EP1268791A2 - Regulateurs de brca-1 et procedes d'utilisation - Google Patents

Regulateurs de brca-1 et procedes d'utilisation

Info

Publication number
EP1268791A2
EP1268791A2 EP01924317A EP01924317A EP1268791A2 EP 1268791 A2 EP1268791 A2 EP 1268791A2 EP 01924317 A EP01924317 A EP 01924317A EP 01924317 A EP01924317 A EP 01924317A EP 1268791 A2 EP1268791 A2 EP 1268791A2
Authority
EP
European Patent Office
Prior art keywords
brca
genbank ace
regulator
sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01924317A
Other languages
German (de)
English (en)
Inventor
Carmela Beger
Jack Barber
Flossie Wong-Staal
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Immusol Inc
Original Assignee
Immusol Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immusol Inc filed Critical Immusol Inc
Publication of EP1268791A2 publication Critical patent/EP1268791A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • This invention relates generally to proliferative diseases such as cancer and, more specifically, to regulation of the tumor suppressor BRCA-1 that can be used to diagnose and treat proliferative diseases.
  • Cancer is one of the leading causes of death in the United States. Each year, more than half a million Americans die from cancer, and more than one million are newly diagnosed with the disease. Cancerous tumors result when a cell escapes from its normal growth regulatory mechanisms and proliferates in an uncontrolled fashion. Tumor cells can metastasize to secondary sites if treatment of the primary tumor is either not complete or not initiated before substantial progression of the disease. Early diagnosis and effective treatment of tumors is, therefore, essential for survival. Cancer involves the clonal replication of populations of cells that have gained competitive advantage over normal cells through the alteration of regulatory genes.
  • tumor suppressor genes which, when activated or overexpressed, promote unregulated cell proliferation, and “tumor suppressor genes,” which when inactivated or underexpressed, fail to prevent abnormal cell proliferation. Loss of function or inactivation of tumor suppressor genes is thought to play a central role in the initiation and progression of a significant number of human cancers.
  • BRCA-1 tumor suppressor gene
  • BRCA-1 expression levels are reduced or undetectable in the tumor cells of sporadic breast cancers.
  • the invention is directed to methods of identifying genes that contribute to the formation of cancer and to the identified genes and gene products as therapeutic targets for the treatment of cancer.
  • the methods are directed to the identification of genes encoding proteins that regulate the tumor suppressor, BRCA-1, resulting in an increased propensity for cancer.
  • the present invention provides ribozymes and encoding nucleic acids having target recognition sequences that enable the ribozymes to bind and cleave BRCA-1 regulators, resulting in upregulation or downregulation of BRCA-1 in a cell.
  • nucleic acids encoding BRCA-1 regulators that contain the target sequences recognized by the ribozymes of the invention. Fragments of these nucleic acid and protein sequences also are provided.
  • a method for identifying a gene for which the expression level is affected by a BRCA-1 regulator comprising: a) hybridizing a first mRNA and a second mRNA to at least one candidate gene, wherein the first mRNA is obtained from cells expressing a ribozyme that targets and cleaves mRNA encoding a BRCA-1 regulator and wherein the second mRNA is from control cells otherwise similar to those expressing the ribozyme except that the BRCA-1 regulator mRNA is not targeted by a ribozyme; and b) comparing the relative amounts of the first and second mRNA that hybridizes to the gene.
  • the mRNAs may be reverse transcribed into DNA before hybridization and the gene or the mRNAs (or cDNA copies) may be labeled with a detectable moiety such as a fluorescent dye.
  • hybridization to multiple genes is achieved by arraying the genes on a solid support.
  • a method of identifying a compound that modulates the activity of a BRCA-1 regulator comprising contacting a BRCA-1 regulator with a test compound and a target molecule responsive to the activity of the BRCA-1 regulator, wherein an increase or decrease in the activity of the BRCA-1 regulator for the target molecule in the presence of the test compound as compared to the absence of the test compound identifies a compound that modulates the activity of a BRCA-1 regulator.
  • the activity of the BRCA-1 regulator can be a DNA binding activity, protein kinase activity, GTP binding activity, protease activity, or protein binding activity.
  • BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a haripin ribozyme and a substrate RNA. (SEQ ID NOS: 3 and 99).
  • Figure 2 shows alignments of the (a) nucleic acid; and (b) amino acid sequences for BRl (SEQ ID NOS: 1 and 2, respectively) and Depression EFG (SEQ ID NOS: 96 and 97, respectively).
  • Figure 3 shows rounds of cell sorting in selection for cells with increased EGFP expression.
  • Figure 4 shows the enrichment of EGFP expressing cells after rounds of cell sorting.
  • Figure 5 shows a RNA expression levels after a fifth round of cell sorting.
  • Figure 6 shows a schematic of a method for amplifying DNA corresponding to the sequence of a TST.
  • Figure 7 shows an RST for BRl and sites of binding for several RSTs of BRl (SEQ ID NOS: 100 and 101, respectively).
  • Figure 8 shows validation ribozyme sequences (SEQ ID NOS: 102 through 221).
  • Figure 9 show the nucleic acid sequence of BRl (SEQ ID NO: 1) and predicted translated polypeptide sequence (SEQ ID NOS: 2 and 222 through 231).
  • the invention is directed to methods of identifying genes that contribute to the formation of cancer and to the identified genes and gene products as therapeutic targets for the treatment of cancer.
  • the methods are directed to the identification of genes encoding proteins that regulate the tumor suppressor, BRCA-1, resulting in an increased propensity for cancer.
  • Genes encoding BRCA-1 regulators are sought for identification and as therapeutic targets because decrease in the level of BRCA-1 expression or BRCA-1 activity is linked with certain cancers, for example, breast carcinomas.
  • BRCA-1 regulators have been identified.
  • BRCA-1 is a tumor suppressor which prevents cells from undergoing uncontrolled growth such as occurs with cancer cells.
  • BRCA-1 can act as a transcription factor, and thus BRCA-1 tumor suppressor activity can result, at least in part, from regulation of gene expression.
  • Decreased BRCA-1 activity is associated with cancers such as breast cancer, ovarian cancer, endometrial cancer, prostate cancer, and the like. While in some cancers, the decreased BRCA-1 activity is due to mutations in the BRCA-1 gene, in other cancers, decreased BRCA-1 activity is due to reduced levels of BRCA- 1 expression.
  • regulation of BRCA-1 expression has not been well characterized.
  • numerous nucleic acid sequences have been identified which correspond to BRCA-1 regulators. These nucleic acid sequences have been shown to regulate BRCA-1 gene expression or activity. Ribozymes that inhibit expression of many of these nucleic acid sequences, including BBC1, BRl, ID4, BR2, and BR3, can increase BRCA-1 expression or activity.
  • nucleic acid or polypeptide of the invention is intended to mean a molecule that is in a form that is relatively free from cellular components such as lipids, polypeptides, nucleic acids or other cellular material that it is associated with in its natural state.
  • nucleic acid is intended to mean a single- or double-stranded DNA or RNA molecule.
  • T also is equivalent to a "U” nucleotide in a recited sequence.
  • a nucleic acid molecule of the invention can be of linear, circular or branched configuration, and can represent either the sense or antisense strand, or both, of a native nucleic acid molecule.
  • a reference to a nucleotide sequence of a nucleic acid molecule includes the sequence in single stranded form and in double stranded form.
  • the term also is intended to include nucleic acid molecules of both synthetic and natural origin.
  • a nucleic acid molecule of natural origin can be derived from any animal, such as a human, non-human primate, mouse, rat, rabbit, bovine, porcine, ovine, canine, feline, or amphibian, or from a lower eukaryote, such as Drosophila, C. elegans or yeast.
  • a synthetic nucleic acid includes, for example, nucleic acids prepared by chemical and enzymatic synthesis.
  • the term '"nucleic acid is similarly intended to include analogues of natural nucleotides which have similar binding properties as the referenced nucleic acid and which can be utilized in a manner similar to naturally occurring nucleotides and nucleosides.
  • fragment when used in reference to a nucleic acid is intended to mean a portion or segment of the nucleic acid molecule having the ability to selectively hybridize or bind to the subject nucleic acid, or its complement.
  • selectively hybridize refers to the ability of a nucleic acid or fragment to bind the subject nucleic acid molecule without substantial cross- reactivity with a molecule that is not the subject nucleic acid molecule.
  • a fragment of a nucleic acid molecule of the invention includes at least about 8-12 nucleotides of the subject nucleic acid.
  • a ribozyme sequence tag (RST) of a hairpin ribozyme and its complementary target sequence tag (TST) described herein generally include about 14-16 nucleotides of which 6-8 nucleotides are in helix 1, about 4 nucleotides are in helix 2, the two helixes separated by 4 non- base pairing nucleotides. Not all of the RST nucleotides in helix 1 need be complementary to the TST for the ribozyme to target and cleave the TST containing RNA.
  • a fragment can be longer, including at least about 25, 30, 40, 50, 100, 300 or 500 or more nucleotides, and can include up to the full length of the reference nucleic acid molecule minus one nucleotide. Fragments of such lengths are able to selectively hybridize with the subject nucleic acid molecule in a variety of detection formats described herein and known to those skilled in the art.
  • a fragment of a nucleic acid molecule of the invention can be used, for example, as an RST to target a ribozyme to a nucleic acid of the invention or as a selective inhibitor of uncontrolled growth in a cell having abnormal BRCA-1 activity or expression levels.
  • a TST can be used as a PCR primer to selectively amplify a nucleic acid molecule of-the invention; as a selective primer for 5' or 3' RACE to determine or identify 5' or 3' sequence of a nucleic acid molecule identified in methods of the invention; as a selective probe to identify or isolate a nucleic acid molecule of the invention on a RNA or DNA blot, or from a genomic or cDNA library.
  • nucleotide sequence encoding the BRCA-1 regulator 1, or BRl differs from the elongation factor G (EFG) encoding sequence at about 285 codon positions or about 694 nucleotides within the coding region.
  • a BRl nucleic acid fragment containing one such characteristic nucleotide is a unique fragment.
  • nucleic acid molecule having substantially the same sequence compared to a reference nucleic acid can include, for example, one or more additions, deletions or substitutions with respect to the reference sequence so long as it can selectively bind to that sequence. Included within this definition are encoding nucleic acids that have degenerate codon sequences at one or more positions and therefore differ in nucleotide sequence compared to the reference nucleic acid but substantially maintain the referenced encoded amino acid sequence.
  • polypeptide that has substantially the same amino acid sequence as a reference human amino acid sequence can be, for example, a homologous polypeptide from a vertebrate species, such as a non-human primate, mouse, rat, rabbit, bovine, porcine, ovine, canine, feline, or amphibian, or from a lower eukaryote, such as Drosophila, C. elegans or yeast.
  • a polypeptide that has substantially the same amino acid sequence as a reference sequence can also have one or more deliberately introduced modifications, such as additions, deletions or substitutions of natural or non-natural amino acids, with respect to the reference sequence.
  • modifications such as additions, deletions or substitutions of natural or non-natural amino acids, with respect to the reference sequence.
  • Those skilled in the art can determine appropriate modifications that, for example, serve to increase the stability, bioavailability, bioactivity or immieuxicity of the polypeptide, or facilitate its purification, without altering the desired functional activity.
  • introduction of a D-amino acid or an amino acid analog, or deletion of a lysine residue can stabilize a polypeptide and reduce degradation.
  • tag sequences such as epitope or histidine tags, or sorting sequences, can facilitate purification of the recombinant polypeptide.
  • the modification can be introduced into the polypeptide, or into the encoding nucleic acid sequence.
  • an amino acid sequence that is substantially the same as a reference amino acid sequence will have greater than about 25% identity with the reference sequence, although an amino acid sequence that is substantially the same as a reference sequence can have greater than about 30% identity, greater than about 40% identity, greater than about 50% identity, greater than about 60% identity, greater than about 70% identity, preferably greater than about 80% identity, more preferably greater than about 90% identity, and especially preferably greater than about 95% identity, or greater than about 98% identity.
  • the amino acid sequences which align across two sequences, and the presence of gaps and non-homologous regions in the alignment can be determined by those skilled in the art based, for example, on a BLAST 2 or Clustal V or similar computer alignment software.
  • a computer alignment can, if desired, be optimized visually by those skilled in the art.
  • the percent identity of two sequences is determined as the percentage of the total amino acids that align in such an alignment which are identical. Those skilled in the art understand that two amino acid molecules with a given percentage identity over the entire sequence or over a substantial portion or portions thereof, are more likely to exhibit similar functional activities than two molecules with the same percentage identity over a shorter portion of the sequence. Sequence identity is preferably determined with by BLAST searching with the default settings provided at the website of the National Cancer Biological Institute (NCBI).
  • a functional fragment when used in reference to a polypeptide of the invention is intended to refer to a portion, segment or fragment of the polypeptide, which retains at least one of the activities of the full length polypeptide.
  • a functional fragment of any of the BRCA-1 regulators of the invention can be a portion of the polypeptide that maintains its ability to regulate BRCA-1 expression or activity.
  • a functional fragment of ID4 can be a portion of ID4 that maintains its ability to bind with one or more helix-loop-helix transcription factors or a portion of ED4 that modulates differentiation in adipocytes or neuronal cells.
  • ribozyme sequence tag or "RST” is intended to mean the target recognition domain of a ribozyme. Therefore, the structure of an RST hairpin ribozyme can be 5'-N 8 -AGAA-N 4 -3' where N 8 and N 4 are complementary to sequences of the target RNA . The bases AGAA form a non- binding loop with the NGUC sequence of the target RNA. Therefore, a "target sequence tag” nucleic acid or "TST” as used herein, is a nucleic acid having a nucleotide sequence that is capable of selectively hybridizing to an RST of a ribozyme and being cleaved by the ribozyme.
  • the TST regions capable of selectively hybridizing to the RST will be substantially the complement of the helix 1 and helix 2 RST region sequences. These selectively hybridizing regions are separated by, for example, a GUC which is capable of being cleaved by a hairpin ribozyme and therefore will have the structure 5'-N 5 -GUC-N 8 -3' where the first four nucleotides of N 5 represent the TST complementary sequence of the ribozyme helix 2 and N 8 represents the TST complementary sequence of the ribozyme helix 1.
  • the term "ribozyme” or "ribozyme RNA molecule” is intended to mean a catalytic RNA that cleaves RNA.
  • Ribozymes include both hairpin and hammerhead classes, which differ in mechanism for hybridization.
  • hairpin ribozyme is intended to refer to an RNA molecule having the general nucleic acid sequence and two-dimensional configuration of the molecule shown in Figure 1, which is capable of selectively hybridizing, or of both selectively hybridizing and cleaving, a target RNA.
  • the term is also intended to include both hairpin ribozyme RNA molecules as well as single- and double-stranded DNA molecules that, when expressed, form hairpin ribozyme RNA molecules.
  • a hairpin ribozyme will have from about 50 to 54 nucleotides, which form two helical domains (helix 3 and helix 4) and 3 loops (Loops 2, 3 and 4). Two additional helices, helix 1 and helix 2, form between the ribozyme and its RNA target or substrate ( Figure 1).
  • a hairpin ribozyme binds a target RNA by forming Watson- Crick base pairs between the substrate and helix 1 and helix 2 sequences (see dots in Figure 1; "N” is any nucleotide).
  • the length of helix 2 is usually about 4 nucleotides, and the length of helix 1 can vary from about 6-10 nucleotides or more.
  • a hairpin ribozyme can have catalytic activity, and thus cleave the target RNA such as at the cleavage site shown in Figure 1.
  • the catalytic activity of the hairpin ribozyme also can be disabled by, for example, altering the AAA sequence in Loop 2 to CGU.
