamHI site of the sequence coding for the mature AAT protein), following the PCR amplification protocol described above in paragraph a.1. After double enzymatic digestion with SacI and BamHI, the DNA fragments resulting from the PCR amplification were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 volume of 3M sodium acetate pH 4.8 and 2.5 volumes of absolute ethanol at -80 ° C for 30 min., centrifuged at 12000 g for 30 min., washed with 70% ethanol, dried, then ligated to plasmid DNA from pBIOC31 doubly digested with SacI and BamHI, purified by electrophoresis on 0.8% agarose gel, electroeluted (Sambrook et al., 1989), subjected to alcoholic precipitation, dried and dephosphorylated by the phosphatase enzyme alkaline calf intestine (Boehringer Mannheim) according to the manufacturer's recommendations. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments resulting from the PCR amplification described above in a reaction medium of 10 μl in the presence of 1 μl of T4 buffer. DNA ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. Bacteria,
Escherichia coli DH5a, made previously competent, have been transformed (Hanahan, 1983).

L'ADN plasmidique des clones obtenus, sélectionnés sur 50 pg/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit de séquençage T7 commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977).The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones retained was verified by sequencing using the T7 sequencing kit marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977).

Les séquences du PS et de AAT mature ont été clonées en maintenant leurs phases de lecture ouverte. La séquence de clivage entre les séquences PS et AAT mature est Ser-Glu. Le plasmide résultant a été appelé pBIOC33.The PS and mature AAT sequences were cloned while keeping their reading phases open. The cleavage sequence between the PS and mature AAT sequences is Ser-Glu. The resulting plasmid was called pBIOC33.

B.3. CONSTRUCTION DU PLASMIDE pBIOC34 CONTENANT
PPS-AAT.B.3. CONSTRUCTION OF THE pBIOC34 PLASMID CONTAINING
PPS-AAT.

Le plasmide pBIOC31 a été digéré doublement par
SacI et BamHI pour supprimer la séquence codant pour le peptide signal naturel de l'al-antitrypsine humaine. Cette séquence a été remplacée par celle codant pour le prépropeptide PPS N-terminal de 37 acides aminés (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA
GCT CTT TCC CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC
AGG TTC AAT CCC ATC CGC CTC CCC ACC ACA CAC GAA CCC
GCC) fusionnée aux 3 premiers codons de la protéine
AAT mature (Glu-Asp-Pro) . La séquence "PPS - 3 premiers codons de la protéine AAT mature" a été amplifiée par PCR à partir du plasmide pMAT103 (Matuoka et Nakamura, 1991) à l'aide des 2 oligodésoxynucléotides, 5' gcgagctcgaattcaacaATG AAA
GCC TTC ACA CTC GC 3' (contenant les sites EcoRI et
SacI et le signal traductionnel de Kozack) et 5' CT
GGG ATC CTC GGC GGG TTC GTG TGT GGT TG 3' (contenant le site BamHI de la séquence de la protéine AAT mature), en suivant le protocole d'amplification PCR décrit ci-dessus dans le paragraphe a.1. Après double digestion enzymatique par SacI et BamHI, les fragments d'ADN issus de l'amplification PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés, puis ligués à l'ADN plasmidique de pBIOC31 doublement digéré par SacI et
BamHI, purifié par électrophorèse sur gel d'agarose 0,8%, électroélué (Sambrook et al., 1989), soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 pl en présence de 1 ul de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bactéries,
Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983).The plasmid pBIOC31 was digested twice by
SacI and BamHI to suppress the sequence coding for the natural signal peptide of human al-antitrypsin. This sequence has been replaced by that coding for the N-terminal PPS prepropeptide of 37 amino acids (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA
GCT CTT TCC CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC
AGG TTC AAT CCC ATC CGC CTC CCC ACC ACA CAC GAA CCC
GCC) fused to the first 3 codons of the protein
Mature AAT (Glu-Asp-Pro). The sequence "PPS - first 3 codons of the mature AAT protein" was amplified by PCR from the plasmid pMAT103 (Matuoka and Nakamura, 1991) using the 2 oligodeoxynucleotides, 5 'gcgagctcgaattcaacaATG AAA
GCC TTC ACA CTC GC 3 '(containing EcoRI and
SacI and Kozack's translational signal) and 5 'CT
GGG ATC CTC GGC GGG TTC GTG TGT GGT TG 3 '(containing the BamHI site of the sequence of the mature AAT protein), following the PCR amplification protocol described above in paragraph a.1. After double enzymatic digestion with SacI and BamHI, the DNA fragments resulting from the PCR amplification were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 volume of 3M sodium acetate pH 4.8 and 2.5 volumes of absolute ethanol at -80 ° C for 30 min., centrifuged at 12000 g for 30 min., washed with 70% ethanol, dried, then ligated to the plasmid DNA of pBIOC31 doubly digested with SacI and
BamHI, purified by electrophoresis on 0.8% agarose gel, electroeluted (Sambrook et al., 1989), subjected to alcoholic precipitation, dried and dephosphorylated by the enzyme calf intestine alkaline phosphatase (Boehringer Mannheim) according to manufacturer's recommendations. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments from the PCR amplification described above in a 10 μl reaction medium in the presence of 1 μl of T4 DNA buffer. ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. Bacteria,
Escherichia coli DH5a, made previously competent, have been transformed (Hanahan, 1983).

L'ADN plasmidique des clones obtenus, sélectionnés sur 50 pg/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit de séquençage T7 TM commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977).The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones retained was verified by sequencing using the T7 TM sequencing kit marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977).

