EP1266202A4 - Methodes de detection des differences entre acides nucleiques - Google Patents

Methodes de detection des differences entre acides nucleiques

Info

Publication number
EP1266202A4
EP1266202A4 EP01918574A EP01918574A EP1266202A4 EP 1266202 A4 EP1266202 A4 EP 1266202A4 EP 01918574 A EP01918574 A EP 01918574A EP 01918574 A EP01918574 A EP 01918574A EP 1266202 A4 EP1266202 A4 EP 1266202A4
Authority
EP
European Patent Office
Prior art keywords
holliday
nucleic acid
complex
difference
junction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01918574A
Other languages
German (de)
English (en)
Other versions
EP1266202A2 (fr
Inventor
Qinghong Yang
Wendy Yang
Alla Lishanski
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Panomics LLC
Original Assignee
Panomics LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Panomics LLC filed Critical Panomics LLC
Publication of EP1266202A2 publication Critical patent/EP1266202A2/fr
Publication of EP1266202A4 publication Critical patent/EP1266202A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Definitions

  • the present invention relates to the field of molecular biology, more particularly nucleic acid hybridization, Holliday junction formation and branch migration.
  • the invention provides methods and reagents for detecting the presence of a difference between two related nucleic acid sequences.
  • the difference is a mutation, such as a point mutation, deletion or insertion.
  • Practical applications of the invention include, but are not limited to, genotyping, discovery and detection of single nucleotide polymorphisms,, characterization and quantitation of polynucleotides, mutation rate detection, gene expression analysis.
  • the invention is capable of distinguishing between homozygous and heterozygous genetic variation.
  • nucleic acids to bind selectively and specifically to complementary nucleic acids has been exploited in the development of numerous nucleic acid hybridization techniques. Not only are such techniques useful for detecting complementarity and/or identity between nucleic acid sequences (e.g.: quantitating differential gene expression level such as Northern blots, Southern blots and gene expression chip/micro-arrays), but in some cases they are exploited to be used for detecting differences between related nucleic acid sequences.
  • quantitating differential gene expression level such as Northern blots, Southern blots and gene expression chip/micro-arrays
  • hybridization is stronger between two perfectly complementary DNA strands than that between two non-perfectly complementary DNA strands (including those that have either a single or multiple base-pair-mismatch between the two complementary strands), a single-base-pair difference is usually too small to render a high enough specificity for SNP scoring.
  • gene-expression chips and/or micro-arrays often have much better specificity/accuracy than SNP chips/micro-arrays due to the fact that the hybridization between specific cDNAs and their corresponding oligos/DNA fragments immobilized on the chip/micro-array is very specific. Such hybridization does not necessarily depend on a single-base pair difference between two nucleic acids.
  • the method disclosed herein addresses the problem by combining highly specific allele-specific holiday structure formation with nucleic acid hybridization techniques (e.g.: gene chip/micro-array).
  • nucleic acid hybridization techniques e.g.: gene chip/micro-array.
  • SNP chips/micro-arrays can achieve the same high level of specificity/accuracy as gene-expression chips/micro-arrays.
  • a single-stranded oligo that is completely (or partially) complementary to a specific part of single-stranded M13mpl8 viral DNA anneals to the viral DNA and form a partial duplex with either 1 (or 2) tail(s) at each end.
  • the partial duplex formed between the oligo and the M13mpl8 viral DNA can then form a four- way Holliday-like structure with an invading partial duplex with either 1 (or 2) complementary tails.
  • the four- way Holliday-like structure then undergoes branch migration in the direction away from the tail(s) (It can not branch migrate back towards the tail(s) due to energy barrier: breaking existing H-bonds without forming new ones).
  • a single (or multiple) base pair difference between the duplex part of oligo/M13mpl8 partial duplex and the duplex part of the invading partial duplex poses enough energy barrier (2 H-Bonds -> 0 H-bond) to impede the branch-migration and prevent the release of the annealed oligo, regardless of the presence or absence of Mg++.
  • a single base pair difference (substitution, deletion or insertion) between the duplex part of oligo/M13mpl8 partial duplex and the duplex part of the invading partial duplex poses enough energy barrier to impede the branch-migration and prevent the release of the annealed oligo ONLY in the presence of Mg++.
  • One method that has been proposed for detecting differences between related nucleic acid sequences involves forming a complex comprising a Holliday junction between the related sequences.
  • a complex comprising a Holliday junction between the related sequences.
  • each member of at least one pair of non-complementary strands within the complex is labeled.
  • the two labels generate a signal that is dependent upon the labels being in close proximity to one another. If there is a difference in the related nucleic acid sequences, the Holliday junction is stabilized, thus positioning the labels within close proximity to one another and thereby generating a signal.
  • the Holliday junction is not stabilized and the complex dissociates into duplexes, eliminating the close proximity between the two labels and attenuating the signal.
  • a determination is made whether a stabilized complex is formed, the presence thereof indicating the existence of a difference between the related sequences.
  • One problem with the above-identified method of detecting differences between related nucleic acid sequences is that it normally requires the use of labeled PCR primers to generate the labeled nucleic acid strands required for detection of the Holliday junction complex.
  • the use of labeled primers can be problematic owing to the concentration of primer that must be used and the ensuing interference that occurs in the presence of high levels of labeled primers. This is a significant disadvantage, since one of the primary practical applications of the methodology is for the analysis of genomic DNA.
  • the present invention addresses the problems associated with the use of labeled polynucleotides and primers by providing novel methods and reagents for the rapid and efficient identification of differences between related nucleic acid sequences. As such, the invention constitutes a highly desirable and practical addition to fields of endeavor including molecular biology and medicine.
  • the present invention provides methods for detecting the presence or absence of a difference between two related nucleic acid sequences.
  • the methods achieve sensitivities great enough to detect the presence of any difference between the nucleic acids, even single nucleotide polymorphisms.
  • a target nucleic acid and a reference nucleic acid are contacted under conditions in which they are capable of forming a four- way nucleic acid complex with a branch structure that is capable of migration. Under the contact conditions, if the reference nucleic acid and target nucleic acid are identical, branch migration is capable of going to completion resulting in complete strand exchange. If the reference nucleic acid and target nucleic acid are different, branch migration does not go to completion, resulting in a stable four-way complex.
  • Detection of the stable four- way complex identifies the presence of a difference between the nucleic acids.
  • a stable four- way complex can be detected with molecules that specifically bind such complexes, by gel electrophoresis or by specific isolation of the stable four-way complex.
  • the present invention provides a method for detecting the presence of a difference between two related nucleic acid sequences.
  • the method involves forming a four-way complex comprising both of the nucleic acid sequences in duplex form, wherein the nucleic acids within the four-way complex are either not labeled or one of the four nucleic acid strands forming the four-way complex has a label, subjecting the four-way complex to conditions allowing branch migration to occur wherein, if a difference between the two related nucleic acid sequences is present, branch migration in said four-way complex ceases and the four-way complex continues to exist as a stable four- way complex; and wherein, if no difference between the two related nucleic acid sequences is present, branch migration in the four-way complex continues until complete strand exchange occurs and the four-way complex resolves into two duplex nucleic acids, subjecting said four-way complex or its resolved duplex products after branch migration to conditions allowing the specific binding of reagent(s) to said four-way complex and the binding of said reagent(s) to said four- way complex produces a detectable signal, and detecting the signal produced upon
  • the present invention provides a method for detecting the presence of a difference between two related nucleic acid sequences.
