EP1257651A2 - Nucleic acids of the human abc1 gene and applications thereof - Google Patents

Nucleic acids of the human abc1 gene and applications thereof

Info

Publication number
EP1257651A2
EP1257651A2 EP00975997A EP00975997A EP1257651A2 EP 1257651 A2 EP1257651 A2 EP 1257651A2 EP 00975997 A EP00975997 A EP 00975997A EP 00975997 A EP00975997 A EP 00975997A EP 1257651 A2 EP1257651 A2 EP 1257651A2
Authority
EP
European Patent Office
Prior art keywords
seq
nucleotides
nucleic acid
complementary
polynucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00975997A
Other languages
German (de)
French (fr)
Inventor
Patrice Denefle
Marie-Françoise Rosier-Montus
Isabelle Arnould-Reguigne
Catherine Prades
Laurent Naudin
Cendrine Lemoine
Nicolas Duverger
Michael Jaye
George H. Searfoss, Iii
Alan Remaley
H. Bryan Brewer
Michael Dean
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharma SA
Original Assignee
Aventis Pharma SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Pharma SA filed Critical Aventis Pharma SA
Priority to EP00975997A priority Critical patent/EP1257651A2/en
Publication of EP1257651A2 publication Critical patent/EP1257651A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to nucleic acids corresponding to the various exons and introns of the ABCl gene, which is a causal gene for pathologies linked to a cholesterol metabolism dysfunction inducing diseases such as arteriosclerosis, more particularly disruption in the reverse transport of cholesterol, and more particularly familial HDL deficiencies (FHD), such as Tangier disease.
  • the present invention also relates to ABCl cDNAs encoding the novel full length ABCl protein.
  • the invention also relates to means for the detection of polymo ⁇ hisms in general, and of mutations in particular, in the ABCl gene or in the corresponding protein produced by the allelic form of the ABCl gene.
  • Lipids are water-insoluble organic biomolecules, which are essential components of diverse biological functions, including the storage, transport, and metabolism of energy, and membrane structure and fluidity. Lipids are derived from two sources in humans and other animals: some lipids are ingested as dietary fats and oils and other lipids are biosynthesized by the human or animal. In mammals at least 10% of the body weight is lipid, the bulk of which is in the form of triacylglycerols.
  • Triacylglycerols also known as triglycerides and triacylglycerides, are made up of three fatty acids esterif ⁇ ed to glycerol. Dietary triacylglycerols are stored in adipose tissues as a source of energy, or hydrolyzed in the digestive tract by triacylglycerol Upases, the most important of which is pancreatic lipase. Triacylglycerols are transported between tissues in the form of lipoproteins.
  • Lipoproteins are micelle-like assemblies found in plasma and contain varying proportions of different types of lipids and proteins (called apoproteins).
  • apoproteins There are five main classes of plasma lipoproteins, the major function of which is lipid transport. These classes are, in order of increasing density, chylomicrons, very low density lipoproteins (VLDL), intermediate-density lipoproteins (IDL), low density lipoproteins (LDL), and high density lipoproteins (HDL).
  • VLDL very low density lipoproteins
  • IDL intermediate-density lipoproteins
  • LDL low density lipoproteins
  • HDL high density lipoproteins
  • triacylglycerols are transported in chylomicrons, VLDL, and IDL; while phospholipids and cholesterol esters are transported in HDL and LDL respectively.
  • Phospholipids are di-fatty acid esters of glycerol phosphate, also containing a polar group coupled to the phosphate. Phospholipids are important structural components of cellular membranes. Phospholipids are hydrolyzed by enzymes called phospholipases.
  • Phosphatidylcholine an exemplary phospholipid, is a major component of most eukaryotic cell membranes.
  • Cholesterol is the metabolic precursor of steroid hormones and bile acids as well as an essential constituent of cell membranes. In humans and other animals, cholesterol is ingested in the diet and also synthesized by the liver and other tissues. Cholesterol is transported between tissues in the form of cholesteryl esters in LDLs and other lipoproteins. Membranes surround every living cell, and serve as a barrier between the intracellular and extracellular compartments. Membranes also enclose the eukaryotic nucleus, make up the endoplasmic reticulum, and serve specialized functions such as in the myelin sheath that surrounds axons. A typical membrane contains about 40% lipid and 60% protein, but there is considerable variation.
  • the major lipid components are phospholipids, specifically phosphatidylcholine and phosphatidylethanolamine, and cholesterol.
  • the physicochemical properties of membranes can be changed by modification of either the fatty acid profiles of the phospholipids or the cholesterol content. Modulating the composition and organization of membrane lipids also modulates membrane-dependent cellular functions, such as receptor activity, endocytosis, and cholesterol flux.
  • High-density lipoproteins (HDL) are one of the four major classes of lipoproteins circulating in blood plasma. These lipoproteins are involved in various metabolic pathways such as lipid transport, the formation of bile acids, steroidogenesis, cell proliferation and, in addition, interfere with the plasma proteinase systems.
  • HDLs are perfect free cholesterol acceptors and, in combination with the cholesterol ester transfer proteins (CETP), lipoprotein lipase (LPL), hepatic lipase (HL) and lecithin:cholesterol acyltransferase (LCAT), play a major role in the reverse transport of cholesterol, that is to say the transport of excess cholesterol in the peripheral cells to the liver for its elimination from the body in the form of bile acid. It has been demonstrated that the HDLs play a central role in the transport of cholesterol from the peripheral tissues to the liver.
  • Various diseases linked to an HDL deficiency have been described, including Tangier and/or FHD disease, HDL deficiency, and LCAT deficiency.
  • HDL-cholesterol deficiencies have been observed in patients suffering from malaria and diabetes (Kittl et al., 1992; Nilsson et al., 1990; Djoumessi, 1989; Mohanty et al., 1992; Maurois et al., 1985; Grellier et al., 1997; Agbedana et al., 1990; Erel et al., 1998; Cuisinier et al., 1990; Chander et al., 1998; Efthimiou et al., 1992; Baptista et al., 1996; Davis et al., 1993; Davis et al., 1995; Pirich et al., 1993; Tomlinson and Raper, 1996; Hager and Hajduk, 1997, Kwiterovich, 1995, Syvanne et al., 1995a, Syvanne et al., 1995b, and French et al., 1993).
  • Tangier disease is an autosomal co-dominant condition characterized in the homozygous state by the absence of HDL-cholesterol (HDL-C) from plasma, hepatosplenomegaly, peripheral neuropathy, and frequently premature coronary artery disease (CAD).
  • HDL-C HDL-cholesterol
  • CAD frequently premature coronary artery disease
  • HDL-C levels are about one-half those of normal individuals. Impaired cholesterol efflux from macrophages leads to the presence of foam cells throughout the body, which may explain the increased risk of CAD in some Tangier disease families.
  • Atherosclerosis is defined in histological terms by deposits (lipid or fibrolipid plaques) of lipids and of other blood derivatives in blood vessel walls, especially the large arteries (aorta, coronary arteries, carotid). These plaques, which are more or less calcified according to the degree of progression of the atherosclerotic process, may be coupled with lesions and are associated with the accumulation in the vessels of fatty deposits consisting essentially of cholesterol esters. These plaques are accompanied by a thickening of the vessel wall, hypertrophy of the smooth muscle, appearance of foam cells (lipid-laden cells resulting from uncontrolled uptake of cholesterol by recruited macrophages) and accumulation of fibrous tissue.
  • the atheromatous plaque protrudes markedly from the wall, endowing it with a stenosing character responsible for vascular occlusions by atheroma, thrombosis or embolism, which occur in those patients who are most affected. These lesions can lead to serious cardiovascular pathologies such as infarction, sudden death, cardiac insufficiency, and stroke.
  • Mutations within genes that play a role in lipoprotein metabolism have been identified. Specifically, several mutations in the apolipoprotein apo A-I gene have been characterized. These mutations are rare and may lead to a lack of production of apo A-I. Mutations in the genes encoding LPL or its activator apo C-II are associated with severe hypertriglyceridemias and substantially reduced HDL-C levels. Mutations in the gene encoding the enzyme LCAT are also associated with a severe HDL deficiency.
  • dysfunctions in the reverse transport of cholesterol may be induced by physiological deficiencies affecting one or more of the steps in the transport of stored cholesterol, from the intracellular vesicles to the membrane surface where it is accepted by the HDLs.
  • ABC-1 transporter mutations have been described within the gene encoding the ABC-1 transporter in patients impaired in the reverse transport of cholesterol, and most particularly in patients suffering from Tangier and FHD diseases (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999).
  • the ABC (ATP-binding cassette) transport proteins constitute a family of proteins that are extremely well conserved during evolution, from bacteria to humans.
  • the ABC transport proteins are involved in membrane transport of various substrates, for example ions, amino acids, peptides, sugars, vitamins or steroid hormones.
  • ABC transporters The characterization of the complete amino acid sequence of some ABC transporters has made it possible to determine that these proteins had a common general structure, in particular two nucleotide binding folds (NBF) with Walker A and B type units as well as two transmembrane domains, each of the transmembrane domains consisting of six helices.
  • NBF nucleotide binding folds
  • ABC transport proteins that have been identified in humans are associated with various diseases. For example, cystic fibrosis is caused by mutations in the CFTR (cystic fibrosis transmembrane conductance regulator) gene. Moreover, some multiple drug resistance phenotypes in tumor cells have been associated with mutations in the gene encoding the MDR (multi-drug resistance) protein, which also has an ABC transporter structure. Other ABC transporters have been associated with neuronal and tumor conditions (US Patent No. 5,858,719) or potentially involved in diseases caused by impairment of the homeostasis of metals, such as the ABC-3 protein. Likewise, another transport ABC, designated PFIC2, appears to be involved in a progressive familial intrahepatic cholestasia form, this protein being potentially responsible, in humans, for the export of bile salts.
  • ABCl a cDNA encoding a new mouse ABC transporter was identified and designated ABCl (Luciani et al., 1994). This protein is characteristic of the ABC transporters in that it has a symmetrical structure comprising two transmembrane domains linked to a highly hydrophobic segment and two NBF units.
  • a partial cDNA comprising a 6603 base pair (bp) open reading frame (ORF) of the human ABCl transporter
  • ORF open reading frame
  • the human ABCl protein is predicted to comprise 2201 amino acids (aa), which results in a protein of approximately 220 kDa in size (Ibid.).
  • aa 2201 amino acids
  • This study also showed that the gene encoding this human ABCl protein isoform is expressed in various tissues, and more particularly at high levels in the placenta, the liver, the lungs, the adrenal glands, as well as several fetal tissues.
  • the Applicant has discovered and isolated a human ABCl full length cDNA containing additional sequences in the 5' and 3' UTR (untranslated regions) and encoding a ABCl protein, which presents a longer amino acid sequence as to that of Langmann et al. (1999).
  • Full length human ABCl cDNA was used to investigate the mechanisms of cholesterol and phospholipid efflux, demonstrating specific activity and interactions of the full length ABCl protein with various lipid acceptors to promote cellular lipid efflux.
  • the present invention relates to nucleic acids corresponding to the various exons and introns of the human ABCl gene, which is a causal gene for pathologies linked to a cholesterol metabolism dysfunction inducing diseases such as arteriosclerosis, more particularly disruption in the reverse transport of cholesterol, and familial HDL deficiencies, such as Tangier and/or FHD disease.
  • a first subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ D NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleo
  • the invention also relates to a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11- 16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36,
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucle
  • the invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a polynucleotide of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleot
  • the invention also relates to nucleic acids, particularly cDNA molecules, which encode the full length human ABCl protein.
  • the invention relates to a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in either SEQ ED NO: 69 or SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • nucleic acid hybridizing, under high stringency conditions with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
  • a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70 encodes a full length ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising an amino acid sequence having at least 80% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a polypeptide having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • a polypeptide according to the invention will have a length of 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1 -60 of SEQ ID NO: 71.
  • a polypeptide according to the invention will comprise a fragment having a length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a polypeptide according to the invention, more particularly of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a means for detecting polymo ⁇ hisms in general, and mutations in particular, in the ABCl gene or in the corresponding protein produced by the allelic form of the ABCl gene. It has been recently shown that patients suffering from Tangier and FHD diseases have a mutated ABCl gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, and Marcil et al., 1999b). According to the present invention, several additional mutations distributed in different exons of the ABCl gene have been identified in the genome of various patients, in particular patients suffering from a severe form of the disease associated with cardiovascular disorders.
  • polymo ⁇ hisms have been found in the introns of the ABCl gene in patients suffering from the mildest forms of the disease, indicating that these patients carry particular alleles of the gene, distinct from the "wild-type" allele(s).
  • Such alleles partly characterized by these polymo ⁇ hisms, are likely to contain substitutions, additions or deletions of nucleotides in the noncoding regions located respectively on the 5' side of the first exon or alternatively on the 3' side of the last exon of the gene, in particular in the regulatory regions, for example, in the promoter sequences or alternatively in the enhancer sequences, of the type which induces defects. These defects may result in either an increase or a decrease in the synthesis of the ABCl polypeptide.
  • the invention also relates to a polypeptide encoded by a mutated ABCl gene, and more particularly a mutated ABCl gene in patients suffering from a deficiency in the reverse transport of cholesterol, most particularly in patients suffering from Tangier disease.
  • the invention therefore relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
  • the invention also relates to a polypeptide comprising an amino acid sequence as depicted in any one of SEQ ID NOs: 89-102.
  • another subject of the invention is a nucleic acid encoding a mutated ABCl polypeptide, wherein the nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 72-88, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid encoding a mutated ABCl polypeptide, wherein the nucleic acid comprises a polynucleotide sequence as depicted in any one of SEQ ED NOs: 72-88, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising any one of SEQ ID NOs: 89-102.
  • the invention also relates to the nucleotide sequences of the ABCl gene comprising at least one biallelic polymo ⁇ hism.
  • another subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence comprising any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
  • Nucleotide probes and primers hybridizing with a nucleic acid sequence located in the region of an ABCl nucleic acid (genomic DNA, messenger RNA, cDNA), in particular, a nucleic acid sequence comprising any one of the mutations or polymo ⁇ hisms described above, also form part of the invention.
  • nucleic acid fragments derived from a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides
  • SEQ ED NO: 27 or of a complementary polynucleotide sequence
  • f nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence
  • g nucleotides 1-242 of SEQ ED
  • nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence are useful for the detection of the presence of at least one copy of a nucleotide sequence of the
  • nucleotide probes or primers according to the invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ D NO: 27, or of a complementary polynucleotide
  • nucleotide probes or primers according to the invention will have a length of 10, 12, 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, in particular of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO
  • a nucleotide probe or primer according to the invention will consist of and/or comprise the fragments having a length of 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, more particularly of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO
  • nucleotide probe or primer therefore covers oligonucleotides which hybridize, under the high stringency hybridization conditions defined above, with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ
  • the preferred probes and primers according to the invention comprise all or part of a polynucleotide sequence comprising any one of SEQ ED NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence.
  • the nucleotide primers according to the invention may be used to amplify any one of the nucleic acids according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the nucleotide primers according to the invention may be used to amplify a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the nucleotide primers according to the invention may be used to amplify a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide
  • Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant thereof contained in a sample, said method comprising the steps of: a) bringing the sample in which the presence of the target nucleic acid is suspected into contact with a pair of nucleotide primers whose hybridization position is located respectively on the 5' side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.
  • Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ
  • ED NO: 70 or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, contained in a sample, said method comprising the steps of: a) bringing the sample in which the presence of the target nucleic acid is suspected into contact with a pair of nucleotide primers whose hybridization position is located respectively on the 5' side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.
  • the present invention also relates to a method of detecting the presence of a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence in a sample, said method comprising the steps of:
  • the oligonucleotide probes are immobilized on a support.
  • the oligonucleotide probes comprise a detectable marker.
  • Another subject of the invention is a box or kit for amplifying a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleo
  • box or kit comprising: 1) a pair of nucleotide primers in accordance with the invention, whose hybridization position is located respectively on the 5' side and 3' side of the target nucleic acid whose amplification is sought; and optionally,
  • Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
  • the subject of the invention is, in addition, a box or kit for amplifying all or part of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide
  • Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
  • the invention also relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probes according to the invention; b) where appropriate, reagents necessary for a hybridization reaction.
  • the detection box or kit is characterized in that the nucleotide probe(s) and primer(s)are immobilized on a support.
  • the detection box or kit is characterized in that the nucleotide probe(s) and primer(s) comprise a detectable marker.
  • such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect target nucleic acids of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention.
  • the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary nucleic acid sequence.
  • the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 125 and 126, making it possible to amplify the region of exon 5 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 72 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 127 and 128, making it possible to amplify the region of exon 6 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 73 or 74 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 131 and 132, making it possible to amplify the region of exon 8 of the ABCl gene carrying the mutations as depicted in SEQ ID NOs: 75-77 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 155 and 156, making it possible to amplify the region of exon 27 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 84 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 159 and 160, making it possible to amplify the region of exon 32 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 85 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 175 and 176, making it possible to amplify the region of exon 47 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 87 or 88 described above, or nucleic acids having a complementary polynucleotide sequence.
  • a primer according to the invention comprises, generally, all or part of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a complementary sequence.
  • the invention also relates to a recombinant vector comprising a nucleic acid according to the invention.
  • a recombinant vector will comprise a nucleic acid selected from the group consisting of a) a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1,
  • nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence
  • a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence
  • a nucleic acid having at least eight consecutive nucleotides of a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a
  • a recombinant vector according to the invention is used to amplify a nucleic acid inserted therein, following transformation or transfection of a desired cellular host.
  • a recombinant vector according to the invention corresponds to an expression vector comprising, in addition to a nucleic acid in accordance with the invention, a regulatory signal or nucleotide sequence that directs or controls transcription and/or translation of the nucleic acid and its encoded mRNA.
  • a recombinant vector according to the invention will comprise in particular the following components: (1) an element or signal for regulating the expression of the nucleic acid to be inserted, such as a promoter and/or enhancer sequence;
  • nucleic acid comprised within the nucleic acid in accordance with the invention to be inserted into such a vector, said coding region being placed in phase with the regulatory element or signal described in (1); and (3) an appropriate nucleic acid for initiation and termination of transcription of the nucleotide coding region of the nucleic acid described in (2).
  • the present invention also relates to a defective recombinant virus comprising a cDNA nucleic acid encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol.
  • the defective recombinant virus comprises a gDNA nucleic acid encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol.
  • the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71. More preferably, the ABCl polypeptide comprises amino acids l-60 of SEQ ID NO: 71.
  • the invention relates to a defective recombinant virus comprising a nucleic acid encoding an ABCl protein involved in the transport and metabolism of cholesterol under the control of a promoter chosen from RSV-LTR or the CMV early promoter.
  • a method of introducing a nucleic acid according to the invention into a host cell comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue.
  • a composition is provided for the in vivo production of the ABCl protein. This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and/or excipient.
  • the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol comprising a nucleic acid encoding the ABC 1 protein, in combination with one or more physiologically compatible excipients.
  • such a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal.
  • the subject of the invention is, in addition, a pharmaceutical composition intended for the prevention of or treatment of a patient or a subject affected by a dysfunction in the reverse transport of cholesterol comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients.