Les séquences du PPS et de AAT mature ont été clonées en maintenant leurs phases de lecture ouverte. La séquence de clivage entre les séquences PPS et AAT mature est Ala-Glu. Le plasmide résultant a été appelé pBIOC34.The PPS and mature AAT sequences were cloned while keeping their reading phases open. The cleavage sequence between the PPS and mature AAT sequences is Ala-Glu. The resulting plasmid was called pBIOC34.

B.4. CONSTRUCTION DU PLASMIDE pBIOC35 CONTENANT
PS-AAT-KDEL.B.4. CONSTRUCTION OF THE pBIOC35 PLASMID CONTAINING
PS-AAT-KDEL.

Le plasmide pBIOC32 a été digéré doublement par
SacI et BamHI pour supprimer la séquence codant pour le peptide signal naturel de l'a1-antitrypsine humaine. Cette séquence a été remplacée par celle codant pour le peptide signal PS de 23 acides aminés (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA GCT CTT TCC
CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC) fusionnée aux 3 premiers codons de la protéine AAT mature (Glu-Asp
Pro). La séquence "PS - 3 premiers codons de la protéine AAT mature" a été amplifiée par PCR à partir du plasmide pMAT103 (Matuoka et Nakamura, 1991) à l'aide des 2 oligodésoxynucléotides, 5' gcgagctcgaattcaacaATG AAA GCC TTC ACA CTC GC 3' (contenant les sites EcoRI et SacI et le signal traductionnel de Kozack) et 5' CT GGG ATC CTC GGA ATG
GGC TGG ATT GGG CAG G 3' (contenant le site BamHI de la séquence de la protéine AAT mature), en suivant le protocole d'amplification PCR décrit ci-dessus dans le paragraphe a.1. Après double digestion enzymatique par
SacI et BamHI, les fragments d'ADN issus de l'amplification PCR ont été purifiés par électrophorèse sur gel d'agarose 2%, électroélués (Sambrook et al., 1989), précipités en présence de 1/10 de volume de 3M acétate de sodium pH4,8 et de 2,5 volumes d'éthanol absolu à -80 C pendant 30 min., centrifugés à 12000g pendant 30 min., lavés à l'éthanol 70%, séchés, puis ligués à l'ADN plasmidique de pBIOC32 doublement digéré par SacI et BamHI, purifié par électrophorèse sur gel d'agarose 0,8%, électroélué (Sambrook et al., 1989), soumis à la précipitation alcoolique, séché et déphosphorylé par l'enzyme phosphatase alcaline d'intestin de veau (Boehringer Mannheim) selon les recommandations du fabricant. La ligation a été réalisée avec 100 ng du vecteur déphosphorylé décrit ci-dessus et 50 ng de fragments d'ADN digérés issus de l'amplification PCR décrits ci-dessus dans un milieu réactionnel de 10 ul en présence de 1 pl de tampon T4 DNA ligase x 10 (Amersham) et de 2,5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bactéries,
Escherichia coli DHSa rendues préalablement compétentes, ont été transformées (Hanahan, 1983)
L'ADN plasmidique des clones obtenus, sélectionnés sur 50 ug/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. L'ADN plasmidique de certains des clones retenus a été vérifié par séquençage à l'aide du kit de séquençage T7 commercialisé par Pharmacia selon la méthode des didésoxynucléotides (Sanger et al., 1977).The plasmid pBIOC32 was digested twice by
SacI and BamHI to suppress the sequence coding for the natural signal peptide of human α1-antitrypsin. This sequence has been replaced by that coding for the signal peptide PS of 23 amino acids (ATG AAA GCC TTC ACA CTC GCT CTC TTC TTA GCT CTT TCC
CTC TAT CTC CTG CCC AAT CCA GCC CAT TCC) fused to the first 3 codons of the mature AAT protein (Glu-Asp
Pro). The sequence "PS - first 3 codons of the mature AAT protein" was amplified by PCR from the plasmid pMAT103 (Matuoka and Nakamura, 1991) using the 2 oligodeoxynucleotides, 5 'gcgagctcgaattcaacaATG AAA GCC TTC ACA CTC GC 3' (containing the EcoRI and SacI sites and the Kozack translational signal) and 5 'CT GGG ATC CTC GGA ATG
GGC TGG ATT GGG CAG G 3 '(containing the BamHI site of the sequence of the mature AAT protein), following the PCR amplification protocol described above in paragraph a.1. After double enzymatic digestion with
SacI and BamHI, the DNA fragments resulting from the PCR amplification were purified by electrophoresis on 2% agarose gel, electroeluted (Sambrook et al., 1989), precipitated in the presence of 1/10 of volume of 3M acetate sodium pH4.8 and 2.5 volumes of absolute ethanol at -80 C for 30 min., centrifuged at 12000 g for 30 min., washed with 70% ethanol, dried, then ligated to the plasmid DNA of pBIOC32 doubly digested with SacI and BamHI, purified by electrophoresis on 0.8% agarose gel, electroeluted (Sambrook et al., 1989), subjected to alcoholic precipitation, dried and dephosphorylated by the enzyme alkaline phosphatase from intestine of veal (Boehringer Mannheim) according to the manufacturer's recommendations. The ligation was carried out with 100 ng of the dephosphorylated vector described above and 50 ng of digested DNA fragments resulting from the PCR amplification described above in a reaction medium of 10 μl in the presence of 1 μl of T4 DNA buffer. ligase x 10 (Amersham) and 2.5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. Bacteria,
Escherichia coli DHSa previously made competent, have been transformed (Hanahan, 1983)
The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The plasmid DNA of some of the clones retained was verified by sequencing using the T7 sequencing kit marketed by Pharmacia according to the dideoxynucleotide method (Sanger et al., 1977).