  • the method involves forming a four- way complex comprising both of the nucleic acid sequences in duplex form, wherein the nucleic acids within the four-way complex are either not labeled or one or more of the four nucleic acid strands forming the four- way complex has a label, subjecting the four-way complex to conditions allowing branch migration to occur wherein, if a difference between the two related nucleic acid sequences is present, branch migration in said four-way complex ceases and the four-way complex continues to exist as a stable four-way complex; and wherein, if no difference between the two related nucleic acid sequences is present, branch migration in the four-way complex continues until complete strand exchange occurs and the four- way complex resolves into two duplex nucleic acids, subjecting said four-way complex or its resolved duplex products after branch migration to conditions allowing the separation of the four-way DNA complex (Holliday structure
  • FIG. 1 provides a schematic diagram of an embodiment in accordance with the present invention for detecting any difference between two related nucleic acid sequences using PCR wherein absence of any difference between the two related sequences leads to complete branch migration and the resolution of the Holliday junction complexes;
  • FIG. 2 provides a schematic diagram of an embodiment in accordance with the present invention for detecting any difference between two related nucleic acid sequences using PCR wherein presence of any difference between the two related sequences blocks branch migration and leads to the formation of stable Holliday junction complexes;
  • FIG. 3 provides a schematic diagram of showing one way of using Holliday junction specifically binding protein(s) for detecting a difference between two related nucleic acid sequences wherein a mutation is present in one of the two related sequences and branch migration is stopped, leading to the formation of stable Holliday junction complexes that can be detected by using labeled Holliday junction specifically binding protein(s);
  • FIG. 4 provides a schematic diagram of showing another way of using Holliday junction specifically binding protein(s) for detecting a difference between two related nucleic acid sequences wherein a mutation is present in one of the two related sequences and branch migration is stopped, leading to the formation of stable Holliday junction complexes that can be detected by using labeled Holliday junction specifically binding protein(s);
  • FIG. 5 provides a schematic diagram of a method of genotyping a target DNA
  • FIG. 6A provides a schematic diagram of a method comparing two nucleic acids by resolving four-way complexes immobilized on a solid substrate
  • FIG. 6B provides a schematic diagram of a method of detecting a difference between two nucleic acids by detecting stabilized Holliday structures immobilized on a solid substrate
  • FIG. 7 is a schematic diagram of an embodiment in accordance with the present invention for determining the genotypes of diploid genomic DNA samples at particular SNP positions by using PCR;
  • FIG. 8 A provides a the results of a typical gel electrophoresis experiment wherein stable Holliday structures are detected
  • FIG. 8B provides the results of a typical gel electrophoresis experiment wherein nucleotide differences withinin several pairs are detected
  • FIG. 9A illustrates a mobility shift of a stable Holliday structure upon protein binding
  • FIG. 9B illustrates specific binding of a stable Holliday structure by RuvA
  • FIG. 9C illustrates specific binding of a stable Holliday structure by RuvA, a mutant
  • FIG. 10 illustrates the specific interaction of a stable Holliday structure with both RuvA and RuvC.
  • TABLE 1 illustrates an exemplary method for determining the genotypes of diploid genomic DNA samples using PCR.
  • the present invention overcomes these and other limitations by providing novel methods for the detection of a difference between nucleic acids.
  • the methods of the present invention display improved accuracy and efficiency when compared to previous methods for detecting a difference between two nucleic acids.
  • nucleic acids comprising specific nucleobase sequences are the conventional one-letter abbreviations.
  • the naturally occurring encoding nucleobases are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).
  • A adenine
  • G guanine
  • C cytosine
  • T thymine
  • U uracil
  • nucleic acid sequences that are represented as a series of one-letter abbreviations are presented in the 5' -> 3' direction.
  • nucleic acid and “polynucleotide” are interchangeable and refer to any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages.
  • phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphon
  • nucleic acid, polynucleotide, and nucleotide also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
  • a polynucleotide of the invention might contain at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylque
  • the polynucleotide can be from a human or non-human mammal, or any other organism, or derived from any recombinant source, synthesized in vitro or by chemical synthesis.
  • the nucleotide may be DNA, RNA, cDNA, DNA-RNA, hybrid or any mixture of the same, and may exist in a double-stranded, single-stranded or partially double-stranded form.
  • the nucleic acids of the invention include both nucleic acids and fragments thereof, in purified or unpurified forms, including genes, chromosomes, plasmids, the genomes of biological material such as microorganisms, e.g., bacteria, yeasts, viruses, viroids, molds, fungi, plants, animals, humans, and the like.
  • the nucleic acid can be only a minor fraction of a complex mixture such as a biological sample.
  • the nucleic acid can be obtained from a biological sample by procedures well known in the art.
  • oligonucleotide refers to a relatively short, single stranded polynucleotide, usually of synthetic origin.
  • An oligonucleotide typically comprises a sequence that is 8 to 100 nucleotides, preferably, 20 to 80 nucleotides, and more preferably, 30 to 60 nucleotides in length.
  • Various techniques can be employed for preparing an oligonucleotide utilized in the present invention. Such oligonucleotide can be obtained by biological synthesis or by chemical synthesis. For short sequences (up to about 100 nucleotides) chemical synthesis will frequently be more economical as compared to the biological synthesis.
  • chemical synthesis provides a convenient way of incorporating low molecular weight compounds and/or modified bases during the synthesis step. Furthermore, chemical synthesis is very flexible in the choice of length and region of the target polynucleotide binding sequence.
  • the oligonucleotide can be synthesized by standard methods such as those used in commercial automated nucleic acid synthesizers. Chemical synthesis of DNA on a suitably modified glass or resin can result in DNA covalently attached to the surface. This may offer advantages in washing and sample handling. For longer sequences standard replication methods employed in molecular biology can be used such as the use of Ml 3 for single stranded DNA as described by J. Messing (1983) Methods Enzymol, 101, 20-78.
  • oligonucleotide “primer” can be employed in a chain extension on a polynucleotide template such as in, for example, an amplification of a nucleic acid.
  • the oligonucleotide primer is usually a synthetic oligonucleotide that is single stranded, containing a hybridizable sequence at its 3 '-end that is capable of hybridizing with a defined sequence of the target or reference polynucleotide.
  • the hybridizable sequence of the oligonucleotide primer has at least 90%, preferably 95%, most preferably 100%, complementarity to a defined sequence or primer binding site.
  • the number of nucleotides in the hybridizable sequence of an oligonucleotide primer should be such that stringency conditions used to hybridize the oligonucleotide primer will prevent excessive random nonspecific hybridization.
  • the number of nucleotides in the hybridizable sequence of the oligonucleotide primer will be at least ten nucleotides, preferably at least 15 nucleotides and, preferably 20 to 50, nucleotides.
  • the primer may have a sequence at its 5'- end that does not hybridize to the target or reference polynucleotides that can have 1 to 60 nucleotides, 5 to 30 nucleotides or, preferably, 8 to 30 nucleotides.
  • sample refers to a material suspected of containing a nucleic acid of interest.
  • samples include biological fluids such as blood, serum, plasma, sputum, lymphatic fluid, semen, vaginal mucus, feces, urine, spinal fluid, and the like; biological tissue such as hair and skin; and so forth.
  • Other samples include cell cultures and the like, plants, food, forensic samples such as paper, fabrics and scrapings, water, sewage, medicinals, etc.
  • the sample may be pretreated with reagents to liquefy the sample and/or release the nucleic acids from binding substances. Such pretreatments are well known in the art.
  • chain extension refers to the extension of a 3'-end of a polynucleotide by the addition of nucleotides or bases.
  • Chain extension relevant to the present invention is generally template dependent, that is, the appended nucleotides are determined by the sequence of a template nucleic acid to which the extending chain is hybridized.
  • the chain extension product sequence that is produced is complementary to the template sequence.
  • chain extension is enzyme catalyzed, preferably, in the present invention, by a thermostable DNA polymerase, such as the enzymes derived from Thermis acquaticus (the Taq polymerase), Thermococcus litoralis, and Pyrococcus furiosis.