  • the invention also relates to the use of a nucleic acid according to the invention encoding an ABCl protein for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to the use of a recombinant vector according to the invention comprising a nucleic acid encoding an ABCl protein for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the subject of the invention is therefore also a recombinant vector comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
  • the invention also relates to the use of such a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the present invention also relates to the use of cells genetically modified ex vivo with such a recombinant vector according to the invention, or of cells producing a recombinant vector, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABCl polypeptide.
  • the invention also relates to the use of a nucleic acid according to the invention encoding an ABC 1 protein for the manufacture of a medicament intended for the prevention or treatment of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to the use of a recombinant vector according to the invention comprising a nucleic acid encoding an ABCl polypeptide according to the invention for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to the use of a recombinant host cell according to the invention, comprising a nucleic acid encoding an ABCl polypeptide according to the invention for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the present invention also relates to the use of a recombinant vector according to the invention, preferably a defective recombinant virus, for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
  • the invention relates to the use of such a recombinant vector or defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular disease linked to a deficiency in the reverse transport of cholesterol.
  • the present invention also relates to a pharmaceutical composition comprising one or more recombinant vectors or defective recombinant viruses according to the invention.
  • the present invention also relates to the use of cells genetically modified ex vivo with a virus according to the invention, or of cells producing such viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active ABCl protein.
  • the present invention shows that it is possible to inco ⁇ orate a nucleic acid encoding an ABCl polypeptide according to the invention into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature polypeptide. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus inco ⁇ orating such a nucleic acid.
  • another subject of the invention relates to any mammalian cell infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to any population of human cells infected with these viruses. These may be in particular cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.
  • Another subject of the invention relates to an implant comprising mammalian cells infected with one or more defective recombinant viruses according to the invention or cells producing recombinant viruses, and an extracellular matrix.
  • the implants according to the invention comprise 10 5 to 10 ⁇ cells. More preferably, they comprise 10 ⁇ to 10 ⁇ cells. More particularly, in the implants of the invention, the extracellular matrix comprises a gelling compound and optionally, a support allowing the anchorage of the cells.
  • the invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly, a nucleic acid comprising either SEQ ID NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly a nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 69 or.SEQ ID NO: 70, or of a complementary polynucleotide sequence.
  • the invention relates to a recombinant host cell comprising nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
  • the invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1 -60 of SEQ ED NO: 71.
  • the invention also relates to a recombinant host cell comprising a recombinant vector according to the invention. Therefore, the invention also relates to a recombinant host cell comprising a recombinant vector comprising any of the nucleic acids of the invention, and more particularly a nucleic acid comprising a nucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
  • the invention relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a method for the production of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, or of a peptide fragment or a variant thereof, wherein the peptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, said method comprising the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) culturing, in an appropriate culture medium, a previously transformed host cell or transfecting a host cell with the recombinant vector of step a); c) recovering the conditioned culture medium or lysing the host cell, for example by sonication or by osmotic shock; d) separating and purifying said polypeptide from said culture medium or alternatively from the cell lysates obtained in step c); and e) where appropriate, characterizing the recombinant polypeptide produced.
  • a specific embodiment of the invention relates to a method for producing a polypeptide comprising an amino acid sequence of amino acids 1-60 of SEQ ID NO: 71.
  • a polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ED NO: 71 also forms part of the invention.
  • Such a homologous polypeptide comprises an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ
  • the ABCl polypeptides according to the invention in particular 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71.
  • an antibody according to the invention is directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71.
  • the present invention relates to an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ED NO: 71 also forms part of the invention, as produced in the trioma technique or the hybridoma technique described by Kozbor et al. (1983b).
  • the subject of the invention is, in addition, a method of detecting the presence of a polypeptide according to the invention in a sample, said method comprising the steps of: a) bringing the sample to be tested into contact with an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, and b) detecting the antigen/antibody complex formed.
  • the invention also relates to a box or kit for diagnosis or for detecting the presence of a polypeptide in accordance with the invention in a sample, said box comprising: a) an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide "homologous" to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, and b) a reagent allowing the detection of the antigen/antibody complexes formed.
  • the invention also relates to a pharmaceutical composition comprising a nucleic acid according to the invention.
  • the invention also provides pharmaceutical compositions comprising a nucleic acid encoding an ABCl polypeptide according to the invention and pharmaceutical compositions comprising an ABCl polypeptide according to the invention intended for the treatment of diseases linked to a deficiency in the reverse transport of cholesterol, such as Tangier and/or
  • the present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, comprising transferring and expressing in vivo nucleic acids encoding an ABCl protein according to the invention.
  • the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the present invention offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport and metabolism of cholesterol.
  • the present invention provides methods to restore or promote improved reverse transport of cholesterol within a patient or subject.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a nucleic acid encoding the ABC 1 protein, in combination with one or more physiologically compatible vehicle and/or excipient.
  • composition for the in vivo production of the ABCl protein.
  • This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically compatible vehicle and/or excipient.
  • the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • such a composition will comprise a nucleic acid comprising a polynucleotide sequence of SEQ ED NO: 69 or SEQ ED NO: 70, placed under the control of appropriate regulatory elements.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible vehicle and/or excipient.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a nucleic acid encoding an ABCl polypeptide according to the invention in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • the invention relates to a pharmaceutical composition for the prevention or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, combined with one or more physiologically compatible vehicles and/or excipients.
  • a method of introducing a nucleic acid according to the invention into a host cell comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a therapeutically effective quantity of an ABCl polypeptide according to the invention in said patient, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • a pharmaceutical composition comprising an ABCl polypeptide according to the invention will be administered to the patient.
  • the invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a nucleic acid encoding a normal ABCl polypeptide, in particular an ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
  • compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol characterized in that they comprise a therapeutically effective quantity of a normal ABCl polypeptide, in particular of a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1 -60 of SEQ ID NO : 71.
  • the invention also provides methods for screening small molecules and compounds that act on the ABCl protein to identify agonists and antagonists of ABCl polypeptide that can restore or promote improved reverse transport of cholesterol to effectively combat arteriosclerosis from a therapeutic point of view. These methods are useful to identify small molecules and compounds for therapeutic use in the treatment of diseases due to a deficiency in the metabolism of cholesterol, particularly in the transport of cholesterol, still more particularly in the reverse transport of cholesterol, such as Tangier disease, or more generally, FHD-type conditions.
  • the invention also relates to the use of an ABCl polypeptide or a cell expressing an ABCl polypeptide according to the invention, for screening active ingredients for the prevention or treatment of diseases resulting from a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) preparing a membrane vesicle comprising an ABCl polypeptide and a lipid substrate comprising a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and/or quantitatively measuring release of the lipid substrate comprising a detectable marker; and d) comparing the release measurement obtained in step b) with a measurement of release of a labeled lipid substrate by a vesicle that has not been previously incubated with the agonist or antagonist candidate compound.
  • the ABCl polypeptide comprises SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABC 1 polypeptide, said method comprising the following steps: a) obtaining a cell, for example a cell line, that, either naturally or after transfecting the cell with an ABCl encoding nucleic acid, expresses an ABCl polypeptide; b) incubating the cell of step a) in the presence of an anion labeled with a detectable marker; c) washing the cell of step b) in order to remove the excess of the labeled anion which has not penetrated into these cells; d) incubating the cell obtained in step c) with an agonist or antagonist candidate compound for the ABCl polypeptide; e) measuring efflux of the labeled anion; and f) comparing the value of efflux of the labeled anion determined in step e) with a value of efflux of a labeled anion measured with cell which have not been previously incubated in the
  • the ABCl polypeptide comprises SEQ ED NO: 71. In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
  • the subject of the invention is also a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) culturing cells of a human monocytic line in an appropriate culture medium, in the presence of purified human albumin; b) incubating the cells of step a) simultaneously in the presence of a compound stimulating the production of IL-1 beta and of the agonist or antagonist candidate compound; c) incubating the cells obtained in step b) in the presence of an appropriate concentration of ATP; d) measuring EL-1 beta released into the cell culture supernatant; and e) comparing the value of the release of the EL-1 beta obtained in step d) with the value of the EL-1 beta released into the culture supernatant of cells which have not been previously incubated in the presence of the agonist or antagonist candidate compound.
  • F Fiigguurree 66AA Measure of cholesterol efflux in the absence ⁇ or presence of apolipoprotein
  • Figure 6B Measure of phospholipid efflux in the absence ⁇ or presence ⁇ of apolipoproteins A-I (Al);
  • Figure 6C Measure of cholesterol efflux in the absence ⁇ or presence of HDL
  • F Fiigguurree 66DD Measure of cholesterol efflux in the absence ⁇ or presence CI of phosphatidylcholine(PC)
  • Figure 7 [ 125 I] apoA-I incubated ABCl cells were placed in the absence of apolipoproteinO , in the presence of apolipoprotein A-I (apoA-I) ⁇ , or in the presence of apolipoprotein A-II (apoA-II) ⁇ ;
  • the present invention contemplates isolation of a gene encoding an ABC 1 polypeptide of the invention, including a full length, or naturally occurring form of ABCl, and any antigenic fragments thereof from any animal, particularly mammalian or avian, and more particularly human, source.
  • the term “gene” refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids.
  • isolated for the pu ⁇ oses of the present invention designates a biological material (nucleic acid or protein) which has been removed from its original environment (the environment in which it is naturally present).
  • a polynucleotide present in the natural state in a plant or an animal is not isolated.
  • the same polynucleotide separated from the adjacent nucleic acids in which it is naturally inserted in the genome of the plant or animal is considered as being "isolated”.
  • Such a polynucleotide may be included in a vector and/or such a polynucleotide may be included in a composition and remains nevertheless in the isolated state because of the fact that the vector or the composition does not constitute its natural environment.
  • purified does not require the material to be present in a form exhibiting absolute purity, exclusive of the presence of other compounds. It is rather a relative definition.
  • a polynucleotide is in the "purified” state after purification of the starting material or of the natural material by at least one order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.
  • nucleotide sequence may be used to designate either a polynucleotide or a nucleic acid.
  • nucleotide sequence covers the genetic material itself and is therefore not restricted to the information relating to its sequence.
  • nucleic acid covers RNA, DNA, gDNA or cDNA sequences or alternatively RNA/DNA hybrid sequences of more than one nucleotide, either in the single-stranded form or in the duplex, double-stranded form.
  • a “nucleic acid” is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded.
  • DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA.
  • nucleotide designates both the natural nucleotides (A, T, G, C) as well as the modified nucleotides that comprise at least one modification such as (1) an analog of a purine, (2) an analog of a pyrimidine, or (3) an analogous sugar, examples of such modified nucleotides being described, for example, in the PCT application No. WO 95/04 064.
  • a first polynucleotide is considered as being "complementary" to a second polynucleotide when each base of the first nucleotide is paired with the complementary base of the second polynucleotide whose orientation is reversed.
  • the complementary bases are A and T (or A and U), or C and G.
  • Heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
  • the heterologous DNA includes a gene foreign to the cell.
  • homologous in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a "common evolutionary origin,” including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al., 1987). Such proteins (and their encoding genes) have sequence homology, as reflected by their high degree of sequence similarity.
  • sequence similarity in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., supra).
  • sequence similarity when modified with an adverb such as “highly,” may refer to sequence similarity and not a common evolutionary origin.
  • two DNA sequences are "substantially homologous" or “substantially similar” when at least about 50% (preferably at least about 75%, and more preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences.
  • Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; Glover et al., 1985; Hames and Higgins, 1985.
  • two amino acid sequences are "substantially homologous” or “substantially similar” when greater than 30% of the amino acids are identical, or greater than about 60% are similar (functionally identical).
  • the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program.
  • the "percentage identity" between two nucleotide or amino acid sequences, for the pu ⁇ oses of the present invention may be determined by comparing two sequences aligned optimally, through a window for comparison.
  • the portion of the nucleotide or polypeptide sequence in the window for comparison may thus comprise additions or deletions (for example "gaps") relative to the reference sequence (which does not comprise these additions or these deletions) so as to obtain an optimum alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which an identical nucleic base or an identical amino acid residue is observed for the two sequences (nucleic or peptide) compared, and then by dividing the number of positions at which there is identity between the two bases or amino acid residues by the total number of positions in the window for comparison, and then multiplying the result by 100 in order to obtain the percentage sequence identity.
  • the optimum sequence alignment for the comparison may be achieved using a computer with the aid of known algorithms contained in the package from the company
  • a nucleic acid or amino acid sequence alignment may include spaces.
  • a gene encoding an ABCl polypeptide of the invention can be isolated from any source, particularly from a human cDNA or genomic library.
  • any animal cell potentially can serve as the nucleic acid source for the molecular cloning of an ABCl gene.
  • the DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA "library”), and preferably is obtained from a cDNA library prepared from tissues with high level expression of the protein, by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (See, for example, Sambrook et al., 1989; Glover, 1985).
  • Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will not contain intron sequences.
  • the gene should be molecularly cloned into a suitable vector for propagation of the gene.
  • DNA fragments are generated, some of which will encode the desired gene.
  • the DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication.
  • the linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography. Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired ABCl gene may be accomplished in a number of ways.
  • the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe (Benton and Davis, 1977; Grunstein and Hogness, 1975).
  • a set of oligonucleotides corresponding to the partial amino acid sequence information obtained for the ABCl protein can be prepared and used as probes for DNA encoding ABCl, as was done in a specific example, infra, or as primers for cDNA or mRNA (e.g., in combination with a poly-T primer for RT-PCR).
  • a fragment is selected that is highly unique to an ABCl nucleic acid or polypeptide of the invention. Those DNA fragments with substantial homology to the probe will hybridize. As noted above, the greater the degree of homology, the more stringent hybridization conditions can be used. In a specific embodiment, stringency hybridization conditions are used to identify a homologous ABCl gene.
  • cDNA clones, or DNA clones which hybrid- select the proper mRNAs can be selected which produce a protein that, e.g., has similar or identical electrophoretic migration, isoelectric focusing or non-equilibrium pH gel electrophoresis behavior, proteolytic digestion maps, or antigenic properties as known for ABCl.
  • An ABCl gene of the invention can also be identified by mRNA selection, i.e., by nucleic acid hybridization followed by in vitro translation.
  • nucleotide fragments are used to isolate complementary mRNAs by hybridization.
  • DNA fragments may represent available, purified ABC 1 DNA, or may be synthetic oligonucleotides designed from the partial amino acid sequence information.
  • Immunoprecipitation analysis or functional assays e.g., tyrosine phosphatase activity
  • specific mRNAs may be selected by adso ⁇ tion of polysomes isolated from cells to immobilized antibodies specifically directed against an ABCl polypeptide of the invention.
  • a radiolabeled ABCl cDNA can be synthesized using the selected mRNA (from the adsorbed polysomes) as a template.
  • the radiolabeled mRNA or cDNA may then be used as a probe to identify homologous ABCl DNA fragments from among other genomic DNA fragments.
  • Variant of a nucleic acid according to the invention will be understood to mean a nucleic acid which differs by one or more bases relative to the reference polynucleotide.
  • a variant nucleic acid may be of natural origin, such as an allelic variant which exists naturally, or it may also be a nonnatural variant obtained, for example, by mutagenic techniques.
  • the differences between the reference (generally, wild-type) nucleic acid and the variant nucleic acid are small such that the nucleotide sequences of the reference nucleic acid and of the variant nucleic acid are very similar and, in many regions, identical.
  • nucleotide modifications present in a variant nucleic acid may be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid.
  • the changes in nucleotides in a variant nucleic acid may also result in substitutions, additions or deletions in the polypeptide encoded by the variant nucleic acid in relation to the polypeptides encoded by the reference nucleic acid.
  • nucleotide modifications in the coding regions may produce conservative or non-conservative substitutions in the amino acid sequence of the polypeptide.
  • the variant nucleic acids according to the invention encode polypeptides which substantially conserve the same function or biological activity as the polypeptide of the reference nucleic acid or alternatively the capacity to be recognized by antibodies directed against the polypeptides encoded by the initial reference nucleic acid.
  • variant nucleic acids will thus encode mutated forms of the polypeptides whose systematic study will make it possible to deduce structure-activity relationships of the proteins in question. Knowledge of these variants in relation to the disease studied is essential since it makes it possible to understand the molecular cause of the pathology.
  • “Fragment” will be understood to mean a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over the common portion, a nucleotide sequence identical to the reference nucleic acid.
  • Such a nucleic acid “fragment” according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent.
  • Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length from 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the invention.
  • nucleic acid molecule refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester anologs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA- DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double- stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • a nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., supra).
  • the conditions of temperature and ionic strength determine the "stringency" of the hybridization.
  • low stringency hybridization conditions corresponding to a T m of 55°, can be used, e.g., 5x SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5x SSC, 0.5%> SDS).
  • Moderate stringency hybridization conditions correspond to a higher T m , e.g., 40% formamide, with 5x or 6x SCC.
  • High stringency hybridization conditions correspond to the highest T m , e.g., 50% formamide, 5x or 6x SCC.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
  • RNA:RNA, DNA:RNA, DNA:DNA The relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
  • equations for calculating T m have been derived (see Sambrook et al., supra, 9.50-0.51).
  • the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-1 1.8).
  • a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides.
  • standard hybridization conditions refers to a T m of
  • the T m is 60°C; in a more preferred embodiment, the T m is 65 °C.
  • High stringency hybridization conditions for the pu ⁇ oses of the present invention will be understood to mean the following conditions: 1- Membrane competition and PREHYBRIDIZATION:
  • 2- Labeled probe competition - Add to the labeled and purified probe 10 to 50 ⁇ l Cot I DNA, depending on the quantity of repeats.
  • hybridization conditions described above are adapted to hybridization, under high stringency conditions, of a molecule of nucleic acid of varying length from 20 nucleotides to several hundreds of nucleotides. It goes without saying that the hybridization conditions described above may be adjusted as a function of the length of the nucleic acid whose hybridization is sought or of the type of labeling chosen, according to techniques known to one skilled in the art. Suitable hybridization conditions may, for example, be adjusted according to the teaching contained in the manual by Hames and Higgins (1985) or in the manual by F. Ausubel et al. (1999).
  • oligonucleotide refers to a nucleic acid, generally of at least 15 nucleotides, that is hybridizable to a nucleic acid according to the invention. Oligonucleotides can be labeled, e.g., with 32 P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid encoding an ABCl polypeptide of the invention.
  • oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of an ABC 1 nucleic acid, or to detect the presence of nucleic acids encoding ABCl.
  • an oligonucleotide of the invention can form a triple helix with an ABCl DNA molecule.
  • oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.
  • Homologous recombination refers to the insertion of a foreign DNA sequence of a vector in a chromosome.
  • the vector targets a specific chromosomal site for homologous recombination.
  • the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and inco ⁇ oration of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination.
  • a DNA "coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3 ' to the coding sequence.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • polyadenylation signals are control sequences.
  • regulatory region means a nucleic acid sequence which regulates the expression of a nucleic acid.
  • a regulatory region may include sequences which are naturally responsible for expressing a particular nucleic acid (a homologous region) or may include sequences of a different origin (responsible for expressing different proteins or even synthetic proteins).
  • the sequences can be sequences of eukaryotic or viral genes or derived sequences which stimulate or repress transcription of a gene in a specific or non-specific manner and in an inducible or non-inducible manner.
  • Regulatory regions include origins of replication, RNA splice sites, enhancers, transcriptional termination sequences, signal sequences which direct the polypeptide into the secretory pathways of the target cell, and promoters.