  • Those skilled in the art can determine which modifications to the overall hairpin ribozyme structure can be made and still maintain the target binding, or both target binding and catalytic activity of a hairpin ribozyme of the invention.
  • the term "library” or "ribozyme library” is intended to mean a collection or population of different species of ribozyme RNA molecules. Within a population, any of the ribozyme species can be uniquely represented or redundant. Therefore, the term “randomized” or “random” when used in reference to a ribozyme library is intended to refer to a population of ribozymes that have differing nucleotide sequences in their target recognition sequence. The differing nucleotide sequences can be purposefully introduced, such as by degenerate, partially degenerate or variegated oligonucleotide synthesis, or other methods well known to those skilled in the art.
  • the differing nucleotide sequences can be introduced by a variety of mutagenesis methods including, for example, chemical and enzymatic methods well known in the art.
  • a random ribozyme library also can be assembled, for example, from combining a collection of different ribozyme species into a single population. Details on the synthesis and construction of random ribozyme libraries is described in the Examples and in WO 00/05415 to Barber et al.
  • target recognition sequence when used in reference to a ribozyme is intended to mean the substrate binding site of a ribozyme, which corresponds to an RST RNA nucleotide sequence or which corresponds to the complement of an TST nucleic acid nucleotide sequence.
  • the target recognition sequence corresponds to the nucleotide sequences of the helix 1 or helix 2 domain or both (see Figure 1).
  • the target recognition sequences of helix 1 and 2 can be separated by catalytic nucleotides, which in the specific example of a hairpin ribozyme correspond to the nucleotides AGAA.
  • BRCA-1 regulator is intended to mean a gene product or a nucleic acid, such as a structural or functional RNA, that modulates the expression or activity of BRCA-1.
  • a BRCA-1 regulator can modulate BRCA-1 expression through, for example, direct binding of a BRCA-1 regulator to a nucleic acid element that influences BRCA-1 expression, such as the BRCA-1 5' regulatory region, where the BRCA-1 regulator bound to the nucleic acid element results in an increase or decrease in BRCA-1 expression.
  • Another manner in which a BRCA-1 regulator can modulate BRCA-1 expression is by binding to a separate molecule that modulates BRCA-1 expression, such as a transcription factor, in such a way that results in an increase or decrease in BRCA-1 expression.
  • BRCA-1 expression can also be modulated by a BRCA-1 regulator which increases or decreases the translation of BRCA-1 -encoding mRNA. Additionally, a BRCA-1 regulator can bind to BRCA-1, thereby modulating BRCA-1 activity. For example, a BRCA-1 regulator can bind BRCA-1 thereby increasing or decreasing the transcriptional activation activity of BRCA-1. Similarly, BRCA-1 regulator can modulate BRCA-1 activity by binding a separate molecule that modulates BRCA-1 expression, for example a transcription factor such as TFIIH, and thereby increase or decrease BRCA-1 activity. It is not necessary that the BRCA-1 regulator be essential for modulation of BRCA-1 expression or activity. All that is needed is that the BRCA-1 regulator be functionally involved in modulating BRCA-1 expression or activity.
  • a BRCA-1 regulator can be encoded by a gene including, for example, a gene originating from the species of the infected cell type as well as a heterologous gene that becomes incorporated into the cell's genome. Also, in accordance with the invention, regulators of BRCA-1 can be involved in regulating BRCA-2 or other factors involved in the DNA repair response. As used herein, the term "modulate" when used in reference to BRCA-1 expression or activity refers to the ability of a BRCA-1 regulator to alter BRCA-1 expression or activity. Altered expression or activity includes, for example, an increase or decrease in BRCA-1 expression or activity.
  • BRCA-1 is intended to mean a member of the BRCA-1 tumor suppressor family.
  • Exemplary members of the tumor suppressor family are human BRCA-1 and species homologs of BRCA-1.
  • selection marker means a natural or modified gene product that influences cell viability or cell growth, or can be used as a measurable indicator of an activity associated with a cell such as viability, growth, gene expression and the like.
  • Specific examples include enhanced green fluorescence protein (EGFP), hygromycin resistance gene and the tumor suppressor BRCA-1.
  • EGFP enhanced green fluorescence protein
  • hygromycin resistance gene hygromycin resistance gene
  • BRCA-1 tumor suppressor BRCA-1.
  • BRCA-1 suppresses anchorage-independent cell growth, resulting in, for example, decreased ability to grow in soft agar.
  • EGFP is another selection marker that can be used as a measurable indicator of gene expression.
  • EGFP fluorescence activated cell sorting
  • FACS fluorescence activated cell sorting
  • Iterative FACS-based selection results in enrichment of cells expressing EGFP at the user-defined expression level.
  • the term "treating" when used in reference to cancer is intended to mean a reduction in the severity, or prevention of a neoplastic disease. Therefore, '"treating a cancerous disease” as used herein, is intended to mean a reduction in severity, regression, or prevention of a cancerous disease. Reduction in severity includes, for example, an arrest or a decrease in clinical symptoms, physiological indicators or biochemical markers.
  • Prevention of the cancer includes, for example, precluding the occurrence of the cancer, such as in prophylactic uses to individuals having a known or suspected propensity for developing cancer, or reversing the cancer in an individual to their non-diseased state of health.
  • cancer As used herein, the terms “cancer,” “tumor” and “neoplasm” and grammatical variants thereof are intended to mean abnormal growth in a tissue or organ. Typically, such a growth is characterized by uncontrolled cell proliferation and can be malignant or benign.
  • neoplastic cell is intended to mean a cell that has altered expression or activity of a BRCA-1 regulator compared to a normal cell from the same or a different individual.
  • a neoplastic cell will generally also exhibit histological or proliferative features of a malignant or premalignant cell. For example, histological methods can be used to show invasion of surrounding normal tissue, increased mitotic index, increased nuclear to cytoplasmic ratio, altered deposition of extracellular matrix, or a less differentiated cell phenotype.
  • a neoplastic cell can also exhibit unregulated proliferation, such as anchorage independent cell growth, proliferation in reduced-serum medium, loss of contact inhibition, or rapid proliferation compared to normal cells.
  • altered expression of a BRCA-1 regulator nucleic acid detected by a method of the invention refers to an increased or decreased amount of a BRCA-1 regulator nucleic acid in the test sample relative to known levels in a normal sample. Altered abundance of a nucleic acid molecule can result, for example, from an altered rate of transcription, from altered transcript stability, or from altered copy number of the corresponding gene.
  • altered structure of a nucleic acid molecule refers to differences, such as point mutations, deletions, translocations, splice variations and other rearrangements, between the structure of a BRCA-1 regulator nucleic acid molecule in a test sample and the structure of the BRCA-1 regulator nucleic acid molecule in a normal sample. Those skilled in the art understand that mutations that alter the structure of a nucleic acid molecule can also alter its expression.
  • altered expression of a BRCA-1 regulator polypeptide refers to an increased or decreased amount, or altered subcellular localization of the polypeptide in the test sample relative to known levels or localization in a normal sample.
  • Altered abundance of a polypeptide can result, for example, from an altered rate of translation or altered copy number of the corresponding message, or from altered stability of the protein. Altered subcellular localization can result, for example, from truncation or inactivation of a sorting sequence, from fusion with another polypeptide sequence, or from altered interaction with other cellular polypeptides.
  • altered structure refers to differences in amino acid sequence, post-translational modifications, or conformation, of the polypeptide in the test sample relative to a normal sample which result in altered expression or activity of a BRCA-1 regulator polypeptide.
  • Post- translational modifications include, for example, phosphorylation, glycosylation and acylation. Such differences can be detected, for example, with a structure-specific detectable binding agent.
  • sample is intended to mean any biological fluid, cell, tissue, organ or portion thereof, that includes or potentially includes nucleic acids and polypeptides of the invention.
  • the term includes samples present in an individual as well as samples obtained or derived from the individual.
  • a sample can be a histologic section of a specimen obtained by biopsy, or cells that are placed in or adapted to tissue culture.
  • a sample further can be a subcellular fraction or extract, or a crude or substantially pure nucleic acid or protein preparation.
  • a sample can be prepared by methods known in the art suitable for the particular format of the detection method.
  • detectable agent refers to a molecule that renders a BRCA-1 regulator nucleic acid or polypeptide detectable by an analytical method.
  • An appropriate detectable agent depends on the particular detection format, and can be determined for a particular application of the method by those skilled in the art.
  • a detectable agent specific for a BRCA-1 regulator nucleic acid molecule can be a complementary nucleic acid molecule, such as a hybridization probe or non-catalytic ribozyme, that selectively hybridizes to the nucleic acid molecule.
  • a hybridization probe or ribozyme can be labeled with a detectable moiety, such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.
  • a detectable moiety such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.
  • a detectable agent specific for a BRCA-1 regulator nucleic acid molecule can also be, for example, a PCR or RT-PCR primer, which can be used to selectively amplify all or a desired molecule, which can then be detected by methods known in the art.
  • a detectable agent specific for a BRCA-1 regulator nucleic acid molecule can be a selective binding agent, such as a peptide, nucleic acid analog, or small organic molecule, identified, for example, by affinity screening of a library of compounds.
  • a detectable agent specific for a BRCA-1 regulator polypeptide can be, for example, an agent that selectively binds the polypeptide.
  • a detectable agent is one that selectively binds with high affinity or avidity to the polypeptide without substantial cross-reactivity with other polypeptides that are not BRCA-1 regulator polypeptides.
  • the binding affinity of a detectable agent that selectively binds a polypeptide will generally be greater than about 10 "5 M and more preferably greater than about 10 "6 M for the polypeptide. High affinity interactions are preferred, and will generally be greater than about 10 "8 M to 10 "9 M.
  • a detectable agent specific for a BRCA-1 regulator polypeptide can be, for example, a polyclonal or monoclonal antibody specific for the polypeptide, or other selective binding agent identified, for example, by screening a library of compounds for binding to the regulator polypeptide.
  • a detectable agent can be utilized that preferentially recognizes a particular conformational or post- translationally modified state of the polypeptide.
  • the detectable agent can be labeled with a detectable moiety, if desired, or rendered detectable by specific binding to a detectable secondary binding agent.
  • the invention provides a substantially pure nucleic acid comprising a nucleotide sequence greater than about 57% identical to SEQ ID NO: 1, or a unique fragment thereof. Also provided is a substantially pure polypeptide comprising an amino acid sequence greater than about 41% identical to SEQ ID NO: 2, or functional fragment thereof.
  • the nucleic acid shown as SEQ ID NO: 1 has been found to encode a BRCA- 1 regulator, which functions in reducing the expression of BRCA-1. As such, it is useful as a target for treating or reducing the severity of a cancer by regulating its proliferation through modulating BRCA-1 expression. Inhibition of the expression or activity of a BRCA-1 regulator results in a concomitant increase in BRCA-1 expression and therefore will result in decreased tumor cell proliferation.
  • SEQ ID NO: 1 corresponds to the expressed message of the human gene encoding BRCA-1 regulator termed BRCA-1 regulator 1 (BRl).
  • SEQ ID NO: 1 is about 2967 nucleotides in length and has 5' and 3' non-coding regions of 395 and 988 nucleotides, respectively ( Figure 9).
  • the resultant coding region is 1584 nucleotides in length, coding for a polypeptide of 521 amino acids.
  • SEQ ID NO: 1 has a nucleotide sequence of about 57% identical to the human EFG sequence.
  • nucleic acids of the invention which do not substantially affect the activity of the encoded BRCA-1 regulator and which maintain nucleotide sequence identity greater than about 57% are included as nucleic acids of the invention.
  • nucleic acids having minor modifications can similarly be used for the development of therapeutic compounds which inhibit the expression or activity of BRl.
  • modifications include, for example, changes in the nucleotide sequence which do not alter the encoded amino acid sequence as well as changes in the nucleotide sequence resulting in conservative amino acid substitutions or minor alterations which do not substantially affect the BRCA-1 regulating activity of BRl.
  • SEQ ID NO: 1 Those skilled in the art will known or can determine what changes within greater than about 57% compared to SEQ ID NO: 1 can be made without substantially affecting the activity of BRl as a regulator of BRCA-1 expression or activity.
  • Unique fragments of SEQ ID NO: 1 are also provided. The fragments are useful in a variety of procedures, including for example, as probes for determining the effectiveness of therapeutic agents which target expression of BRl as a regulator of BRCA-1 expression or activity. Unique fragments also can be used to encode functional fragments of BRl as therapeutic targets for anti-cancer compounds in the screening methods of the invention.
  • the unique fragments of SEQ ID NO: 1 are applicable in a variety of other methods and procedures known to those skilled in the art.
  • Unique fragments of SEQ ID NO: 1 correspond to fragments or portions of SEQ ID NO: 1 that are of sufficient length to distinguish the fragment as a BRl encoding nucleic acid and that contain at least one nucleotide characteristic of SEQ ID NO: 1.
  • Such a characteristic nucleotide, or nucleotides, within a specific fragment of SEQ ID NO: 1 distinguish that fragment from other related nucleotide sequences.
  • fragments of the non-coding region of SEQ ID NO: 1 are generally unique when compared to nucleotide sequences such as EFG, for example, because there is little evolutionary pressure to conserve non-coding domains.
  • Nucleic acid sequences as small as between about 12-15 nucleotides are statistically unique sequences within the human genome.
  • nucleic acids as small as between about 8-12 nucleotides can be unique. Therefore, non-coding region fragments of SEQ ID NO: 1 of about 8-9, preferably about 10-11, and more preferably about 12 or 15 nucleotides or more in length can be nucleotide sequences corresponding to unique fragments of SEQ ID NO: 1 of the invention. Additionally, unique nucleotide sequences arise in the coding region of SEQ ID NO: 1 of the invention.
  • nucleic acid sequence alignment of SEQ ID NO: 1 with the nucleic acid sequence of EFG shows that there are about 285 codon differences between the BRl and EFG sequences indicating at least about 694 or more unique nucleotides in SEQ ID NO: 1 compared to the EFG encoding nucleotide sequence ( Figure 2). Inclusion of any or all of these distinguishing nucleotide differences within a fragment of SEQ ID NO: 1 confers uniqueness onto the fragment.
  • a substantially pure nucleic acid molecule having a nucleotide sequence greater than about 57% identical to SEQ ID NO: 1, or a unique fragment thereof, will be of sufficient length and identity to SEQ ID NO: 1 to selectively hybridize to it under at least moderately stringent hybridization conditions.
  • a substantially pure nucleic acid molecule contains a nucleotide sequence greater than about 57% as SEQ ID NO: 1, or a unique fragment thereof, by determining its ability to hybridize in a filter hybridization assay to a molecule having the sequence of SEQ ID NO: 1, but not to other unrelated nucleic acid molecules, under conditions equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.
  • Suitable alternative buffers and hybridization conditions that provide for moderately stringent hybridization conditions in particular assay formats are known or can be determined by those skilled in the art (see, for example, Sambrook et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989).
  • the nucleic acid shown as SEQ ID NO: 1 encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.
  • modifications of SEQ ID NO: 2 which do not substantially affect the activity of the BRCA-1 regulator and which maintain amino acid sequence identity greater than about 41% are included as polypeptides of the invention. These polypeptides having minor modifications can similarly be used for the development of therapeutic compounds which inhibit the BRCA-1 -regulating activity of BRl.