  • a "stabilized" Holliday junction is a junction where a mismatch has stalled branch migration to an extent sufficient that the stabilized Holliday junction is detectable and distinguishable from the duplex DNA that would be released from a Holliday junction involving identical sequences owing to branch migration.
  • a Holliday junction comprising "complex” refers to a complex of four nucleic acid strands associated through a Holliday junction, which can be inhibited from dissociation into two double stranded sequences by a difference in the sequences and their complements.
  • mutant refers to a change in the sequence of nucleotides of a normally conserved nucleic acid sequence resulting in the formation of a mutant as differentiated from the normal (unaltered) or wild type sequence. Mutations can generally be divided into two general classes, namely, base-pair substitutions and frame-shift mutations. The latter entail the insertion or deletion of one to several nucleotide pairs. A difference of one nucleotide can be significant as to phenotypic normality or abnormality as in the case of, for example, sickle cell anemia.
  • a “duplex” is a double stranded nucleic acid sequence comprising two complementary sequences annealed to one another.
  • a “partial duplex” is a double stranded nucleic acid sequence wherein a section of one of the strands is complementary to the other strand and can anneal to form a partial duplex, but the full lengths of the strands are not complementary, resulting in a single-stranded polynucleotide tail at at least one end of the partial duplex.
  • a "small organic molecule” is a compound of molecular weight less than about 1500, preferably 100 to 1000, more preferably 300 to 600 such as biotin, digoxigenin, fluorescein, rhodamine and other dyes, tetracycline and other protein binding molecules, and haptens, etc.
  • the small organic molecule can provide a means for attachment of a nucleotide sequence to a label or to a support.
  • the present invention provides methods and reagents useful for the detection of a difference between two related nucleic acid sequences by determining whether constructs comprising the sequences are capable of forming a stabilized Holliday junction.
  • the present invention provides methods and reagents for generating such constructs for use in the practice of the invention, and methods and reagents useful for stabilizing and detecting Holliday junctions.
  • the stabilized Holliday junction is detected by means of one or more binding proteins capable of specifically binding a Holliday junction.
  • sequences are related in the sense that the sequences are either identical, or would be identical if not for some difference between the two sequences.
  • the difference is a substitution, deletion or insertion variation or mutation, such as but not limited to a single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the target sequence and the reference sequence are prepared as a pair of sequences that are capable of forming a partial duplex according to the methods described in detail below.
  • a typical partial duplex A' is illustrated in FIG. 1.
  • Partial duplex A' comprises a complementary duplex region and one or more tail regions.
  • a complementary duplex region comprises a target sequence or a reference sequence annealed to its complement.
  • Other examples of partial duplexes are illustrated as A", B' and B".
  • one tail region comprises the oligonucleotide tails Tl and T2 ⁇
  • a second tail region comprises the oligonucleotide tails T3' and T4.
  • Tail Tl, T2', T3' and/or T4 can be linked to the target sequence via any linkage known to those of skill in the art for linking polynucleotides. They can be linked directly via a covalent bond or via a linker.
  • the linker can be a polynucleotide or any other linker known to those of skill in the art.
  • tail Tl and/or T3' is linked to the target sequence directly via a phosphodiester linkage.
  • tail Tl, T2, T3, T4, Tl', T2', T3' and/or T4' can be linked to a target sequence or a reference sequence.
  • All four tails are comprised of sequences that unrelated to each other and to the template DNA, or alternatively, one of the pair of polynucleotide tails at each terminus of the partial duplexes (T1/T2' or T3VT4) can be template DNA sequences.
  • a tail is capable of hybridizing with another sequence that complements the tail without interference from the target sequence, the reference sequence or from other tails.
  • partial duplexes A' and B illustrated in FIG. 1, are capable of forming a four-way structure under the appropriate conditions.
  • partial duplex A' comprises the tails Tl, T2', T3', and T4.
  • Another partial duplex B M comprises the tails Tl', T2, T3 and T4 ⁇
  • Each pair of polynucleotide tails at each end of the partial duplexes e.g., T1/T2', T2/T1', T37T4, T3/T4' are not complementary and will not anneal to one another under the applicable conditions.
  • tail T3' at the right end of partial duplex A' is complementary to, and hence can hybridize with, tail T3 at the right end of partial duplex B.
  • Tail T4 at the right end of partial duplex A' is complementary to, and hence can hybridize with, tail T4' at the right end of partial duplex B.
  • Tail Tl at the left end of partial duplex A' is complementary to, and hence can hybridize with, tail Tl" at the left end of partial duplex B.
  • Tail T2' at the left end of partial duplex A' is complementary to, and hence can hybridize with, tail T2 at the left end of partial duplex B".
  • the partial duplexes described above can be prepared by any method known to those of skill in the art for the preparation of polynucleotides or nucleic acids.
  • the partial duplexes can be prepared by standard recombinant, synthetic or PCR techniques, or a combination thereof.
  • the partial duplexes, or portions thereof such as the target or reference sequence can be isolated from natural sources. Exemplary methods of preparing sequences that are capable of forming partial duplexes are described in U.S. Patent No. 6,013,439, which is hereby incorporated by reference in its entirety.
  • FIG. 1 illustrates the preparation of partial duplexes A', A", B' and B" by PCR.
  • Partial duplexes such as A' and B" can be used to detect a difference between a target sequence and a reference sequence.
  • A can be a target sequence and B a reference sequence, or vice versa.
  • duplex A and B are amplified, either separately or jointly, by standard PCR using a common set of primers made up of one or more forward primers and two reverse primers Rl & R2.
  • forward primer FI or forward primer F2 can be used in the PCR reaction. If forward primer FI is used, duplexes with Tl/Tl' tails will be generated such as Al.
  • forward primer F2 duplexes with T2/T2' tails will be generated such as A2.
  • Two forward primers can also be used to generate partial duplexes at the end corresponding to the forward primer. For instance, using forward primers FI and F2 in the same PCR reaction generates sequences that can be used to produce partial duplexes A' and A".
  • a forward primer with no tails can be used to generate a duplex with no tails at the end corresponding to the forward primer.
  • the primers need not be labeled, but that in certain applications the labeling of one or more primers can be desirable.
  • the distance between the binding sites for the forward and reverse primers is at least 1 base pair, preferably in the range of 1 - 600 base pairs or 5 - 600 base pairs, more preferably in the range of 5 - 100 base pairs, depending on the desired purpose of the application and the nature of the polynucleotide of interest.
  • PCR amplification according to the invention involves temperature cycling to denature duplexes, oligonucleotide primer annealing, and primer extension by thermal- stable template dependent nucleotide polymerase.
  • the temperatures for the present method for the amplification by PCR generally range from about 50°C to 100°C, more usually from about 60°C to 95°C. Relatively low temperatures of from about 50°C to 80°C are employed for hybridization steps, while denaturation is carried out at a temperature of from about 80°C to 100°C and extension is carried out at a temperature of from about 70°C to 80°C, usually about 72°C to 74°C.
  • the time period for conducting the method is from about 10 seconds to 10 minutes per cycle and any number of cycles can be used from one to as high as 60 or more, usually 10 to 50, frequently 20 to 45.
  • PCR protocols are known in the art and can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold Spring Harbor Laboratory Press, New York (1989), or arrived at by the skilled artisan without undue experimentation.
  • the PCR amplification employs convergent oligonucleotide primers designed to be complementary to and anneal to sequences flanking the area of the nucleic acids to be amplified.
  • the primers are designed such that the 3' portion is at least 90%, preferably 95%, and most preferably 100% complementary to a portion of the strand to be amplified.
  • the complementary portion of the primer should be long enough to hybridize selectively to the target or reference sequence under the primer annealing conditions employed for the reaction.
  • the number of nucleotides in the hybridizable sequence of the primer will be at least 10, preferably at least 15 nucleotides, and more preferably 20 to 50 nucleotides in length.
  • the primer is complementary to the target sequence, such as for example the F primer in FIG. 1.
  • the 5' end of the primer is not complementary to the target, in which case this non-complementary sequence will be incorporated at the end of the resulting amplicon.