Les séquences du PS et de AAT mature ont été clonées en maintenant leurs phases de lecture ouverte. La séquence de clivage entre les séquences PS et AAT mature est Ser-Glu. Le plasmide résultant a été appelé pBIOC35.The PS and mature AAT sequences were cloned while keeping their reading phases open. The cleavage sequence between the PS and mature AAT sequences is Ser-Glu. The resulting plasmid was called pBIOC35.

C. CONSTRUCTION DES PLASMIDES UTILISABLES EN
TRANSFORMATION GENETIQUE DU MAIS PAR BIOLISTIQUE
C.1. EXPRESSION CONSTITUTIVE : Construction de pPAR-IAR-PA-AAT, pPAR-IAR-PS-AAT, pPAR-IAR-PS-AAT-KDEL et pPAR-IAR-PPS-AAT.C. CONSTRUCTION OF PLASMIDS THAT CAN BE USED IN
GENETIC TRANSFORMATION OF BUT BY BIOLISTICS
C.1. CONSTITUTIVE EXPRESSION: Construction of pPAR-IAR-PA-AAT, pPAR-IAR-PS-AAT, pPAR-IAR-PS-AAT-KDEL and pPAR-IAR-PPS-AAT.

L'expression constitutive dans le maïs a nécessité, entre autre, les séquences régulatrices suivantes - promoteur actine de riz suivi de l'intron actine de riz (pAR-IAR) contenu dans le plasmide pActl-F4 décrit par McElroy et al. (1991) ; - la séquence terminatrice de transcription, terminateur polyA NOS, qui correspond à la région en 3' non codante du gène de la nopaline synthase du plasmide Ti d' Agrobacterium turne fa ci ens souche à nopaline (Depicker et al., 1982). Constitutive expression in corn required, inter alia, the following regulatory sequences - rice actin promoter followed by the rice actin intron (pAR-IAR) contained in the plasmid pActl-F4 described by McElroy et al. (1991); - the transcription terminator sequence, polyA NOS terminator, which corresponds to the 3 ′ non-coding region of the nopaline synthase gene of the Ti plasmid of Agrobacterium turne fa ness strain of nopaline (Depicker et al., 1982).

Le plasmide pBSII-PAR-IAR-tNOS, dans lequel ont été insérées les séquences codant "PA-AAT", "PS-AAT", "PS-AAT-KDEL" et "PPS-AAT", est décrit par exemple dans la demande de brevet W09633277 qui est incorporée par référence. The plasmid pBSII-PAR-IAR-tNOS, into which the sequences coding "PA-AAT", "PS-AAT", "PS-AAT-KDEL" and "PPS-AAT" have been inserted, is described for example in patent application W09633277 which is incorporated by reference.

Les séquences, codant "PA-AAT", "PS-AAT", "PS
AAT-KDEL" et "PPS-AAT", ont été isolées par digestion enzymatique EcoRI respectivement à partir de pBIOC74, pBIOC33, pBIOC35 et pBIOC34. Les fragments digérés ont été purifiés par électrophorèse sur gel d'agarose à 0,8%, puis soumis à l'électroélution, à la précipitation alcoolique, séchés, repris dans H20. Ils ont été traités par action de l'enzyme Klenow (New
England Biolabs) selon les recommandations du fabricant. Ils ont été insérés dans le plasmide pBSII
PAR-IAR-tNOS digéré doublement par SalI et NcoI, purifié, traité à l'enzyme Mung Bean Nucléase (New
England Biolabs) et déphosphorylé par l'enzyme phosphatase alcaline de veau (Boehringer Mannheim) selon les recommandations des fabricants. La ligation a été réalisée avec 20 ng du vecteur déphosphorylé et 200 ng de fragments d'ADN contenant la séquence codant "PA-AAT", "PS-AAT", "PS-AAT-KDEL" ou "PPS-AAT", décrits ci-dessus, dans un milieu réactionnel de 20 pl en présence de 2 p1 de tampon T4 DNA ligase x 10 (Amersham), de 2 p1 de 50% polyethylène glycol 8000 et de 5 U d'enzyme T4 DNA ligase (Amersham) à 14"C pendant 16 heures. Les bactéries, Escherichia coli
DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983). L'ADN plasmidique des clones obtenus, sélectionnés sur 50 pg/ml ampicilline, a été extrait selon la méthode de la lyse alcaline (Birnboim et Doly, 1979) et analysé par digestion enzymatique par des enzymes de restriction. Les plasmides résultants ont été appelés pPAR-IAR-PA-AAT, pPAR- IAR-PS -AAT, pPAR- lAR- PS -AAT -KDEL e t pPAR- IAR-PPS -
AAT. The sequences, coding "PA-AAT", "PS-AAT", "PS
AAT-KDEL "and" PPS-AAT ", were isolated by EcoRI enzymatic digestion respectively from pBIOC74, pBIOC33, pBIOC35 and pBIOC34. The digested fragments were purified by electrophoresis on 0.8% agarose gel, then subjected to electroelution, to alcoholic precipitation, dried, taken up in H20. They were treated by the action of the enzyme Klenow (New
England Biolabs) according to the manufacturer's recommendations. They were inserted into the plasmid pBSII
PAR-IAR-tNOS double digested with SalI and NcoI, purified, treated with the enzyme Mung Bean Nuclease (New
England Biolabs) and dephosphorylated by the enzyme calf alkaline phosphatase (Boehringer Mannheim) according to the manufacturers' recommendations. The ligation was carried out with 20 ng of the dephosphorylated vector and 200 ng of DNA fragments containing the sequence coding "PA-AAT", "PS-AAT", "PS-AAT-KDEL" or "PPS-AAT", described above, in a reaction medium of 20 μl in the presence of 2 μl of T4 DNA ligase x 10 buffer (Amersham), of 2 μl of 50% polyethylene glycol 8000 and of 5 U of T4 DNA ligase enzyme (Amersham) at 14 "C for 16 hours. Bacteria, Escherichia coli
DH5a made previously competent, have been transformed (Hanahan, 1983). The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis (Birnboim and Doly, 1979) and analyzed by enzymatic digestion with restriction enzymes. The resulting plasmids were called pPAR-IAR-PA-AAT, pPAR- IAR-PS -AAT, pPAR- lAR- PS -AAT -KDEL and pPAR- IAR-PPS -
AAT.