  • Such modifications include, for example, changes in the amino acid sequence which do not substantially alter the structure or function of a domain within the polypeptide as well as changes in the amino acid sequence which result in conservative substitutions or minor alterations which do not substantially affect the activity of BRl.
  • changes in the amino acid sequence which do not substantially alter the structure or function of a domain within the polypeptide as well as changes in the amino acid sequence which result in conservative substitutions or minor alterations which do not substantially affect the activity of BRl.
  • Those skilled in the art will known or can determine what changes within greater than about 41% compared to SEQ ID NO: 2 can be made without substantially affecting the BRCA-1 -regulating activity of BRl.
  • the BRCA-1 regulator BRl can regulate BRCA-1 by inhibiting the translation of BRCA-1 mRNA. Therefore, it is within the scope of the invention that an example of a functional fragment of BRl is a domain that inhibits translation of a mRNA into a polypeptide, for example the, translation of BRCA-1 mRNA into a polypeptide.
  • the invention also provides a substantially pure TST nucleic acid including a fragment having substantially the nucleotide sequence of SEQ ID NO: 1, wherein the TST has substantially the nucleotide sequence 5'-N 5 -GUC-N 8 -3' or 5'-N 5 -GUA- N 8 -3' (SEQ ID NOS: 3 and 4, respectively).
  • the TST nucleic acid portion of the fragment can have between about 8-12 nucleotides, and preferably about 9-10 nucleotides at positions N 5 and N 8 , that are identical to a fragment of SEQ ID NO: 1. Therefore, depending on the length of the TST nucleic acid portion, a fragment of SEQ ID NO: 1 as described above can be about 11-15 nucleotides or greater in length.
  • Hairpin ribozymes cleave RNA substrates 5' to the G nucleotide in either of the sequences 5'-N 5 -GUC-N 8 -3' or 5'-N 5 -GUA-N 8 -3' (SEQ ID NOS: 3 and 4, respectively)
  • Fragments of SEQ ID NO: 1 having a corresponding RNA form that is recognized by the target recognition site of a hairpin ribozyme therefore include nucleic acids having the sequence 5'-N 5 -GUC-N 8 -3' or 5'-N 5 -GUA-N 8 -3' (SEQ ID NOS: 3 and 4, respectively) where N 5 and N 8 are nucleotide sequences substantially the same as a sequence corresponding to SEQ ID NO: 1.
  • TST nucleic acids correspond to the complement sequence of a ribozyme target recognition site or RST, and are referred to herein as TST nucleic acids.
  • the TST nucleic acids can be of any desired length and can include additional sequences other than those corresponding to SEQ ID NO: 1 and other moieties so long as they have the structure 5'-N 5 -GUC-N 8 -3' or 5'-N 5 -GUA-N 8 -3' (SEQ ID NOS: 3 and 4, respectively) where N 5 and N 8 correspond substantially to a nucleotide sequence of SEQ ID NO: 1. Moreover, it is not necessary for all nucleotide residues within the N 5 and N 8 regions to be identical to the corresponding sequence within SEQ ID NO: 1.
  • TST nucleic acids to selectively hybridize to a complementary RST. Therefore, less than all 13 nucleotides at positions N 5 and N 8 can be identical to a nucleotide sequence or fragment of SEQ ID NO: 1. Generally, between about 8-12 or between about 9-10 nucleotides are sufficient for selective hybridization of a RST with a TST nucleic acid. Described further below in the Examples is a specific example of an RST present in a ribozyme that selectively hybridizes to SEQ ID NO: 1.
  • the TST nucleic acids can be used to design ribozymes that selectively hybridize and cleave a RNA corresponding to SEQ ID NO: 1.
  • a specific example of such a ribozyme is a hairpin ribozyme having a target recognition sequence complementary to a TST nucleic acid of SEQ ID NO: 1 and having the nucleotide sequence 5'-N 8 -AGAA-N 4 -3'.
  • it is not necessary that all the sequences with position N 8 and N be identical in complement to SEQ ID NO: 1 so long as the target recognition sequence can selectively hybridize to the RNA form of TST nucleic acid and cleave it as a substrate.
  • RST sequences are sufficient for selective hybridization as well as for cleavage of a target RNA substrate.
  • Exemplary ribozymes selective for SEQ ID NO: 1 were constructed as described in the Examples. These ribozymes have the RST sequences: 5'- UUGAUGUGAGAAGCUU-3', 5'-ACUUUUCUAGAAGGAA-3', 5'- UAUUCCAUAGAAACUG-3', 5 * -AGGACUGGAGAAAGCC-3', 5'- AACAACAUUAGAAUCAA-3' (SEQ ID NOS: 17-21).
  • the invention provides a ribozyme having a target recognition sequence capable of selectively hybridizing to a RNA corresponding to SEQ ID NO: 1 and cleaving said RNA.
  • the target recognition sequence of the ribozyme can consist of a RST complementary to a fragment of SEQ ID NO: 1 and having substantially the nucleotide sequence 5'-N 8 -AGAA- N 4 -3' (SEQ ID NO: 99).
  • the target recognition sequence can further be between about 8-12 nucleotides, preferably about 9-10 nucleotides at positions N 8 , and N that are complementary to a fragment of SEQ ID NO: 1.
  • the invention further provides a RST having one of the following nucleotide sequences:
  • ribozymes containing different RST sequences were expressed in cells, and cells expressing an increased level of BRCA-1 marker were selected.
  • SEQ ID NOS: 5-10 represent RST sequences of ribozyme binding sites which, when the ribozymes were expressed, resulted in an increased level of BRCA-1 marker expression.
  • BRCA-1 marker expression was determined by increased EGFP expression, increased hygromycin resistance or decreased ability to grow in soft agar.
  • the ribozymes containing RST sequences selective for a BRCA-1 regulator can increase BRCA-1 marker expression by selectively cleaving RNAs that regulate BRCA-1 promoter activity, BRCA-1 expression, BRCA-1 activity, or any combination thereof.
  • Each of the RST sequences SEQ ID NOS: 5-10 correspond to a nucleic acid encoding a BRCA-1 regulator
  • the 5' terminal N 8 positions and the 3' terminal N 5 positions are separated by the intervening trinucleotide sequence 5 -GUC-3' in the BRCA-1 regulator RNA and correspond to the complement of the RST sequence or the TST sequence.
  • at least about 8-12 nucleotides within positions N 8 and N 5 of a TST are sufficient for selective binding between a ribozyme and its BRCA-1 regulator target RNA.
  • a BRCA-1 regulator nucleic acid molecule of the invention contains least about 8-12 nucleotides corresponding to a RST sequence set forth as SEQ ED NOS: 5-10, or its TST sequence complement corresponding to SEQ ID NOS: 11-16, and including the intervening trinucleotide 5 -GUC-3'. Therefore, the invention also provides a TST nucleic acid having one of the following nucleotide sequences:
  • the BRCA-1 regulator nucleic acids of the invention will be described with reference to its TST nucleic acid sequence and specifically with reference to a BRCA-1 nucleic acid containing at least about 8-12 regulator nucleotides corresponding to a TST nucleic acid sequence of SEQ ID NOS: 11-16.
  • reference to a BRCA-1 regulator TST nucleotide sequence also specifically includes reference to the complementary sequence of the RST nucleic acid molecule.
  • reference to a BRCA-1 regulator containing at least about 8-12 nucleotides corresponding to a TST sequence of SEQ ID NOS: 11-16 also includes reference to a BRCA-1 regulator nucleic acid containing at least about 11-15 nucleotides corresponding to a TST sequence set forth as SEQ ID NOS: 11-16, which includes the intervening trinucleotide 5 -GUC-3' between the 5' terminal N 8 positions and the 3' terminal N 5 positions and as described previously with respect to the BRCA-1 regulator shown as SEQ ID NO: 1 and its TST fragments.
  • the invention also provides substantially pure TST nucleic acids having the structure 5'-N 5 -GUC- N 8 -3' or 5'-N 5 -GUA-N 8 -3' and substantially the nucleotide sequences shown as SEQ ID NOS: 11-16.
  • a BRCA-1 regulator nucleic acid molecule containing at least about 8-12 nucleotides corresponding to a TST nucleic acid sequence set forth as SEQ ID NOS: 11-16, or about 11-15 nucleotides corresponding to a TST nucleic acid sequence set forth as SEQ ID NOS: 11-16, and including the intervening trinucleotide 5 -GUC-3' or a functional fragment thereof, does not have the exact endpoints of nucleotide sequences deposited and available in public databases.
  • databases include, for example, the nonredundant GenBank database and NCBI dbest EST database.
  • a BRCA-1 regulator nucleic acid molecule of the invention containing at least about 8-12 nucleotides corresponding to a TST sequence set forth as SEQ ID NOS: 11-16 can be advantageously used, for example, as a therapeutic target for the treatment of cancer, as a diagnostic target for determining the presence or propensity for cancer, or to identify and isolate additional sequences corresponding to other regions of the BRCA-1 regulator nucleic acid molecules of the invention.
  • the nucleic acid molecule can contain none, one, or many nucleotides at the 5' or 3' end, or both, of the TST sequences recited as SEQ ID NOS: 11-16.
  • additional nucleotides can correspond to the native sequence of the BRCA-1 regulator nucleic acid molecule, or can be nonnative sequences, or both.
  • non-native flanking sequences that correspond to a restriction endonuclease site or a tag, or which stabilize the nucleic acid containing at least about 8-12 nucleotides corresponding to a TST nucleic acid sequence set forth as SEQ-ID NOS: 11-16, in a hybridization assay, can be advantageous when the nucleic acid molecule is used as a probe or primer to identify or isolate longer BRCA-1 regulator nucleic acid molecules.
  • Native BRCA-1 regulator nucleotide sequences flanking the at least about 8- 12 nucleotides corresponding to a TST sequence set forth as SEQ ID NOS: 11-16 can be determined by methods known in the art, such as RT-PCR, 5' or 3' RACE, screening of cDNA or genomic libraries, and the like, using an oligonucleotide having at least about 8-12 nucleotides corresponding to the TST sequence of SEQ ID NOS: 11-16 as a primer or probe, and sequencing the resultant product.
  • the appropriate source of template RNA or DNA for amplification, extension or hybridization screening can be determined by those skilled in the art.
  • a specific example of a substantially pure BRCA-1 regulator nucleic acid molecule containing at least about 8-12 nucleotides of a TST corresponding to SEQ ID NO: 13 and flanking coding sequence is the BRCA-1 regulator nucleic acid molecule having the nucleotide sequence set forth as SEQ ID NO: 1.
  • SEQ ID NO: 1 The isolation of SEQ ID NO: 1, based on knowledge of the corresponding RST sequence of SEQ ED NO: 7, is described further below in the Examples. Therefore, such procedures can be used to identify and substantially purify longer nucleic acid molecules that contain at least about 8-12 nucleotides corresponding to a TST of SEQ ID NOS: 11- 16.
  • Such molecules and their functional fragments can be used to produce BRCA-1 regulator polypeptides and specific antibodies, for example, by methods known in the art and described herein, for use in the diagnostic and therapeutic methods described herein and known in the art.
  • SEQ ID NOS: 5, 6, 8 and 9 have similarly been used to identify flanking nucleic acid sequences of the corresponding encoded BRCA-1 regulators.
  • SEQ ID NO: 5 has been used to identify a BRCA-1 regulator which was found to correspond to breast basic conserved protein 1 (BBC1, GenBank accession number X64707).
  • BBC1 breast basic conserved protein 1
  • BBC1 identified previously from a human breast carcinoma cDNA library, is downregulated in hormone-refractory prostate cancer.
  • BBC1 contains a 25 amino acid region which has strong similarity to the plant basic peptide P14.
  • SEQ ID NO: 5 also has been used to identify a protein which corresponds to human CHLl related protein CHLR2, a partial sequence of which is reported in GenBank as accession number U33834. A portion of CHLR2 has been reported to act as a helicase. CHLR2 localizes to the nucleus and is apparently expressed at high levels only in proliferating human cell lines.
  • ID4 is a transcriptional repressor of basic helix-loop-helix transcription factors which prevents transcriptional activation by dimerization to transcription factors, thereby blocking the ability of the transcription factor to bind DNA. It is within the scope of the invention that ID4 can bind to a transcription factor that increases BRCA-1 expression, including BRCA-1.
  • SEQ ID NO: 8 also has been used to identify protein corresponding to ALL-1 fusion partner AF6 (GenBank accession number AB011399), a translation breakpoint sequence found in acute myeloid leukemia. AF6 also is considered to be a Ras-binding protein and regulator of cell junction formation.
  • SEQ ID NOS: 6 and 9 have been used to identify BRCA-1 regulators corresponding to polypeptides termed herein as BR2 and BR3 (GenBank accession numbers AL045940 and AI273697, respectively), which have been reported only as EST sequences, and have not been characterized.
  • SEQ ED NO: 6 also has been used to identify an EST, termed BR4, having GenBank accession No. AI668913.
  • a BRCA-1 regulator nucleic acid molecule when functionally inactivated in a cell, results in increased BRCA-1 expression or activity, or both. Such increase results in the concomitant decrease in the ability of a cell to proliferate or undergo uncontrolled growth. Similar results can be observed by inactivation of the BRCA-1 regulator polypeptide by, for example, inhibiting its activity.
  • the BRCA-1 regulator activity of a nucleic acid molecule containing at least about 8-12 nucleotides corresponding to a TST of SEQ ED NOS: 11-16 and additional native nucleic acid sequences can be further demonstrated using various methods known in the art and described herein.
  • nucleic acid sequences flanking the SEQ ID NOS: 11-16 sequences can be selectively targeted in a cell with ribozymes by the methods described herein.
  • the effect on cell proliferation due to decreased BRCA-1 expression or activity or both can be determined by the assays described below. If inactivation by ribozymal cleavage of a second sequence within the isolated nucleic acid molecule also results in increased BRCA-1 expression or activity, that nucleic acid molecule is a confirmed BRCA-1 regulator nucleic acid molecule.
  • ribozymes targeted toward a second sequence within the nucleic acid molecules of BBC1, ED4 and BRl have increased BRCA-1 or reporter gene expression and/or decreased cell proliferation in soft agar, further confirming these genes as encoding BRCA-1 regulators.
  • knowledge of the nucleic acid sequence of a BRCA-1 regulator provides information that can be used to target further ribozymes against the BRCA- 1 regulator, as demonstrated in the Examples.
  • a portion of one of the above-described BRCA-1 regulators which has a sequence 5'-N 5 -GUC- N 8 -3' or 5'- N 5 -GUA- N 8 -3' is considered to be a TST.
  • Such a TST can be used as a template to design novel ribozymes having RST sequences 5'-N 8 -AGAA- N 4 -3' where N 8 and N have nucleotide sequences substantially complementary to the corresponding residues in the 5'-N 5 -GUC- N 8 -3' or 5'-N 5 -GUA- Ng-3' TST sequences.
  • the RST sequence can have between 8-12 nucleotides, and preferably 9-10 nucleotides at positions N 8 and N that are complementary to the corresponding 5'-N 5 -GUC- N 8 -3' or 5 -N5-GUA- N 8 -3' TST sequences.
  • a BRCA-1 regulator nucleic acid containing at least about 8-12 nucleotides of a TST corresponding to SEQ ED NO: 11-16 can be used to corroborate the activity of a BRCA-1 regulator nucleic acid containing at least about 8-12 nucleotides of a TST corresponding to SEQ ED NO: 11-16.
  • an antibody or other selective agent that binds a polypeptide encoded by the nucleic acid molecule can be introduced into the cell, and the effect of the antibody on BRCA-1 expression-or activity determined, for example, by measuring the ability of the cells to proliferate in soft agar.
  • an antisense nucleic acid that inhibits transcription or translation of the BRCA-1 regulator nucleic acid can be introduced into a cell, and the effect of the antisense nucleic acid on BRCA-1 expression or activity determined.
  • an altered form of a BRCA-1 regulator nucleic acid molecule such as a dominant-negative mutant, can be expressed in a cell and its encoded polypeptide will compete with or inhibit an endogenous BRCA-1 regulator molecule, and thus increase BRCA-1 expression or activity.
  • Those skilled in the art can determine other appropriate assays to demonstrate that a substantially pure nucleic acid molecule containing, at least about 8-12 nucleotides of any of SEQ ED NOS: 11-16 have BRCA-1 regulator activity.
  • the TST sequences set forth as SEQ ED NOS: 11-16 were identified from a random hai ⁇ in ribozyme library by assessing the ability of their corresponding RST to increase BRCA-1 expression (SEQ ED NOS: 5-10). Therefore, the invention provides ribozymes containing the RST sequences set forth as SEQ ED NOS: 5-10 as the ribozyme target recognition sequence.
  • the hairpin ribozymes of the invention selectively bind to BRCA-1 regulator mRNA molecules complementary, in part, to these RST sequences.
  • a substantially pure hai ⁇ in ribozyme of the invention can be catalytic, so as to bind and cleave a BRCA-1 regulator nucleic acid messenger RNA.
  • a catalytic hai ⁇ in ribozyme of the invention can therefore be used to selectively regulate the activity of a BRCA-1 regulator nucleic acid molecule of the invention.