  • the non-complementary end can have 1 to 60 or more nucleotides, 5 to 30 nucleotides or, preferably, 8 to 30 nucleotides. It is by means of such primers that the oligonucleotide tails at the end of the partial duplexes are generated.
  • Such primers can also be used to generate amplicon intermediates capable of recognition by a universal primer for the production of the partial duplexes of the invention.
  • the concentration of oligonucleotide primers used in the PCR amplification will be at least as great as the number of copies desired and will usually be in the range of 1 nM to 1 mM, preferably 100 nM to 110 ⁇ M.
  • concentration of oligonucleotide primers used in the PCR amplification will be at least as great as the number of copies desired and will usually be in the range of 1 nM to 1 mM, preferably 100 nM to 110 ⁇ M.
  • For the amplification of genomic DNA about 500nM-1000nM for the forward primers and -250 ⁇ M - 500 ⁇ M for each of the two reverse primers is preferred, i.e, similar to the conditions used to amplify an STS (sequence tagged site).
  • lower primer concentrations are sufficient, for example about 25 nM-250 nM.
  • forward primer F The entire sequence of the forward primer F hybridizes with the template DNA, i.e., both A and B.
  • Fl has a 5 '-end portion (Tl) that does or does not hybridize with the template DNA.
  • F2 has a 5 '-end portion (T2) that does or does not hybridize with the template DNA.
  • Rl has a 5'-end portion (T3) that does not hybridize with the template DNA.
  • R2 has a 5 '-end portion (T4) that is not complementary to and hence does not hybridize with the template DNA.
  • T3 is not related with T4, i.e., the complementary strand of T3 (T3') is not complementary to T4 and the complementary strand of T4 (T4') is not complementary to T3.
  • T4' will not hybridize with T3 under the conditions employed in the method.
  • Multiple rounds of PCR amplification will result in the formation of a number of DNA products, including the component strands of the four tailed partial duplexes A', A", B', B" (FIG. 1).
  • the tailed duplexes are formed by adjusting the temperature of the solution so that the component strands can hybridize to form the desired partial duplexes. Note that a number of other duplexes will also be formed. These unintended products generally do not pose a problem because a sufficient number of partial duplexes are formed under the conditions described above.
  • Each tailed partial duplex A' is comprised of a duplex of two complementary nucleic acid strands of duplex A and, at one end of the duplex, two non-complementary oligonucleotide tails T3' and T4.
  • a and B can be achieved in separate reactions using primers Fl/Rl or F2/R2, as depicted in FIG. 1.
  • the resulting tailed amplification products could then be combined under the appropriate conditions to form partial duplexes A', A", B' and B" (FIG. 1).
  • a and B can be achieved in separate reactions using primers Fl/Rl or F2/R2, as depicted in FIG. 1.
  • the resulting tailed amplification products could then be combined under the appropriate conditions to form partial duplexes A', A", B' and B" (see FIG. 1).
  • a and B can be achieved in separate reactions using primers F, Rl and R2, and the resulting tailed amplification products could then be combined under the appropriate conditions to form partial duplexes A', A", B' and B".
  • a and B could initially be amplified using F and only one of the R primers
  • partial duplexes (A', A", B', B") comprising sequences A and B are brought into contact under conditions where the complementary tails can anneal to one another, thereby initiating the formation of a four- stranded complex (Holliday junction), as depicted in FIG. 1.
  • the resulting complexes CI, C2, C3, C4 are subjected to conditions where branch migration can occur.
  • Branch migration is restricted from proceeding in the direction of the tails, because the tails on a given partial duplex are not complementary to one another, e.g., Tl is not complementary to T2'. However, branch migration can occur in the other direction to the extent that the reference and target sequences are the same.
  • branch migration can proceed to the ends of the strands, resulting in the dissociation of the complex into two duplexes, each comprising one strand from each of the original partial duplexes.
  • branch migration past this point of difference will result in a mismatch in the newly formed duplex.
  • the presence of such a difference will actually block branch migration, resulting in a stabilized Holliday junction complex.
  • the presence of a difference between the two sequences is manifested in the creation of a stabilized Holliday junction that, in the absence of the difference, would resolve into two duplexes.
  • the Holliday junction complexes CI, C2, C3 and C4 are subject to branch migration conditions wherein, because tails Tl and T2 and tails T3 and T4 are different, the branch migration can only proceed away from the tails whose hybridization initiates four- way Holliday complex formation. If there is no mismatch between A and B, the branch migration of complex CI, C2, C3 and C4 can proceed away from the tail all the way to the other end of the partial duplexes. As a result, each of the four Holliday complexes CI, C2, C3 and C4 resolve into duplexes (FIG. 1).
  • branch migration is conducted in the presence of an ion such as Mg* "1" , which enhances the tendency of a mismatch to impede spontaneous DNA migration and hence stabilizes Holliday junction complexes involving such a mismatch.
  • Mg* "1" an ion such as Mg* "1" , which enhances the tendency of a mismatch to impede spontaneous DNA migration and hence stabilizes Holliday junction complexes involving such a mismatch.
  • a preferred concentration range for Mg "1""1" is 1 to 10 mM.
  • stabilization can be achieved by means of other ions, particularly divalent cations such Mh" " or Ca ⁇ , or by a suitable combination of ions.
  • branch migration is achieved by incubation at 65°C for about 20-120 minutes in buffer containing 4mM MgCl 2 , 50mM KC1, lOmM Tris-HCl, PH 8.3 .
  • a description of branch migration conditions suitable for the formation of stabilized Holliday junction as a consequence of a single base mismatch can be found, for example, in Panyutin and Hsieh, (1993) J. Mol. Biol, 230:413- 24, which is hereby incorporated by reference in its entirety.
  • a molecule or molecules with specificity for a Holliday structure is used to detect the presence of a stabilized Holliday structure and thereby the presence of a difference between polynucleotide sequence A and polynucleotide sequence B.
  • the presence of a Holliday structure can be detected with any molecule or molecules known to those of skill in the art to specifically bind Holliday structures.
  • a protein or proteins is used to bind and detect the formation of a stabilized Holliday junction. Many proteins from various organisms have been shown specifically bind to Holliday junctions. Those proteins include but are not limited to: RuvA, RuvC, RuvB, RusA, RuvG of E.
  • coli RuvC provides evidence for conserved mechanism of homologous recombination in Bacteria, Eukarya, and Archaea. Proc ⁇ atl Acad Sci U S A. 96(16):8873-8; Komori K, et al. 2000. Mutational analysis of the Pyrococcus furiosus Holliday junction resolvase Hjc revealed functionally important residues for dimer formation, junction D ⁇ A binding and cleavage activities. J Biol Chem.(September/2000 issue); Sharpies GJ, et al. 1999.
  • Holliday junction processing in bacteria insight from the evolutionary conservation of RuvABC, RecG, and RusA. J bacteriol 181(8);5543-50; Sharpies GJ, et al. 1993. An E. coli RuvC mutant defective in cleavage of synthetic Holliday junctions. Nucleic Acid Research, 21(15): 3359-64. Proteins specifically bound to a Holliday structure can be detected by methods known to those of skill in the art for detecting and/or visualizing proteins. In fact, one advantage of the instant invention is that is allows for the detection of stable Holliday junctions without the use of labeled nucleic acids.
  • At least one Holliday junction-specific binding protein i.e., a protein capable of selectively recognizing and binding a Holliday junction
  • a protein capable of selectively recognizing and binding a Holliday junction is labeled with at least one label and subjected to conditions that allow said protein(s) to bind to a stable Holliday junction such as complex CI , C2, C3 and/or C4.
  • the binding of said proteins to the Holliday junction produces some signal(s) that can be detected, preferably in a quantitative way.
  • Said signals can be used as indicators for the presence and quantity of stable Holliday junctions, and in turn, as indicators for the presence and quantity/ratio of mismatched DNA in DNA polymo ⁇ hism analysis.
  • the instant invention employs at least one labeled protein to detect the Holliday junction.
  • the label can be endogenous to the protein, e.g., the natural fluorescence of a protein resulting from the fluorescence of amino acids such as tryptophan, tyrosine, or phenylalanine, or a protein side-chain capable of reacting in a detectable manner.
  • the label can be attached to the protein, either during translation or post- translationally.
  • Suitable labels include, but are not limited to, fluorescent molecules (including, for example, fluorescein, rhodamine, and fluorescent proteins and peptides such as GFP and GFP variants and analogs), radioactive groups, solid surfaces, oligonucleotides, enzymes, dyes, chemiluminiscent groups, coenzymes, enzyme substrates, ligands, receptors and small organic molecules.