C.2. EXPRESSION DANS L'ALBUMEN DES SEMENCES DE
MAIS
C.2.1 CONSTRUCTION DE pPgzéine-PA-AAT, pPgzéine-PS-AAT, pPgzéine-PS-AAT-KDEL et pPgzéine-PPS
AAT.C.2. EXPRESSION IN THE SEED ALBUMEN
BUT
C.2.1 CONSTRUCTION OF pPgzein-PA-AAT, pPgzein-PS-AAT, pPgzein-PS-AAT-KDEL and pPgzein-PPS
AAT.

L'expression dans l'albumen des semences de maïs a nécessité, entre autre, les séquences régulatrices suivantes - le promoteur du gène gamma (g) zéine de maïs (Pgzéine) contenu dans le plasmide p63 est décrit dans
Reina et al., 1990. Le plasmide p63 résulte du clonage de Pgzéine, en remplacement du promoteur 35S (P35S), aux sites HindIII et XbaI du plasmide pUC18 renfermant, entre ses sites HindIII et EcoRI, la cassette d'expression "P35S-gus-TNOS" de pBI221 commercialisé par Clontech. Il permet une expression dans l'albumen des semences de maïs.Expression in the albumen of corn seeds required, among other things, the following regulatory sequences - the promoter of the gamma gene (g) zein of corn (Pgzein) contained in the plasmid p63 is described in
Reina et al., 1990. The plasmid p63 results from the cloning of Pgzein, replacing the promoter 35S (P35S), at the HindIII and XbaI sites of the plasmid pUC18 containing, between its HindIII and EcoRI sites, the expression cassette "P35S- gus-TNOS "from pBI221 marketed by Clontech. It allows an expression in the albumen of corn seeds.

- la séquence terminatrice de transcription, terminateur polyA NOS, qui correspond à la région en 3' non codante du gène de la nopaline synthase du plasmide Ti d' Agrobacterium tumefaciens souche à nopaline (Depicker et al., 1982).- the transcription terminator sequence, polyA NOS terminator, which corresponds to the 3 ′ non-coding region of the nopaline synthase gene of the Ti plasmid of Agrobacterium tumefaciens nopaline strain (Depicker et al., 1982).

Les plasmides pPgzéine-PA-AAT, pPgzéine-PS-AAT, pPgzéine-PS-AAT-KDEL et pPgzéine-PPS-AAT où les séquences codant "PA-AAT", "PS-AAT", "PS-AAT-KDEL" ou "PPS-AAT" ont été placées sous contrôle du Pgzéine, ont été obtenus par clonage aux sites, SacI et BamHI, traités par l'enzyme T4 DNA polymérase (New England
Biolabs), puis déphosphorylés par l'enzyme phosphatase alcaline de veau (Boehringer Mannheim) du plasmide p63, des fragments EcoRI traité à la Klenow (New
England Biolabs) isolé à partir de pBIOC74, pBIOC33, pBIOC35 et pBIOC34. La ligation a été réalisée comme décrite dans l'exemple C1. Les bactéries, Escherichia coli DH5a rendues préalablement compétentes, ont été transformées (Hanahan, 1983). L'ADN plasmidique des clones obtenus, sélectionnés sur 50 pg/ml ampicilline, a été extrait selon la méthode de la lyse alcaline et analysé par digestion enzymatique par des enzymes de restriction. Les clones résultants ont été appelés pPgzéine-PA-AAT, pPgzéine-PS-AAT, pPgzéine-PS-AAT-KDEL et pPgzéine-PPS-AAT.The plasmids pPgzein-PA-AAT, pPgzein-PS-AAT, pPgzein-PS-AAT-KDEL and pPgzein-PPS-AAT where the sequences coding "PA-AAT", "PS-AAT", "PS-AAT-KDEL" or "PPS-AAT" were placed under the control of Pgzein, were obtained by cloning at the sites, SacI and BamHI, treated with the enzyme T4 DNA polymerase (New England
Biolabs), then dephosphorylated by the enzyme calf alkaline phosphatase (Boehringer Mannheim) of the plasmid p63, EcoRI fragments treated with Klenow (New
England Biolabs) isolated from pBIOC74, pBIOC33, pBIOC35 and pBIOC34. Ligation was carried out as described in Example C1. The bacteria, Escherichia coli DH5a, made competent beforehand, have been transformed (Hanahan, 1983). The plasmid DNA of the clones obtained, selected on 50 μg / ml ampicillin, was extracted according to the method of alkaline lysis and analyzed by enzymatic digestion with restriction enzymes. The resulting clones were called pPgzein-PA-AAT, pPgzein-PS-AAT, pPgzein-PS-AAT-KDEL and pPgzein-PPS-AAT.