  • a substantially pure hai ⁇ in ribozyme of the invention can also be catalytically disabled, for example, by replacement of the Loop 2 AAA sequence indicated in Figure 1 with a UGC sequence, so as to bind, but not cleave, a BRCA-1 regulator nucleic acid molecule of the invention.
  • a non-catalytic hai ⁇ in ribozyme can be used, for example, as a control for the inhibition activity of non-disabled ribozymes.
  • the invention also provides a ribozyme containing a target recognition sequence having any one of the following nucleotide sequences: 5'-CCGGAUGCAGAACAAU-3', 5'-AGUACAUUAGAAUACU-3' 5'- CUAGUGAGAGAAGGGA-3', 5'-UGAGAUCCAGAAAAGC-3' 5 -UGUUACUAGAAUGUU-3', and 5'-CCCUAUUUAGAAUUGU-3' (SEQ ID NOS: 5-10, respectively).
  • This method can be used for cloning a flanking sequence of any target nucleic acid for which there is a ribozyme cleavage site.
  • a nucleic acid sample is subjected to cleavage by a sequence-specific test ribozyme.
  • the sequence specific recognition and cleavage by a ribozyme results in at least one cleavage product nucleic acid having a specific sequence at either the 5' or 3' end, which corresponds to the sequence recognized by the ribozyme.
  • cleavage product nucleic acid contains a general sequence, for example, a 3' poly A tail
  • two primers can be constructed, a first complementary to the sequence recognized by the ribozyme, and a second complementary to the general sequence. These two primers can then be used to amplify the cleavage product nucleic acid, which then can be identified using known sequencing methods. Thus from a nucleic acid sample, those nucleic acids that are cleaved by a ribozyme can be specifically amplified and subsequently identified.
  • Target nucleic acids can be either RNA or DNA, and can be cleaved by any ribozyme, including a hai ⁇ in ribozyme, a hammerhead ribozyme and a Tetrahymena group I ribozyme.
  • amplification products Prior to sequencing, amplification products can be separated by gel electrophoresis and can further be compared to a nucleic acid sample subjected to cleavage by a control ribozyme having sequence specificity different than the ribozyme used in the nucleic acid sample being tested.
  • the amplification products that are specific for the test ribozyme cleaved sample can be recovered and sequenced.
  • a first primer hybridizes to a 3' end first general sequence of the cleavage product nucleic acid, and strand synthesis is carried out.
  • the enzyme used for such a synthesis places a second general sequence at the 3' end of the newly synthesized strand, which also is adjacent the specific flanking sequence of ribozyme cleavage.
  • Such an exemplary enzyme is MMLV reverse transcriptase, which places 3-5 deoxycytidine nucleotides at the 3' end of the nascent DNA strand.
  • a second primer which contains a sequence complementary to the second general sequence is added, and the nascent nucleic acid is further extended.
  • the template strand is then removed, for example, by RNAse digestion if the template strand is RNA.
  • the remaining nucleic acid is then amplified using a third primer complementary to the sequence of the first primer and a fourth primer complementary to the sequence of the second primer and containing the flanking sequence of ribozyme cleavage.
  • the amplified product is then identified using sequencing methods known in the art.
  • the nucleic acid molecules of the invention including BRCA-1 regulator nucleic acid molecules and fragments, and hai ⁇ in ribozyme nucleic acid molecules, can be produced or isolated by methods known in the art. The method chosen will depend, for example, on the type of nucleic acid molecule one intends to isolate.
  • BRCA-1 regulator nucleic acid molecules can readily isolate BRCA-1 regulator nucleic acid molecules as genomic DNA, or desired introns, exons or regulatory sequences therefrom; as full-length cDNA or desired fragments therefrom; or as full-length mRNA or desired fragments therefrom, by methods known in the art.
  • those skilled in the art can produce or isolate hai ⁇ in ribozymes selective for these sequences.
  • a useful method of isolating a BRCA-1 regulator nucleic acid molecule of the invention involves amplification of the nucleic acid molecule using the polymerase chain reaction (PCR), and purification of the resulting product by gel electrophoresis.
  • PCR polymerase chain reaction
  • RT-PCR reverse-transcription PCR
  • Desired modifications to the nucleic acid sequence can also be introduced by choosing an appropriate primer with one or more additions, deletions or substitutions.
  • Such nucleic acid molecules can be amplified exponentially starting from as little as a single gene or mRNA copy, from any cell, tissue or species of interest.
  • Another method of producing or isolating a BRCA-1 regulator nucleic acid molecule of the invention is by screening a library, such as a genomic library, cDNA library or expression library, with a detectable agent.
  • libraries are commercially available or can be produced from any desired tissue, cell, or species of interest using methods known in the art.
  • a cDNA or genomic library can be screened by hybridization with a detectably labeled nucleic acid molecule having a nucleotide sequence disclosed herein.
  • an expression library can be screened with an antibody raised against a polypeptide corresponding to the coding sequence of a BRCA-1 -regulator nucleic acid disclosed herein.
  • nucleic acid molecules of the invention can be purified away from other clones by methods known in the art.
  • nucleic acid molecules of the invention can be produced by synthetic means.
  • a single strand of a nucleic acid molecule can be chemically synthesized in one piece, or in several pieces, by automated synthesis methods known in the art.
  • the complementary strand can likewise be synthesized in one or more pieces, and a double-stranded molecule made by annealing the complementary strands.
  • Direct synthesis is particularly advantageous for producing relatively short molecules, such as RST or hai ⁇ in ribozyme nucleic acid molecules, as well as hybridization probes and primers.
  • nucleic acid molecules of the invention can be produced using in vitro enzymatic synthesis using RNA polymerase.
  • a template DNA can be combined with RNA polymerase and ribonucleotide triphosphates.
  • the RNA polymerase synthesizes an RNA nucleic acid complementary to the sequence of the DNA template. If it is desired to subclone, amplify or express a substantially pure nucleic acid molecule of the invention, the isolated nucleic acid molecule can be inserted into a commercially available cloning or expression vector using methods known in the art.
  • Appropriate regulatory elements can be chosen, if desired, to provide for constitutive, inducible or cell type-specific expression in a host cell of choice, such as a bacterial, yeast, amphibian, insect or mammalian cell, including human cells. Those skilled in the art can determine an appropriate host and vector system for cloning a nucleic acid molecule of the invention or for expressing and purifying its encoded polypeptide.
  • Methods for introducing a cloning or expression vector into a host cell include, for example, various methods of transfection such as the calcium phosphate, DEAE-dextran and lipofection methods, viral transduction, electroporation and microinjection.
  • Host cells expressing BRCA-1 regulator nucleic acid molecules can be used, for example, as a source to isolate recombinantly expressed BRCA-1 regulator polypeptides, to identify and isolate molecules that regulate or interact with BRCA-1 regulator nucleic acids and polypeptides, or to screen for compounds that enhance or inhibit the activity of a BRCA-1 regulator molecule of the invention, as described further below.
  • BRCA-1 regulator polypeptides and functional fragments of the invention can be isolated or prepared by methods known in the art, including biochemical, recombinant and synthetic methods.
  • a BRCA-1 regulator polypeptide can be purified by routine biochemical methods from a cell or tissue source that expresses abundant amounts of the corresponding transcript or polypeptide.
  • Biochemical purification can include, for example, steps such as solubilization of the appropriate tissue or cells, isolation of desired subcellular fractions, size or affinity chromatography, electrophoresis, and immunoaffinity procedures.
  • the methods and conditions for biochemical purification of a polypeptide of the invention can be chosen by those skilled in the art, and purification monitored, for example, by an ELISA assay or a functional assay.
  • a fragment having any desired boundaries and modifications to a BRCA-1 regulator amino acid sequences can also be produced by recombinant methods.
  • Recombinant methods involve expressing a nucleic acid molecule encoding the desired polypeptide or fragment in a host cell or cell extract, and isolating the recombinant polypeptide or fragment, such as by routine biochemical purification methods described above.
  • nucleic acid sequences that encode epitope tags, polyhistidine tags, glutathione-S-transferase (GST) domains, and similar affinity binding sequences, or sequences that direct expression of the polypeptide in the periplasm or direct secretion are well known in the art.
  • Functional fragments of a BRCA-1 regulator polypeptide can also be produced, for example, by enzymatic or chemical cleavage of the full-length polypeptide. Methods for enzymatic and chemical cleavage and for purification of the resultant peptide fragments are well known in the art (see, for example, Deutscher, Methods in Enzymology, Vol. 182, “Guide to Protein Purification,” San Diego: Academic Press, Inc. (1990)), which is inco ⁇ orated herein by reference. Furthermore, functional fragments of a BRCA-1 regulator polypeptide can be produced by chemical synthesis.
  • such molecules can be modified to include D- stereoisomers, non-naturally occurring amino acids, and amino acid analogs and mimetics. Examples of modified amino acids and their uses are presented in Sawyer, Peptide Based Drug Design, ACS, Washington (1995) and Gross and Meienhofer, The Peptides: Analysis, Synthesis, Biology, Academic Press, En ⁇ , New York (1983), both of which are inco ⁇ orated herein by reference.
  • a functional activity of a BRCA-1 regulator polypeptide or fragment of the invention can be its ability to alter BRCA-1 expression or activity, for example increasing unrestricted cell growth, when expressed or introduced in a cell.
  • a polypeptide or fragment can be expressed in the cell by recombinant methods known in the art and the effect of the BRCA-1 regulator can be determined in vitro.
  • expression of the BRCA-1 regulator can be inhibited in vivo, including cell culture or animal models and BRCA-1 expression or activity can be determined.
  • expression of the BRCA-1 regulator can be inhibited in vivo, including cell culture or animal models and the expression of a BRCA-1 promoter-linked reporter marker determined.
  • An increase in cell proliferation in soft agar or decrease in the expression of a BRCA-1 promoter-linked reporter marker indicates that the polypeptide or fragment is a BRCA-1 regulator of the invention.
  • the invention provides a method of identifying a compound that modulates the activity of a BRCA-1 regulator comprising contacting a BRCA-1 regulator with a target molecule responsive to the activity of the BRCA-1 regulator and the test compound. En this method, an increase or decrease in the activity of the BRCA-1 regulator for the target molecule compared to the absence of the test compound indicates that the compound modulates the activity of the BRCA-1 regulator.
  • a target molecule responsive to the activity of the BRCA-1 regulator means that the BRCA-1 regulator either binds or chemically modifies the a target molecule that exists in a cell.
  • the target molecule responsive to this activity is a nucleic acid comprising a sequence of nucleotides recognized and bound by the particular BRCA-1 regulator.
  • the BRCA-1 regulator has protein kinase activity, due for example to having a serine/ threonine kinase domain, the target molecule responsive to this activity is a protein having an appropriate serine or threonine kinase recognition site.
  • the target molecule responsive is a protein cleaved by the BRCA-1 regulator.
  • nucleic acid element when used in reference to regulation of BRCA-1 expression refers to a nucleic acid region that modulates BRCA-1 expression.
  • nucleic acid elements are the BRCA-1 5' promoter and regulatory region or other transcriptional regulation regions, and translational regulatory regions of the transcribed mRNA. Generally, the nucleic acid element will be the 5' promoter and regulatory region.
  • BRCA-1 regulator compounds that increase or enhance the activity of BRCA-1 regulator also can be identified.
  • a test compound added to a sample containing a BRCA-1 regulator and a nucleic acid element modulated by a BRCA-1 regulator which decreases BRCA-1 activity or the amount or rate of expression of BRCA-1 or a reporter gene operatively linked to the nucleic acid element compared to the absence of the test compound indicates that the compound increases the activity of the BRCA-1 regulator. Therefore, the invention provides a method of identifying compounds that modulate the activity of a BRCA-1 regulator.
  • a reaction system for identifying a compound that inhibits or increases BRCA-1 regulator activity can be prepared using essentially any sample, material or components thereof that contains a BRCA-1 regulator.
  • a BRCA-1 regulator containing sample used for such methods can be, for example, in vitro transcription or translation systems using, for example, nucleic acid derived from the BRCA-1 gene-of a normal or tumor cell or a hybrid construct linking the nucleic acid element modulated by a BRCA-1 regulator to a reporter gene.
  • nucleic acids and proteins obtained from normal cells can also be used since BRCA-1 regulators can also act in normal cells.
  • the BRCA-1 regulator-containing sample can additionally be derived from cell extracts, cell fractions or, for example, in vivo systems such as cell culture or animal models which contain a nucleic acid element modulated by a BRCA-1 regulator.
  • the expression levels or activity of BRCA-1 or the reporter gene can be measured in the reaction system to determine the modulatory effect of the test compound on the BRCA-1 regulator. Such measurements can be determined using methods described herein as well as methods well known to those skilled in the art.
  • the BRCA-1 regulator source is combined with a nucleic acid element or protein modulated by a BRCA-1 regulator as described above and incubated in the presence or absence of a test compound.
  • the expression levels or activity of BRCA-1 or the reporter gene in the presence of the test compound is compared with that in the absence of the test compound.
  • Those test compounds which provide an increase in expression levels or activity of BRCA-1 or the reporter gene of at least about 50% are considered to be BRCA-1 regulator inhibitors, or antagonists, and further, potential therapeutic compounds for the treatment of neoplastic diseases such as cancer.
  • those compounds which decrease expression levels or activity of BRCA-1 or the reporter gene by about two-fold or more are considered to be compounds which increase the activity of a BRCA-1 regulator, or BRCA-1 regulator agonists.
  • Such agonists can be used as therapeutics, for example, to promote cell growth or cell survival in transplanted or explanted cells which are subsequently transplanted.
  • Compounds identified to modulate BRCA-1 regulator activity can, if desired, be subjected to further in vitro or in vivo studies to corroborate that they affect the activity of a BRCA-1 regulator toward the BRCA-1 expression or activity.
  • test compounds for the above-described assays can be any substance, molecule, compound, mixture of molecules or compounds, or any other composition which is suspected of being capable of inhibiting BRCA-1 regulator activity in vivo or in vitro, for example, compounds with cell proliferation-inhibiting activity.
  • the test compounds can be macromolecules, such as biological polymers, including proteins, polysaccharides and nucleic acids.
  • Sources of test compounds which can be screened for BRCA-1 regulator inhibitory activity include, for example, libraries of small organic molecules, peptides, polypeptides, DNA, and RNA. Additionally, test compounds can be pre-selected based on a variety of criteria. For example, suitable test compounds can be selected as having known inhibition or enhancement activity with respect to cell proliferation.
  • test compounds can be selected randomly and tested by the screening methods of the present invention.
  • Test compounds can be administered to the reaction system at a single concentration or, alternatively, at a range of concentrations to determine, for example, the optimal modulatory activity toward the BRCA-1 regulator.
  • the activity of a BRCA-1 regulator for which drug screening is desired can be a protein kinase activity.
  • BRCA-1 regulators that have a serine/threonine kinase domain may be used for drug screening where the activity which is modulated is a protein kinase activity.
  • Protein kinase assays are well known to those skilled in the art (see, e.g., U.S. Pat. Nos. 5,538,858 and 5,757,787; Anal. Biochem, 209:348-353, (1993)).
  • the activity of a BRCA-1 regulator for which drug screening is desired also can be GTP binding activity.
  • BRCA-1 regulators that have a GTP binding site may be used for drug screening where the activity which is modulated is GTP binding.
  • BRCA-1 regulators that have GTP-binding activity may regulate cell growth such as through regulating BRCA-1 expression, or may have affects on cell cycle control, protein secretion, and intracellular vesicle interaction.