  • a regulatory region from a "heterologous source” is a regulatory region which is not naturally associated with the expressed nucleic acid. Included among the heterologous regulatory regions are regulatory regions from a different species, regulatory regions from a different gene, hybrid regulatory sequences, and regulatory sequences which do not occur in nature, but which are designed by one having ordinary skill in the art.
  • a “cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites.
  • the segment of DNA encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then trans-RNA spliced and translated into the protein encoded by the coding sequence.
  • a “signal sequence” is included at the beginning of the coding sequence of a protein to be expressed on the surface of a cell. This sequence encodes a signal peptide, N-terminal to the mature polypeptide, that directs the host cell to translocate the polypeptide.
  • the term "translocation signal sequence” is used herein to refer to this sort of signal sequence. Translocation signal sequences can be found associated with a variety of proteins native to eukaryotes and prokaryotes, and are often functional in both types of organisms.
  • a "polypeptide” is a polymeric compound comprised of covalently linked amino acid residues.
  • Amino acids have the following general structure:
  • Amino acids are classified into seven groups on the basis of the side chain R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
  • side chain R (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
  • a “protein” is a polypeptide which plays a structural or functional role in a living cell.
  • the polypeptides and proteins of the invention may be glycosylated or unglycosylated.
  • "Homology” means similarity of sequence reflecting a common evolutionary origin. Polypeptides or proteins are said to have homology, or similarity, if a substantial number of their amino acids are either (1) identical, or (2) have a chemically similar R side chain. Nucleic acids are said to have homology if a substantial number of their nucleotides are identical.
  • isolated polypeptide or “isolated protein” is a polypeptide or protein which is substantially free of those compounds that are normally associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids). "Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.
  • “Fragment” of a polypeptide according to the invention will be understood to mean a polypeptide whose amino acid sequence is shorter than that of the reference polypeptide and which comprises, over the entire portion with these reference polypeptides, an identical amino acid sequence. Such fragments may, where appropriate, be included in a larger polypeptide of which they are a part. Such fragments of a polypeptide according to the invention may have a length of 10, 15, 20, 30 to 40, 50, 100, 200 or 300 amino acids.
  • Variant of a polypeptide according to the invention will be understood to mean mainly a polypeptide whose amino acid sequence contains one or more substitutions, additions or deletions of at least one amino acid residue, relative to the amino acid sequence of the reference polypeptide, it being understood that the amino acid substitutions may be either conservative or nonconservative.
  • a "variant" of a polypeptide or protein is any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature.
  • variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or post-translational modification.
  • variants also include a related protein having substantially the same biological activity, but obtained from a different species.
  • variants having single or multiple amino acid substitutions, deletions, additions, or replacements.
  • These variants may include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non- conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin.
  • the techniques for obtaining these variants including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.
  • a "vector” is a replicon, such as plasmid, virus, phage or cosmid, to which another
  • DNA segment may be attached so as to bring about the replication of the attached segment.
  • replica is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control.
  • the present invention also relates to cloning vectors containing genes encoding analogs and derivatives of a ABCl polypeptide of the invention, that have the same or homologous functional activity as that ABCl polypeptide, and homologs thereof from other species.
  • the production and use of derivatives and analogs related to ABC 1 are within the scope of the present invention.
  • the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type an ABCl polypeptide of the invention.
  • ABCl derivatives can be made by altering encoding nucleic acid sequences by substitutions, additions or deletions that provide for functionally equivalent molecules.
  • derivatives are made that have enhanced or increased functional activity relative to native ABCl.
  • such derivatives may encode soluble fragments of the ABCl extracellular domain that have the same or greater affinity for the natural ligand of an ABC 1 polypeptide of the invention.
  • Such soluble derivatives may be potent inhibitors of ligand binding to ABCl.
  • nucleotide coding sequences which encode substantially the same amino acid sequence as an ABCl gene may be used in the practice of the present invention. These include but are not limited to allelic genes, homologous genes from other species, and nucleotide sequences comprising all or portions of ABCl genes which are altered by the substitution of different codons that encode the same amino acid residue within the sequence, thus producing a silent change.
  • the ABCl derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of an ABCl protein including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a conservative amino acid substitution.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • Amino acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or isoelectric point. Particularly preferred substitutions are:
  • Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduced a potential site for disulfide bridges with another Cys.
  • a His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis).
  • Pro may be introduced because of its particularly planar structure, which induces b- rurns in the protein's structure.
  • the genes encoding ABCl derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level.
  • the cloned ABCl gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro.
  • the ABCl -encoding nucleic acids can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • such mutations enhance the functional activity of the mutated ABCl gene product.
  • mutagenesis Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C, et al., 1978; Zoller and Smith, 1984; Oliphant et al., 1986; Hutchinson et al., 1986; Huygen et al., 1996) use of TAB® linkers (Pharmacia), etc.
  • PCR techniques are preferred for site directed mutagenesis (see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70).
  • the identified and isolated gene can then be inserted into an appropriate cloning vector.
  • vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Examples of vectors include, but are not limited to, Escherichia coli, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives, e.g., pGEX vectors, pmal-c, pFLAG, etc.
  • the insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini.
  • the ends of the DNA molecules may be enzymatically modified.
  • any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences.
  • Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.
  • the cloned gene is contained on a shuttle vector plasmid, which provides for expansion in a cloning cell, e.g., Escherichia coli, and facile purification for subsequent insertion into an appropriate expression cell line, if such is desired.
  • a shuttle vector which is a vector that can replicate in more than one type of organism, can be prepared for replication in both Escherichia coli and Saccharomyces cerevisiae by linking sequences from an Escherichia coli plasmid with sequences form the yeast 2m plasmid.
  • the desired gene may be identified and isolated after insertion into a suitable cloning vector in a "shot gun" approach. Enrichment for the desired gene, for example, by size fractionation, can be done before insertion into the cloning vector.
  • the nucleotide sequence coding for an ABCl polypeptide or antigenic fragment, derivative or analog thereof, or a functionally active derivative, including a chimeric protein, thereof, can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • nucleic acid encoding an ABCl polypeptide of the invention is operationally associated with a promoter in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under control of such regulatory sequences.
  • An expression vector also preferably includes a replication origin.
  • the necessary transcriptional and translational signals can be provided on a recombinant expression vector, or they may be supplied by a native gene encoding ABCl and/or its flanking regions.
  • Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • virus e.g., vaccinia virus, adenovirus, etc.
  • insect cell systems infected with virus e.g., baculovirus
  • microorganisms such as yeast containing yeast vectors
  • bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA e.g., bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
  • a recombinant ABCl protein of the invention, or functional fragment, derivative, chimeric construct, or analog thereof, may be expressed chromosomally, after integration of the coding sequence by recombination.
  • any of a number of amplification systems may be used to achieve high levels of stable gene expression (See Sambrook et al., 1989, supra).
  • the cell into which the recombinant vector comprising the nucleic acid encoding an ABCl polypeptide according to the invention is cultured in an appropriate cell culture medium under conditions that provide for expression of the ABC 1 polypeptide by the cell.
  • Any of the methods previously described for the insertion of DNA fragments into a cloning vector may be used to construct expression vectors containing a gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination).
  • ABCl polypeptide may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression.
  • Promoters which may be used to control ABCl gene expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980), the he ⁇ es thymidine kinase promoter (Wagner et al., 1981), the regulatory sequences of the metallothionein gene (Brinster et al, 1982); prokaryotic expression vectors such as the b- lactamase promoter (Villa-Kamaroff, et al., 1978), or the tac promoter (DeBoer, et al., 1983); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; promoter elements
  • Expression vectors containing a nucleic acid encoding an ABCl polypeptide of the invention can be identified by four general approaches: (a) polymerase chain reaction (PCR) amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, (d) analyses with appropriate restriction endonucleases, and (e) expression of inserted sequences.
  • PCR polymerase chain reaction
  • nucleic acids can be amplified by PCR to provide for detection of the amplified product.
  • the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene.
  • the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker” gene functions (e.g., b-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector.
  • selection marker e.g., b-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.
  • recombinant expression vectors are identified by digestion with appropriate restriction enzymes.
  • recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein assumes a functionally active conformation.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., Escherichia coli plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al, 1988), pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2m plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian
  • both non-fusion transfer vectors such as but not limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, Smal, Xbal, EcoRI, Notl, Xmalll, BglU, and Pstl cloning site; Invitrogen), pVL1392 (BglE, Pstl, Notl, Xmalll, EcoRI, Xbal, Smal, and Bamrll cloning site; Summers and Invitrogen), and pBlueZtacIII (BamHl, BglU, Pstl, Ncol, and Hindis, cloning site, with blue/white recombinant screening possible; Invitrogen), and fusion transfer vectors, such as but not limited to pAc700 (BamHl and Kpril cloning site, in which the BamHl recognition site begins with the initiation
  • Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any expression vector with a DHFR expression vector, or a Z)HER/methotrexate co-amplification vector, such as pED (Pstl, Sail, Sbal, Smal, and EcoRI cloning site, with the vector expressing both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991).
  • DHFR dihydrofolate reductase
  • a glutamine synthetase/methionine sulfoximine co-amplification vector such as p ⁇ 14 (Hind l, Xbal, Smal, Sbal, EcoRI, and Bell cloning site, in which the vector expresses glutamine synthase and the cloned gene; Celltech).
  • a vector that directs episomal expression under control of Epstein Barr Virus can be used, such as pREP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindUl, Nhel, PvuU, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker; Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindUl, Nhel, PvuU, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, HindUl, Notl, Xhol, Sfil, BamHl cloning site, inducible methallothionein Eta gene promoter, hygromycin selectable marker: Invitrogen), pRE
  • Selectable mammalian expression vectors for use in the invention include pRc/CMV (HindUl, BstXl, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen), pRc/RSV (HindUl, Spel, BstXl, Notl, Xbal cloning site, G418 selection; Invitrogen), and others.
  • Vaccinia virus mammalian expression vectors for use according to the invention include but are not limited to pSCl l (Smal cloning site, TK- and b-gal selection), pMJ601 (Sail, Smal, Afil, Narl, BspME, BamHl, Apal, Nhel, SacU, Kpnl, and HindUl cloning site; TK- and b-gal selection), and pTKgptFlS (EcoRI, Pstl, Sa l, Accl, HindU, Sbal, BamHl, and Hpa cloning site, TK or XPRT selection).
  • Yeast expression systems can also be used according to the invention to express an
  • the non-fusion pY ⁇ S2 vector (Xbal, Sphl, Shol, Notl, Gst l, EcoRI, BstXl, BamHl, Sacl, Kpnl, and HindUl cloning sit; Invitrogen) or the fusion pY ⁇ SHisA, B, C (Xbal, Sphl, Shol, Notl, BstXl, EcoRI, BamHl, Sacl, Kpnl, and HindUl cloning site, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention.
  • the expression vectors which can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid and cosmid DNA vectors, to name but a few.
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired.
  • Different host cells have characteristic and specific mechanisms for the translational and post- translational processing and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of proteins.
  • Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed.
  • expression in a bacterial system can be used to produce an nonglycosylated core protein product.
  • the transmembrane ABCl protein expressed in bacteria may not be properly folded.
  • Expression in yeast can produce a glycosylated product.
  • Expression in eukaryotic cells can increase the likelihood of "native" glycosylation and folding of a heterologous protein.
  • expression in mammalian cells can provide a tool for reconstituting, or constituting, ABCl activity.
  • different vector/host expression systems may affect processing reactions, such as proteolytic cleavages, to a different extent.
  • Vectors are introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al., 1992; Wu and Wu, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990).
  • a cell has been "transfected” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • a cell has been "transformed” by exogenous or heterologous DNA when the transfected DNA effects a phenotypic change.
  • the transforming DNA should be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • a recombinant marker protein expressed as an integral membrane protein can be isolated and purified by standard methods.
  • the integral membrane protein can be obtained by lysing the membrane with detergents, such as but not limited to, sodium dodecyl sulfate (SDS), Triton X-100 polyoxyethylene ester, Ipagel/nonidet P-40 (NP ⁇ IO) (octylphenoxy)-polyethoxyethanol, digoxin, sodium deoxycholate, and the like, including mixtures thereof. Solubilization can be enhanced by sonication of the suspension.
  • SDS sodium dodecyl sulfate
  • NP ⁇ IO Ipagel/nonidet P-40
  • Solubilization can be enhanced by sonication of the suspension.
  • Soluble forms of the protein can be obtained by collecting culture fluid, or solubilizing inclusion bodies, e.g., by treatment with detergent, and if desired sonication or other mechanical processes, as described above.
  • the solubilized or soluble protein can be isolated using various techniques, such as polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, 2-dimensional gel electrophoresis, chromatography (e.g., ion exchange, affinity, immunoaffinity, and sizing column chromatography), centrifugation, differential solubility, immunoprecipitation, or by any other standard technique for the purification of proteins.
  • PAGE polyacrylamide gel electrophoresis
  • isoelectric focusing e.g., isoelectric focusing
  • 2-dimensional gel electrophoresis e.g., ion exchange, affinity, immunoaffinity, and sizing column chromatography
  • centrifugation e.g., ion exchange, affinity, immunoaffinity, and sizing column chromatography
  • a nucleic acid or vector according to the invention can be introduced in vivo by lipofection.
  • liposomes for encapsulation and transfection of nucleic acids in vitro.
  • Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al. 1987; Mackey, et al., 1988; Ulmer et al., 1993).
  • the use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, 1989).
  • lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications W095/18863 and W096/17823, and in U.S. Patent No. 5,459,127.
  • the use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages.
  • Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly preferred in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain.
  • Lipids may be chemically coupled to other molecules for the pu ⁇ ose of targeting [see Mackey, et. al., supra].
  • Targeted peptides e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.
  • a nucleic acid in vivo, is also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., International Patent Publication W095/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO96/25508), or a cationic polymer (e.g., International Patent Publication W095/21931).
  • a cationic oligopeptide e.g., International Patent Publication W095/21931
  • peptides derived from DNA binding proteins e.g., International Patent Publication WO96/25508
  • a cationic polymer e.g., International Patent Publication W095/21931.
  • naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, Wu et al., 1992; Wu and Wu, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990; Williams et al., 1991). Receptor-mediated DNA delivery approaches can also be used (Curiel et al., 1992; Wu and Wu, 1987).
  • “Pharmaceutically acceptable vehicle or excipient” includes diluents and fillers which are pharmaceutically acceptable for method of administration, are sterile, and may be aqueous or oleaginous suspensions formulated using suitable dispersing or wetting agents and suspending agents.
  • the particular pharmaceutically acceptable carrier and the ratio of active compound to carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration, and standard pharmaceutical practice. Any nucleic acid, polypeptide, vector, or host cell of the invention will preferably be introduced in vivo in a pharmaceutically acceptable vehicle or excipient.
  • pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • excipient refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as excipients, particularly for injectable solutions. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • the invention contemplates delivery of a vector that will express a therapeutically effective amount of an ABCl polypeptide for gene therapy applications.
  • therapeutically effective amount is used herein to mean an amount sufficient to reduce by at least about 15 percent, preferably by at least 50 percent, more preferably by at least 90 percent, and still more preferably prevent, a clinically significant deficit in the activity, function and response of the host.
  • a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the host.
  • Lipid profile means the set of concentrations of cholesterol, triglyceride, lipoprotein cholesterol and other lipids in the body of a human or other animal.
  • An "undesirable lipid profile” is the condition in which the concentrations of cholesterol, triglyceride, or lipoprotein cholesterol are outside of the age- and gender-adjusted reference ranges.
  • a concentration of total cholesterol > 200 mg/dl, of plasma triglycerides > 200 mg/dl, of LDL cholesterol > 130 mg/dl, of HDL cholesterol ⁇ 39 mg/dl, or a ratio of total cholesterol to HDL cholesterol > 4.0 is considered to be an undesirable lipid profile.
  • An undesirable lipid profile is associated with a variety of pathological conditions, including hyperlipidaemias, diabetes hypercholesterolaemia, atherosclerosis, and other forms of coronary artery disease.
  • the human ABC 1 gene is thought to comprise 48 exons and 47 introns, if reference is made in particular to the structure of the orthologous ABCl gene in mice. Recently, partial exonic and intronic ABC 1 genomic DNA has been isolated and identified (Rust et al., 1999).
  • the human ABCl gene comprises 49 exons and 48 introns.
  • genomic nucleotide sequences of the ABCl gene have been isolated and characterized according to the invention, these genomic sequences comprise both new exonic sequences and intronic sequences which may be used in particular for the production of various means of detection of the ABCl gene or of its nucleotide expression products in a sample.
  • a first subject of the invention consists in a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1 and 4-17, or of a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a polynucleotide sequence comprising a) any one of SEQ ID NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
  • the subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising any one of SEQ ED NOs: 18-36, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 18-36, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
  • the subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides 1-1657 of SEQ ED NO: 36, or a complementary polynucleotide sequence.
  • intronic nucleic acids of the ABCl gene may also be used as nucleotide probes or primers for detecting the presence of at least one copy of the ABC 1 gene in a sample, or alternatively for amplifying a given target sequence in the ABC 1 gene.
  • the intronic nucleic acid sequences of the ABCl gene are indicated in Table EQ.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence.
  • the subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence.
  • a partial cDNA sequence corresponding to the human ABCl gene has been identified by Langmann et al. (1999).
  • This partial cDNA sequence of ABCl consists of 6880 nucleotides and contains a 6603 nucleotide open reading frame corresponding to a partial 2201 amino acid (aa) ABCl polypeptide produced in subjects not affected by disorders linked to the reverse transport of cholesterol.
  • the cDNA sequence described by Langmann et al. (1999) contains, in addition, a portion of the 5'- untranslated region (UTR) (nucleotides 1 to 120) and a portion of the 3'-UTR (nucleotides 6727 to 6880).
  • UTR 5'- untranslated region
  • a cDNA that encodes the full length human ABCl protein has now been identified according to the invention (see Example 2).
  • This novel, human ABCl cDNA (SEQ ID NO: 69) includes a newly identified 5 '-region comprising 244 additional 5' nucleotides and the true initiation ATG codon.
  • the new human ABCl cDNA comprises a larger open reading frame than that previously reported by Langmann et al. (1999) and Rust et al. (1999).
  • this cDNA nucleic acid molecule of the invention encodes 60 additional amino acids at the N-terminus of the full length human ABCl protein.
  • this new cDNA molecule of the invention comprises a newly identified 5'UTR.
  • Figure 7 unambiguously demonstrates a specific binding of apo A-I and A-E to full length ABCl transfected cells, thereby suggesting that full length ABCl protein act via direct interaction with apolipoproteins, and that these interactions are required for the lipid efflux facilitated by apolipoproteins and the full length ABCl protein. It is thus conceivable that in vivo apolipoproteins from the liver and intestine circulate and interact with full length ABCl protein on the cell surface to recruit lipid efflux from peripheral cells.
  • a cDNA molecule of the human ABCl gene having the polynucleotide sequence of SEQ ED NO: 69 comprises an open reading frame beginning from the nucleotide at position 185 (base A of the ATG codon for initiation of translation) to the nucleotide at position 6967.
  • a polyadenylation signal (having the sequence ATTAAA) is present, starting from the nucleotide at position 9698 of the sequence SEQ ED NO: 69.