D. CONSTRUCTION DES PLASMIDES UTILISABLES EN
TRANSFORMATION GENETIQUE DU MAIS PAR Agrobacterium tume fa ci ens
Les plasmides pSB-PA-AAT, pSB-PS-AAT, pSB-PS-AAT-KDEL, pSB-PPS-AAT, qui portent une réplication de pBR322 et un gène de résistance à la spectinomycine, ont été obtenus par insertion d'un plasmide binaire possédant des régions ori et cos, construit selon les méthodes décrites dans les brevets WO 9400977 et WO 9506722 entre les bordures droite et gauche du T-DNA des cassettes d'expression "promoteur actine de riz-intron actine de riz-gène bar-terminateur NOS" et respectivement PA-AAT sous contrôle de PAR-IAR ou
Pgzéine, PS-AAT sous contrôle de PAR-IAR ou Pgzéine,
PS-AAT-KDEL sous contrôle de PAR PAR ou Pgzéine et
PPS-AAT sous contrôle de PAR-IAR ou Pgzéine.D. CONSTRUCTION OF PLASMIDS THAT CAN BE USED IN
GENETIC TRANSFORMATION OF MAIZE BY Agrobacterium tume fa ci ens
The plasmids pSB-PA-AAT, pSB-PS-AAT, pSB-PS-AAT-KDEL, pSB-PPS-AAT, which carry a replication of pBR322 and a spectinomycin resistance gene, were obtained by insertion of a binary plasmid having ori and cos regions, constructed according to the methods described in patents WO 9400977 and WO 9506722 between the right and left borders of the T-DNA of the expression cassettes "rice actin promoter-intron rice actin gene" NOS bar-terminator "and PA-AAT respectively under PAR-IAR control or
Pgzein, PS-AAT under PAR-IAR control or Pgzein,
PS-AAT-KDEL under PAR PAR or Pgzein control and
PPS-AAT under PAR-IAR or Pgzéine control.

Les plasmides obtenus ont été introduits dans
Agrobacterium tumefaciens souche LBA4404 (pSB1) décrite par Ishida et al. (Nature Biotechnology, 1996, 14 : 745-750) . Les bactéries résultantes contiennent les cointégrats de pSB1 et respectivement de pSB-PA
AAT, pSB-PS-AAT, pSB-PS-AAT-KDEL, pSB-PPS-AAT. The plasmids obtained were introduced into
Agrobacterium tumefaciens strain LBA4404 (pSB1) described by Ishida et al. (Nature Biotechnology, 1996, 14: 745-750). The resulting bacteria contain the cointegrates of pSB1 and pSB-PA respectively
AAT, pSB-PS-AAT, pSB-PS-AAT-KDEL, pSB-PPS-AAT.

Il. OBTENTION DE PLANTES DE MAIS TRANSGENIQUES. He. OBTAINING TRANSGENIC BUT PLANTS.

A. Obtention et utilisation de cal de maïs comme cible pour la transformation génétique. A. Obtaining and using corn callus as a target for genetic transformation.

La transformation génétique du maïs, quelle que soit la méthode employée (électroporation; Agrobacterium, microfibres, canon à particules), requiert généralement l'utilisation de cellules indifférenciées en divisions rapides ayant conservé une aptitude à la régénération de plantes entières. Ce type de cellules compose le cal friable embryogène (dit de type II) de mais.The genetic transformation of corn, whatever the method used (electroporation; Agrobacterium, microfibers, particle cannon), generally requires the use of undifferentiated cells in rapid divisions which have retained the ability to regenerate whole plants. This type of cell makes up the embryogenic friable callus (called type II) of corn.

Ces cals sont obtenus à partir d'embryons immatures de génotype Hl II ou (A188 x B73) selon la méthode et sur les milieux décrits par Armstrong (1994). Les cals ainsi obtenus sont multipliés et maintenus par repiquages successifs tous les quinze jours sur le milieu d'initiation.These calluses are obtained from immature embryos of genotype Hl II or (A188 x B73) according to the method and on the media described by Armstrong (1994). The calluses thus obtained are multiplied and maintained by successive subcultures every fortnight on the initiation medium.

Des plantules sont ensuite régénérées à partir de ces cals en modifiant l'équilibre hormonal et osmotique des cellules selon la méthode décrite par Vain et al.Seedlings are then regenerated from these calluses by modifying the hormonal and osmotic balance of the cells according to the method described by Vain et al.

(1989). Ces plantes sont ensuite acclimatées en serre où elles peuvent être croisées ou autofécondées.(1989). These plants are then acclimatized in the greenhouse where they can be crossed or self-fertilized.

B. Utilisation du canon à particules pour la transformation génétique du maïs. B. Use of the particle gun for the genetic transformation of corn.

Le paragraphe précédent décrit l'obtention et la régénération des lignées cellulaires nécessaires à la transformation ; on décrit ici une méthode de transformation génétique conduisant à l'intégration stable des gènes modifiés dans le génome de la plante. The previous paragraph describes obtaining and regenerating the cell lines necessary for transformation; a method of genetic transformation leading to the stable integration of the modified genes into the plant genome is described here.

Cette méthode repose sur l'utilisation d'un canon à particules ; les cellules cibles sont des fragments de cals décrits dans le paragraphe 1. Ces fragments d'une surface de 10 à 20 mm2 ont été disposés, 4 h avant bombardement, à raison de 16 fragments par boite au centre d'un boite de petri contenant un milieu de culture identique au milieu d'initiation, additionné de 0,2 M de mannitol + 0,2 M de sorbitol. Les plasmides portant les gènes à introduire sont purifiés sur colonne Qiagen,, en suivant les instructions du fabricant. Ils sont ensuite précipités sur des particules de tungsten (M10) en suivant le protocole décrit par Klein (1987). Les particules ainsi enrobées sont projetées vers les cellules cibles à l'aide du canon et selon le protocole décrit par J. Finer (1992).This method is based on the use of a particle gun; the target cells are fragments of calluses described in paragraph 1. These fragments with an area of 10 to 20 mm 2 were placed, 4 h before bombardment, at the rate of 16 fragments per dish in the center of a petri dish containing a culture medium identical to the initiation medium, supplemented with 0.2 M mannitol + 0.2 M sorbitol. The plasmids carrying the genes to be introduced are purified on a Qiagen column, following the manufacturer's instructions. They are then precipitated on tungsten particles (M10) following the protocol described by Klein (1987). The particles thus coated are projected towards the target cells using the cannon and according to the protocol described by J. Finer (1992).