  • GTP binding assays are well known to those skilled in the art (see, e.g., U.S. Pat. Nos. 5,840,969 to Hillman et al.).
  • the activity of a BRCA-1 regulator for which drug screening is desired also can be hormone binding activity.
  • BRCA-1 regulators that have a hormone binding site may be used for drug screening where the activity which is modulated is hormone binding.
  • Hormones that bind to a BRCA-1 regulator may be steroid hormones such as estrogen or a protein based hormone.
  • Receptor hormone binding assays including receptor estrogen binding assays are well known to those skilled in the art (see, e.g., U.S. Pat. Nos. 6,204,067 to Simon et al.).
  • the invention provides a method of identifying a ribozyme reactive with a BRCA-1 regulator.
  • the method comprises: (a) introducing a randomized ribozyme library into a population of cells expressing a selection marker gene operatively linked to a nucleic acid element modulated by a BRCA-1 regulator; (b) subjecting the population of cells to selection, and (c) recovering one or more ribozymes from viable cells following selection. Also provided is a method of identifying a BRCA-1 regulator.
  • the method comprises: (a) introducing a randomized ribozyme library into a population of cells expressing a selection marker operatively linked to a nucleic acid element modulated by a BRCA-1 -regulator; (b) subjecting the population of cells to selection; (c) recovering one or more ribozymes from viable cells following selection; and (d) sequencing the target recognition sequence of the recovered ribozyme to identify the nucleic acid encoding the BRCA-1 regulator.
  • neoplastic disease amenable to the methods of identifying a ribozyme or a BRCA-1 regulator of the invention
  • one skilled in the art will readily know, in light of the teachings and description herein that such methods are applicable to essentially all neoplastic diseases which employ tumor suppressor regulators for continued propagation. Therefore, the methods of identifying a BRCA-1 regulator, or ribozyme selective to a BRCA-1 regulator, as well as methods of treating a neoplastic disease once such regulators have been identified are applicable to methods of identifying any tumor suppressor regulator and to methods of treating a neoplastic disease.
  • a method of identifying tumor suppressor regulators can be carried out using the methods described herein. Briefly, a nucleic acid element of a tumor suppressor gene that regulates the expression of the gene, for example, the 5' promoter and regulatory region for a specific tumor suppressor, can be operatively linked to a reporter gene. A sample containing a tumor suppressor regulator and a nucleic acid element modulated by the tumor suppressor regulator linked to a reporter gene can be contacted with a test compound and the expression or activity of the reporter gene can be measured. A test compound found to increase reporter gene expression or activity indicates that the test compound inhibits tumor suppressor regulator activity. A test compound found to decrease reporter gene expression or activity indicates that the test compound increases or enhances tumor suppressor regulator activity.
  • nucleic acid derived from a normal or tumor cell, which is modulated by a tumor suppress or regulator, for example, the BRCA-1 promoter or the p53 promoter.
  • a tumor suppress or regulator for example, the BRCA-1 promoter or the p53 promoter.
  • the nucleic acid derived from the normal or tumor cell can be unique to the regulation of expression or activity of the specific tumor suppressor in that cell.
  • the normal or tumor cell-derived tumor suppressor regulator nucleic acid can overlap or be redundant with other regulators of tumor suppressor expression or activity.
  • the expression or activity level of the tumor suppressor can rely on a balance between levels of one or more tumor suppressor regulators found in normal cells compared to levels of one or more tumor suppressor regulators in tumor cells. Therefore, decreasing the level or activity of tumor suppressor regulators acting on common components or structures can shift the balance toward utilization of tumor suppressor regulators for normal cellular functions reducing the amount of unrestricted cell growth.
  • nucleic acid modulated by a tumor suppressor regulator includes a nucleic acid that is expressed in normal cells, but whose expression is increased in tumor cells.
  • Another example of a nucleic acid modulated by a tumor suppressor regulator includes a nucleic acid that is not expressed in normal cells, but is expressed in tumor cells.
  • the method of identifying a ribozyme reactive with a BRCA-1 regulator involves the construction of a population of cells expressing a selection marker gene which is under the control, or operatively linked to a nucleic acid modulated by a BRCA-1 regulator. Specific examples of such a cell population and its use are described further below in the Examples.
  • a nucleic acid element modulated by a BRCA-1 regulator can be essentially any nucleic acid sequence that influences BRCA-1 expression or activity. Specific examples of such an element includes the BRCA-1 promoter and the 5' regulator region. Methods using BRCA-1 regulators identified for the BRCA-1 promoter and therapeutic compounds directed thereto are applicable to all neoplastic diseases related to decreased BRCA-1 expression or activity. Other elements can include, for example, transcription enhancers and BRCA-1 mRNA.
  • Cell populations containing a nucleic acid element modulated by a BRCA-1 regulator are operatively linked to a selection marker gene. Operative linkage will depend on the type of element employed and is intended to refer to placing the nucleic acid element in an appropriate context and location in the reporter construct as it would be found in its native genome. In the specific example of BRCA-1 promoter, operative linkage places the element 5' to the transcription start site of the marker gene. Operative linkage of a promoter element-will be sufficiently upstream of the translation start codon to include sufficient 5' untranslated region sequence to effect translation in, for example, a CAP-dependent manner.
  • the reporter constructs can be introduced into cell population using well known methods in the art and as described previously.
  • a selection marker can be a gene product that is, or can be made to influence cell viability or cell growth, or can be used as a measurable indicator.
  • Specific examples include enhanced green fluorescence protein (EGFP), hygromycin resistance gene, the tumor suppressor BRCA-1, He ⁇ es Simplex Virus thymidine kinase (HSV-tk), cytosine deaminase (CD) and diphtheria toxin (DT).
  • EGFP enhanced green fluorescence protein
  • HSV-tk He ⁇ es Simplex Virus thymidine kinase
  • CD cytosine deaminase
  • DT diphtheria toxin
  • the expression of a negative selection marker in cells is either toxic alone, or toxic in the presence of a negative selection compound which is metabolized by the marker gene product into a cytotoxic or cytostatic substance.
  • expression of a positive selection marker in cells protects cells from arrested growth or cell death.
  • the gene product can be a measurable indicator that can be used in selecting cells having a certain measured level of expression of this gene product.
  • Expression of an easily detectable gene product such as EGFP can be used as a measurable indicator of gene expression.
  • EGFP allows a specific, user-defined expression level to be selected using methods such as fluorescence activated cell sorting (FACS). For example, cells representing the 10% of the population expressing the highest levels of EGFP can be recovered using FACS methods. The selected subpopulation can be grown and subjected to a second round of FACS- based selection of high level EGFP expression. This iterative FACS-based selection results in enrichment of cells expressing high levels of EGFP and thus represents a FACS-based positive selection method.
  • FACS fluorescence activated cell sorting
  • Positive selection can also be carried out, for example, using hygromycin.
  • Expression of the hygromycin resistance gene permits cells to survive in the presence of hygromycin.
  • Hygromycin is an aminoglycoside antibiotic that kills bacteria, fungi and higher eukaryotic cells by inhibiting protein synthesis.
  • Expression of hygromycin resistance gene allows cells to survive in the presence of hygromycin.
  • Concentrations of hygromycin used for selection are between about 50 ⁇ g/ml and 1000 ⁇ g/ml, preferably about 250 ⁇ g/ml.
  • Phenotype selection can also be carried out.
  • Expression of the BRCA-1 gene suppresses cell growth, and particularly anchorage-independent growth, resulting in, for example, a decreased ability to grow in soft agar.
  • the selected cells are those which express a ribozyme that is reactive with a BRCA-1 regulator that inhibits or decreases BRCA-1 promoter-dependent expression of the reporter gene.
  • the cells are isolated and the ribozymes are recovered using, for example, PCR or other well known methods in the art.
  • the RST of the ribozyme is a sequence tag corresponding to a BRCA-1 regulator. Sequencing of this tag identifies the nucleic acid encoding the BRCA-1 regulator.
  • RSTs corresponding to BRCA-1 regulators of the invention are set forth as SEQ ED NOS: 5-10 and their corresponding TSTs are set forth as SEQ ED NOS: 11-16.
  • Five RST sequences have been determined. Specifically, SEQ ID NO: 7 co ⁇ esponds to the RST for BRl, the full length nucleotide and amino acid sequences of which is shown as SEQ ED NOS: 1 and 2.
  • SEQ ED NO: 5 corresponds to the RST for BBC1 (GenBank accession number X64707) and also for CHLR2 (GenBank accession number U33834) and SEQ ED NO: 8 corresponds to the RST for ID4 (GenBank accession number NM_001546) and also for AF6 (GenBank accession number AB011399).
  • SEQ ED NO: 6 corresponds to the RST for BR2 (GenBank accession number AL045940), and SEQ ED NO: 9 corresponds to the RST for BR3 (GenBank accession number AE276397).
  • the invention also provides a method of treating breast cancer or ovarian cancer.
  • the method consists of introducing a ribozyme selectively reactive with a RNA encoding BBC1, BRl, ID4, BR2, or BR3, into a cancerous breast or ovarian cell, preferably the ribozyme is selectively reactive with an RNA encoding BBC1, ED4 or BRl . Also provided is a method of treating breast or ovarian cancer by introducing a ribozyme selectively reactive with a RNA encoding a BRCA-1 regulator corresponding to a RST selected from the group consisting of SEQ ED NOS: 5-10.
  • ribozymes of the invention selectively reactive with a BRCA-1 regulator RNA with an antisense nucleic acid corresponding to a RST sequence selected from the group consisting of SEQ ED NOS: 5-10
  • antisense nucleic acids hybridize to the BRCA-1 regulator nucleic acid similar to catalytic ribozymes and inhibit transcription processing or translation of the RNA without subsequent cleavage.
  • Such methods will be described below with reference to a ribozyme of the invention, but those skilled in the art will know that antisense nucleic acids can similarly be substituted for the ribozymes to prevent or reduce the severity of breast cancer or ovarian cancer.
  • a ribozyme encoding any of the RST sequences set forth as SEQ ED NOS: 5- 10, or a combination thereof can be delivered in a wide variety of ways to tumor cells or cells susceptible to uncontrolled proliferation to interrupt or prevent neoplastic growth.
  • the ribozyme can be administered as RNA or expressed from an expression vector.
  • the ribozyme can be administered ex vivo by, for example, administering to cells that have been removed from an infected individual, and then returned to the individual, or the ribozyme can be administered in vivo.
  • Delivery can be performed using any appropriate delivery vehicle known to those skilled in the art including, for example, a liposome, a controlled release vehicle, electroporation or covalently attached moieties, and other pharmacologically acceptable methods of delivery.
  • a carrier can provide specificity for tissue or organ accumulation, such as breast or ovary accumulation, of the ribozyme at the tissue or organ which is the primary site of the neoplastic-growth.
  • the ribozyme delivery vehicle can be designed to serve as a slow release reservoir or to deliver its contents directly to the target cell. Examples of ribozyme delivery vehicles include liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. Liposomes can readily be targeted to the liver for delivery of RNA to infected tumor cells.
  • ribozyme administration examples include intramuscular, aerosol, intravenous, parenteral, intraperitoneal. Generally however, the route of administration will be through a blood vessel which represents a direct route-to the organ or tissue to be treated.
  • the dosage of ribozyme will also depend on a variety of factors, such as the form of the ribozyme, the route of administration, the severity of the cancer or stage of disease, the general condition of the patient being treated, and thus can vary widely. Generally the dosage of ribozyme will be between about lO ⁇ g - 200mg/kg of body weight per day and result in therapeutic or prophylactic levels within the targeted cells sufficient to inhibit or eradicate the tumor cells.
  • the duration of treatment can extend throughout the course of the neoplastic disease or disease symptoms, usually at least about 7-30 days, with longer duration being necessary for severe diseases. The number and timing of doses can also vary depending on, for example, the extent of disease.
  • a viral vector containing a ribozyme corresponding to a BRCA-1 regulator RST of the invention can be prepared in any of a wide variety of ways known to those skilled in the art.
  • Representative retroviral vectors which can be used in the methods of the invention are described, for example, in U.S. Patent Nos. 4,861,719, 5,124,263 and 5,219,740.
  • Other vectors can also be employed, particularly for the ex vivo methods, such as DNA vectors, pseudotype retroviral vectors, adenovirus, and adeno-associated virus vectors.
  • the viral vector contemplated for use in the methods of the present invention comprises infectious, but replication-defective, viral particles, which contain at least one DNA sequence encoding a ribozyme selectively reactive with a BRCA-1 regulator, is administered in an amount effective to inhibit or prevent cancer formation or progression in a subject.
  • the vector particles can be administered in an amount-from 1 plaque forming unit to about 10 14 plaque forming units, more preferably from about 1X10 6 plaque forming units to about 1X10 13 plaque forming units.
  • a sufficient number of vector particles containing a ribozyme selectively reactive with a BRCA-1 regulator of the invention is administered to the cancerous tissue or organ to infect up to at least about 50% of the cancerous cells, usually about 80%, preferably about 90%, or more of the cancerous cells in the individual. Subsequent administrations can be performed, as needed, to effectively treat or reduce the severity of the cancer.
  • Exemplary ribozymes of the invention include, for example, those having RST sequences set forth as SEQ ID NOS: 5-10.
  • One of these RST sequences, SEQ ID NO: 5, corresponds to the proteins BBC1 and CHRL2.
  • Another RST sequence, SEQ ED NO: 8, co ⁇ esponds to the proteins ID4 and AF6.
  • Three of the RST sequences correspond to sequences without previously known roles. Briefly, SEQ ED NO: 7 corresponds to BRl (SEQ ED NO: 1), SEQ ED NO: 6 corresponds to BR2 and SEQ ED NO: 9 corresponds to BR3.
  • cancerous conditions may be treated by administering to a warm-blooded animal (e.g., a human) a therapeutically effective amount of ribozyme.
  • a warm-blooded animal e.g., a human
  • the present invention provides for treatment of cancer by contacting desired cells with an effective amount of ribozyme of this invention.
  • a suitable "therapeutically effective amount” will depend on the nature and extent of diseased tissue being treated. Such "therapeutically effective amounts” can be readily determined by those of skill in the art using well known methodology, and suitable animal models such as a rat, rabbit, or porcine model, or, based upon clinical trials.
  • a patient is deemed to be "treated” if the cancerous condition is reversed or inhibited in a patient in a quantifiable manner.
  • a therapeutically effective amount or regimen of treatment should result in: (1) decrease in the frequency, severity, or, duration of clinical symptoms (e.g., pain); (2) increase of time in the period of remission; (3) a change in pathological symptoms (e.g. reduction in tumor volume or tumor markers); or (4) any combination thereof.
  • the RNA molecule can be embedded within a stable RNA molecule or in another form of protective environment, such as a liposome. Alternatively, the RNA can be embedded within Rnase-resistant DNA counte ⁇ arts.
  • ribozyme Cellular uptake of the exogenous ribozyme can be enhanced by attaching chemical groups to the DNA ends, such as cholesteryl moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989).
  • Hammerhead ribozymes suitable for use within the present invention preferably recognize the sequence NUH, wherein N is any of G, U, C, or A and H is C, U, or A.
  • the hai ⁇ in recognition sites GUC are a subset of the hammerhead recognition sites NUH. Therefore, all hai ⁇ in sites are by definition also hammerhead sites, although the converse is not true.
  • Chimeric hammerhead ribozymes are designed to have an appropriate NUH sequence for ribozyme cleavage.
  • Ribozymes are chemically synthesized with the general structure shown below as Scheme 1.
  • the binding arms bases and stem loop comprise DNA, and the catalytic domain comprises RNA and/or 2' O methyl RNA bases.