  • fluorescent molecules including, for example, fluorescein, rhodamine, and fluorescent proteins and peptides such as GFP and GFP variants and analogs
  • radioactive groups include, but are not limited to, fluorescent molecules (including, for example, fluorescein, rhodamine, and fluorescent proteins and peptides such as GFP and GFP variants and analogs), radioactive groups, solid surfaces, oligonucleotides, enzymes, dyes, chemiluminiscent groups, coenzymes, enzyme substrates, ligands, receptors and small organic molecules.
  • two or more proteins can be used to detect a stabilized Holliday junction.
  • the two proteins can be the same protein or two different proteins, or domains or subunits of a single protein.
  • the two or more proteins can associate to form a dimer or higher order oligomer, and in some embodiments oligomerization is dependent upon binding to a Holliday junction.
  • the two proteins are labeled with different labels and Holliday- junction-dependent complex formation between these two proteins causes the association of the two labels.
  • the association of the two labels can be used as an indicator for the presence of stable Holliday junctions (FIG. 3).
  • RuvA and RuvC cannot form a RuvC-RuvA complex by themselves in the absence of Holliday junction.
  • both RuvA and RuvC can bind to a Holliday junction simultaneously and form a RuvA-RuvC-Holliday junction complex.
  • Both RuvA and RuvC, as well as many RuvC mutants, have been cloned, over-expressed and purified.
  • RuvA and RuvC are each fused with a different fluorophores capable of serving as a donor/acceptor pair for intermolecular fluorescence resonance energy transfer (FRET).
  • FRET intermolecular fluorescence resonance energy transfer
  • FRET Fluorescence resonance energy transfer between blue-emitting and red-shifted excitation derivatives of green fluorescente protein. Gene 173:13-7; and Furey WS, et al. 1998. Use of fluorescence energy transfer to investigate the conformation of DNA substrates to the Klenow fragment.
  • the invention preferably employs a RuvC mutant that lacks the wild-type form of the enzyme's Holliday junction-specific endonuclease activity but retains the ability to specifically bind Holliday junctions.
  • Such mutants include D7N, E66Q, D138N, D141N, D7N, E66D, D138E, and ruvC51, and are described, for example, in Saito A, et al. 1995. Identification of four acidic amino acids that constitute the catalytic center of the RuvC Holliday junction resolvase. Proc Natl Acad Sci U S A 92:7470-4; and Sha ⁇ les GJ, et al. 1993. An E. coli RuvC mutant defective in cleavage of synthetic Holliday junctions. Nucleic Acid Research, 21(15): 3359-64.
  • the FRET donor and acceptor pair comprise proteins.
  • Particularly suitable proteins include Green Fluorescent Proteins (GFPs) and GFP mutants possessing the appropriate excitation and emission frequencies, some of which are described in the preceding references, e.g., Heim R., supra; Foerster T., supra; Mitra RD, et al., supra; and Furey WS, et al., supra.
  • GFPs Green Fluorescent Proteins
  • intra-molecular FRET can be exploited to detect the presence/quantity of Holliday junctions (FIG. 4).
  • the single Holliday junction-binding protein can be double-labeled with two fluorophores, e.g., two GFP mutants that serve as an intra-molecular donor/acceptor FRET pair.
  • the single protein used is RuvC, more preferably one of the aforementioned RuvC mutants.
  • the double- labeled protein undergoes a conformational change upon binding to a Holliday junction, which results in a change in the physical relationship between the two fluorophores and hence a change in FRET signal.
  • a solid surface can act as the label, such as the surface of an optical biosensors, e.g., Biacore or Iasys.
  • optical biosensors are described, for example, in Canziani G, et al. 1999. Exploring biomolecular recognition using optical biosensors. Methods 19(2): 253-69.
  • a molecule capable of binding a Holliday junction preferably including a protein as discussed above, is immobilized on the surface of the biosensor.
  • the binding of a Holliday junction to the immobilized protein is able to produce a detectable optical signal.
  • the signal can be recorded by the biosensors as an indication of the presence and quantity of stable Holliday junctions.
  • a single label i.e., the biosensor surface
  • the biosensor surface is sufficient for the detection of Holliday junctions.
  • One advantage of this embodiment of the invention is that neither the polynucleotides forming the Holliday junction nor the Holliday junction binding molecules need to be labeled.
  • Luminescent oxygen channeling immunoassay Measurement of particle binding kinetics by chemiluminescence. Proc Natl Acad Sci U S A 91 :5426-30.
  • detection of the binding of a Holliday-junction binding protein to a Holliday junction can be accomplished by means of an ELISA assay.
  • ELISA assays are well known in the art, and are described, for example, in U.S. Patent No. 6,013,439 and Sambrook et al., supra.
  • the mixture that results from subjecting the four-way complexes to branch migration conditions is separated by gel electrophoresis.
  • stabilized Holliday structures can be detected by gel electrophoresis under the appropriate conditions. The presence of a stabilized Holliday structure identified by gel electrophoresis indicates the presence of a difference between the target and reference sequences.
  • the gel electrophoresis conditions should be chosen so that a stabilized Holliday structure can be resolved from other complexes in the mixture such as duplexes, partial duplexes and single stranded polynucleotides.
  • the actual conditions for gel electrophoresis depend on the size and identity of polynucleotide sequences and the partial duplexes. Such conditions will be apparent to those of skill in the art. For instance, when the target and reference sequence are about 35 - 300 bp in length and corresponding partial duplexes are about 50 - 300 bp in length, a stabilized Holliday structure can be resolved in a 4%-6% TBE-PAGE gel at 160V for 30*.
  • the stabilized Holliday junction is detected by separating the stabilized Holliday junction from other molecules in the mixture such as duplexes and single stranded polynucleotides.
  • the stabilized Holliday junction may be separated from duplex DNA and isolated by means of gel electrophoresis, capillary electrophoresis, chromatography (including affinity chromatography using columns coated with Holliday-Structure-specifically binding proteins such as those described in detail above).
  • a set of PCR primers (Fl, F2, Rl, and R2) can be designed for each SNP position.
  • DNA fragments (partial duplexes) obtained by PCR using the individual's genomic DNA can be regarded as the target DNA.
  • DNA fragments (partial duplexes) of known genotype obtained by using the same set of primers are regarded as the reference DNA. Therefore, there will be two reference DNA (partial duplexes) for each SNP.
  • the target DNA (partial duplex) at each SNP position is mixed and compared with corresponding two versions of reference DNA (partial duplex), one at a time, by undergoing Holliday junction formation branch-migration. After PCR/Branch Migration, the resulting mixtures at multiple (1- millions) SNP positions are pooled together.
  • the pooled DNA is then subjected to conditions (e.g.: gel/capillary electrophoresis, chromotography) that will allow the separation/isolation of Holliday structures.
  • conditions e.g.: gel/capillary electrophoresis, chromotography
  • Holliday junctions can be separated from duplex DNA by gel electrophoresis or capillary electrophoresis. The band containing Holliday junction DNA can then be identified and isolated. DNA from the band containing Holliday junctions can then be eluted/purified from the gel band.
  • the pool comprised of Holliday junctions can be isolated by chromatography.
  • solid surface e.g.: columns, filters, plasticsituated coated/conjugated with a Holliday structure specifically binding protein(s) can be used to isolate/purify Holliday junctions.
  • the existence of DNA fragments of a specific SNP in the purified pool comprised of Holliday junction indicates that the target DNA of that SNP is different from the reference DNA it has been compared with. Or, in other words, the diploid genomic DNA used for generating the target DNA at that specific SNP position has at least one copy of the SNP version that is different from the version of the reference DNA used.
  • any method that allows the resolution of the identity of the DNA fragments comprising the isolated/purified pool of Holliday junctions can be used for SNP scoring.
  • Many proteins from various organisms have been shown specifically bind a Holliday junction, and are described in detail above.
  • DNA hybridization can be used for the resolution of the identity of the DNA fragments comprising the isolated/purified pool of Holliday junctions.
  • the DNA comprising the isolated Holliday structures can be labeled and used as probes to hybridize with DNA fragments/oligos immobilized on SNP-chips/Micro-arrays for SNP scoring.
  • a positive hybridization signal for a specific SNP on the chip/microarray means that the diploid genomic DNA used for generating the target DNA at that specific SNP position has at least one copy of the SNP version that is different from the version of the reference DNA used.