Les boites de cals ainsi bombardées sont ensuite scellées à l'aide de ScellofraisB, puis cultivées à l'obscurité à 27"C. Le premier repiquage a lieu 24 h après, puis tous les quinze jours pendant 3 mois sur milieu identique au milieu d'initiation additionné d'un agent sélectif. Les agents sélectifs utilisables consistent généralement en composés actifs de certains herbicides (basta, Round upO,) ou certains antibiotiques (Hygromycine, Kanamycine...). The callus boxes thus bombarded are then sealed using ScellofraisB, then cultivated in the dark at 27 "C. The first transplanting takes place 24 hours later, then every fortnight for 3 months on medium identical to the medium of initiation added with a selective agent. The selective agents which can be used generally consist of active compounds of certain herbicides (basta, Round upO,) or certain antibiotics (Hygromycin, Kanamycin, etc.).

On obtient après 3 mois ou parfois plus tôt, des cals dont la croissance n'est pas inhibée par l'agent de sélection, habituellement et majoritairement composés de cellules résultant de la division d'une cellule ayant intégré dans son patrimoine génétique une ou plusieurs copies du gène de sélection. La fréquence d'obtention de tels cals est d'environ 0,8 cal par boite bombardée. Calls are obtained after 3 months or sometimes earlier, calluses whose growth is not inhibited by the selection agent, usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene. The frequency of obtaining such calluses is approximately 0.8 cal per bombarded box.

Ces cals sont identifiés, individualisés, amplifiés puis cultivés de façon à régénérer des plantules. Afin d'éviter toute interférence avec des cellules non transformées toutes ces opérations sont menées sur des milieux de culture contenant l'agent sélectif. These calluses are identified, individualized, amplified and then cultivated so as to regenerate seedlings. In order to avoid any interference with untransformed cells, all these operations are carried out on culture media containing the selective agent.

Les plantes ainsi régénérées sont acclimatées puis cultivées en serre où elles peuvent être croisées ou autofécondées.The plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.

C. Utilisation d'Agrobacterium tumefaciens pour la transformation génétique du maïs. C. Use of Agrobacterium tumefaciens for the genetic transformation of maize.

La technique utilisée est décrite par Ishida et al. (Nature Biotechnology, 1996, 14 : 745-750). The technique used is described by Ishida et al. (Nature Biotechnology, 1996, 14: 745-750).

III. : ANALYSE DE L'EXPRESSION DE L'al-ANTITRYPSINE
HUMAINE DANS LES GRAINES DE MAIS
Le protocole d'extraction de l' < x1-antitrypsine pour la réalisation des tests ELISA et des Western blot, à partir de graines de maïs est le suivant : 100 mg de graines sont broyées dans l'azote liquide puis dans 1 ml de tampon Tris-HCl 100mM pH 8 additionné d'EDTA lmM, de dithiotréitol lmM et de NaC1 250 mM. Le broyat est conservé à 40C pour macération pendant 2 heures, puis centrifugé à 4"C pendant 10 min à 10000g.III. : ANALYSIS OF THE EXPRESSION OF AL-ANTITRYPSIN
HUMAN IN CORN SEEDS
The protocol for extracting <x1-antitrypsin for carrying out the ELISA tests and Western blots, from corn seeds is as follows: 100 mg of seeds are ground in liquid nitrogen and then in 1 ml of buffer 100 mM Tris-HCl pH 8 supplemented with lmM EDTA, lmM dithiotreitol and 250 mM NaC1. The ground material is stored at 40C for maceration for 2 hours, then centrifuged at 4 "C for 10 min at 10000g.

Sur le surnageant de centrifugation, un dosage des protéines solubles est réalisé par la méthode de
Bradford (1976).On the centrifugation supernatant, a determination of the soluble proteins is carried out by the method of
Bradford (1976).

Immunodétection par Western blot
Les protéines extraites selon le protocole cidessus sont dénaturées par chauffage à 95"C pendant 5 min en présence de tampon Tris-HCl 50 mM pu6,8, SDS 4%, ss-mercaptoéthanol 1%, saccharose 20% et bleu de bromophénol 0,01%. Les protéines sont ensuite séparées par électrophorèse sur gel de polyacrylamide en conditions dénaturantes selon la technique de Laemmli (1970) à raison de 30 g de protéines solubles par échantillon. Après migration, les protéines sont transférées sur une membrane de nitrocellulose. Un anticorps polyclonal anti-a1-antitrypsine obtenu chez le lapin (Dako) est utilisé comme sonde et la révélation est effectuée au moyen d'un anticorps antiimmunoglobulines de lapin marqué à la phosphatase alcaline (Sigma). Western blot immunodetection
The proteins extracted according to the above protocol are denatured by heating at 95 "C for 5 min in the presence of 50 mM pu6.8 Tris-HCl buffer, 4% SDS, 1% ss-mercaptoethanol, 20% sucrose and 0 bromophenol blue, Proteins are then separated by polyacrylamide gel electrophoresis under denaturing conditions according to the technique of Laemmli (1970) at the rate of 30 g of soluble proteins per sample After migration, the proteins are transferred to a nitrocellulose membrane. anti-a1-antitrypsin polyclonal antibody obtained in rabbits (Dako) is used as probe and the revelation is carried out by means of an anti-rabbit immunoglobulin antibody labeled with alkaline phosphatase (Sigma).