  • the ABCl cDNA comprising SEQ ED NO: 69 encodes a full length ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71. Consequently, the invention also relates to a nucleic acid comprising SEQ ED NO: 69, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in SEQ ED NO: 69, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid molecule comprising nucleotides 1-244 of SEQ ID NO: 69, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69, or a complementary polynucleotide sequence.
  • the subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69, or a nucleic acid having a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a nucleotides 1-244 of SEQ ED NOs: 69, or a nucleic acid having a complementary polynucleotide sequence.
  • Another subject of the invention is a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69, or a nucleic acid having a complementary polynucleotide sequence.
  • This second cDNA molecule comprises the nucleotide sequence of SEQ ED NO: 70.
  • the ORF of this second cDNA molecule is located from nucleotide 298 to nucleotide 7080 of SEQ ED NO: 70 and the polyadenylation signal (having the sequence ATTAAA) is located beginning at nucleotide 9811 of SEQ ED NO: 70.
  • the nucleic acid comprising SEQ ID NO: 70 also encodes the full length human ABCl protein comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a nucleic acid comprising SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • Another subject of the invention is a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a nucleic acid having a complementary polynucleotide sequence.
  • a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70 encodes a full length human ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO: 71.
  • the invention also relates to a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising amino acid sequence of SEQ ED
  • the invention also relates to a polypeptide comprising amino acid sequence as depicted in SEQ ID NO: 71.
  • the invention relates to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a polypeptide comprising an amino acid sequence having at least 80% amino acid identity with a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71, or a peptide fragment thereof.
  • the invention also relates to a polypeptide having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% amino acid identity with a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
  • a polypeptide according to the invention will have a length of 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
  • a polypeptide according to the invention will comprise a fragment having a length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a polypeptide according to the invention, more particularly of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
  • the analysis of mutations in the ABCl gene may be carried out on genomic DNA from several individuals belonging to a family of which several members suffer from Tangier and/or FHD disease with premature coronary disorders.
  • several mutations have been identified in regions of the ABCl gene, which encode the ABCl polypeptide. These mutations have been found particularly in patients suffering from severe forms of Tangier disease, associated with serious coronary disorders. Seventeen mutations are described in Table EV. The mutation of the wild-type (WT) sequence is indicated in Table EV for each mutant sequence.
  • the structural characteristics which make it possible to differentiate the normal sequences from the mutated sequences of ABCl may be exploited in order to produce means of detection of the mutated sequences of ABCl in a sample, in particular, probes specifically hybridizing with the mutated sequences of ABC 1 or pairs of primers making it possible to selectively amplify the regions of the ABC 1 gene carrying the mutations described above, it being possible to carry out the detection of the presence of these mutations in particular by distinguishing the length of the amplified nucleic acid fragments, by hybridization of the amplified fragments with the aid of the specific probes described above, or by direct sequencing of these amplified fragments.
  • the invention relates to a nucleic acid comprising any one of SEQ ED NOs: 72-88, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 72-88, or a complementary polynucleotide sequence.
  • a further subject of the invention is a nucleic acid encoding a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
  • the invention also relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
  • polymo ⁇ hisms have been found within the ABCl gene, in particular nucleotide substitutions located in the noncoding regions (introns).
  • Each of the eight polymo ⁇ hisms identified in the ABCl gene are represented in Table V.
  • Table V depicts the wild type (WT) allele and the mutant allele, with the polymo ⁇ hism itself being defined by the two nucleotide sequences corresponding respectively to each of the alleles.
  • the invention also relates to nucleic acids of the ABC 1 gene comprising a nucleotide sequence comprising at least one biallelic polymo ⁇ hism as described in Table V.
  • the invention relates to a nucleic acid comprising any one of SEQ ED NOs: 103 and 109-118, or a complementary polynucleotide sequence.
  • the invention also relates to a nucleic acid comprising a nucleotide sequence as depicted in SEQ ED NOs: 103 and 109-118, or a complementary polynucleotide sequence.
  • the detection of these ABCl gene polymo ⁇ hisms within a DNA sample obtained from a subject may, for example, be carried out by a specific amplification of the nucleotide region of ABCl containing the polymo ⁇ hic base, and then sequencing the amplified fragment in order to determine the nature of the allele or of the alleles carried by said subject.
  • the detection of these polymo ⁇ hisms in a DNA sample obtained from a subject may also be carried out with the aid of nucleotide probes or primers specifically hybridizing with a given allele containing one of the polymo ⁇ hic bases of a polymo ⁇ hism of the ABC 1 gene according to the invention.
  • nucleotide primers are for example primers whose base at the 3' end hybridizes with the base located immediately on the 5' side of the polymo ⁇ hic base of the fragment comprising said polymo ⁇ hism.
  • a step of extension with a mixture of the two dideoxynucleotides complementary to the polymo ⁇ hic base of said polymo ⁇ hism, for example differentially labeled by fluorescence and then a step detection of the fluorescence signal obtained makes it possible to determine which of the two differentially labeled fluorescent dideoxynucleotides has been inco ⁇ orated and to directly deduce the nature of the polymo ⁇ hic base present at the level of this polymo ⁇ hism.
  • Various approaches may be used for the labeling and detection of the dideoxynucleotides.
  • a method in homogeneous phase based on FRET has been described by Chen and Kwok (1997).
  • the amplified fragments of genomic DNA containing polymo ⁇ hisms are incubated with a primer labeled with fluorescein at the 5' end in the presence of labeled dideoxynucleotide triphosphate and a modified Taq polymerase.
  • the labeled primer is extended by one base by inco ⁇ oration of the labeled dideoxynucleotide specific for the allele present on the complementary genomic DNA sequence.
  • the fluorescence intensities for the two labeling compounds for the labeled dideoxynucleotides are directly analyzed without separation or purification. All these steps may be carried out in the same tube and the modifications of the fluorescence signal monitored in real time.
  • the extended primer may be analyzed by MALDI-TOF type mass spectrometry.
  • the base located at the level of the polymo ⁇ hic site is identified by measuring the mass added to the microsequencing primer (Haff and Smirnov, 1997).
  • Such nucleotide primers may, for example, be immobilized on a support. Furthermore, it is possible to immobilize on a support, for example in an orderly manner, multiple specific primers as described above, each of the primers being suited to the detection of one of the polymo ⁇ hisms of the ABCl gene according to the invention.
  • the polymo ⁇ hisms of the ABCl gene according to the invention are useful in particular as genetic markers in studies of association between the presence of a given allele in a subject and the predisposition of this subject to a given pathology, in particular to one of the pathologies already associated with the chromosomal region 9q31 preferably with a pathology linked to a dysfunction in the reverse transport of cholesterol.
  • the methods for the genetic analysis of complex characters are of various types (Lander and Schork, 1994).
  • the biallelic polymo ⁇ hisms according to the invention are useful in any of the methods described in the state of the art intended to demonstrate a statistically significant correlation between a genotype and a phenotype.
  • the biallelic polymo ⁇ hisms may be used in linkage analyses and in allele sharing methods.
  • the biallelic polymo ⁇ hisms according to the invention are used to identify genes associated with detectable characters (phenotypes) in use for studies of association, an approach which does not require the use of families affected by the character, and which allows, in addition, the identification of genes associated with complex and sporadic characters.
  • nucleic acid probes and primers hybridizing with a nucleic acid also form part of the invention.
  • nucleic acid fragments derived from a polynucleotide comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucle
  • nucleotide probes or primers according to the invention comprise a nucleotide sequence comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleo
  • nucleotide probes or primers according to the invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleot
  • nucleotide probes or primers according to the invention will have a length of 10, 12, 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, in particular of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO
  • a nucleotide probe or primer according to the invention will consist of and/or comprise the fragments having a length of 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, more particularly of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED
  • nucleotide probe or primer therefore covers oligonucleotides which hybridize, under the high stringency hybridization conditions defined above, with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ
  • a nucleotide primer according to the invention comprises a nucleotide sequence of any one of SEQ ED NOs: 119-136, 138, and 141-152, or of a complementary nucleic acid sequence.
  • probes and primers comprise all or part of a polynucleotide sequence comprising any one of SEQ ED NOs: 119-136, 138, and 141-152, or a nucleic acid having a complementary nucleic acid sequence.
  • a nucleotide primer or probe according to the invention may be prepared by any suitable method well known to persons skilled in the art, including by cloning and action of restriction enzymes or by direct chemical synthesis according to techniques such as the phosphodiester method by Narang et al. (1979) or by Brown et al. (1979), the diethylphosphoramidite method by Beaucage et al. (1980) or the technique on a solid support described in EU patent No. EP 0,707,592.
  • Each of the nucleic acids according to the invention may be labeled, if desired, by inco ⁇ orating a marker which can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means.
  • markers may consist of radioactive isotopes ( 32 P, 33 P, H, 35 S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or ligands such as biotin.
  • the labeling of the probes is preferably carried out by inco ⁇ orating labeled molecules into the polynucleotides by primer extension, or alternatively by addition to the 5' or 3' ends. Examples of nonradioactive labeling of nucleic acid fragments are described in particular in French patent No. 78 109 75 or in the articles by Urdea et al. (1988) or Sanchez-pescador et al. (1988).
  • the nucleotide probes and primers according to the invention may have structural characteristics of the type to allow amplification of the signal, such as the probes described by Urdea et al. (1991) or alternatively in European patent No. EP-0,225,807 (CHIRON).
  • oligonucleotide probes according to the invention may be used in particular in Southern-type hybridizations with the genomic DNA or alternatively in hybridizations with the corresponding messenger RNA when the expression of the corresponding transcript is sought in a sample.
  • the probes and primers according to the invention may also be used for the detection of products of PCR amplification or alternatively for the detection of mismatches.
  • Nucleotide probes or primers according to the invention may be immobilized on a solid support.
  • Such solid supports are well known to persons skilled in the art and comprise surfaces of wells of microtiter plates, polystyrene beds, magnetic beds, nitrocellulose bands or microparticles such as latex particles.
  • the present invention also relates to a method of detecting the presence of a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68- 70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence in a sample, said method comprising the steps of:
  • nucleotide probes or primers according to the invention 1) bringing one or more nucleotide probes or primers according to the invention into contact with the sample to be tested; 2) detecting the complex which may have formed between the probe(s) and the nucleic acid present in the sample.
  • the oligonucleotide probes and primers are immobilized on a support.
  • the oligonucleotide probes and primers comprise a detectable marker.
  • the invention relates, in addition, to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probe(s) or primer(s) as described above; b) where appropriate, the reagents necessary for the hybridization reaction.
  • the detection box or kit is characterized in that the probe(s) or primer(s) are immobilized on a support.
  • the detection box or kit is characterized in that the oligonucleotide probes comprise a detectable marker.
  • such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect a target nucleic acid of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention, more particularly of nucleic acids comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence.
  • the probes according to the invention immobilized on a support, may be ordered into matrices such as "DNA chips". Such ordered matrices have in particular been described in US patent No. 5,143,854, in published PCT applications WO 90/15070 and WO 92/10092.
  • the nucleotide primers according to the invention may be used to amplify any one of the nucleic acids according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the nucleotide primers according to the invention may be used to amplify a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the nucleotide primers according to the invention may be used to amplify a nucleic acid comprising a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide
  • Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary poly
  • the subject of the invention is, in addition, a box or kit for amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of
  • Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
  • the subject of the invention is, in addition, a box or kit for amplifying all or part of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide
  • Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
  • the invention also relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probes according to the invention; b) where appropriate, reagents necessary for a hybridization reaction.
  • the detection box or kit is characterized in that the nucleotide probe(s) and primer(s)are immobilized on a support.
  • the detection box or kit is characterized in that the nucleotide probe(s) and primer(s) comprise a detectable marker.
  • such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect target nucleic acids of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention.
  • the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary nucleic acid sequence.
  • the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 125 and 126, making it possible to amplify the region of exon 5 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 72 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 127 and 128, making it possible to amplify the region of exon 6 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 73 or 74 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 131 and 132, making it possible to amplify the region of exon 8 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 75-77 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 155 and 156, making it possible to amplify the region of exon 27 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 84 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 159 and 160, making it possible to amplify the region of exon 32 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 85 described above, or nucleic acids having a complementary polynucleotide sequence.
  • two primers according to the invention comprise all or part of SEQ ED NOs: 175 and 176, making it possible to amplify the region of exon 47 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 87 or 88 described above, or nucleic acids having a complementary polynucleotide sequence.
  • a primer according to the invention comprise, generally, all or part of any one of SEQ ED NOs: 119-136, 138, and 141-152, or a complementary sequence.
  • nucleotide primers according to the invention are particularly useful in methods of genotyping subjects and/or of genotyping populations, in particular in the context of studies of association between particular allele forms or particular forms of groups of alleles (haplotypes) in subjects and the existence of a particular phenotype (character) in these subjects, for example the predisposition of these subjects to develop diseases linked to a deficiency in the reverse transport of cholesterol, or alternatively the predisposition of these subjects to develop a pathology whose candidate chromosomal region is situated on chromosome 9, more precisely on the 9q arm and still more precisely in the 9q31 locus.
  • the invention also relates to a recombinant vector comprising a nucleic acid according to the invention.
  • Vector for the pu ⁇ oses of the present invention will be understood to mean a circular or linear DNA or RNA molecule which is either in single-stranded or double-stranded form.
  • such a recombinant vector will comprise a nucleic acid chosen from the following nucleic acids: a) a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, b) a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, c) a nucleic acid comprising nucleotides 1-244 of SEQ D NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence, d) a nucleic acid having at least eight consecutive nucleotides of
  • a recombinant vector according to the invention corresponds to an expression vector comprising, in addition to a nucleic acid in accordance with the invention, a regulatory signal or nucleotide sequence that directs or controls transcription and/or translation of the nucleic acid and its encoded mRNA.
  • a recombinant vector according to the invention will comprise in particular the following components:
  • an element or signal for regulating the expression of the nucleic acid to be inserted such as a promoter and/or enhancer sequence
  • nucleic acid in accordance with the invention (2) a nucleotide coding region comprised within the nucleic acid in accordance with the invention to be inserted into such a vector, said coding region being placed in phase with the regulatory element or signal described in (1);
  • the recombinant vectors according to the invention may include one or more origins for replication in the cellular hosts in which their amplification or their expression is sought, markers or selectable markers.
  • the bacterial promoters may be the Lad or LacZ promoters, the T3 or T7 bacteriophage RNA polymerase promoters, the lambda phage PR or PL promoters.
  • the promoters for eukaryotic cells will comprise the he ⁇ es simplex virus (HSV) virus thymidine kinase promoter or alternatively the mouse metallothionein-L promoter.
  • HSV he ⁇ es simplex virus
  • bacteriophage vectors such as the PI bacteriophage vectors such as the vector pl58 or the vector pl58/neo8 described by Stemberg (1992, 1994) will be preferably used.
  • the preferred bacterial vectors according to the invention are for example the vectors pBR322(ATCC37017) or alternatively vectors such as pAA223-3 (Pharmacia, Uppsala, Sweden), and pGEMl (Promega Biotech, Madison, WI, UNITED STATES).
  • vectors pQE70, pQE60, pQE9 (Qiagen), psiX174, pBluescript SN p ⁇ H8N pNH16A, pNH18A, pNH46A, pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene).
  • They may also be vectors of the baculovirus type such as the vector pVL1392/1393 (Pharmingen) used to transfect cells of the Sf9 line (ATCC No. CRL 1711) derived from Spodoptera frugiperda. They may also be adenoviral vectors such as the human adenovirus of type 2 or 5.
  • a recombinant vector according to the invention may also be a retroviral vector or an adeno-associated vector (AAV).
  • AAV adeno-associated vector
  • Such adeno-associated vectors are for example described by Flotte et al. (1992), Samulski et al. (1989), or McLaughlin BA et al. (1996).
  • a polynucleotide according to the invention To allow the expression of a polynucleotide according to the invention, the latter must be introduced into a host cell.
  • the introduction of a polynucleotide according to the invention into a host cell may be carried out in vitro, according to the techniques well known to persons skilled in the art for transforming or transfecting cells, either in primer culture, or in the form of cell lines. It is also possible to carry out the introduction of a polynucleotide according to the invention in vivo or ex vivo, for the prevention or treatment of diseases linked to a deficiency in the reverse transport of cholesterol.
  • a person skilled in the art can preferably refer to various techniques, such as the calcium phosphate precipitation technique (Graham et al., 1973 ; Chen et al., 1987), DEAE Dextran (Gopal, 1985), electroporation (Tur-Kaspa, 1896 ; Potter et al., 1984), direct microinjection (Harland et al., 1985), liposomes charged with DNA (Nicolau et al., 1982, Fraley et al., 1979).
  • various techniques such as the calcium phosphate precipitation technique (Graham et al., 1973 ; Chen et al., 1987), DEAE Dextran (Gopal, 1985), electroporation (Tur-Kaspa, 1896 ; Potter et al., 1984), direct microinjection (Harland et al., 1985), liposomes charged with DNA (Nicolau et al., 1982, Fraley et al., 1979).
  • the polynucleotide may be stably integrated into the genome of the cell.
  • the intregration may be achieved at a precise site of the genome, by homologous recombination, or it may be randomly integrated.
  • the polynucleotide may be stably maintained in the host cell in the form of an episome fragment, the episome comprising sequences allowing the retention and the replication of the latter, either independently, or in a synchronized manner with the cell cycle.
  • a method of introducing a polynucleotide according to the invention into a host cell comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" polynucleotide according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" polynucleotide being absorbed by the cells of this tissue.
  • compositions for use in vitro and in vivo comprising "naked" polynucleotides are for example described in PCT Application No. WO 95/11307 (Institut Pasteur, Inserm, University of Ottawa) as well as in the articles by Tacson et al. (1996) and Huygen et al. (1996) .
  • composition for the in vivo production of the ABCl protein.
  • This composition comprises a polynucleotide encoding the ABC 1 polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vector.
  • the quantity of vector which is injected into the host organism chosen varies according to the site of the injection.
  • polynucleotide encoding the ABCl protein there may be injected between about 0.1 and about 100 ⁇ g of polynucleotide encoding the ABCl protein into the body of an animal, preferably into a patient likely to develop a disease linked to a deficiency in the reverse transport of cholesterol or who has already developed this disease, in particular a patient having a predisposition to Tangier disease or a patient who has already developed the disease.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol comprising a nucleic acid encoding the ABCl protein, in combination with one or more physiologically compatible excipients.
  • a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal.
  • the subject of the invention is, in addition, a pharmaceutical composition intended for the prevention of or treatment of a patient or a subject affected by a dysfunction in the reverse transport of cholesterol comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients.
  • the invention also relates to the use of a nucleic acid according to the invention, encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to the use of a recombinant vector according to the invention, comprising a nucleic acid encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the subject of the invention is therefore also a recombinant vector comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
  • the invention also relates to the use of such a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the present invention also relates to the use of cells genetically modified ex vivo with such a recombinant vector according to the invention, or of cells producing a recombinant vector, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABC 1 polypeptide.
  • Vectors useful in methods of somatic gene therapy and compositions containing such vectors are provided.
  • the present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol. It provides an advantageous solution to the disadvantages of the prior art, by demonstrating the possibility of treating the pathologies linked to the transport of cholesterol by gene therapy, by the transfer and expression in vivo of a gene encoding an ABCl protein involved in the transport and the metabolism of cholesterol.