  • FIG. 5 a method for genotyping multiple polymo ⁇ hic positions is illustrated in FIG. 5.
  • a target DNA is amplified with four forward primers (F/Rl, F/R2, F/R3 and F/R4) and one reverse primer.
  • the four forward primers F/Rl, F/R2, F/R3 and F/R4 comprise a polynucleotide sequence F that complements the target DNA and one of four tail sequences Tl, T2, T3 and T4.
  • the reverse primer comprises a polynucleotide sequence that complements the target DNA and an optional universal tail UT.
  • PCR is carried out as described above to yield target partial duplexes.
  • the forward and reverse primer are chosen so that the resulting partial duplexes include a polymo ⁇ hism of interest in the target DNA.
  • a reference DNA corresponding to the target DNA and comprising a known sequence at the polymo ⁇ hism is amplified with the same primers to yield reference partial duplexes.
  • the target duplexes and reference duplexes are mixed under conditions in which four-way structures are capable of forming and in which branch migration can occur.
  • Stabilized Holliday structures can be isolated according to any of the methods described above. Isolation of a Holliday structure indicates a difference between the target sequence and the reference sequence.
  • the hybridization can be carried out with, for example, a gene chip, an array of oligonucleotides or labeled beads coated with the oligonucleotides.
  • the presence of a detectable hybridization signal indicates that a particular target DNA differs from its corresponding reference DNA. For instance, hybridization of recovered polynucleotides to oligonucleotides corresponding to tails T5, T6, T7 and T8 indicates that the second target DNA differed from its corresponding reference DNA.
  • the same detection apparatus e.g., gene chip, an array of oligonucleotides or labeled beads coated with the oligonucleotides
  • the detection apparatus is specific for the tails corresponding to the PCR primers used in the above method, not for the target DNA.
  • the present invention provides methods and reagents for resolving four- way complexes on solid substrates.
  • One polynucleotide of a partial duplex corresponding to a polynucleotide sequence is immobilized on a solid support and contacted with other polynucleotides from under conditions in which a four-way complex can form and in which branch migration can occur.
  • the sequence can be, for example, a target sequence which forms a four-way complex with a nucleic acid that corresponds to a reference sequence, or vice versa. If the target sequence and reference sequence are identical, then branch migration goes to completion and one duplex is released from the solid surface.
  • duplexes for example Al
  • the mixture of duplexes A2/B1/B2 is added to immobilized duplex Al followed by branch migration conditions so that partial duplexes A', A", B', B" can form transient Holliday structures (FIGS. 6 A and 6B). If there a mismatch/difference between A and B will the transient Holliday structure become a stabilized Holliday structure/junction (FIG. 6B). When there is no difference between A and B, the transient Holliday structure/junction will resolve into duplexes (FIG. 6A).
  • one of the duplexes for example Al
  • Al is then denatured and hybridized with A2 to form partial duplexes A' and A" immobilized on the solid substrate (FIGS. 6A and 6B).
  • a mixture of Bl and B2, preferably at a 1 : 1 ration, is then subject to boiling/denaturing conditions and then reannealing conditions to form partial duplexes B' and B" form in the mixture (FIGS. 6A and 6B).
  • the B1/B2 mixture that contains B' and B" partial duplexes is then added to the solid substrate with the immobilized A' and A" partial duplexes.
  • the resulting mixture is then subject to branch migration conditions so that partial duplexes A', A", B', B" can form transient Holliday structures (FIGS. 6A and 6B).
  • a and B partial duplexes A', A", B', B" can form transient Holliday structures.
  • the transient Holliday structure/junction will quickly resolve into duplexes (FIG. 6A).
  • Any unbound material is then optionally washed from the solid substrate using PCR/Branch migration buffer or any buffer that will not disrupt Holliday structures. Only when there is a mismatch/difference between A and B will stable four- way Holliday structure form on the glass surface that will not be washed away (FIG. 6B).
  • Reagents are then added to the solid substrate that can not only specifically bind to Holliday structure but can also be detected directly or indirectly.
  • Said reagents include but not limited to GFP (or other fluorescence) labeled Holliday-junction-specifically-binding proteins such as RuvC, RuvA, RusA and their homologues, and other such reagents described in detail above. Any reagents not specifically bound to the surface are then optionally washed. The specifically bound reagent(s) are then detected and/or quantitated by methods appropriate for the reagent. Such methods are described in detail above. Specifically bound reagents indicate the presence of a stabilized Holliday structure on the solid substrate and thereby a difference between A and B.
  • Any genetic variation, including SNPs, involves at least two possible versions for each variable position within a DNA sequence. To determine which versions a target DNA sample (either diploid or haploid) has at a particular variable position, the target DNA sequence(s) are compared with each reference DNA sequences representing all possible versions of variations at that variable position. It is known that DNA variations exist in forms other than SNPs. Not only can this invention detect SNPs, but also, polymo ⁇ hisms involving multiple bases, multi-base-paired deletions, insertions and mis-sense mutations.
  • genotyping by means of SNPs will be used to illustrate, and not limit, an application of this invention to determine the genotypes of various genetic variations of diploid individuals, such as humans.
  • the target DNA is amplified from the genomic DNA in question.
  • two reference DNA (A or B) is amplified from either two reference genomic DNA samples (A/A or B B) or from cloned DNA fragments containing the two reference DNA sequences (A or B). All three DNA samples are amplified by PCR with two common sets of unlabeled primers under standard PCR conditions.
  • LF is preferably ⁇ 10bp away from the SNP position.
  • LR1 and LR2 share the same 3 '-end portion (LR) that hybridizes to the target sequence at the right side of the SNP position in question.
  • LR1/LR2 is designed in such a way that it should be at minimum distance from the SNP position in question as far as the feasibility of the PCR amplification is concerned.
  • the 3' end of LR1/LR2 preferably corresponds to the base pair next to the SNP position in question.
  • RF hybridizes to the target sequence at the left side of the SNP position in question.
  • RF is designed in such a way that it should be at minimum distance from the SNP position in question as far as the feasibility of the PCR amplification is concerned.
  • the 3' end of RF preferably corresponds to the base pair next to the SNP position in question.
  • LR1 and LR2 share the same 3 '-end portion (RR) that hybridizes to the target sequence at the right side of the SNP position in question.
  • RR1/RR2 is designed in such a way that it should be at minimum distance from the SNP position in question as far as the feasibility of the PCR amplification is concerned.
  • the 3' end of RR1/RR2 should generally be between 5 and 500 bps, and preferably less than 10 bp.
  • Amplicon L(X/X) is mixed separately at 1 :1 ratio with amplicon L(A/A) and amplicon L(B/B) to form mixture L(X/X)/(A/A) and L(X/X)/(B/B).
  • Amplicon R(X/X) is mixed separately at 1 : 1 ratio with amplicon R(A/A) and amplicon R(B/B) to form mixture R(X/X)/(A/A) and R(X/X)/(B/B).
  • Holliday structures can be formed from polynucleotides with differing sequences.
  • the stabilized Holliday structures can be detected by gel electrophoresis according to the methods of the present invention.
  • Five regions of human genomic DNA that contain known single-nucleotide polymo ⁇ hisms (SNPs) were PCR-amplified using tailed reverse primers to allow the formation of Holliday junctions.
  • the sequence of these regions, the location and identity of the respective SNPs within them and the sequences of the primers can be found in the National Center for Biotechnology Information (NCBI) SNP database.
  • NCBI assay LD's of the SNPs used were as follows: 4215, 4217, 4213, 4141 and 4212.
  • Genomic DNA samples from the M08PDR panel (the smallest subset of the Human Polymo ⁇ hism Discovery Resource panel containing eight individual DNA samples) were purchased from Coriell Cell Repository (Camden, NJ). Two genomic DNA samples were amplified for each SNP, one homozygote and one heterozygote. The genotypes of these samples are described in Lishanski, 2000, Clinical Chemistry 46 (9), 1464-1470.
  • the primer sequences for amplifying genomic DNA were as follows.
  • Rt2 5'- GATCCTAGGCCTCACGTATTGTAAACTTTCTGAGCCTCTGG -3 ' (SEQ ID NO: 3)
  • Rtl 5 '- ACCATGCTCGAGATTACGAGGGTTTGCTGGAAGAAAGCAG -3 ' (SEQ ID NO: 5)
  • Rt2 5'- GATCCTAGGCCTCACGTATTCTGAATACTCTCCATCCTTGCC -3 ' (SEQ ID NO: 9)
  • Rtl 5'- ACCATGCTCGAGATTACGAGGGGGTCTCTGCAGTTAACCA -3' (SEQ ID NO: 11)
  • Rt2 5'- GATCCTAGGCCTCACGTATTGGGGTCTCTGCAGTTAACCA -3 ' (SEQ ID NO: 12)
  • Rtl 5'- ACCATGCTCGAGATTACGAGAATATGCAAAGTAATTTTCTGGCC -3 ' (SEQ LD NO: 14)
  • Rt2 5'- GATCCTAGGCCTCACGTATTAATATGCAAAGTAATTTTCTGGCC -3 ' (SEQ LD NO: 15) where F is the forward PCR primer, R is the reverse PCR primer, tl and t2 are the "tail" sequences (underlined) that are common for all 5 amplicons.