Purification partielle de 11a1-antitrypsine à partir de graines de maïs
L'extrait protéique est passé sur colonne d'héparine BIORAD, colonne échangeuse d'anions Mono Q, et une colonne gel filtration Superdex 75. Partial purification of 11a1-antitrypsin from corn seeds
The protein extract is passed through a BIORAD heparin column, anion exchange column Mono Q, and a gel filtration column Superdex 75.

REFERENCES BIBLIOGRAPHIQUES :
An G., 1986, Plant Physiol., 81, 86-91.BIBLIOGRAPHICAL REFERENCES:
An G., 1986, Plant Physiol., 81, 86-91.

Berg D.E. et Berg C.M., 1983, Biotechnology, 1, 417435.Berg D.E. and Berg C.M., 1983, Biotechnology, 1, 417435.

Birnboim H.C. et Doly J., 1979, Nucl. Acids. Res., 7, 1513-1523.Birnboim H.C. and Doly J., 1979, Nucl. Acids. Res., 7, 1513-1523.

Bradford M., 1976, Anal. Biochem., 72, 248.Bradford M., 1976, Anal. Biochem., 72, 248.

Close J.J. et Rodriguez R.L., 1982, Gene, 20, 305-316.Close J.J. and Rodriguez R.L., 1982, Gene, 20, 305-316.

Depicker et al., 1982, J. Mol. Appl. Genet., 1, 561573.Depicker et al., 1982, J. Mol. Appl. Genet., 1, 561573.

Depigny-This et al., 1992, Plant. Mol. Biol., 20, 467479.Depigny-This et al., 1992, Plant. Mol. Biol., 20, 467479.

Franck et al., 1980, Cell, 21, 285-294.Franck et al., 1980, Cell, 21, 285-294.

Gamborg O.L., Miller R.A. et Ojima K., 1968, Exp. Cell
Res., 50, 151-158.Gamborg OL, Miller RA and Ojima K., 1968, Exp. Cell
Res., 50, 151-158.

Guerineau F. et Mullineaux P., 1993, Plant Molecular
Biology LABFAX, Groy R.R.D (Ed), Nios. Scientific
Publishers, Blackwell Scientific Publications, 121147.Guerineau F. and Mullineaux P., 1993, Plant Molecular
Biology LABFAX, Groy RRD (Ed), Nios. Scientific
Publishers, Blackwell Scientific Publications, 121147.

Hanahan D., 1983, J. Mol. Biol., 166, 557-580.Hanahan D., 1983, J. Mol. Biol., 166, 557-580.

Holsters et al., 1978, Mol. Gen. Genet., 163, 181-187. Holsters et al., 1978, Mol. Gen. Genet., 163, 181-187.

Horsch R.B., Fry J.E., Hoffmann N.L., Eichholtz D. et
Rogers S.G., 1985, Science, 227, 1229-1231. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D. and
Rogers SG, 1985, Science, 227, 1229-1231.

Kay et al., 1987, Science, 236, 1299-1302.Kay et al., 1987, Science, 236, 1299-1302.

Laemmli U.K., 1970, Nature, 227, 680-685.Laemmli U.K., 1970, Nature, 227, 680-685.

Liu et al., 1993, Mol. Plant Microb. Interactions, 6, 144-156.Liu et al., 1993, Mol. Plant Microb. Interactions, 6, 144-156.

Matsuoka K. et Nakamura K., 1991, Proc. Natl. Acad.Matsuoka K. and Nakamura K., 1991, Proc. Natl. Acad.

Sci., USA, 88, 834-838.Sci., USA, 88, 834-838.

Montreuil J. 1980, Advances in Carbohydrate Chemistry and Biochemistry, Academic Press Inc., 37, 157-223.Montreuil J. 1980, Advances in Carbohydrate Chemistry and Biochemistry, Academic Press Inc., 37, 157-223.

Murakami et al., 1986, Plant Mol. Biol., 7, 343-355.Murakami et al., 1986, Plant Mol. Biol., 7, 343-355.

Murashige T. et Skoog F., 1962, Physiol. Plantarum, 15, 473-497.Murashige T. and Skoog F., 1962, Physiol. Plantarum, 15, 473-497.

Renart J. et Sandoval IV., 1984, Meth. Enzymol., 104, 455-460.Renart J. and Sandoval IV., 1984, Meth. Enzymol., 104, 455-460.

Sambrook et al., 1989, Molecular Cloning Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory
Press.Sambrook et al., 1989, Molecular Cloning Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory
Press.

Sanger et al., 1977, Proc. Natl. Acad. Sci., 74, 54635467.Sanger et al., 1977, Proc. Natl. Acad. Sci., 74, 54635467.

Travis J. et Johnson D., 1981, Meth. in Enzymol., 80, 754-765.Travis J. and Johnson D., 1981, Meth. in Enzymol., 80, 754-765.

Vliegenthart J.F.G. and Montreuil J., Chap. II,
Glycoproteins, Montreuil J., Schachter H., vliegenthart J.F.G., 1995, ELSEVIER SCIENCE B.V., 1328. Vliegenthart JFG and Montreuil J., Chap. II,
Glycoproteins, Montreuil J., Schachter H., vliegenthart JFG, 1995, ELSEVIER SCIENCE BV, 1328.

Claims

1 - Process for the production of a1-antitrypsin (al

AT), or variants thereof characterized by i) the introduction into monocotyledonous plant cells, of a nucleic acid comprising a sequence coding for al-antitrypsin (al-AT) or for a variant thereof ci, the variants differentiating from natural human a1-AT by one or more substitution (s), deletion (s) or insertion (s) of amino acids, and possibly a sequence coding for a selective agent ii) selection of cells having stably integrated nucleic acid; iii) propagation of cells transformed into culture, or regeneration of chimeric or transgenic whole plants; iv) recovery and possibly purification of the α-antitrypsin or of its variants, thus produced.