  • the stem loop can be replaced by a propanediol linker.
  • DNA bases are shown in upper case, RNA bases in lower case, 2' O methyl RNA is shown as lower case underlined, and propanediol linker is shown as pr pr pr pr.
  • inhibitory compounds identified by the screening methods described previously can similarly be used to reduce the severity of breast cancer or ovarian cancer.
  • Small organic compounds have particular advantages because of their ease of formulation and administration using well known methods in the pharmaceutical arts.
  • the present invention provides methods to identify gene targets that are down regulated by ribozyme activity. Another powerful application of this technology is to identify other genes in the pathway that contribute to the phenotype changes observed after ribozyme knockdown. Expression profiles can be determined in hybridization arrays of cDNA targets from known genes or expressed sequence tag
  • differentially expressed mRNA in control ribozyme and effector ribozyme transduced cells can be detected by reverse transcribing the mRNA from the cells into cDNA, which is labeled with green (control ribozyme) and red fluorescent dye (effector ribozyme).
  • cDNA which is labeled with green (control ribozyme) and red fluorescent dye (effector ribozyme).
  • Individual EST clones are arrayed on a solid support such as polylysine-coated glass (e.g., a 24 x 24 panel). The microarray is hybridized with a mix of the two labeled cDNA and then scanned for fluorescent color.
  • a G3pDH DNA fragment is spotted on the corners of each 24x24 panel and serves as an internal control to check for an equal amount of cDNA applied from the two cell lines.
  • the intensity of the color at each location of the array is proportional to the expression level of that gene in the sample.
  • EST fragments which showed a predominant red color indicate that the EST is expressed mostly in the effector ribozyme cells or up-regulated by effector ribozyme treatment, while a predominance of green color indicates that the EST is expressed largely in the control ribozyme cells or down-regulated by effector ribozyme treatment.
  • arrays of clones can be formed on any of a variety of solid supports, including, for example a membranes such as made from nylon or a silicon based chip.
  • the cDNA prepared from the two transduced cell types may be differentially labeled by fluorophores, enzymes, radioisotopes and the like. If radiolabeled cDNA is used, each pool of labeled cDNA is hybridized to separate membranes, which are scanned for radioactive intensity using a phosphorimager.
  • each anay element is proportional to the number of bound cDNA molecules, so the intensities of effector ribozyme cDNA can be directly compared to control ribozyme cDNA in a similar fashion to the fluorescent elements described above. Criteria such as at least a 2 fold difference in expression level can be set to delineate potential targets, for genes involved in the pathway leading to the phenotypic change. Using this technology, additional drug targets indirectly regulated by the ribozyme can be identified.
  • Regulators of BRCA-1 expression were identified using the above expression profiling approach as described in greater detail in Example X. These genes, which included GenBank Ace. No. AA419229, GenBank Ace. No. H18950, GenBank Ace. No. H07920, GenBank Ace. No. H70047, GenBank Ace. No. H84815, GenBank Ace. No. AA757764, GenBank Ace. No. H19111, GenBank Ace. No. AA629897, GenBank Ace. No. AA663439, GenBank Ace. No. R15740, GenBank Ace. No. AA454570, GenBank Ace. No. AA485748, GenBank Ace. No. AA464601, GenBank Ace. No. AA102107: and GenBank Ace. No. Z49826, represent therapeutic drug or ribozyme effector targets for increasing BRCA-1 expression.
  • the invention also provides a high throughput drug discovery method using ribozyme transduced cells and chip array technology.
  • drugs By combining array technology with ribozyme knockdown, drugs can be rapidly screened for effects on a given pathway. Once the expression profile leading to a given phenotype is determined, additional anays can be generated with the relevant regulated EST sequences. These can be screened with mRNA from drug treated cells. Profiles matching the ribozyme treated profile can be identified. Treatment with the drugs identified in this way can be expected to give the desired phenotype. This methodology allows the linking of the function of these target genes to the desired phenotype i.e., increased BRCA-1 expression.
  • Small molecule drugs, ribozyme drugs, or antibody drugs can be identified by those skilled in the art that inhibit the activity of these gene targets resulting, for example, in increased BRCA-1 expression.
  • the gene targets can be used to develop high throughput assays that can be screened with existing small molecule libraries.
  • genes which express a surface or secreted protein can be targets for antibody development.
  • Antibodies specific for the gene product can be generated preferably in transgenic mouse systems to generate human antibodies.
  • chimeric ribozyme drugs targeting these BRCA-1 regulators can be designed as explained above (see e.g., scheme 1 above and scheme 2 below).
  • the invention also provides a method of detecting a neoplastic cell in a sample.
  • the method consists of contacting the sample with a detectable agent specific for a BRCA-1 regulator nucleic acid molecule, and detecting the nucleic acid molecule in the sample. Altered expression or structure of the nucleic acid molecule indicates the presence of a neoplastic cell in the sample.
  • the method consists of contacting the sample with a detectable agent specific for a BRCA-1 regulator polypeptide of the invention, and detecting the polypeptide in the sample. Altered expression or structure of the polypeptide indicates the presence of a neoplastic cell in the sample.
  • the diagnostic methods described herein are applicable to the identification of neoplastic cells present, in solid tumors (carcinomas and sarcomas) such as, for example, breast cancer, ovarian cancer and prostate cancer.
  • solid tumors carcinomas and sarcomas
  • the BRCA-1 regulator molecules that can be detected using this method include nucleic acids encoding BRl, BR2, BR3, BBC1, or ED4 or the corresponding polypeptides.
  • RNA abundance Various qualitative and quantitative assays to detect altered expression or structure of a nucleic acid molecule in a sample are well known in the art, and generally involve hybridization of a detectable agent, such as a complementary primer or probe, to the nucleic acid molecule.
  • a detectable agent such as a complementary primer or probe
  • assays include, for example, in situ hybridization, which can be used to detect altered chromosomal location of the nucleic acid molecule, altered gene copy number, or altered RNA abundance, depending on the format used.
  • RNA blots and RNase protection assays which can be used to determine the abundance and integrity of RNA
  • DNA blots which can be used to determine the copy number and integrity of DNA
  • SSCP analysis which can detect single point mutations in DNA, such as in a PCR or RT-PCR product
  • coupled PCR, transcription and translation assays such as the Protein Truncation Test, in which a mutation in DNA is determined by an altered protein product on an electrophoresis gel.
  • Further assays include methods known in the art for genotyping a BRCA-1 regulator gene, for example, by RFLP analysis or by determining specific SNPs in a BRCA-1 regulator gene.
  • An appropriate assay format and detectable agent to detect an alteration in the expression or structure of a BRCA-1 regulator nucleic acid molecule can be determined by one skilled in the art depending on the alteration one wishes to identify.
  • a detectable agent such as an antibody or selective binding agent
  • Such assays can be performed in situ, such as by immunohistochemistry or immunofluorescence, in which a detectably labeled antibody contacts a polypeptide in a cell.
  • Other assays for example, ELISA assays, immunoprecipitation, and immunoblot analysis, can be performed with cell or tissue extracts.
  • Assays in which the polypeptide remains in a native form are particularly useful if a conformation- specific binding agent is used, which can detect a polypeptide with an altered structure.
  • a structural variant of a BRCA-1 regulator polypeptide can act, for example, in a dominant-negative fashion to decrease BRCA-1 expression or activity and cause unregulated cell proliferation.
  • An appropriate assay format and detectable agent to detect an alteration in a BRCA-1 regulator polypeptide can be determined by one skilled in the art depending on the alteration one wishes to identify.
  • Imaging reagents are well known in the art and include radioactive reagents, electron-dense reagents and magnetic or electronic reagents.
  • the diagnostic methods described herein can also be used in prognostic assays. Such an application can identify alterations in expression or structure of BRCA-1 regulator molecules that take place at characteristic stages in the progression of a proliferative disease or of a tumor. Knowledge of the stage of the tumor allows the clinician to select the most appropriate treatment for the tumor and to predict the likelihood of success of-that treatment.
  • the diagnostic methods described herein can also be used to monitor the effectiveness of therapy. Successful therapy can be indicated, for example, by a reduction in the number of neoplastic cells in an individual, as evidenced by more normal expression or structure of the BRCA-1 regulator in a sample following treatment.
  • the level of expression or structure of the detected BRCA-1 regulator nucleic acid or polypeptide in the test sample is compared to the known expression level or structure of the nucleic acid or polypeptide in a normal sample.
  • the normal sample can be obtained either from normal tissue of the same histological origin of the same or a different individual, or a population of individuals.
  • the diagnostic methods described herein can also be used in a method for determining the propensity of a subject to develop cancer.
  • Such a method includes collecting a pre-neoplastic sample from a subject which can include a sample of a specific tissue or organ in which a neoplastic growth is suspected to occur, or alternatively a sample from any portion of the subject, such as a blood, saliva or cheek swab sample.
  • the detected expression level or structure of a BRCA-1 regulator nucleic acid or polypeptide is then compared to the corresponding expression level or structure known for a population of normal and cancer subjects, whereby the expression level or structure will correspond to a specific subpopulation of subjects.
  • the number of normal subjects relative to cancer subjects in the specific subpopulation can be determined and results in a likelihood value of any subject within that subpopulation for developing cancer.
  • the propensity of the subject to developing cancer is determined by assigning to it the likelihood value of the subpopulation to which the expression level or structure of the subject corresponds. It is understood that modifications which do not substantially affect the activity of the various embodiments of this invention are also included within the description of the invention provided herein. Accordingly, the following examples are intended to illustrate but not limit the present invention.
  • This example demonstrates the construction of a random retroviral vector ribozyme gene library.
  • the inventors have discovered that by introducing a random retroviral vector ribozyme gene library in the PA1 ovarian carcinoma cell line, certain of the ribozymes will selectively target and inactivate mRNA molecules encoding regulators of the BRCA-1 tumor suppressor gene.
  • a ribozyme gene library with randomized target recognition sequences was introduced into mammalian cells stably expressing a selectable marker, enhanced green fluorescent protein (EGFP) under the control of the BRCA-1 promoter. Cells in which BRCA-1 expression was upregulated by particular ribozymes were selected through their concomitant increase in EGFP expression.
  • EGFP enhanced green fluorescent protein
  • TST target sequence tag
  • a plasmid-based retroviral library was constructed by inserting random ribozyme gene sequences into parent vector pLHPM-2kb.
  • pLHPM-2kb contains 5' and 3' long terminal repeats (LTR) of the Moloney retroviral genome; a neomycin resistance gene driven by the LTR; an SV40 promoter driving a puromycin resistance gene; and a transcription cassette containing a tRNAval promoter and a 2 kb stuffer insert.
  • LTR long terminal repeats
  • tRNAval promoter can drive transcription of the inserted ribozyme gene.
  • plasmid pLEEPM was digested overnight at 65°C with BstBl, phenol: chloroform extracted and ethanol precipitated. The resuspended DNA was then digested overnight at 37°C with Mlul. This double digestion excises the 2kb stuffer fragment. The resultant 6kb plasmid vector DNA fragment was purified by agarose gel electrophoresis.
  • oligol:oligo2:oligo3 To prepare the random ribozyme library inserts, three ohgonucleotides were synthesized and annealed in annealing buffer (50 mM NaCl, 10 mM Tris pH 7.5, 5 mM MgC12) at a molar ratio of 1:3:3 (oligol:oligo2:oligo3) by heating to 90°C followed by slow cooling to room temperature.
  • the three ohgonucleotides had the following sequences:
  • Oligol 5'-pCGCGTACCAGGTAATATACCACGGACCGAAGTCCG
  • Oligo2 5'-pGTCCGTGGTATATTACCTGGTA-3' (SEQ ED NO: 50)
  • Oligo3 5'-pCGAAACCGGGCGGAAACAGG-3' (SEQ ID NO: 51)
  • the ribozyme insert library formed by annealing the three ohgonucleotides thus contains 8 positions with random nucleotides corresponding to helix 1 of the ribozyme, and 4 random positions with random nucleotides corresponding to helix 2 of the ribozyme.
  • the bacterial colonies containing the retroviral plasmid ribozyme library were pooled in aliquots as a master stock and frozen at -80°C.
  • Working stocks were made by culturing 1 ml of the master stock in 60 ml LB media overnight at 30°C. A 1 ml aliquot of the working stock was used to make a 500 ml bacterial culture by incubation at 30°C overnight. Plasmid DNA was then-extracted from the 500 ml culture and used to generate retroviral vector as described below.
  • in vitro cleavage was utilized to determine if ribozymes that target known RNA substrates were present in the library pool. This involved in vitro transcribing of the entire ribozyme library in one reaction and then testing the pool's ability to cleave a variety of different RNA substrates of both cellular and viral origin. Six out of seven known RNA targets were properly and efficiently cleaved by the in vitro transcribed library. This qualitative analysis suggested a significantly complex library of ribozyme genes and the lack of cleavage of one target out of seven may reflect the slight non-randomness suggested by the base composition described above.
  • Viral vector was produced from the ribozyme library plasmid using a triple transfection technique.
  • CF2 cells were seeded at 3.5 x 10 4 cells/cm 2 one day prior to transfection.
  • the cells were transfected with a 1 : 1 : lmixture of the ribozyme library plasmid or control ribozyme plasmid, a plasmid encoding the moloney-murine virus gag-pol genes, and a plasmid encoding the vesicular stomatitis virus-G gene, using the cationic lipid TransIT-LTl (Pan Vera Co ⁇ oration).
  • EXAMPLE IE Isolation of ribozymes that target BRCA-1 regulator nucleic acids
  • This example demonstrates the isolation of ribozyme genes that bind to and inactivate BRCA-1 regulator nucleic acid molecules, and the identification of the nucleic acid sequences they target.
  • a reporter gene based cellular selection system was used in order to facilitate functional selection for cells with a change in their BRCA-1 expression.
  • the reporter construct allowed expression of EGFP under control of the BRCA-1 promoter region contained in a 2.9 kb fragment from the BRCA-1 genomic sequence.
  • the 2.9 kb BRCA-1 promoter region was amplified using a primer with an added Pstl site (5 - ATCTTTCTGCAGCTGCTGGCCCGG-3'; SEQ ED NO: 52) and an Agel containing primer (5'-GTGTAAACCGGTAACGCGAAGAGCAGATA-3'; SEQ ID NO: 53) and the PCR Long Template System (Boehringher Mannheim) from a pGL2 vector containing a 3.8 kb genomic BRCA-1 fragment.
  • the PCR product was gel purified, digested with Pstl and Agel and cloned into pEGFP-1 (Clontech) which also contains a neomycin resistance marker using standard molecular techniques.
  • the ovarian cancer cell line PA1 was transfected with the BRCA/EGFP reporter construct using Lipofectamine Plus (Gibco-BRL) and stable integrants selected using neomycin at 400-800 mg/ml for two weeks. Clones of reporter cells were generated by limited dilution and characterized for endogenous BRCA-1 and EGFP expression. A reporter clone designated P8EGBR3 with an intermediate level of expression of both genes was chosen for library introduction. Retroviral library vector or control vector was introduced into the P8EGBR3 reporter cells, and selected for stable integration of the vector using the puromycin resistance marker. 1.
  • Ribozymes were rescued from the shifted cell population by PCR amplification. PCR rescue was performed on five separate aliquots of 1 mg of genomic DNA extracted from the cells using the QIAmp Blood Kit (Qiagen, Valencia, CA). PCR was carried out using the AmpliTaq Gold system (Perkin- Elmer, Norwalk, CT) with an initial denaturation at 94°C for 10 min. followed by 35 cycles of 94°C for 20 sec, 65°C for 30 sec, and 72°C for 30 sec. A final extension was performed at 72°C for 7 min. PCR primers (5 - GGCGGGACTATGGTTGCTGACTAAT-3', 5'-