  • the invention thus offers a simple means allowing a specific and effective treatment of related pathologies such as, for example, atherosclerosis.
  • Gene therapy consists in correcting a deficiency or an abnormality (mutation, aberrant expression and the like) and in bringing about the expression of a protein of therapeutic interest by introducing genetic information into the affected cell or organ.
  • This genetic information may be introduced either ex vivo into a cell extracted from the organ, the modified cell then being reintroduced into the body, or directly in vivo into the appropriate tissue.
  • the retroviruses (RSV, HMS, MMS, and the like), the HSV virus, the adeno-associated viruses and the adeno viruses.
  • the present invention therefore also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, consisting in transferring and in expressing in vivo genes encoding ABCl .
  • the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the applicant has now found that it is possible to construct recombinant vectors comprising a nucleic acid encoding an ABC 1 protein involved in the metabolism of cholesterol, to administer these recombinant vectors in vivo, and that this administration allows a stable and effective expression of a biologically active ABC 1 protein in vivo, with no cytopathological effect.
  • the present invention also results from the demonstration that adenoviruses constitute particularly efficient vectors for the transfer and the expression of the ABCl gene. Ln particular, the present invention shows that the use of recombinant adenoviruses as vectors makes it possible to obtain sufficiently high levels of expression of this gene to produce the desired therapeutic effect.
  • Other viral vectors such as retroviruses or adeno-associated viruses (AAV) allowing a stable expression of the gene are also claimed.
  • the present invention thus offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport of cholesterol.
  • the subject of the invention is therefore also a defective recombinant virus comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
  • the invention also relates to the use of such a defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • a defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the present invention also relates to the use of cells genetically modified ex vivo with such a defective recombinant virus according to the invention, or of cells producing a defective recombinant virus, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABCl polypeptide.
  • the present invention shows that it is possible to inco ⁇ orate a DNA sequence encoding ABCl into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature form. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus inco ⁇ orating such a DNA.
  • the present invention is particularly advantageous because it makes it possible to induce a controlled expression, and with no harmful effect, of ABCl in organs which are not normally involved in the expression of this protein. In particular, a significant release of the
  • ABCl protein is obtained by implantation of cells producing vectors of the invention, or infected ex vivo with vectors of the invention.
  • the activity of transport of cholesterol produced in the context of the present invention may be of the human or animal ABC 1 type.
  • the nucleic sequence used in the context of the present invention may be a cDNA, a genomic DNA (gDNA), an RNA (in the case of retroviruses) or a hybrid construct consisting, for example, of a cDNA into which one or more introns (gDNA) would be inserted. It may also involve synthetic or semisynthetic sequences.
  • a cDNA or a gDNA is used.
  • the use of a gDNA allows a better expression in human cells.
  • these sequences are preferably modified, for example by site- directed mutagenesis, in particular for the insertion of appropriate restriction sites.
  • sequences described in the prior art are indeed not constructed for use according to the invention, and prior adaptations may prove necessary, in order to obtain substantial expressions.
  • the use of a nucleic sequence encoding a human ABCl protein is preferred.
  • a construct encoding a derivative of these ABCl proteins comprises, for example, any sequence obtained by mutation, deletion and/or addition relative to the native sequence, and encoding a product retaining the cholesterol transport activity.
  • the derivatives for the pu ⁇ oses of the invention may also be obtained by hybridization from nucleic acid libraries, using as probe the native sequence or a fragment thereof. These derivatives are in particular molecules having a higher affinity for their binding sites, molecules exhibiting greater resistance to proteases, molecules having a higher therapeutic efficacy or fewer side effects, or optionally new biological properties.
  • the derivatives also include the modified DNA sequences allowing improved expression in vivo.
  • the present invention relates to a defective recombinant virus comprising a cDNA encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol.
  • a defective recombinant virus comprises a genomic DNA (gDNA) encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol.
  • the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71. More preferably, the ABCl polypeptide comprised amino acids l-60 of SEQ ID NO:71.
  • the vectors of the invention may be prepared from various types of viruses.
  • vectors derived from adenoviruses adeno-associated viruses (AAV), he ⁇ esviruses (HSV) or retroviruses are used. It is preferable to use an adenovirus, for direct administration or for the ex vivo modification of cells intended to be implanted, or a retrovirus, for the implantation of producing cells.
  • the viruses according to the invention are defective, that is to say that they are incapable of autonomously replicating in the target cell.
  • the genome of the defective viruses used in the context of the present invention therefore lacks at least the sequences necessary for the replication of said virus in the infected cell.
  • regions may be either eliminated (completely or partially), or made nonfunctional, or substituted with other sequences and in particular with the nucleic sequence encoding the ABCl protein.
  • the defective virus retains, nevertheless, the sequences of its genome which are necessary for the encapsidation of the viral particles.
  • adenoviruses As regards more particularly adenoviruses, various serotypes, whose structure and properties vary somewhat, have been characterized. Among these serotypes, human adenoviruses of type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin (see Application WO 94/26914) are preferably used in the context of the present invention.
  • adenoviruses of animal origin which can be used in the context of the present invention, there may be mentioned adenoviruses of canine, bovine, murine (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine, avian or simian (example: SAV) origin.
  • the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan or A26/61 strain (ATCC VR-800) for example].
  • adenoviruses of human or canine or mixed origin are used in the context of the invention.
  • the defective adenoviruses of the invention comprise the ITRs, a sequence allowing the encapsidation and the sequence encoding the ABCl protein.
  • the El region at least is made nonfunctional.
  • the El gene and at least one of the E2, E4 and L1-L5 genes are nonfunctional.
  • the viral gene considered may be made nonfunctional by any technique known to a person skilled in the art, and in particular by total suppression, by substitution, by partial deletion or by addition of one or more bases in the gene(s) considered. Such modifications may be obtained in vitro (on the isolated DNA) or in situ, for example, by means of genetic engineering techniques, or by treatment by means of mutagenic agents.
  • the adenovirus according to the invention comprises a deletion in the El and E4 regions and the sequence encoding ABCl is inserted at the level of the inactivated El region.
  • it comprises a deletion in the El region at the level of which the E4 region and the sequence encoding ABCl (French Patent Application FR94 13355) are inserted.
  • the defective recombinant adenoviruses according to the invention may be prepared by any technique known to persons skilled in the art (Levrero et al., 1991, EP 185 573; and Graham, 1984). In particular, they may be prepared by homologous recombination between an adenovirus and a plasmid carrying, inter alia, the nucleic acid encoding the ABCl protein. The homologous recombination occurs after cotransfection of said adenoviruses and plasmid into an appropriate cell line.
  • the cell line used must preferably (i) be transformable by said elements, and (ii), contain the sequences capable of complementing the part of the defective adenovirus genome, preferably in integrated form in order to avoid the risks of recombination.
  • a line there may be mentioned the human embryonic kidney line 293 (Graham et al., 1977), which contains in particular, integrated into its genome, the left part of the genome of an Ad5 adenovirus (12%) or lines capable of complementing the El and E4 functions as described in particular in Applications No. WO 94/26914 and WO95/02697.
  • the adenoviruses which have multiplied are recovered and purified according to conventional molecular biological techniques, as illustrated in the examples.
  • AAV adeno-associated viruses
  • AAVs DNA viruses of a relatively small size, which integrate into the genome of the cells which they infect, in a stable and site- specific manner. They are capable of infecting a broad spectrum of cells, without inducing any effect on cellular growth, mo ⁇ hology or differentiation. Moreover, they do not appear to be involved in pathologies in humans.
  • the genome of AAVs has been cloned, sequenced and characterized. It comprises about 4700 bases, and contains at each end an inverted repeat region (ITR) of about 145 bases, serving as replication origin for the virus.
  • ITR inverted repeat region
  • the remainder of the genome is divided into 2 essential regions carrying the encapsidation functions: the left hand part of the genome, which contains the rep gene, involved in the viral replication and the expression of the viral genes; the right hand part of the genome, which contains the cap gene encoding the virus capsid proteins.
  • the defective recombinant AAVs according to the invention may be prepared by cotransfection, into a cell line infected with a human helper virus (for example an adenovirus), of a plasmid containing the sequence encoding the ABCl protein bordered by two AAV inverted repeat regions (ITR), and of a plasmid carrying the AAV encapsidation genes (rep and cap genes).
  • a human helper virus for example an adenovirus
  • ITR AAV inverted repeat regions
  • rep and cap genes AAV encapsidation genes
  • the recombinant AAVs produced are then purified by conventional techniques.
  • the construction of recombinant vectors has been widely described in the literature: see in particular Breakfield et al., (1991); EP 453242, EP178220, Bernstein et al. (1985); McCormick, (1985), and the like.
  • the retroviruses are integrating viruses, infecting dividing cells.
  • the genome of the retroviruses essentially comprises two long terminal repeats (LTRs), an encapsidation sequence and three coding regions (gag, pol and env).
  • LTRs long terminal repeats
  • gag, pol and env three coding regions
  • the gag, pol and env genes are generally deleted, completely or partially, and replaced with a heterologous nucleic acid sequence of interest.
  • These vectors may be produced from various types of retroviruses such as in particular MoMuLV ("murine moloney leukemia virus”; also called MoMLV), MSV ("murine moloney sarcoma virus”), HaSV ("harvey sarcoma virus”); SNV ("spleen necrosis virus”); RSV ("rous sarcoma virus”) or Friend's virus.
  • MoMuLV murine moloney leukemia virus
  • MSV murine moloney sarcoma virus
  • HaSV human moloney sarcoma virus
  • SNV spleen necrosis virus
  • RSV rous sarcoma virus
  • Friend's virus Friend's virus.
  • a plasmid containing in particular the LTRs, the encapsidation sequence and said coding sequence is generally constructed, and then used to transfect a so-called encapsidation cell line, capable of providing in trans the retroviral functions deficient in the plasmid.
  • the encapsidation lines are therefore capable of expressing the gag, pol and env genes.
  • encapsidation lines have been described in the prior art, and in particular the PA317 line (US 4,861,719), the PsiCRIP line (WO 90 /02806) and the GP+envAm-12 line (WO 89/07150).
  • the recombinant retroviruses may contain modifications at the level of the LTRs in order to suppress the transcriptional activity, as well as extended encapsidation sequences, containing a portion of the gag gene (Bender et al., 1987). The recombinant retroviruses produced are then purified by conventional techniques.
  • a defective recombinant adenovirus it is preferable to use a defective recombinant adenovirus.
  • the particularly advantageous properties of adenoviruses are preferred for the in vivo expression of a protein having a cholesterol transport activity.
  • the adenoviral vectors according to the invention are particularly preferred for a direct administration in vivo of a purified suspension, or for the ex vivo transformation of cells, in particular autologous cells, in view of their implantation.
  • the adenoviral vectors according to the invention exhibit, in addition, considerable advantages, such as in particular their very high infection efficiency, which makes it possible to carry out infections using small volumes of viral suspension.
  • a line producing retroviral vectors containing the sequence encoding the ABCl protein is used for implantation in vivo.
  • the lines which can be used to this end are in particular the PA317 (US 4,861,719), PsiCrip (WO 90/02806) and GP+envAm-12 (US 5,278,056) cells modified so as to allow the production of a retrovirus containing a nucleic sequence encoding an ABCl protein according to the invention.
  • PA317 US 4,861,719
  • PsiCrip WO 90/02806
  • GP+envAm-12 US 5,278,056 cells modified so as to allow the production of a retrovirus containing a nucleic sequence encoding an ABCl protein according to the invention.
  • totipotent stem cells, precursors of blood cell lines may be collected and isolated from a subject.
  • These cells when cultured, may then be transfected with the retroviral vector containing the sequence encoding the ABCl protein under the control of viral, nonviral or nonviral promoters specific for macrophages or under the control of its own promoter. These cells are then reintroduced into the subject. The differentiation of these cells will be responsible for blood cells expressing the ABCl protein, in particular for monocytes which, when transformed to macrophages, participate in the removal of cholesterol from the arterial wall. These macrophages expressing the ABCl protein will have an increased capacity to metabolize cholesterol in excess and will make it available to the cell surface for its removal by the primary acceptors of membrane cholesterol.
  • the sequence encoding the ABCl protein is placed under the control of signals allowing its expression in the infected cells.
  • signals may be expression signals which are homologous or heterologous, that is to say signals different from those which are naturally responsible for the expression of the ABCl protein. They may also be in particular sequences responsible for the expression of other proteins, or synthetic sequences. In particular, they may be sequences of eukaryotic or viral genes or derived sequences, stimulating or repressing the transcription of a gene in a specific manner or otherwise and in an inducible manner or otherwise.
  • they may be promoter sequences derived from the genome of the cell which it is desired to infect, or from the genome of a virus, and in particular the promoters of the El A or major late promoter (MLP) genes of adenoviruses, the cytomegalo virus (CMV) promoter, the RSV-LTR and the like.
  • MLP major late promoter
  • CMV cytomegalo virus
  • the ubiquitous promoters HPRT, vimentin, ⁇ -actin, tubulin and the like
  • the promoters of the intermediate filaments desmin, neurofilaments, keratin, GFAP, and the like
  • the promoters of therapeutic genes of the MDR, CFTR or factor Vi ⁇ type, and the like
  • tissue-specific promoters pyruvate kinase, villin, promoter of the fatty acid binding intestinal protein, promoter of the smooth muscle cell ⁇ -actin, promoters specific for the liver; Apo Al, Apo All, human albumin and the like
  • promoters corresponding to a stimulus steroid hormone receptor, retinoic acid receptor and the like
  • these expression sequences may be modified by addition of enhancer or regulatory sequences and the like.
  • the inserted gene may be inserted into the genome of the defective virus downstream of such a sequence.
  • the invention relates to a defective recombinant virus comprising a nucleic acid encoding an ABCl protein involved in the metabolism of cholesterol under the control of a promoter chosen from RSV-LTR or the CMV early promoter.
  • a promoter chosen from RSV-LTR or the CMV early promoter chosen from RSV-LTR or the CMV early promoter.
  • the present invention also relates to any use of a virus as described above for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising one or more defective recombinant viruses as described above.
  • These pharmaceutical compositions may be formulated for administration by the topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular or transdermal route and the like.
  • the pharmaceutical compositions of the invention comprises a pharmaceutically acceptable vehicle or physiologically compatible excipient for an injectable formulation, in particular for an intravenous injection, such as for example into the patient's portal vein.
  • injectable formulation in particular for an intravenous injection, such as for example into the patient's portal vein.
  • These may relate in particular to isotonic sterile solutions or dry, in particular, freeze-dried, compositions which, upon addition depending on the case of sterilized water or physiological saline, allow the preparation of injectable solutions.
  • Direct injection into the patient's portal vein is preferred ecause it makes it possible to target the infection at the level of the liver and thus to concentrate the therapeutic effect at the level of this organ.
  • the doses of defective recombinant virus used for the injection may be adjusted as a function of various parameters, and in particular as a function of the viral vector, of the mode of administration used, of the relevant pathology or of the desired duration of treatment.
  • the recombinant adenoviruses according to the invention are formulated and administered in the form of doses of between 10 ⁇ and 10 ⁇ pfu/ml, and preferably 10" to 10 ⁇ ⁇ pfu ml.
  • pfu plaque forming unit
  • plaque forming unit corresponds to the infectivity of a virus solution, and is determined by infecting an appropriate cell culture and measuring, generally after 48 hours, the number of plaques that result from infected cell lysis.
  • the techniques for determining the pfu titer of a viral solution are well documented in the literature.
  • the compositions according to the invention may directly contain the producing cells, with a view to their implantation.
  • another subject of the invention relates to any mammalian cell infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to any population of human cells infected with such viruses. These may be in particular cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.
  • the cells according to the invention may be derived from primary cultures. These may be collected by any technique known to persons skilled in the art and then cultured under conditions allowing their proliferation. As regards more particularly fibroblasts, these may be easily obtained from biopsies, for example according to the technique described by Ham (1980). These cells may be used directly for infection with the viruses, or stored, for example by freezing, for the establishment of autologous libraries, in view of a subsequent use.
  • the cells according to the invention may be secondary cultures, obtained for example from pre- established libraries (see for example EP 228458, EP 289034, EP 400047, EP 456640).
  • the cells in culture are then infected with a recombinant virus according to the invention, in order to confer on them the capacity to produce a biologically active ABCl protein.
  • the infection is carried out in vitro according to techniques known to persons skilled in the art. In particular, depending on the type of cells used and the desired number of copies of virus per cell, persons skilled in the art can adjust the multiplicity of infection and optionally the number of infectious cycles produced. It is clearly understood that these steps must be carried out under appropriate conditions of sterility when the cells are intended for administration in vivo.
  • the doses of recombinant virus used for the infection of the cells may be adjusted by persons skilled in the art according to the desired aim.
  • the conditions described above for the administration in vivo may be applied to the infection in vitro.
  • For the infection with a retrovirus it is also possible to co-culture a cell to be infected with a cell producing the recombinant retrovirus according to the invention. This makes it possible to eliminate purification of the retrovirus.
  • Another subject of the invention relates to an implant comprising mammalian cells infected with one or more defective recombinant viruses according to the invention or cells producing recombinant viruses, and an extracellular matrix.
  • the implants according to the invention comprise 10 ⁇ to 10 i ⁇ cells. More preferably, they comprise 10" to 10° cells.
  • the extracellular matrix comprises a gelling compound and optionally a support allowing the anchorage of the cells.
  • various types of gelling agents may be used.
  • the gelling agents are used for the inclusion of the cells in a matrix having the constitution of a gel, and for promoting the anchorage of the cells on the support, where appropriate.
  • Various cell adhesion agents can therefore be used as gelling agents, such as in particular collagen, gelatin, glycosaminoglycans, fibronectin, lectins and the like.
  • collagen is used in the context of the present invention. This may be collagen of human, bovine or murine origin. More preferably, type I collagen is used.
  • the compositions according to the invention preferably comprise a support allowing the anchorage of the cells.
  • anchorage designates any form of biological and/or chemical and/or physical interaction causing the adhesion and/or the attachment of the cells to the support.
  • the cells may either cover the support used, or penetrate inside this support, or both. It is preferable to use in the context of the invention a solid, nontoxic and/or biocompatible support. In particular, it is possible to use polytetrafluoroethylene (PTFE) fibers or a support of biological origin.
  • PTFE polytetrafluoroethylene
  • the present invention thus offers a very effective means for the treatment or prevention of pathologies linked to the transport of cholesterol, in particular obesity, HDL deficiency, hypertriglyceridemia, atherosclerosis, or, in the field of cardiovascular conditions, myocardial infarction, angina, sudden death, cardiac decompensation and cerebrovascular accidents.
  • this treatment may be applied to both humans and any animals such as ovines, bovines, domestic animals (dogs, cats and the like), horses, fish and the like.