2 - Process according to claim 1 characterized in that the al-antitrypsin or its variants have an activity of inhibiting serine proteases, preferably an activity of human al-AT.

3 - Method according to claim 2 characterized in that the nucleic acid introduced into plant cells code for the protein illustrated in Figure 1, or for a protein having at least 90% homology with it, or a fragment of one of these proteins having a length between 200 and 393 amino acids.

4 - Method according to claim 3 characterized in that the nucleic acid further comprises a sequence coding for a signal peptide or "prepeptide", and optionally a sequence coding for an endoplasmic retention signal or for a vacuolar addressing signal.

5 - Method according to any one of claims 3 or 4 characterized in that the nucleic acid further comprises regulatory transcription sequences recognized by a monocotyledonous plant cell.

6 - Protein having a serine protease inhibitor activity, preferably an activity of human al-antitrypsin, characterized in that it is capable of being produced by the process according to any one of claims 1 to 5.

7 - Protein according to claim 6 characterized in that it is N-glycosylated by at least one glycan of mannosidic or polymannosidic type, and / or by at least one glycan of complex type optionally comprising within its structure one or more residues xylose and possibly one or more residues of fucose.

8 - Protein according to claim 7 comprising the amino acid sequence illustrated in Figure 1, or a sequence having at least 90% homology with this sequence, or a fragment of one of these sequences having a length between 200 and 393 amino acids.

9 - Protein according to claim 8 characterized in that the glycan is linked glycosidically to Asn-46, Asn-83 or Asn-247.

10 - Protein according to any one of the preceding claims, characterized in that it carries both one or more glycans of the polymannosic type and one or more glycans of the complex type.

11 - Protein according to any one of the preceding claims, characterized in that the polymannosic glycan has the structure GlcNAc2 Man59, for example GlcNAc2-Mang.

12 - Protein according to any one of the preceding claims, characterized in that the complex glycan has the structure GlcNAc2 (Fuc)

Man3 (Xyl).

13 - Protein according to one of claims 6 to 12 characterized in that the amino acid sequence further comprises an N-terminal signal peptide, allowing secretion of the protein and optionally a signal responsible for the retention of the protein in the endoplasmic reticulum, or a signal recognized by a plant cell as being a vacuolar addressing signal.

14 - Protein according to claim 13 characterized in that the signal peptide is the prepeptide of sporamine, barley lectin, vegetable extensin, a-mating factor, pathogenesis proteins.

15 - Protein according to claim 13 characterized in that the signal peptide is that of 1 a1-native antitrypsin.

16 - Protein according to claim 13 characterized in that the signal responsible for the retention of the protein in the endoplasmic reticulum is chosen from the KDEL peptides,

SEKDEL and HDEL.

17 - Protein according to claim 13 characterized in that the vacuolar addressing signal is of plant origin, such as that of sporamine, or that of barley lectin.

18 - Protein according to claim 6 characterized in that it is free of Nglycosidic chains.

19 - Nucleic acid comprising: i) a sequence coding for al-AT or for a variant thereof, and ii) an addressing sequence chosen from a sequence coding for a signal peptide "pre" of plant origin and optionally a sequence coding for a retention signal or for a vacuolar addressing signal, and iii) transcription regulatory sequences recognized by a monocotyledonous plant cell.

20 - Nucleic acid according to claim 19 characterized in that the regulatory sequences comprise one or more promoter (s) of plant or viral origin.

21 - Nucleic acid according to any one of claims 19 and 20 characterized in that the sequence coding for a1-AT is a cDNA coding for mature a1-AT.

22 - Vector comprising a nucleic acid according to any one of claims 19 to 21.

23 - Monocotyledonous plant cells stably transformed by a nucleic acid according to any one of Claims 19 to 21, and capable of producing one or more protein (s) having a serine protease inhibitor activity, preferably an activity a1-antitrypsin.

24 - Monocotyledonous plant cells according to claim 23 characterized in that it is a culture of plant cells, for example in a liquid or immobilized medium, or a culture of roots.

25 - Plant cells according to claim 24 characterized in that they are cells forming part of a transformed monocotyledonous plant.

26 - Chimeric or transgenic monocotyledonous plant capable of producing a protein having a serine protease inhibitor activity, preferably an al-antitrypsin activity, characterized in that it comprises cells according to claim 23.

27 - Seeds of transgenic plant according to claim 26.

28 - Monoclonal or polyclonal antibodies capable of specifically recognizing the protein according to claims 6 to 18.

29 - Pharmaceutical product comprising one or more protein (s) according to any one of claims 6 to 18 in association with an excipient acceptable from the physiological point of view.

30 - Protein having an activity of al-AT according to claims 6 to 18 for use as a medicament.

31 - Protein according to claim 30 for use in therapy of conditions linked to a deficiency in a1-AT, in particular pulmonary emphysema, cystic fibrosis, septic shock, or as an antirheumoid.

32 - Use of a protein according to any one of claims 6 to 18 for the preparation of a medicament for the treatment of conditions linked to an al-AT deficiency.

33 - Use of a protein according to any one of claims 6 to 18 in the preparation of cosmetic products, or chemical reagents.

34 - Plant extract containing 1 to 90% approximately of a protein according to any one of claims 6 to 18, and in particular al-antitrypsin.

35 - Plant extract according to claim 34 for use as a medicament.

36. Plant extract according to claim 35 for use in therapy of conditions linked to an al-AT deficiency, in particular pulmonary emphysema, cystic fibrosis, septic shock or as an anti-rheumatoid.

37. A pharmaceutical composition comprising a plant extract according to claim 34 in association with an excipient which is physiologically acceptable, preferably for administration by the oral or nasal route, for example in the form of an aerosol.