  • the forward and reverse primer sequences are published in NCBI SNP database.
  • PCR amplifications were carried out using a PTC-200 DNA Engine thermocycler (MJ Research Inc., Waltham, MA). 35 PCR cycles were performed with 10 s denaturation at 94°C, 15 s reannealing at 62°C and 45 s extension at 72°C. The cycling was preceded by a 10-min incubation at 95°C to activate AmpliTaq GoldTM DNA polymerase (Applied Biosystems, Foster City, CA) and followed by 2 min of denaturation at 95°C and 30-min incubation at 65°C (reannealing and branch migration).
  • the reaction mixtures (100 ⁇ l) contained 100 ng genomic DNA, 2.5 U AmpliTaq GoldTM DNA polymerase, 200 ⁇ M each dNTP and 250 nM each primer in the commercial AmpliTaq buffer (10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl 2 , 0.01 % gelatin).
  • the relatively faint slowly moving bands are present only in the samples heterozygous for each SNP, when there is a single-base sequence difference between the two alleles. Slower bands correspond to longer amplicons.
  • a serial dilution experiment (not shown) demonstrated that the amount of DNA in these bands is approximately equal to the expected amount of unresolved Holliday junctions (1/16 of the total material).
  • the slowly moving bands disappear upon digestion with the wild type E.coli RuvC protein that is a Holliday junction-specific endonuclease (not shown). Based on this evidence, the slowly moving band clearly represents the unresolved Holliday junctions and is, therefore, indicative of the presence of two alternative alleles in genomic DNA.
  • RuvA and RuvC proteins are part of the multi-subunit RuvABC complex that promotes homologous genetic recombination by resolving Holliday junctions. Shinagawa and Iwasaki, 1996 Trends In Biological Sciences 21, 107-111; Eggleston and West, 2000, J.Biol.Chem. 275, 26467-26476. Their binding to synthetic Holliday junctions in vitro is well studied. Davies and West, 1998, Current Biology 8, 725-727; Whitby et al., ! 1996, LMoLBiol. 264, 878-890.
  • the 22kDa RuvA protein exists in solution as a homotetramer and binds specifically to synthetic Holliday junctions either as a tetramer or an octamer, depending on the protein concentration.
  • the 19 kDa RuvC protein is a Holliday junction-specific endonuclease or a resolvase that binds to Holliday junctions as a dimer, cleaves them and initiates their resolution.
  • Several mutants of RuvC protein have been isolated that retain their specific binding activity but lack the endonuclease activity. Saito et al., 1995, Biochemistry 92, 7470-7474.
  • Recombinant Ruv A and RuvC (D7N mutant) proteins that were expressed and purified from E.coli were provided by Dr. Hideo Shinagawa (Osaka University, Japan).
  • PCR amplification and branch migration of selected samples from M08PDR panel were conducted as described in Example 1.
  • SNPs 3989 and 4216 two more SNPs were included in the experiments: SNPs 3989 and 4216.
  • the following sets of primers were used: SNP 3989
  • Rtl 5'- ACCATGCTCGAGATTACGAGT ⁇ GGCTTTCATCTTCCCC-3' (SEQ ID NO: 17)
  • Rt2 5'- GATCCTAGGCCTCACGTAT rrTGGCTTTCATCTTCCCC -3 ' (SEQ JD NO: 18)
  • Rtl 5'- ACCATGCTCGAGATTACGAGATGTTTTATGTGGAGAGGTATCTGC -3 ' (SEQ ID NO: 20)
  • Rt2 5'- GATCCTAGGCCTCACGTAT ⁇ ATGTTTTATGTGGAGAGGTATCTGC -3 ' (SEQ ID NO: 21)
  • RuvC was demonstrated by probing the Holliday structure with antisera against the two proteins (provided by Dr. Hideo Shinagawa, Osaka University, Japan).
  • the membrane was incubated in 10 ml of 1 : 1000 dilution of hnmunoPureTM goat anti-rabbit IgG (alkaline phosphatase conjugate) in 1% blocking solution for 30 min. The membrane was again washed in four 20 ml changes of 1 X TBST, 5-10 min each wash.
  • the substrate solution for alkaline phosphatase was prepared by adding 44 ⁇ l of 75 mg/ml Nitroblue Tetrazolium Chloride (NBT) and 33 ⁇ l of 5-Bromo-4- chloro-3-indolylphosphate p-Toluidine Salt (BCLP) to 10 ml of 0.1 M Tris-HCl, pH 9.5, 0.1
  • Lane 1 provides heterozygous PCR product + RuvA
  • Lane 2 provides heterozygous PCR product + RuvC (mutant) and Lane 3 provides heterozygous PCR product + (RuvA + RuvC).
  • Panel I provides the gel stained with SYBR Gold
  • Panel II mrovides the membrane probed with anti-RuvC antibody
  • Panel III provides the membrane reprobed with anti-RuvC antibody. Staining with the anti-RuvC antibody is still visible in Lane 2 of Panel III.
  • stabilized Holliday junction structures if any, are contacted with biotinylated RuvA (b-RuvA) and unlabeled mutant RuvC.
  • the complexes are then contacted with antiserum (for instance, mouse or rabbit) specific for RuvC.
  • antiserum for instance, mouse or rabbit
  • the resulting complexes are contacted with donor beads coated with streptavidin and acceptor beads coated with anti-mouse or anti-rabbit IgG, as appropriate.
  • the mixture is then illuminated with laser light at 680 nm, which produces singlet oxygen in a photosensitizer in the donor bead. Singlet oxygen induces chemiluminescence in the compound in the acceptor bead. Signal is observed if stabilized Holliday structures were formed because of a difference between the reference polynucleotide and the target polynucleotide. In the absence of Holliday junctions (no inhibition of branch migration) no signal is observed.
  • This example deomonstrates that two molecules of the same protein can be individually labeled with different labels and used for the detection of differences between a target polynucleotide and a reference polynucleotide.
  • PCR products are prepared as described in Examples 1-4 and subject to branch migration conditions. Stabilized Holliday structures, if any, are contacted with b-RuvA and f-RuvA. The resulting mixture is then contacted with donor beads coated with streptavidin and acceptor beads coated with anti-fluorescein antibody. The interaction of the donor beads and acceptor beads is detected as described in Example ⁇ 4. The presence of a donor-acceptor signal indicates a difference between the target sequence and the reference sequence.
  • RuvA in one tetramer is labeled with a donor member of a FRET pair, e.g. fluorescein, and RuvA in the second tetramer is labeled with a corresponding acceptor member, such as tetramethylrhodamine or QSY 7 dye (Molecular Probes, Eugene Oregon).
  • PCR products are prepared as described in Examples 1-4 and subject to branch migration conditions.
  • Stabilized Holliday structures, if any, are contacted with both labeled RuvA tetramers. After binding, the donor fluorophore is excited with an appropriate wavelength using a spectrofluorometer and FRET is detected by the appearance of sensitized fluorescence of the acceptor.
  • FRET pairs other pairs of molecules that specifically interact with a Holliday are labeled with FRET pairs.
  • RuvA and mutant RuvC are labeled with two different fluorescent dyes that constitute a FRET pair, and their assembly on Holliday junctions is detected.
  • This example provides another sensitive and efficient method for detecting differenences between polynucleotide sequences.
  • the method in this Example is based on Bioluminescence Resonance Energy Transfer (BRET; Packard BioScience, Meriden CT).
  • BRET Bioluminescence Resonance Energy Transfer
  • energy transfer from a bioluminescent donor luciferase to an acceptor GFP is detected.
  • PCR products are prepared as described in Examples 1-6 and subject to branch migration conditions. Stabilized Holliday structures, if any, are contacted with both a RuvA fused to luciferase and a RuvA fused to GFP. Fusions of RuvA with luciferase and GFP, respectively, are prepared with commercially available cloning and expression vectors.).
  • the donor fluorophore After binding, the donor fluorophore is excited with an appropriate wavelength using a spectrofluorometer and BRET is detected by the appearance of sensitized fluorescence of the acceptor. No excitation light source is required for the detection of the BRET signal. The presence of the BRET signal indicates a difference between the polynucleotide sequences.
  • RuvA and mutant RuvC can be fused to luciferase and GFP, respectively (or vice versa), and their assembly on Holliday junctions detected by BRET.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des méthodes permettant de détecter la présence ou l'absence d'une différence entre deux séquences d'acides nucléiques apparentées. Lesdites méthodes consistent à mettre en contact un acide nucléique cible et un acide nucléique de référence dans des conditions où ils peuvent former un complexe d'acide nucléique à quatre branches possédant une structure susceptible de migrations. Dans ces conditions de contact, si l'acide nucléique de référence et l'acide nucléique cible sont identiques, la migration entre les branches peut s'effectuer jusqu'à son terme et résulter en un échange de brins complet. Si l'acide nucléique de référence et l'acide nucléique cible sont différents, la migration entre les branches n'arrive pas à son terme, ce qui entraîne la création d'un complexe à quatre branches stable. Pour identifier la présence d'une différence entre les acides nucléiques, on utilise ledit complexe à quatre branches stable. Ledit complexe à quatre branches stable peut également être détecté à l'aide de molécules se liant spécifiquement à ces complexes, soit par électrophorèse sur gel soit par isolement spécifique du complexe à quatre branches stable.
EP01918574A 2000-03-11 2001-03-12 Methodes de detection des differences entre acides nucleiques Withdrawn EP1266202A4 (fr)