  • the pooled PCR product which contained a pool of ribozyme genes, was isolated by electrophoresis on 1% agarose, purified using a Gel Extraction Kit (Qiagen), then digested with BamHE and MluE and ligated into LHPM digested with the same enzymes. The ligated DNA was used to transform DH12S bacteria by electroporation. The entire bacterial culture was plated on LB-agar plates containing ampicillin and incubated at 37°C overnight.
  • the resulting bacterial colonies were pooled and purified DNA was used in the triple transfection protocol to generate new retroviral vector. Individual colonies were also sequenced by the standard dideoxy method using a vector primer (5 -CTGACTCCATCGAGCCAGTGTAGAG-3'; SEQ ED NO: 98). Several ribozyme sequences were found to be enriched.
  • the retroviral pool was introduced into new reporter cells and subjected to several rounds of selection by FACS. Again the library transduced cells shifted compared to control transduced cells. Rescue of the ribozymes from these cells showed six predominant ribozymes designated. RH1, RH2, RH3, RH4, RH5, and RH6 (Tables 1-6).
  • the substrate binding sequence of RH1 (SEQ ED NO: 5), together with its corresponding target sequence tag (TST1; SEQ ED NO: 11) is presented in Table 1 below.
  • the substrate binding sequence of RH2 (SEQ ID NO: 10), together with its corresponding target sequence tag (TST2; SEQ ED NO: 16) is presented in Table 2 below.
  • the substrate binding sequence of RH3 (SEQ ED NO: 6), together with its corresponding target sequence tag (TST3; SEQ ED NO: 12) is presented in Table 3 below.
  • RH4 SEQ ID NO: 7
  • TST4 conesponding target sequence tag
  • the substrate binding sequence of RH5 (SEQ ED NO: 8), together with its conesponding target sequence tag (TST5; SEQ ED NO: 14) is presented in Table 5 below.
  • RH6 substrate binding sequence of RH6 (SEQ ED NO: 9), together with its conesponding target sequence tag (TST6; SEQ ED NO: 15) is presented in Table 6 below.
  • vector was generated from plasmids encoding individual ribozymes and introduced by retroviral transduction into a second reporter system (SKHYTK4) with, the hygromycin resistance gene driven by the BRCA-1 promoter in the SKBR3 breast carcinoma cell line.
  • the BRCA-1/EGFP plasmid was used to excise a Sapl insert containing the 2.9 kb BRCA-1 promoter region, the ends were blunted using Klenow and the insert digested with Bglll.
  • a plasmid containing the hygromycin resistance gene fused to HSV thymidine kinase was used as a backbone 30 to construct the hygromycin reporter plasmid.
  • This plasmid contains a separate neomycin resistance cassette.
  • the plasmid was digested with Nhel, the ends were blunted using Klenow and the plasmid digested with Bglll.
  • the insert was ligated into the plasmid with one blunt end and one Bglll site to generate a BRCA1 promoter driven hygromycin gene.
  • the breast cancer cell line SKBR3 was transfected with the BRCA/HyTK reporter construct using Lipofectamine Plus (Gibco-BRL) and stable integrants selected using neomycin at 400-800 mg/ml for two weeks. Clones of reporter cells were generated by limited dilution and characterized for resistance to hygromycin B.
  • SKHYTK4 One clone, SKHYTK4, was selected for its sensitivity to hygromycin over a range of 400-800 mg/ml.
  • the BRCA-1/hygroTK cassette was determined to be present in these cells by PCR and sequence analysis of the genomic DNA.
  • SKHYTK4 cells transduced with individual ribozymes RH3, RH4, or RH6 showed increased resistance to hygromycin as determined by an increase in cell number when the transduced cells were grown in hygromycin containing media (3.1, 8.5, and 147 fold respectively).
  • RH2 did not confirm in this assay.
  • ribozymes were introduced into PA1 cells by retroviral transduction, and analyzed for their ability to grow in soft agar.
  • 6 well plates were coated with Escove's media (Gibco-BRL) containing 0.6% agar and 10% fetal calf serum.
  • 1 xlO 6 PA1 cells were transduced with retroviral vector at an MOE of 1 on day 1 and 2.
  • freshly transduced PA1 cells were overlaid on coated plates at 6 x 10 4 or 9 x 10 4 cells per well in Iscove's media containing 0.4% agar and 7.7% fetal calf serum.
  • ribozymes containing substrate binding sequences designated SEQ ED NOS: 5-10 are ribozymes which target and inactivate regulators of BRCA-1 expression nucleic acid molecules.
  • the targets of these ribozymes which are nucleic acid molecules containing nucleic acid sequences designated SEQ ED NOS: 11-16, are regulators of BRCA-1 expression nucleic acid molecules.
  • BCC1 Breast Basic conserveed Protein 1
  • This example demonstrates the isolation of a full-length transcriptional regulator of BRCA-1 nucleic acid molecule designated Breast Basic conserveed Protein 1 cDNA and its encoded polypeptide.
  • TST Target Sequence Tag
  • the TST can thus be used to BLAST search the gene and EST databases, and also can be used as a primer for 3' and 5' RACE. BLAST searches of the databases with the TST conesponding to RH1 yielded no complete matches, and incomplete matches only with non-human sequences.
  • the RH1 target gene was cloned using the RK TST as a primer for a novel technique developed for the pu ⁇ ose of identifying ribozyme cleavage targets.
  • This novel technique called SMART C-SPACE for Switching Mechanism At 5' end of RNA Template in Cleavage-Specific Amplification of cDNA Ends takes advantage of the unique cleavage site of the hai ⁇ in ribozyme to generate a 5' terminus on the target nucleic acid consisting of the bases GUC.
  • This method consists of in vitro cleavage of cellular mRNA by a particular ribozyme (compared with a control ribozyme cleavage performed with another aliquot of the target cell mRNA), combined with SMART cDNA technology (Clontech) for detection of the cleavage products by PCR amplification.
  • SMART cDNA technology is a PCR-based method for generating high yields of high quality, double-stranded cDNA from nanograms of total or poly A+ RNA.
  • RNA from PA1 cells was first cleaved with in vitro transcribed RH1 ribozyme (Welch P et al., 1997), then used as a template for SMART cDNA synthesis.
  • the first strand reaction was primed by a modified oligo (dT) oligonucleotide and catalyzed by MMLV reverse transcriptase (Superscript, GIBCO BRL).
  • dT modified oligo
  • Superscript, GIBCO BRL MMLV reverse transcriptase
  • the 3' end of the SMART oligonucleotide which contains a stretch of G residues, anneals with the C-rich motif, forming an extended template.
  • the reverse transcriptase enzyme then switches templates and replicates the oligonucleotide.
  • RNase treatment the result is a single-stranded cDNA with a sequence complementary to the oligo (dT) primer at the 5' end and a sequence complementary to the SMART oligonucleotide at the 3' end. These sequences subsequently serve as priming sites in PCR amplification.
  • the 3' attached sequence lies directly adjacent to the CAG sequence generated by reverse transcription of the ribozyme recognition triplet GUC of the mRNA.
  • This sequence stretch in combination with the adjacent 8 bases of helix 1 of the ribozyme consists of a stretch of 14 bases specific for cleaved substrate RNA molecules.
  • the cDNA generated using this technique was amplified by PCR using an oligonucleotide primer that recognize the SMART sequence, attached C residues, GTC site, and adjacent helix 1 of the ribozyme, and an oligonucleotide primer that recognizes a unique portion of the oligo(dT) primer.
  • the amplification products were compared between the RH1 cleaved mRNA and mRNA cleaved with a control ribozyme. Several bands specific for the RH1 ribozyme cleaved sample were recovered, cloned and sequenced ( Figure 6).
  • Target validation ribozyme target GUC sites were identified in the BBC1 sequence, and target validation ribozymes designed (TV6-10, Table 7; SEQ ED NOS: 56 through 60, respectively).
  • Target validation ribozyme expressing retroviral vectors generated as before from the individual target validation ribozyme sequences were tested as described above in the SKHYTK4 hygromycin resistance assay.
  • Several of these target validation ribozymes scored positive for enhanced hygromycin resistance with TV9 showing the most pronounced effect (20 fold increase in cell number). Additional target validation ribozymes are provided in Figure 8 (SEQ ED NOS: 102 through 221). Table 7
  • RT-PC-R Real-time quantitative polymerase chain reaction
  • a reporter dye is attached to the 5' end and a quencher is attached to the 3' end.
  • the fluorescence from the reporter dye is quenched by the quencher. In this anangement, the fluorescence detector will not be able to detect any signal.
  • the probe anneals to its template between the two primers. As the taq polymerase enzyme replicates the template from the primers, it comes upon the probe. Besides its polymerase activity, taq also has a 5' to 3' exonuclease activity.
  • the fluorescence detector can detect the signal. This fluorescence reading is taken at the end of each cycle of the PCR. In this way, the detector can determine the amount of probe which has been destroyed during each cycle. The amount of probe destroyed is directly proportional to the amount of template at the beginning of the PCR reaction. Consequently, the amount of mRNA encoding a given protein can be determined in each sample tested.
  • RNA levels For determining BRCA-1 mRNA levels, we use the following oligonucleotide sequences: forward primer- 5'-CTGCTCAGGGCTATCCTCTCA-3' reverse primer- 5-TGCTGGAGCTTTATCAGGTTATGT-3 probe- 5'-lTGACATTTTAACCACTCAGCAGAGGGATACCA2-3' where 1 is the 6-FAM reporter dye and 2 is the TAMRA quencher (SEQ ED NOS: 61 through 63, respectively).
  • RT-PCR-analysis of the mRNA extracted from the TV9 transduced cells showed a 150% increase in BRCA-1 message compared to control vector transduced cells. This confirms the involvement of BBC1 in the observed phenotype, and establishes a novel function of this gene as a transcriptional regulator of BRCA-1.
  • This example demonstrates the isolation of a full-length regulator of BRCA-1 nucleic acid molecule designated Candidate BRCA1 Regulator (BRl) cDNA and its encoded polypeptide.
  • BRl Candidate BRCA1 Regulator
  • ribozyme target GUC sites were identified in the BRl sequence, and target validation ribozymes designed (TV1-5, Table 9; SEQ ID NOS: 70 through 74, respectively).
  • Retroviral vectors generated as before from the individual target validation ribozyme sequences were tested in the SKHYTK4 hygromycin resistance assay.
  • Several of these target validation ribozymes scored positive for enhanced hygromycin resistance, with TN3 showing a 17 fold increase in cell number. This confirms the involvement of BRl in the observed phenotype, and establishes a novel function of this gene as a regulator of BRCA-1.
  • This example demonstrates the isolation of a full-length transcriptional regulator of BRCA-1 nucleic acid designated Inhibitor, dominant negative 4 (ED4) cDNA and its encoded polypeptide.
  • Inhibitor dominant negative 4
  • the RH5 TST sequence showed a 14/16 match to the ED4 gene (GenBank accession number NM_001546), by BLAST search.
  • ED4 is a known transcriptional repressor located on chromosome 6p21.3-p22/6p22.3-p23. It belongs to a family of inhibitors of basic helix-loop-helix transcription factors. Et prevents transcriptional activation by dimerization to the factors and blocks their ability to bind DNA. They are known to be involved in differentiation of adipocytes and neuronal cells.
  • target validation ribozymes (TV19-22, Table 10; SEQ ED NOS: 75 through 78, respectively) were designed conesponding to GUC sites in the ID4 sequence. Retroviral vectors generated from the individual target validation ribozymes were introduced into the SKHYTK4 cell line to assay for hygromycin resistance. The validation ribozymes as well as the original RH5 ribozyme failed to generate enhanced resistance to hygromycin. ED4 message was found to be undetectable in SKBR3 cells. The validation ribozymes were tested in the soft agar assay using PA1 cells, which do express ED4.
  • RH5 and several target validation ribozymes decreased the anchorage-independent growth ability of these cells (58,10 and 34% reduction for RH5, TV20, and TV21 respectively).
  • Over-expression of the entire cDNA for 1D4 in PA1 cells caused an increase in the anchorage-independent growth ability of these cells, leading to large colonies after 10 days of culture.
  • RT-PCR analysis of cells transduced with RH5 vector showed considerable variability depending on the population tested. This can be due to a complex feedback regulation mechanism.
  • This example demonstrates the isolation of an EST encoding a nucleic acid containing a TST conesponding to RH3.
  • the RH3 TST sequence was used as a primer for 5' RACE using standard methodology.
  • the resulting PCR product had a 13/16 match with an EST from the databases (GenBank accession number AL045940). This EST is undergoing target validation with 5 additional GUC recognition sites (SEQ ED NOS: 82 through 86, respectively).
  • a second EST was identified by database search (GenBank accession number AI668913) with a 14/15 match to RH3. This EST is undergoing target validation with 4 additional GUC recognition sites (SEQ ED NOS: 87 through 91, respectively).
  • ED4 sense and antisense expression vectors were introduced into P8R3 cells by transduction with retroviral vectors.
  • the cDNA sequence from ED4 was amplified using primers ED4-3 (5'-TCCGAAGGGAGTGACTAGGACACCC-3'; SEQ ED NO: 94) and ED4-7 (5 * -TTCTGCTCTTCCCCCTCCCTCTCTA-3'; SEQ ED NO: 95).
  • the amplified product was cloned into T/A-vector (Envitrogen), and verified by sequencing from both vector sites.
  • Plasmid DNA was digested with Eco RE, releasing the whole insert out of the cloning vector and cloned into the EcoRE linearized retroviral expression vector pLPCX (Clontech). Clones were analyzed for the conect insert as well as for orientation screening by multiple restriction digests. Sequencing of both junction sites from both directions using vector-based primers 5 - and 3 - LPCX (Clontech) confirmed the conect orientation and junction sequence. Following stable integration, cells were evaluated for their anchorage-independent growth potential using the soft agar assay described above. The biological consequences of BRCA-1 downregulation should be increased growth in soft agar, and the converse for BRCA-1 upregulation. Cells expressing sense ED4 had a dramatic increase in anchorage-independent growth in comparison to cells expressing antisense ED4.
  • This example provides methods to use BRCA-1 regulator ribozymes to identify other genes in the BRCA-1 pathway that contribute to the phenotype changes observed after ribozyme mediated target RNA cleavage (i.e. target "knockdown").
  • Expression profiling of genes in hybridization assays identifies cellular genes upregulated or downregulated subsequent to BRCA-1 regulator knockdown. Such genes constitute potential BRCA-1 regulators.
  • RNA extracted from cells expressing ribozymes RH1, RH3, RH4, RH5, and RH6 was sequentially hybridized to an anay filter. Probes, filters, and analysis were as recommended by the manufacturer (Research Genetics, Huntsville AL). Briefly, 10 micrograms of total RNA from each ribozyme or control transduced cell population was primed with oligo dT, and reverse transcribed with reverse transcriptase (Superscript II Life Technologies, Gaithersburg MD) inco ⁇ orating 33 P labeled dCTP to generate a detectable cDNA probe. Denatured probe was hybridized to the filter in the supplied buffer for 18 hours at 42°C.
  • Filters were washed in 2X SSC, 1% SDS at 50°C twice for 20 minutes each, followed by washing in 0.5 X SSC, 1% SDS at room temperature for 15 minutes.
  • the filters were exposed to a phospor imaging screen and the image captured using a Molecular Dynamics (Sunnyvale, CA) phosphor imaging system. Comparisons between filters were made using the Pathways analysis software (Research Genetics, Huntsville AL).
  • the expression profile was compared to the pattern generated by hybridizing the filter to RNA extracted from cells expressing the control ribozyme.
  • Several genes were found to be down-regulated in some or all of the ribozyme expression profiles. From the pattern of expression it is possible to ascertain a pathway of differentially expressed genes. Numerous genes were differentially expressed at levels in the ribozyme expression cells that were greater than in the control cells.
  • AA419229 EST sharing sequence identity with o ⁇ han GPR39 A.
  • AF034633.1 Homo sapiens o ⁇ han G protein-coupled receptor (GPR39) mRNA, complete eds
  • HI 8950 EST sharing sequence identity with NADC3 A.
  • AF 154121.1 Homo sapiens sodium-dependent high-affinity dicarboxylate transporter (NADC3) mRNA, complete eds
  • H07920 EST sharing sequence identity with MKK6 A.
  • XM_012648.1 Homo sapiens mitogen-activated protein kinase kinase 6
  • NM_002758.1 Homo sapiens mitogen-activated protein kinase kinase 6 (MAP2K6), mRNA
  • NM_005833.1 Homo sapiens Rab9 effector p40 (RAB9P40), mRNA
  • R15740 EST sharing sequence identity with chondroitin-6-sulfotransferase
  • AA454570 EST sharing sequence identity with lambda 5 semaphorin
  • AA464601 EST sharing sequence identity with tspan-5
  • D. XM_011178.1 Homo sapiens sharing sequence identity with tetraspan 5 (H. sapiens) (LOC65435), mRNA
  • AA102107 EST sharing sequence identity with aminopeptidase A A. L12468.1 - Homo sapiens aminopeptidase A mRNA, complete eds
  • HSHNF4G hepatocyte nuclear factor 4 gamma Ribozymes can be designed to target the cleavage sites in the above 15 genes to verify that the above genes are BRCA-1 regulators according to methods disclosed above. Potential cleavage TST target sequences and the sequence of a ribozyme substrate recognition site for cleaving those TST target sequences is shown in tables 15-17 below.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)