  • the invention relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly, a nucleic acid comprising a polynucleotide sequence of either SEQ ID NO: 69 or SEQ ID NO: 70, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly a nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
  • the invention relates to a recombinant host cell comprising nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
  • the invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
  • the invention also relates to a recombinant host cell comprising a recombinant vector according to the invention. Therefore, the invention also relates to a recombinant host cell comprising a recombinant vector comprising any of the nucleic acids of the invention, and more particularly a nucleic acid comprising a nucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
  • the invention relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
  • the invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
  • the preferred host cells according to the invention are for example the following: a) prokaryotic host cells: strains of Escherichia coli (strain DH5- ⁇ ), of Bacillus subtilis, of Salmonella typhimurium, or strains of genera such as Pseudomonas, Streptomyces and Staphylococus ; b) eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No. CCL70), COS cells (ATCC No. CRL 1650), Sf-9 cells (ATCC No. CRL 1711), CHO cells (ATCC No. CCL-61) or 3T3 cells (ATCC No. CRL-6361). MUTATED ABCl POLYPEPTEDES
  • the invention relates to a polypeptide encoded by a mutated ABCl gene, and more particularly a mutated ABCl gene in patients suffering from a deficiency in the reverse transport of cholesterol, more particularly in patients suffering from Tangier disease.
  • polypeptides as depicted in SEQ ID NOs: 89-102 correspond to the non-silent ABCl gene mutations, and are useful in particular for the preparation of antibodies specifically recognizing them.
  • Such antibodies constitute a means for detecting the production of mutated ABC 1 polypeptides in a sample obtained from a subject to be tested, preferably a patient having symptoms characteristic of a deficiency in the reverse transport of cholesterol, and more preferably in a patient having the symptoms characteristic of Tangier and/or FHD disease.
  • the invention also relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
  • the invention also relates to a polypeptide comprising an amino acid sequence as depicted in any one of SEQ ID NOs: 89-102.
  • polypeptides according to the invention are provided in an isolated or purified form.
  • the invention also relates to a method for the production of a polypeptide comprising an amino acid sequence of any one of SEQ D NOs: 71 and 89-102, said method comprising the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) culturing, in an appropriate culture medium, a previously transformed host cell or transfecting a host cell with the recombinant vector of step a); c) recovering the conditioned culture medium or lysing the host cell, for example by sonication or by osmotic shock; d) separating and purifying said polypeptide from said culture medium or alternatively from the cell lysates obtained in step c); and e) where appropriate, characterizing the recombinant polypeptide produced.
  • a specific embodiment of the invention relates to a method for producing a polypeptide comprising an amino acid sequence of amino acids 1-60 of SEQ ID NO: 71.
  • the polypeptides according to the invention may be characterized by binding to an immunoaffinity chromatography column on which the antibodies directed against this polypeptide or against a fragment or a variant thereof have been previously immobilized.
  • a recombinant polypeptide according to the invention may be purified by passing it over an appropriate series of chromatography columns, according to methods known to persons skilled in the art and described for example in F. Ausubel et al (1989).
  • a polypeptide according to the invention may also be prepared by conventional chemical synthesis techniques either in homogeneous solution or in solid phase.
  • a polypeptide according to the invention may be prepared by the technique either in homogeneous solution described by Houben Weyl (1974) or the solid phase synthesis technique described by Merrifield (1965a; 1965b).
  • a polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ED NO: 71 also forms part of the invention.
  • Such a homologous polypeptide comprises an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ
  • an "equivalent amino acid” will be understood to mean for example replacement of a residue in the L form by a residue in the D form or the replacement of a glutamic acid (E) by a pyro-glutamic acid according to techniques well known to persons skilled in the art.
  • the synthesis of peptide containing at least one residue in the D form is described by Koch (1977).
  • two amino acids belonging to the same class that is to say two uncharged polar, nonpolar, basic or acidic amino acids, are also considered as equivalent amino acids.
  • Polypeptides comprising at least one nonpeptide bond such as a retro-inverse bond
  • polypeptides according to the invention comprising one or more additions, deletions, substitutions of at least one amino acid will retain their capacity to be recognized by antibodies directed against the nonmodified polypeptides.
  • the ABCl polypeptides according to the invention in particular 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, may be used for the preparation of an antibody, in particular for detecting the production of a normal or altered form of an ABCl polypeptide in a patient.
  • An antibody directed against a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71 may be used for the preparation of an antibody, in particular for detecting the production of a normal or altered form of
  • an antibody directed against a polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71 also forms part of the invention.
  • Such an antibody is directed against a homologous polypeptide comprising an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ ID NO: 71.
  • Antibody for the pu ⁇ oses of the present invention will be understood to mean in particular polyclonal or monoclonal antibodies or fragments (for example the F(ab)' 2 and Fab fragments) or any polypeptide comprising a domain of the initial antibody recognizing the target polypeptide or polypeptide fragment according to the invention.
  • Monoclonal antibodies may be prepared from hybridomas according to the technique described by Kohler and Milstein (1975).
  • a polypeptide produced recombinantly or by chemical synthesis, and fragments or other derivatives or analogs thereof, including fusion proteins may be used as an immunogen to generate antibodies that recognize a polypeptide according to the invention.
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.
  • the anti-ABC 1 antibodies of the invention may be cross reactive, e.g., they may recognize an ABCl polypeptide from different species. Polyclonal antibodies have greater likelihood of cross reactivity.
  • an antibody of the invention may be specific for a single form of ABCl. Preferably, such an antibody is specific for human ABCl.
  • ABCl polypeptide or derivative or analog thereof Various procedures known in the art may be used for the production of polyclonal antibodies to an ABCl polypeptide or derivative or analog thereof.
  • various host animals can be immunized by injection with an ABCl polypeptide, or a derivative (e.g., fragment or fusion protein) thereof, including but not limited to rabbits, mice, rats, sheep, goats, etc.
  • the ABCl polypeptide or fragment thereof can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum bacille Calmette-Guerin
  • any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (1975), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983a); Cote et al. (1983), and the EBV-hybridoma technique to produce human monoclonal antibodies [Cole et al., 1985).
  • monoclonal antibodies can be produced in germ-free animals [International Patent Publication No. WO 89/12690, published 28 December 1989].
  • chimeric antibodies In fact, according to the invention, techniques developed for the production of "chimeric antibodies" [Morrison et al., (1984); Neuberger et al., (1984); Takeda et al., (1985)] by splicing the genes from a mouse antibody molecule specific for an ABCl polypeptide together with genes from a human antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention.
  • Such human or humanized chimeric antibodies are preferred for use in therapy of human diseases or disorders (described infra), since the human or humanized antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves.
  • such fragments include but are not limited to: the F(ab') 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • radioimmunoassay e.g., ELISA (enzyme-linked immunosorbant assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoa
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies which recognize a specific epitope of an ABCl polypeptide, one may assay generated hybridomas for a product which binds to an ABCl polypeptide fragment containing such epitope. For selection of an antibody specific to an ABCl polypeptide from a particular species of animal, one can select on the basis of positive binding with an ABCl polypeptide expressed by or isolated from cells of that species of animal.
  • the foregoing antibodies can be used in methods known in the art relating to the localization and activity of an ABCl polypeptide, e.g., for Western blotting, ABCl polypeptide in situ, measuring levels thereof in appropriate physiological samples, etc. using any of the detection techniques mentioned above or known in the art.
  • antibodies that agonize or antagonize the activity of an ABCl polypeptide can be generated. Such antibodies can be tested using the assays described infra for identifying ligands.
  • the present invention relates to an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ED NO: 71, also forms part of the invention, as produced in the trioma technique or the hybridoma technique described by Kozbor et al. (1983b).
  • the invention also relates to single-chain Fv antibody fragments (ScFv) as described in US patent No. 4,946,778 or by Martineau et al. (1998).
  • the antibodies according to the invention also comprise antibody fragments obtained with the aid of phage libraries as described by Ridder et al., (1995) or humanized antibodies as described by Reinmann et al. (1997) and Leger et al., (1997).
  • the antibody preparations according to the invention are useful in immunological detection tests intended for the identification of the presence and/or of the quantity of antigens present in a sample.
  • An antibody according to the invention may comprise, in addition, a detectable marker which is isotopic or nonisotopic, for example fluorescent, or may be coupled to a molecule such as biotin, according to techniques well known to persons skilled in the art.
  • the subject of the invention is, in addition, a method of detecting the presence of a polypeptide according to the invention in a sample, said method comprising the steps of: a) bringing the sample to be tested into contact with an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, and b) detecting the antigen/antibody complex formed.
  • the invention also relates to a box or kit for diagnosis or for detecting the presence of a polypeptide in accordance with the invention in a sample, said box comprising: a) an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, and b) a reagent allowing the detection of the antigen/antibody complexes formed.
  • the invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a polynucleotide capable of giving rise to the production of an effective quantity of the normal ABCl polypeptide, in particular a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1- 60 of SEQ ID NO: 71.
  • compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol characterized in that they comprise a therapeutically effective quantity of the normal ABC 1 polypeptide, in particular a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1-60 of SEQ ED NO: 71.
  • the invention also relates to the use of the ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ED NO: 71 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention relates to a pharmaceutical composition for the prevention or treatment of subjects affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of the polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a therapeutically effective quantity of the ABCl polypeptide in said patient, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • a pharmaceutical composition comprising a polypeptide according to the invention will be administered to the patient.
  • the invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a polynucleotide capable of giving rise to the production of an effective quantity of a normal ABCl polypeptide, in particular of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ED NO: 71.
  • compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol characterized in that they comprise a therapeutically effective quantity of a normal ABCl polypeptide, in particular of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71.
  • compositions will be preferably suitable for the administration, for example by the parenteral route, of a quantity of the ABCl polypeptide ranging from 1 ⁇ g/kg/day to 10 mg/kg/day, preferably at least 0.01 mg/kg/day and more preferably between 0.01 and 1 mg/kg/day.
  • the invention also provides pharmaceutical compositions comprising a nucleic acid encoding an ABCl polypeptide according to the invention and pharmaceutical compositions comprising an ABCl polypeptide according to the invention intended for the treatment of diseases linked to a deficiency in the reverse transport of cholesterol, such as Tangier and/or
  • the present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, comprising transferring and expressing in vivo nucleic acids encoding an ABCl protein according to the invention.
  • the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
  • the present invention offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport and metabolism of cholesterol. Specifically, the present invention provides methods to restore or promote improved reverse transport of cholesterol within a patient or subject.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a nucleic acid encoding the ABCl protein, in combination with one or more physiologically compatible vehicle and/or excipient.
  • composition for the in vivo production of the ABCl protein.
  • This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and/or excipient.
  • the present invention also relates to a composition
  • a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • the present invention also relates to a composition
  • a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
  • such a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, placed under the control of appropriate regulatory elements.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a nucleic acid encoding an ABC 1 polypeptide according to the invention in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients.
  • a method of introducing a nucleic acid according to the invention into a host cell comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue.
  • the invention also relates to the use of a nucleic acid according to the invention, encoding the ABCl protein, for the manufacture of a medicament intended for the prevention or treatment of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the invention also relates to the use of a recombinant vector according to the invention, comprising a nucleic acid encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
  • the present invention also relates to the use of a defective recombinant virus according to the invention for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
  • the invention relates to the use of such a defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular disease linked to a deficiency in the reverse transport of cholesterol.
  • the present invention also relates to a pharmaceutical composition comprising one or more defective recombinant viruses according to the invention.
  • the present invention also relates to the use of cells genetically modified ex vivo with a virus according to the invention, or of producing cells such as viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active ABCl protein.
  • the present invention shows that it is possible to inco ⁇ orate a nucleic acid encoding an ABCl polypeptide into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature form. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus inco ⁇ orating such a DNA.
  • the pharmaceutical compositions of the invention comprise a pharmaceutically acceptable vehicle or physiologically compatible excipient for an injectable formulation, in particular for an intravenous injection, such as for example into the patient's portal vein.
  • a pharmaceutically acceptable vehicle or physiologically compatible excipient for an injectable formulation in particular for an intravenous injection, such as for example into the patient's portal vein.
  • injectable formulation in particular for an intravenous injection, such as for example into the patient's portal vein.
  • injectable formulation in particular for an intravenous injection, such as for example into the patient's portal vein.
  • an injectable formulation in particular for an intravenous injection, such as for example into the patient's portal vein.
  • These may relate in particular to isotonic sterile solutions or dry, in particular, freeze-dried, compositions which, upon addition depending on the case of sterilized water or physiological saline, allow the preparation of injectable solutions.
  • Direct injection into the patient's portal vein is preferred because it makes it possible to target the infection at the level of the liver and
  • a "pharmaceutically acceptable vehicle or excipient" includes diluents and fillers which are pharmaceutically acceptable for method of administration, are sterile, and may be aqueous or oleaginous suspensions formulated using suitable dispersing or wetting agents and suspending agents.
  • the particular pharmaceutically acceptable carrier and the ratio of active compound to carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration, and standard pharmaceutical practice.
  • nucleic acid, polypeptide, vector, or host cell of the invention will preferably be introduced in vivo in a pharmaceutically acceptable vehicle or excipient.
  • pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • excipient refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as excipients, particularly for injectable solutions. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
  • the pharmaceutical compositions according to the invention may be equally well administered by the oral, rectal, parenteral, intravenous, subcutaneous or intradermal route.
  • the invention also relates to the use of the ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol.
  • the invention finally relates to a pharmaceutical composition for the prevention or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, combined with one or more physiologically compatible vehicles and/or excipients.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient or subject a nucleic acid encoding an ABCl polypeptide in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient or subject a therapeutically effective quantity of an ABCl polypeptide according to the invention in said patient or subject, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
  • nucleic acids, polypeptides, recombinant vectors, and compositions according to the invention can be delivered in a vesicle, in particular a liposome (see Langer, 1990; Treat et al., 1989; and Lopez-Berestein, 1989).
  • the nucleic acids, polypeptides, recombinant vectors, recombinant cells, and compositions according to the invention can be delivered in a controlled release system.
  • the polypeptide may be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration.
  • a pump may be used (see Langer, 1990; Sefton, 1987; Buchwald et al., 1980; Saudek et al., 1989).
  • polymeric materials can be used (Langer and Wise, 1974; Smolen and Ball, 1984; Ranger and Peppas, 1983; Levy et al., 1985; During et al., 1989; and Howard et al., 1989).
  • a controlled release system can be placed in proximity of the target tissue or organ, i.e., the cardiovascular system, thus requiring only a fraction of the systemic dose (see Goodson, 1984). Other controlled release systems are discussed in the review by Langer (1990).
  • recombinant cells that have been transformed with a nucleic acid according to the invention and that express high levels of an ABCl polypeptide according to the invention can be transplanted in a subject in need of ABCl polypeptide.
  • autologous cells transformed with an ABCl encoding nucleic acid according to the invention are transplanted to avoid rejection; alternatively, technology is available to shield non- autologous cells that produce soluble factors within a polymer matrix that prevents immune recognition and rejection.
  • the ABCl polypeptide can be delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration.
  • the ABCl polypeptide, properly formulated, can be administered by nasal or oral administration.
  • a constant supply of ABCl can be ensured by providing a therapeutically effective dose (i.e., a dose effective to induce metabolic changes in a subject) at the necessary intervals, e.g., daily, every 12 hours, etc.
  • a therapeutically effective dose i.e., a dose effective to induce metabolic changes in a subject
  • the necessary intervals e.g., daily, every 12 hours, etc.
  • a subject in whom administration of the nucleic acids, polypeptides, recombinant vectors, recombinant host cells, and compositions according to the invention is performed is preferably a human, but can be any animal.
  • the methods and pharmaceutical compositions of the present invention are particularly suited to administration to any animal, particularly a mammal, and including, but by no means limited to, domestic animals, such as feline or canine subjects, farm animals, such as but not limited to bovine, equine, caprine, ovine, and porcine subjects, wild animals (whether in the wild or in a zoological garden), research animals, such as mice, rats, rabbits, goats, sheep, pigs, dogs, cats, etc., avian species, such as chickens, turkeys, songbirds, etc., i.e., for veterinary medical use.
  • a pharmaceutical composition comprising a nucleic acid, a recombinant vector, a polypeptide, or a recombinant host cell, as defined above, will be administered to the patient or subject.
  • the invention also relates to various methods of screening compounds or small molecules for therapeutic use which are useful in the treatment of diseases due to a deficiency in the metabolism of cholesterol, particularly in the transport of cholesterol, still more particularly in the reverse transport of cholesterol, such as Tangier disease, or more generally FHD-type conditions.
  • the invention therefore also relates to the use of an ABC 1 polypeptide, or of cells expressing an ABCl polypeptide, for screening active ingredients for the prevention or treatment of diseases resulting from a dysfunction in the reverse transport of cholesterol.
  • the catalytic sites and oligopeptide or immunogenic fragments of an ABC 1 polypeptide can serve for screening product libraries by a whole range of existing techniques.
  • the polypeptide fragment used in this type of screening may be free in solution, bound to a solid support, at the cell surface or in the cell. The formation of the binding complexes between the ABCl polypeptide fragments and the tested agent can then be measured.
  • Another possibility is to perform a product screening method using an ABCl neutralizing antibody competition, an ABCl protein and a product potentially binding the ABCl protein.
  • the antibodies may be used to detect the presence of a peptide having a common antigenic unit with an ABCl polypeptide or protein.
  • kinase-specific ATP homologs involved in the activation of the molecules, as well as phosphatases, which may be able to avoid the dephosphorylation resulting from said kinases.
  • inhibitors of the phosphodiesterase (PDE) theophylline and 3-isobutyl-l-methylxanthine type or the adenylcyclase forskolin activators may be mentioned in particular inhibitors of the phosphodiesterase (PDE) theophylline and 3-isobutyl-l-methylxanthine type or the adenylcyclase forskolin activators.
  • PDE phosphodiesterase
  • this invention relates to the use of any method of screening products, i.e., compounds, small molecules, and the like, based on the method of translocation of cholesterol (see Example 13) between the membranes or vesicles, this being in all synthetic or cellular types, that is to say of mammals, insects, bacteria, or yeasts expressing constitutively or having inco ⁇ orated a human ABCl encoding nucleic acid.
  • labeled lipid analogs may be used.
  • the ABCl protein allowed anion transport
  • the present invention also relates to the use of such a system for screening molecules modulating the activity of the ABCl protein (see Example 14).
  • ABCl protein by determining the release of EL-lbeta from any cell type expressing two proteins
  • the invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) preparing a membrane vesicle comprising an ABCl polypeptide and a lipid substrate comprising a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and/or quantitatively measuring release of the lipid substrate comprising a detectable marker; and d) comparing the release measurement obtained in step b) with a measurement of release of labeled lipid substrate by a vesicle that has not been previously incubated with the agonist or antagonist candidate compound.
  • the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71.
  • the ABCl polypeptide comprises amino acids 1-60 of SEQ ED NO: 71.
  • the membrane vesicle is a synthetic lipid vesicle, which may be prepared according to techniques well known to a person skilled in the art.
  • the ABCl protein may be a recombinant ABCl protein.
  • the membrane vesicle is a vesicle of a plasma membrane derived from cells expressing an ABC 1 polypeptide. These may be cells naturally expressing an ABCl polypeptide or cells transfected with a nucleic acid encoding an ABCl polypeptide or recombinant vector comprising a nucleic acid encoding an ABC 1 polypeptide.
  • the lipid substrate is chosen from cholesterol or phosphatidylcholine.
  • the lipid substrate is radioactively labeled, for example with an isotope chosen from 3 H or 125 I.
  • the lipid substrate is labeled with a fluorescent compound, such as NBD or pyrene.