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
US18866900P 2000-03-11 2000-03-11
US188669P 2000-03-11
US22888500P 2000-08-29 2000-08-29
US228885P 2000-08-29
US23422900P 2000-09-21 2000-09-21
US234229P 2000-09-21
US23436300P 2000-09-22 2000-09-22
US234363P 2000-09-22
US24277000P 2000-10-23 2000-10-23
US24284000P 2000-10-23 2000-10-23
US242840P 2000-10-23
US242770P 2000-10-23
PCT/US2001/007858 WO2001069200A2 (fr) 2000-03-11 2001-03-12 Methodes de detection des differences entre acides nucleiques

Publications (2)

Publication Number Publication Date
EP1266202A2 EP1266202A2 (fr) 2002-12-18
EP1266202A4 true EP1266202A4 (fr) 2005-11-09

Family

ID=27558796

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01918574A Withdrawn EP1266202A4 (fr) 2000-03-11 2001-03-12 Methodes de detection des differences entre acides nucleiques

Country Status (6)

Country Link
EP (1) EP1266202A4 (fr)
JP (1) JP2003527119A (fr)
CN (1) CN1191374C (fr)
AU (2) AU2001245634B2 (fr)
CA (1) CA2402483A1 (fr)
WO (1) WO2001069200A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009093667A1 (fr) * 2008-01-22 2009-07-30 Hiroshima University Procédé et kit de dosage de protéine de liaison à l'acide nucléique

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997023646A1 (fr) * 1995-12-22 1997-07-03 Behringwerke Aktiengesellschaft Detection de differences dans les acides nucleiques
WO1999036574A1 (fr) * 1998-01-20 1999-07-22 Mayo Foundation For Medical Education And Research Detection simplifiee des mutations

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2188660C (fr) * 1994-04-25 2005-01-18 Richard G. H. Cotton Detection de mutations par clivage par resolvase
US5824471A (en) * 1995-06-05 1998-10-20 Brigham And Women's Hospital Detection of mismatches by cleavage of nucleic acid heteroduplexes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997023646A1 (fr) * 1995-12-22 1997-07-03 Behringwerke Aktiengesellschaft Detection de differences dans les acides nucleiques
WO1999036574A1 (fr) * 1998-01-20 1999-07-22 Mayo Foundation For Medical Education And Research Detection simplifiee des mutations

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BHATTACHARYYA A ET AL: "MODEL FOR THE INTERACTION OF DNA JUNCTIONS AND RESOLVING ENZYMES", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 221, no. 4, 1991, pages 1191 - 1207, XP000612384, ISSN: 0022-2836 *
BOLT E L ET AL: "Identification of three aspartic acid residues essential for catalysis by the RusA holliday junction resolvase", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 286, no. 2, 19 February 1999 (1999-02-19), pages 403 - 415, XP004459761, ISSN: 0022-2836 *
DAVIES ADELINA A ET AL: "Formation of RuvABC-Holliday junction complexes in vitro", CURRENT BIOLOGY, vol. 8, no. 12, 4 June 1998 (1998-06-04), pages 725 - 727, XP002339439, ISSN: 0960-9822 *
FRAPPIER L ET AL: "CHARACTERIZATION OF THE BINDING SPECIFICITY OF TWO ANTICRUCIFORM DNA MONOCLONAL ANTIBODIES", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 264, no. 1, 1989, pages 334 - 341, XP002339441, ISSN: 0021-9258 *
ICHIYANAGI KENJI ET AL: "Mutational analysis on structure-function relationship of a Holliday junction specific endonuclease RuvC", GENES TO CELLS, vol. 3, no. 9, September 1998 (1998-09-01), pages 575 - 586, XP002339440, ISSN: 1356-9597 *

Also Published As

Publication number Publication date
WO2001069200A3 (fr) 2002-03-14
EP1266202A2 (fr) 2002-12-18
CA2402483A1 (fr) 2001-09-20
CN1191374C (zh) 2005-03-02
JP2003527119A (ja) 2003-09-16
CN1429277A (zh) 2003-07-09
WO2001069200A2 (fr) 2001-09-20
AU2001245634B2 (en) 2005-10-06
AU4563401A (en) 2001-09-24

Similar Documents

Publication Publication Date Title
US6653079B2 (en) Methods for detection of differences in nucleic acids
EP1427847B1 (fr) Methodes et compositions de generation de copies multiples de sequences d'acides nucleiques et methodes de detection correspondantes
US6815164B2 (en) Methods and probes for detection and/or quantification of nucleic acid sequences
US6830884B1 (en) Method of amplification
US7371580B2 (en) Use of unstructured nucleic acids in assaying nucleic acid molecules
US20080051568A1 (en) Capture moieties for nucleic acids and uses thereof
US9617587B1 (en) Isothermal amplification components and processes
CA2725405A1 (fr) Procedes et dosages pour la capture d'acide nucleiques
EP1151136A1 (fr) Methode pour detecter des nucleotides alleliques par amplification multiplex arms
US20100112556A1 (en) Method for sample analysis using q probes
Liu et al. A novel single nucleotide polymorphism detection of a double-stranded DNA target by a ribonucleotide-carrying molecular beacon and thermostable RNase HII
US6821733B2 (en) Methods and compositions for detecting differences between nucleic acids
CA2394800A1 (fr) Procede d'amplification d'une sonde d'acide nucleique circularisee
US20070148636A1 (en) Method, compositions and kits for preparation of nucleic acids
AU2001245634B2 (en) Methods for detection of differences in nucleic acids
US20030235827A1 (en) Methods and compositions for monitoring primer extension and polymorphism detection reactions
US20040235004A1 (en) Methods for detection of differences in nucleic acids
AU2001245634A1 (en) Methods for detection of differences in nucleic acids
US6878530B2 (en) Methods for detecting polymorphisms in nucleic acids
US20030129598A1 (en) Methods for detection of differences in nucleic acids
Buzdin DNA hybridization in solution for Mutation Detection
WO2002024960A1 (fr) Detection de la variation d'adn

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020913

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: PANOMICS, INC.

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12Q 1/68 A

A4 Supplementary search report drawn up and despatched

Effective date: 20050927

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061003