Abstract

L'invention se rapporte à des ribozymes et à des acides nucléiques codants ayant des séquences de reconnaissance qui permettent au ribozyme de cibler et de couper les régulateurs de BRCA-1, ce qui se traduit par une régulation par augmentation des BRCA-1 dans une cellule. L'invention se rapporte également à des acides nucléiques codant pour des régulateurs de BRCA-1, qui contiennent les séquences cibles reconnues par les ribozymes précités. L'invention se rapporte à des fragments de ces séquences d'acides nucléiques et de protéines. L'invention se rapporte également à un procédé d'identification d'un gène dans lequel le niveau d'expression est modifié par un régulateur de BRCA-1 ainsi qu'à l'identité de plusieurs gènes ainsi modifiés. L'invention se rapporte en outre à un procédé d'identification d'un composé qui module l'activité d'un régulateur de BRCA-1. Elle se rapporte aussi à une méthode de traitement du cancer, qui consiste notamment à introduire dans une cellule cancéreuse un ribozyme réagissant sélectivement avec un ARN codant pour un régulateur de BRCA-1. L'invention se rapporte enfin à un procédé de détection d'une cellule néoplasique dans un échantillon.
EP01924317A 2000-03-23 2001-03-23 Regulateurs de brca-1 et procedes d'utilisation Withdrawn EP1268791A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US536058 1995-09-29
US53605800A 2000-03-23 2000-03-23
PCT/US2001/009559 WO2001070982A2 (fr) 2000-03-23 2001-03-23 Regulateurs de brca-1 et procedes d'utilisation

Publications (1)

Publication Number Publication Date
EP1268791A2 true EP1268791A2 (fr) 2003-01-02

Family

ID=24136951

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01924317A Withdrawn EP1268791A2 (fr) 2000-03-23 2001-03-23 Regulateurs de brca-1 et procedes d'utilisation

Country Status (5)

Country Link
EP (1) EP1268791A2 (fr)
JP (1) JP2003527860A (fr)
AU (1) AU2001250980A1 (fr)
CA (1) CA2402834A1 (fr)
WO (1) WO2001070982A2 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW444257B (en) 1999-04-12 2001-07-01 Semiconductor Energy Lab Semiconductor device and method for fabricating the same
AU2001257406A1 (en) * 2000-04-26 2001-11-07 Millennium Pharmaceuticals, Inc. Methods and compositions for the diagnosis and treatment of cardiovascular and tumorigenic disease using 4941

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001502893A (ja) * 1996-09-04 2001-03-06 オニックス ファーマシューティカルズ，インコーポレイティド Ｂｒｃａ１活性のモジュレーター
US6476207B1 (en) * 1998-06-11 2002-11-05 Chiron Corporation Genes and gene expression products that are differentially regulated in prostate cancer
JP2002528049A (ja) * 1998-07-22 2002-09-03 イミューソル インコーポレイテッド 実質的に完全なリボザイムライブラリー
JP2002539777A (ja) * 1999-03-19 2002-11-26 ヒューマン ジノーム サイエンシーズ， インコーポレイテッド ４８個のヒト分泌タンパク質
CA2392428A1 (fr) * 2000-01-31 2001-08-02 Human Genome Sciences Inc. Acides nucleiques, proteines et anticorps
WO2001079556A2 (fr) * 2000-04-14 2001-10-25 Millennium Pharmaceuticals, Inc. Nouveaux genes, compositions et methodes destines a l'identification, l'evaluation, la prevention, et la therapie de cancers humains

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0170982A2 *

Also Published As

Publication number Publication date
WO2001070982A2 (fr) 2001-09-27
CA2402834A1 (fr) 2001-09-27
AU2001250980A1 (en) 2001-10-03
JP2003527860A (ja) 2003-09-24
WO2001070982A3 (fr) 2002-08-22

Similar Documents

Publication Publication Date Title
US20050208486A1 (en) Brca-1 regulators and methods of use
KR101944555B1 (ko) 유방암 전이의 진단, 예후 및 치료 방법
EP2502628B1 (fr) Séquences de polynucléotides et de polypeptides impliquées dans le cancer
JP4802087B2 (ja) 哺乳類遺伝子の多対立遺伝子発現の破壊
US7867709B2 (en) Method for detecting cancer and method for suppressing cancer
Wang et al. Sprouty4, a suppressor of tumor cell motility, is downregulated by DNA methylation in human prostate cancer
AU2004213432A1 (en) Novel therapeutic targets in cancer
AU2008229749A1 (en) Novel compositions and methods for cancer
WO2005100998A2 (fr) Marqueurs membranaires destines a etre utilises pour le diagnostic et le traitement du cancer
JP2015109806A (ja) 新規ｒｅｔ融合体の検出法
JP2011254830A (ja) 結腸癌に関するポリヌクレオチド
KR20050067409A (ko) 전립선암에 관련된 유전자 및 폴리펩티드
WO2006063462A9 (fr) Sequences polynucleotidiques et polypeptidiques participant au remodelage osseux
Qi et al. Androgens differentially regulate the expression of NEDD4L transcripts in LNCaP human prostate cancer cells
JP4890763B2 (ja) アポトーシスを調節するための核酸、ポリペプチド、及びアポトーシスを調節する方法
WO2003035837A2 (fr) Nouvelles compositions et procedes relatifs au cancer
WO2001070982A2 (fr) Regulateurs de brca-1 et procedes d'utilisation
CA2409219A1 (fr) Regulateurs cellulaires d'agents infectieux et methodes d'utilisations
JP2009502111A5 (fr)
CA2546363A1 (fr) Procedes et agents de criblage de composes capables de moduler l'expression de her2
WO2008075713A1 (fr) Marqueur pour le diagnostic du cancer et molécule cible pour une thérapie
AU2003225750B2 (en) Novel compositions and methods in cancer associated with altered expression of KCNJ9
US20040053210A1 (en) Genetic demonstration of requirement for nkx6.1, nkx2.2 and nkx6.2 in ventral neuron generation
JP2000308492A (ja) ヒトナース細胞レセプター遺伝子
JP2003289865A (ja) Ｆａｓ介在型アポトーシスに関連するタンパク質をコードするポリヌクレオチドおよびその発現を抑制するリボザイム

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20021022

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050421

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050902