  • the membrane vesicle comprising the labeled lipid substrate and the ABCl polypeptide is immobilized at the surface of a solid support prior to step b).
  • the measurement of the fluorescence or of the radioactivity released by the vesicle is the direct reflection of the activity of lipid substrate transport by the ABCl polypeptide.
  • the invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) obtaining cells, for example a cell line, that, either naturally or after transfecting the cell with an ABCl encoding nucleic acid, expresses an ABCl polypeptide; b) incubating the cells of step a) in the presence of an anion labeled with a detectable marker; c) washing the cells of step b) in order to remove the excess of the labeled anion which has not penetrated into these cells; d) incubating the cells obtained in step c) with an agonist or antagonist candidate compound for the ABCl polypeptide; e) measuring efflux of the labeled anion; and f) comparing the value of efflux of the labeled anion determined in step e) with a value of the efflux of a labeled anion measured with cells that have not been previously incubated in the presence
  • the ABCl polypeptide comprises an amino acid sequence of SEQ ID NO: 71. In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of
  • the cells used are cells naturally expressing an ABCl polypeptide. They may be human monocytes in primary culture, purified from a population of human blood mononuclear cells. They may also be human » monocytic cell lines, such as the monocytic leukemia line THP 1.
  • the cells used in the screening method described above may be cells not naturally expressing, or alternatively expressing at a low level, an ABCl polypeptide, said cells being transfected with a recombinant vector according to the invention capable of directing the expression of a nucleic acid encoding an ABCl polypeptide.
  • the cells may be cells having a natural deficiency in anion transport, or cells pretreated with one or more anion channel inhibitors such as VerapamilTM or tetraethylammonium.
  • the anion is a radioactively labeled iodide, such as the salts K 125 I or Na 125 I.
  • the measurement of efflux of the labeled anion is determined periodically over time during the experiment, thus making it possible to also establish a kinetic measurement of this efflux.
  • the value of efflux of the labeled anion is determined by measuring the quantity of labeled anion present at a given time in the cell culture supernatant.
  • the value of efflux of the labeled anion is determined as the proportion of radioactivity found in the cell culture supernatant relative to the total radioactivity corresponding to the sum of the radioactivity found in the cell lysate and the radioactivity found in the cell culture supernatant.
  • the subject of the invention is also a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) culturing cells of a human monocytic line in an appropriate culture medium, in the presence of purified human albumin; b) incubating the cells of step a) simultaneously in the presence of a compound stimulating the production of IL-1 beta and of an agonist or antagonist candidate compound; c) incubating the cells obtained in step b) in the presence of an appropriate concentration of ATP; d) measuring EL-1 beta released into the cell culture supernatant; and e) comparing the value of the release of the EL-1 beta obtained in step d) with the value of the EL-1 beta released into the culture supernatant of cells which have not been previously incubated in the presence of the agonist or antagonist candidate compound.
  • the cells used belong to the human leukemic monocytic line THP1.
  • the compound stimulating the production of IL-1 beta is a lipopolysaccharide.
  • the production of EL-1 alpha, EL-6 and TNF alpha by these cells is also qualitatively and/or quantitatively determined.
  • the level of expression of the messenger RNA encoding EL-1 beta is also determined.
  • EXAMPLE 1 Tissue distribution of the transcripts of the ABCl gene according to the invention.
  • the profile of expression of the polynucleotides according to the present invention is determined according to the protocols for PCR-coupled reverse transcription and Northern blot analysis described in particular by Sambrook et al. (1989).
  • a pair of primers as described above may be synthesized from a cDNA of the human ABCl gene comprising a polynucleotide sequence as depicted in SEQ ED NOs: 69 and 70. This primer pair may be used to detect the corresponding ABCl cDNA.
  • two oligonucleotide primers specific for ABCl comprising either 1) a sequence contained within nucleotide region 1-184 of SEQ ID NO: 69 and a complementary sequence contained within nucleotide region 6968-9741 of SEQ ID NO: 69, or 2) a sequence contained within nucleotide region 1-297 of SEQ ED NO: 70 and a complementary sequence contained within nucleotide region 7081-9854 of SEQ ED NO: 70, may be used to isolate the ABC 1 cDNA.
  • the polymerase chain reaction is carried out on cDNA templates corresponding to retrotranscribed polyA + mRNAs (Clontech).
  • the reverse transcription to cDNA is carried out with the enzyme SUPERSCRIPT Q (GibcoBRL, Life Technologies) according to the conditions described by the manufacturer.
  • the polymerase chain reaction is carried out according to standard conditions, in 20 ⁇ l of reaction mixture with 25 ng of cDNA preparation.
  • the reaction mixture is composed of 400 ⁇ M of each of the dNTPs, 2 units of Thermus aquaticus (Taq) DNA polymerase (Ampli Taq Gold; Perkin Elmer), 0.5 ⁇ M of each primer, 2.5 mM MgC12, and PCR buffer.
  • PCR cycles [denaturing 30 seconds at 94°C, annealing of 30 seconds divided up as follows during the 34 cycles: 64°C (2 cycles), 61°C (2 cycles), 58°C (2 cycles), and 55°C (28 cycles), and an extension of one minute per kilobase at 72°C] are carried out after a first step of denaturing at 94°C for 10 minutes using a Perkin Elmer 9700 thermocycler.
  • the PCR reactions are visualized on agarose gel by electrophoresis.
  • the cDNA fragments obtained may be used as probes for a Northern blot analysis and may also be used for the exact determination of the polynucleotide sequence.
  • a cDNA probe produced as described above is labeled with 32 P by means of the DNA labeling system High Prime (Boehringer) according to the instructions indicated by the manufacturer. After labeling, the probe is purified on a
  • Tissue Northern, MTN, Clontech Blot 2, reference 77759-1) is hybridized with the labeled probe.
  • the protocol followed for the hybridizations and washes may be either directly as that described by the manufacturer (Instruction manual PT 1200-1) or an adaptation of this protocol using methods known to persons skilled in the art and described for example in F. Ausubel et al (1999). It is thus possible to vary, for example, the prehybridization and hybridization temperatures in the presence of formamide.
  • the blot is analyzed after overnight exposure in contact with a phosphorus screen revealed with the aid of Storm (Molecular Dynamics, Sunnyvale, CA).
  • This Example describes the isolation and identification of cDNA molecules encoding the full length human ABCl protein. 5' extension of the partial ABCl cDNA sequence (GenBank Accession # AJ012376, Langmann et al., 1999) was performed using a modified 5' RACE approach.
  • THP1 cDNA library in the Lambda phage vector LZip-lox, Life Tech® which had previously been made from THP1 cells that were differentiated with phorbol ester and then loaded with acetylated LDL to convert them to the foam cell phenotype was used in this Example. It has been shown that THP1 cells, when loaded with cholesterol, strongly up- regulate the expression of the human ABCl gene (Langmann et al., 1999). This THP1 cDNA library was used to 5' extend the human ABCl cDNA, since it should be enriched for ABCl cDNA.
  • a set of nested PCR primers (SEQ D NOs: 155 and 156) which hybridize to nucleotides of the 5' published sequence region of human ABCl cDNA (Langmann et al., 1999) was used to elongate the ABCl cDNA in the 5' direction (see Table VH).
  • Two sets of nested vector arm specific primers (SEQ ED NOs: 2, 140, 153, and 154) were designed for the reverse synthesis in the direction towards the human ABCl cDNA specific primer (see Table VII and Figure 1).
  • the term “Comp” refers to the complementary nucleotide sequence of the nucleotide positions indicated. In this manner, a PCR product corresponding to the true 5' end of the human ABCl cDNA can be obtained, regardless of its orientation within the vector.
  • TTTP1 cDNA library (cleared bacterial lysate, containing approximately 5 xlO 9 pfu ml of ⁇ Zip-lox-THPl-FC library phage, 2.5xl0 6 recombinants, with an average insert size of 1.5kb) was heated to 95°C for 10 minutes to lyse the phage and release its DNA.
  • the PCR reaction was amplified as above except the cycling parameters were adjusted as follows: 25 cycles at 94°C for 20 seconds, 56°C for 20 seconds, and 72°C for 1.5 minutes. Five ul of the secondary PCR reaction were analyzed on an agarose gel as described above.
  • the primary PCR reactions yielded only faint bands, other than the primers staining (see Figure 2-a). Therefore, a secondary nested PCR reaction was performed.
  • the secondary PCR reactions ( Figure 2-b) produced an intensely stained, single band of approximately 800bp using primers ABC 1-9 (SEQ ED NO: 156) and ⁇ Zip-seq-2 (SEQ ED NO: 2) in two of the reactions (see lanes 3 and 6, Figure 2-b), while there was a fainter band of approximately 750bp in lane 7 using primers ABC1-9 (SEQ ID NO: 156) and ⁇ Zip-seq-1 (SEQ ID NO: 154).
  • an additional nested PCR reaction was performed using the diluted primary PCR reactions that had yielded the bands obtained in the secondary PCR reactions (lanes 3, 6, and 7 of Figure 2-b) using primers ABC 1-7 (SEQ ED NO: 139) and ⁇ Zip-seq-2 (SEQ ED NO: 154) or ⁇ Zip-seq-1 (SEQ ED NO: 2), respectively.
  • This additional nested PCR reaction should yield a product that is 254bp smaller than the one obtained in the secondary PCR reactions. This was indeed the case for the samples corresponding to lanes 3 and 6. However, the sample of lane 7 yielded no such product and therefore, was not likely to be ABCl cDNA specific and was not analyzed further.
  • the secondary PCR reactions consisting of the first sample 3, the lOOul scale-up of sample 3, and sample 6 were gel purified in preparation for cloning and sequencing (see Figure 3). Following purification, 5ul of the three gel purified samples were sequenced using the ABC 1-7 oligonucleotide (SEQ ED NO: 139) as a primer. In addition, the purified products were each cloned into the plasmid, PCR2.1 (Invitrogen).
  • This new open reading frame extended the human ABCl protein by an additional 60 amino acid residues (amino acids 1-60 of SEQ ED NO: 71) as compared to the sequence of Langmann et al. (1999).
  • the invention provides nucleic acids encoding the full length human ABCl protein (SEQ ED NO: 71).
  • the present invention provides nucleic acids encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
  • ED NOs: 69 and 70 comprise the new 5' extended ABCl cDNA region (SEQ ED NO: 3) obtained within this Example. Specifically, nucleotides 1-244 of SEQ ED NO: 3 correspond to nucleotides 1-244 of SEQ ID NO: 69 and nucleotides 114-357 of SEQ ID NO: 70, respectively.
  • a complete clone may be directly isolated by hybridization by screening a cDNA library by means of a polynucleotide probe specific for the sequence of the gene of interest.
  • a specific probe of 30-40 nucleotides is synthesized using a synthesizer of the Applied Biosystem/Perkin Elmer trademark depending on the chosen sequence.
  • the oligonucleotide obtained is radiolabeled, for example with [ ⁇ - 32 P]ATP using T4 polynucleotide kinase and is purified according to the customary methods (e.g. Maniatis et al., 1982 or F. Ausubel et al., 1989).
  • the clone library containing the cDNA that is desired to screen is established on a culture medium in a Petri dish (1.5% agar) containing the appropriate antibiotics according to the customary methods cited above (F. Ausubel et al.).
  • the colonies thus produced after incubation are transferred on nitrocellulose filters and screened by means of the radiolabeled nucleotide probe, according to the customary methods and the colonies hybridizing with the probe are isolated and subcloned.
  • the DNA of the clones thus identified is prepared and analyzed by sequencing.
  • the clones containing the fragments corresponding to the complete cDNA are purified and recloned into the vector pcDNA3 according to the protocols known to persons skilled in the art and presented for example in F. Ausubel et al (1989).
  • RACE-PCR Rapid Amplification of cDNA End-PCR
  • RNA oligonucleotide is ligated to the 5' end of an mRNA population.
  • a set of primers specific respectively for the adaptor ligated in 5' and for a sequence situated in 3' of the gene of interest is used in PCR to amplify the 5' portion of the desired cDNA.
  • the amplified fragment is then used to reconstruct the complete cDNA.
  • the verification of the impairment of the level of expression of the ABCl gene causing the Tangier cellular phenotype may be determined by hybridizing these sequences with probes corresponding to the mRNAs obtained from fibroblasts of subjects suffering or otherwise from the disease, according to the methods described below:
  • RNAs Preparation of the total RNAs. of the poly(A) + mRNAs and of cDNA probes
  • the total RNAs are obtained from cell cultures of the fibroblasts of normal subjects or subjects suffering from Tangier disease by the guanidine isothiocyanate method (Chomczynski & Sacchi, 1987).
  • the poly(A) + mRNAs are obtained by affinity chromatography on oligo(dT)- cellulose columns (Sambrook et al., 1989) and the cDNAs used as probes are obtained by RT-PCR (DeRisi et al., 1997) with oligonucleotides labeled with a fluorescent product (Amersham Pharmacia Biotech ; CyDyeTM).
  • the glass membranes containing the sequences presented in this patent application, corresponding to the Tangier gene are hybridized with the cDNA probes obtained from fibroblasts (Iyer et al., 1999).
  • the use of the Amersham/molecular Dynamics system (Avalanche MicroscannerTM) allows the quantification of the expressions of the products of sequences on healthy or affected cell types.
  • EXAMPLE 4 Construction of the expression vector containing the complete cDNA of ABCl in mammalian cells
  • the ABCl gene may be expressed in mammalian cells.
  • a typical eukaryotic expression vector contains a promoter which allows the initiation of the transcription of the mRNA, a sequence encoding the protein, and the signals required for the termination of the transcription and for the polyadenylation of the transcript. It also contains additional signals such as enhancers, the Kozak sequence and sequences necessary for the splicing of the mRNA.
  • An effective transcription is obtained with the early and late elements of the SV40 virus promoters, the retroviral LTRs or the CMV virus early promoter. However, cellular elements such as the actin promoter may also be used.
  • Many expression vectors may be used to carry out the present invention, an example of such a vector is pcDNA3 (Invitrogen).
  • EXAMPLE 5 Production of normal and mutated ABCl polypeptides.
  • the normal ABCl polypeptide encoded by the complete cDNA of ABCl whose isolation is described in Example 2 (cloning of the complete cDNA), or the mutated ABCl polypeptides whose complete cDNA may also be obtained according to the techniques described in Example 2, may be easily produced in a bacterial or insect cell expression system using the baculovirus vectors or in mammalian cells with or without the vaccinia virus vectors. All the methods are now widely described and are known to persons skilled in the art. A detailed description thereof will be found for example in F. Ausubel et al. (1989).
  • EXAMPLE 6 Production of an antibody directed against one of the mutated ABCl polypeptides.
  • the antibodies in the present invention may be prepared by various methods (Current Protocols In Molecular Biology Volume 1 edited by Frederick M. Ausubel, Roger Brent, Robert E. Scientific, David D. Moore, J.G. Seidman, John A. Smith, Kevin Struhl - Massachusetts General Hospital Harvard Medical School, chapter 11, 1989).
  • the cells expressing a polypeptide of the present invention are injected into an animal in order to induce the production of serum containing the antibodies.
  • the proteins are prepared and purified so as to avoid contaminations. Such a preparation is then introduced into the animal with the aim of producing polyclonal antisera having a higher activity.
  • the antibodies of the present invention are monoclonal antibodies.
  • Such monoclonal antibodies may be prepared using the hybridoma technique (K ⁇ hler et al, 1975 ; K ⁇ hler et al, 1976 ; Kohler et al, 1976 ; Hammeling et al., 1981).
  • such methods involve immunizing the animal (preferably a mouse) with a polypeptide or better still with a cell expressing the polypeptide. These cells may be cultured in a suitable tissue culture medium.
  • the cells in an Eagle medium (modified Earle) supplemented with 10% fetal bovine serum (inactivated at 56°C) and supplemented with about 10 g /l of nonessential amino acids, 1000 U/ml of penicillin and about 100 ⁇ g/ml of streptomycin.
  • an Eagle medium modified Earle
  • fetal bovine serum inactivated at 56°C
  • the splenocytes of these mice are extracted and fused with a suitable myeloma cell line.
  • a suitable myeloma cell line SP20
  • the parental myeloma cell line SP20
  • the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described by Wands et al. (1981).
  • the hybridoma cells obtained after such a selection are tested in order to identify the clones secreting antibodies capable of binding to the polypeptide.
  • antibodies capable of binding to the polypeptide may be produced according to a 2-stage procedure using anti-idiotype antibodies such a method is based on the fact that the antibodies are themselves antigens and consequently it is possible to obtain an antibody recognizing another antibody.
  • the antibodies specific for the protein are used to immunize an animal, preferably a mouse.
  • the splenocytes of this animal are then used to produce hybridoma cells, and the latter are screened in order to identify the clones which produce an antibody whose capacity to bind to the specific antibody-protein complex may be blocked by the polypeptide.
  • These antibodies may be used to immunize an animal in order to induce the formation of antibodies specific for the protein in a large quantity.
  • Fab and F(ab')2 and the other fragments of the antibodies of the present invention are typically produced by proteolytic cleavage with the aid of enzymes such as Papa ⁇ n (in order to produce the Fab fragments) or Pepsin (in order to produce the F(ab')2 fragments). Otherwise, the secreted fragments recognizing the protein may be produced by applying the recombinant DNA or synthetic chemistry technology.
  • chimeric monoclonal antibodies For the in vivo use of antibodies in humans, it would be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies may be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. The methods for producing the chimeric antibodies are known to persons skilled in the art (for a review, see : Morrison, (1985) ; Oi et al., (1986) ; Cabilly et al., US patent No.
  • the Tangier disease is characterized by an accelerated catabolism of the high-density lipoprotein (HDL) particles and an accumulation of cholesterol in the tissues.
  • the fibroblasts of the skin of patients suffering from Tangier disease have a reduced capacity to eliminate their cholesterol content by the process of efflux of cholesterol carried out by apolipoprotein A-I (apoA-I), the major protein of the HDLs (Francis et al., 1995).
  • apoA-I apolipoprotein A-I
  • This characteristic corresponding to a loss of function is also found in other fibroblast cells of patients suffering from familial HDL deficiency (Marcil et al., 1999a).
  • the correction of the phenotype of the Tangier fibroblasts can be carried out by the transfection of the complete cDNA of ABCl according to the invention, into said cells.
  • the cDNA is inserted into an expression vector which is then transfected according to the methods described below :
  • the primary fibroblasts of human skin are obtained by culturing a skin biopsy obtained from the forearm. These biopsies are performed on patients suffering from Tangier disease having the clinical and biochemical features of the "homozygotes", that is to say orange-colored tonsils, plasma concentrations of apoA-I and of cholesterol-HDL less than the 5 th percentile.
  • the normal fibroblast lines are obtained from the American Type Culture Collection (Rockville, MD).
  • the fibroblasts are cultured in an EMMEM (Eagle-modified minimium essential medium ; GEBCO) medium supplemented with 10% fetal calf serum, 2 mM glutamine, 100 EU/ml of penicillin and 100 ⁇ g/ml of steptomycin (medium designated EMMEM10).
  • these cells are preloaded with cholesterol by incubating for 24 hours with 50 ⁇ g/ml of cholesterol in the medium described above without calf serum but containing 2 mg/ml of bovine albumin (BSA, fraction V).
  • BSA bovine albumin
  • the fibroblasts preloaded with cholesterol at confluence on 24-well plates are incubated in the EMMEM 10 medium and 1 ⁇ Ci/ml of l,2- 3 H-cholesterol (50 Ci/mmol ; Dupont ; Wilmington, DE) for 48 hours. About 100,000 counts per minute are obtained per well or 1000 counts per minute and per ⁇ g of cellular protein.
  • the cells are washed three times with EMMEM/BSA medium, and incubated with this medium for 24 hours before transfecting the gene of interest and starting the efflux by adding 10 ⁇ g/ml of proteoliposome containing apo A-I in EMMEM/BSA medium.
  • proteoliposomes are prepared by sonication of phosphatidylcholine and purified human apoA-I (Jonas, 1986). The cell transfection is carried out by the calcium phosphate precipitation technique (Sambrook et al., 1989). After the period of efflux, in general 20 hours, the medium is collected, centrifuged (1000 g, 5 min), and the radioactivity determined by liquid scintillation counting. The residual radioactivity in the cells is also determined overnight after extraction of the lipids in isopropanol. The percentage efflux is calculated by dividing the radioactivity measured in the supernatant by the sum of the radioactivities measured, in the supernatant and the cellular extract.
  • An internal standard is prepared by transfection of a marker gene and incubation for 24 hours with an EMMEM/BSA medium without proteoliposome containing apoA-I.
  • the efflux of cellular cholesterol from normal fibroblasts transfected with a control gene correspond to 6 ⁇ 2% whereas that obtained from fibroblasts suffering from Tangier disease and transfected with this control gene is less than 1%.
  • the transfection of the fibroblasts suffering from Tangier disease with a plasmid containing the complete cDNA or the genomic DNA for ABCl according to the invention could make it possible to restore the capacity of these cells to eliminate their excess of cholesterol at a level corresponding to that of normal fibroblasts.
  • EXAMPLE 8 Isolation and characterization of genomic fragments of the human ABCl gene.
  • a fragment of about 3 kb of the human ABC 1 cDNA was obtained from the cDNA clone designated "pflO" containing the first ATP-binding domain of ABCl, this cDNA clone being described in the article by Luciani et al. (1994).
  • the labeled cDNA fragment was used to screen the LLNL (Lawrence Livermore National Labs) cosmid library of chromosome 9, immobilized on a NylonTM filter.
  • the clone cos3a was subcloned in the form of an EcoRI fragment into the vector Gen3zf(-) and sequenced at both ends using the Big Dye Terminator technology on an ABI377 type sequencer (Applied Biosystems, Perkin Elmer).
  • the clones containing distinct inserts (determined after sequencing of the ends of the various inserts or by determining the size thereof) which were too long to be completely sequenced with the aid of the primers hybridizing with the sequences of the vector, were analyzed more before by the technique of transposon insertion and then of sequencing with the aid of primers specific to the transposon ("GPS" system marketed by the company New England Biolabs).
  • Primers for the amplification of the DNA of the patients were designed from nonrepetitive sequences of the intron DNA of the ABCl gene, in such a way that an amplification of the intron-exon junctions as well as the bases essential for the formation of the secondary structure during the splicing step are included in the amplified fragments.
  • the genomic DNA of the patients was amplified with the aid of the primers described above using Qiagen's Star Taq kit or the Supertaq kit, using the hybridization conditions and the amplification cycle conditions recommended by the manufacturer.
  • the amplified PCR products were then purified using a kit marketed by the company Qiagen, and then sequenced by the Big Dye Terminator method on an ABI377 sequencer.
  • EXAMPLE 9 Determination of polymorphisms/mutations in the ABCl gene.
  • the detection of polymo ⁇ hisms or of mutations in the sequences of the transcripts or in the genomic sequence of the ABCl gene may be carried out according to various protocols.
  • the preferred method is direct sequencing.
  • the preferred method consists in preparing the cDNAs and sequencing them directly.
  • the preferred method For patients for whom only DNA is available, and in the case of a transcript where the structure of the corresponding gene is unknown or partially known, it is necessary to precisely determine its intron-exon structure as well as the genomic sequence of the corresponding gene. This therefore involves, in a first instance, isolating the genomic DNA BAC or cosmid clone(s) corresponding to the transcript studied according to the method described in Example 8, sequencing the insert of the corresponding clone(s) and determining the intron-exon structure by comparing the cDNA sequence to that of the genomic DNA obtained.
  • the technique of detection of mutations by direct sequencing consists in comparing the genomic sequences of the ABCl gene obtained from homozygotes for the disease or from at least 8 individuals (4 individuals affected by the pathology studied and 4 individuals not affected).
  • the sequence divergences constitute polymo ⁇ hisms. All those modifying the amino acid sequence of the wild-type protein may be mutations capable of affecting the function of said protein which it is preferred to consider more particularly for the study of cosegregation of the mutation and of the disease (denoted genotype-phenotype correlation) in the pedigree or in the studies of case/control association for the analysis of the sporadic cases.
  • EXAMPLE 10 Identification of a causal gene for a disease linked to a deficiency in the reverse transport of cholesterol by causal mutation or a transcriptional difference
  • Primers for the amplification of the DNA of the patients were designed from nonrepetitive sequences of the intron DNA of the ABCl gene, in such a way that an amplification of the intron-exon junctions as well as the bases essential for the formation of the secondary structure during the RNA splicing step are included in the amplified fragments.
  • amplified PCR products were then purified using a kit marketed by the company Qiagen, and then sequenced by the Big Dye Terminator method on an ABI377 sequencer (Applied Biosystems, Perkin Elmer).
  • EXAMPLE 12 Construction of recombinant vectors comprising a nucleic acid encoding a ABCl protein
  • Total RNA 500 ng isolated from a human cell (i.e., placental tissue, Clontech, Palo Alto, CA, USA, or THPl cells) may be used as source for the synthesis of the cDNA of the human ABCl gene.
  • Methods to reverse transcribe mRNA to cDNA are well known in the art. For example, one may use the system "Superscript one step RT-PCR (Life Technologies, Gaithersburg, MD, USA).
  • Oligonucleotide primers specific for ABCl cDNA may be used for this pu ⁇ ose.
  • two oligonucleotide primers specific for ABCl (0.25 ⁇ M) comprising either 1) a sequence contained within nucleotide region 1-184 of SEQ ID NO: 69 and a complementary sequence contained within nucleotide region 6968-9741 of SEQ ED NO: 69, or 2) a sequence contained within nucleotide region 1-297 of SEQ ED NO: 70 and a complementary sequence contained within nucleotide region 7081-9854 of SEQ ED NO: 70, may be used to isolate a nucleic acid encoding an ABC 1 protein.
  • oligonucleotide primers may be synthesized by the phosphoramidite method on a DNA synthesizer of the ABI 394 type (Applied Biosystems, Foster City, CA, USA). Sites recognized by the restriction enzyme Notl may be inco ⁇ orated into the amplified
  • ABC 1 cDNA to flank the ABC 1 cDNA region desired for insertion into the recombinant vector by a second amplification step using 50 ng of human ABCl cDNA as template, and 0.25 ⁇ M of the ABCl specific oligonucleotide primers used above containing, at their 5' end, the site recognized by the restriction enzyme Notl (5'-GCGGCCGC-3'), in the presence of 200 ⁇ M of each of said dideoxynucleotides dATP, dCTP, dTTP and dGTP as well as the Pyrococcus furiosus DNA polymerase (Stratagene, Inc. La Jolla, CA, USA).
  • the PCR reaction may be carried out over 30 cycles each comprising a step of denaturation at 95°C for one minute, a step of renaturation at 50°C for one minute and a step of extension at 72°C for two minutes, in a thermocycler apparatus for PCR (Cetus Perkin Elmer Norwalk, CT, USA).
  • the human ABCl cDNA insert may then be cloned into the Notl restriction site of an expression vector, for example, the pCMV vector containing a cytomegalovirus (CMV) early promoter and an enhancer sequence as well as the SV40 polyadenylation signal (Beg et al., 1990; Applebaum-Boden, 1996), in order to produce an expression vector designated pABCl.
  • an expression vector for example, the pCMV vector containing a cytomegalovirus (CMV) early promoter and an enhancer sequence as well as the SV40 polyadenylation signal (Beg et al., 1990; Applebaum-Boden, 1996), in order to produce an expression vector designated pABCl.
  • CMV cytomegalovirus
  • the sequence of the cloned cDNA can be confirmed by sequencing on the two strands using the reaction set "ABI Prism Big Dye Terminator Cycle Sequencing ready" (marketed by Applied Biosystems, Foster City, CA, USA) in a capillary sequencer of the ABI 310 type (Applied Biosystems, Foster City, CA, USA).
  • ⁇ -galactosidase cDNA of the expression vector pCMV- ⁇ (Clontech, Palo Alto,
  • CA, USA, Gene Bank Accession No. U02451 may be deleted by digestion with the restriction endonuclease Notl and replaced with a multiple cloning site containing, from the 5' end to the
  • the DNA fragment between the EcoRI and Sanl sites of the modified expression vector pCMV may be isolated and cloned into the modified Xbal site of the shuttle vector pXCXII (McKinnon et al., 1982; McGrory et al., 1988).
  • the EcoRI-Sall DNA fragment isolated from the modified vector pCMV- ⁇ containing the CMV promoter/enhancer, the donor and acceptor splicing sites of FV40 and the polyadenylation signal of FV40 may then be cloned into the EcoRI-Sall site of the modified shuttle vector pXCX, designated pCMV-11.
  • the human ABCl cDNA is obtained by an RT-PCR reaction, as described above, and cloned at the level of the Notl site into the vector pCMV-12, resulting in the obtaining of the vector pCMV-ABCl.
  • the ABCl-rldV recombinant adenovirus containing the human ABCl cDNA may be constructed according to the technique described by McGrory et al. (1988).
  • the vector pAD12-ABCl is cotransfected with the vector tGM17 according to the technique of Chen and Okayama (1987).
  • the vector pAD12-Luciferase was constructed and cotransfected with the vector pJM 17.
  • the recombinant adenoviruses are identified by PCR amplification and subjected to two purification cycles before a large-scale amplification in the human embryonic kidney cell line HEK 293 (American Type Culture Collection, Rockville, MD, USA).
  • the infected cells are collected 48 to 72 hours after their infection with the adenoviral vectors and subjected to five freeze-thaw lysing cycles.
  • the recombinant adenoviruses are stored at -70°C and titrated before their administration to animals or their incubation with cells in culture.
  • the absence of wild-type contaminating adenovirus is confirmed by screening with the aid of PCR amplification using oligonucleotide primers located in the structural portion of the deleted region.
  • Polyclonal antibodies specific for a human ABCl polypeptide may be prepared as described above in rabbits and chicks by injecting a synthetic polypeptide fragment derived from an ABCl protein, comprising all or part of an amino acid sequence as described in SEQ
  • ED NO: 71 These polyclonal antibodies are used to detect and/or quantify the expression of the human ABCl gene in cells and animal models by immunoblotting and/or immunodetection.
  • the biological activity of ABCl may be monitored by quantifying the cholesterol fluxes induced by apoA-I using cells transfected with the vector pCMV-ABCI which have been loaded with cholesterol (Remaley et al., 1997).
  • fibroblasts in primary culture derived from Tangier patients or from patients suffering from hypo-alphalipoproteinemia are transfected with the expression vector pCMV-ABCl (5-25 ⁇ g) using Lipofectamine (BRL, Gaithersburg, MD, USA) or by coprecipitation with the aid of calcium chloride (Chen et al., 1987).
  • the expression of human ABC 1 may be monitored by immunoblotting as well as by quantification of the efflux of cholesterol induced by apoA-1 using transfected and/or infected cells.
  • the evaluation of the physiological role of the ABCl protein in the metabolism of lipoproteins is carried out by determining the total quantity of cholesterol, of triglycerides, of phospholipids and of free cholesterol (Sigma and Wako Chemicals, Richmond, VA, USA), of cholesterol-HDL (CEBA-Corning, Oberlin, OH, USA) and apolipoproteins A-I, A-Q, E and B from mice (Foger et al., 1997), before (day zero) and after (days 2, 4, 7, 10, 14) the administration of the adenovirus.
  • Kinetic studies with the aid of radioactively labelled produces such as apoA-I-HDL,
  • CE-HDL as well as apoB-LDL and CE-LDL are carried out on day 5 after the administration of the vectors rLucif-AdV and rABCl-AdV in order to evaluate the effect of the expression of ABCl on the metabolism of the HDLs and of the LDLs as well as on the release of cholesterol toward the liver.
  • the effect of the expression of ABCl on the development of atherosclerosis may be evaluated by quantifying the mean surface area of aortic lesion in apoE mice after administration of the vector rABCl-Adv.
  • transgenic mice and rabbits overexpressing the ABCl gene may be produced, in accordance with the teaching of Vaisman (1995) and Hoeg (1996) using constructs containing the human ABCl cDNA under the control of endogenous promoters such as ABCl, CMV or apoE.
  • EXAMPLE 13 Use of vesicles for screening for agonist and antagonist molecules of an ABCl protein.
  • the basis of this screening test is the reconstitution of membranes which have inco ⁇ orated the ABCl protein and containing substrates such as cholesterol or phospholipids.
  • the ABCl protein may then be activated or its function repressed by the addition of molecules of interest.
  • the outflow of the substrates through the channel formed by the ABCl protein is then detected.
  • lipid substrate such as phospholipids, cholesterol or cholesterol ester, a radioactive substrate of the 3 H-cholesterol, 125 I-cholesterol or 3 H-phosphatidylcholine type or a fluorescent substrate with NBD or pyrene (Molecular Probes ; http ://www.probes.com) and phospatidylcholine from eggs (1 mM) are dried on the pellet of a glass flask.
  • b) Capture of the proteoliposome on a solid surface This step may be carried out by inco ⁇ orating binding proteins of the integrin type. In this protocol, a capture by the antibodies directed against the ABCl protein and previous adsorbed on a 96- or 384-well plate is used.
  • a solution containing these antibodies at the concentration of 100 ⁇ g/1 are absorbed on these multi-well plates by incubating overnight at 4°C. After washing, the plate is then saturated with bovine albumin at 1 mg/ml incubated for 2 hours at 37°C. The whole is then washed and incubated with the proteoliposomes containing ABCl for 2 hours at 37°C.
  • This step is carried out by incubation of products for 1 hour at 37°C.
  • EXAMPLE 14 Use of anion transport for screening of agonist and antagonist molecules of an ABCl protein.
  • the principle of this test lies in the property that the ABCl protein has for transporting the anions during its activation.
  • the macrophage cells of the THP-1 lines are a model of differentiated macrophages.
  • the cells are cultured in an RPMI 1640 medium supplemented with 10% fetal calf serum in 48-multiwell plates at the density of 2 x 10 5 cells per well.
  • the fibroblast cells of patients suffering from Tangier disease may be used as a negative control because their ABCl protein is not functional. Another negative control may be obtained by the addition of anti-ABC 1 antibodies.
  • anion transport defective cells or cells treated with anion channel inhibitors may also be used.
  • anion channel inhibitors Verapamil type, an inhibitor of P-glycoprotein or tetraethylammonium, a potassium channel inhibitor
  • the cells are then washed with an Earles's modified salt solution (ESS) medium preloaded with 1 ml of Kl at 1 ⁇ mol L (0.1 ⁇ Ci/ml of NaI125) in this ESS medium for 30 minutes at 37°C. The products are then added to the extracellular medium. The cells are then washed with the ESS medium. d) The quantity of iodide in the medium is detected every minute for 11 minutes. The first two points correspond to the basal efflux. At the end of the incubation, the medium is taken up and the quantity of iodine remaining in the cells is counted following lysis of the cells in 1 molar NaOH.
  • ESS Earles's modified salt solution
  • the total quantity of radioactivity at time zero is equal to the sum of the radioactivity found in the supernatant and the residual radioactivity in the cells.
  • the efflux curves are constructed by plotting the percentage of radioactivity released into the medium as a function of time.
  • EXAMPLE 15 Use of THP-1 macrophages expressing EL-lbeta to screen for agonist and antagonist molecules of an ABCl protein.
  • the macrophage cells of the THP-1 lines are a model of differentiated macrophages.
  • the cells are cultured in an RPMI 1640 medium supplemented with 10% fetal calf serum in multiwell plates at the density of 2 105 cells per well.
  • the cells are then washed and placed in an RPMI 1640 medium containing 1 mg/ml of purified human albumin fraction EV.
  • LPS lipopolysaccharide
  • EL-lbeta concentrations of EL-lbeta and of control EL-1 alpha, tumor necrosis factor alpha (TNFalpha) and EL-6 are determined by ELISA kits according to the manufacturers' instructions (R&D Sytem ; human EL-lbeta Chemiluminescent ELISA reference QLB00). The variations of mRNA for EL-lbeta which is not supposed to be affected are evaluated by the Northern blotting technique with the corresponding probe.
  • EXAMPLE 16 ABCl mediated phospholipid and cholesterol efflux
  • DMEM Dulbecco- modified Minimum Essential Medium
  • the cholesterol efflux assay was essentially performed as described by Oram et al. (1986) and Rothblat et al. (1986).
  • Confluent cholesterol-loaded fibroblasts grown on 24-well plates were incubated with EMEM10 containing 1 ⁇ Ci/ml of 1,2- 3H-cholesterol (50 Ci/mmol)(Dupont, Wilmington, DE) for 48 h.
  • this labeling protocol resulted in approximately 100,000 CPM/well or 1000 CPM/ug protein.
  • the percent efflux was calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the media plus the cell fraction. Unless indicated, EMEM/BSA media was used as a blank and the results from the blank were subtracted from the radioactive counts obtained in the presence of a cholesterol acceptor.
  • the phospholipid efflux assay was essentially performed as described by Mendez et al.
  • Choline-containing phospholipids were labeled by incubating confluent cholesterol- loaded fibroblasts grown on 24 well plates with EMEM10 medium containing 5 ⁇ Ci/ml of methyl-3Hcholine chloride (84Ci/mmol (Amersham; Arlington Heights, 111) for 24 h. Cells were washed three times with EMEM/BSA, followed by a lh pre-incubation in EMEM/BSA, prior to incubation with EMEM/BSA media in presence or absence of 10 ⁇ g/ml phospholipid acceptors, i.e..
  • apoA-I, apoA-Q, apoA-EV, apoC-I, apoC-Q, apoC-QI, apoE 3 Typically, this labeling protocol resulted in approximately 500,000 CPM/well or 5000 CPM/ug protein.
  • media was collected and centrifuged (10,000 X g; 5 min). An aliquot of the supernatant was extracted with chloroform:methanol (2: 1), and radioactivity was determined by liquid scintillation counting of the organic phase. The remaining counts in the cell fraction was determined after an overnight extraction with isopropanol, followed by a 1 h extraction with hexane: isopropanol (3:2).
  • the percent efflux is calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the efflux media plus the cell fraction. Unless indicated, EMEM/BSA media was used as a blank and the results from the blank were subtracted from the radioactive counts obtained in the presence of a phospholipid acceptor.
  • Apolipoproteins were purified from human plasma by column chromatography as described by Brewer et al. (1986) and were determined to be over 99 % pure, as assessed by
  • Phosphatidylcholine vesicles and reconstitution of apoA-I with egg yolk phosphatidylcholine at a ratio of 1:2.5 (w/w) was performed by sonication, as previously described by Jonas et al.
  • ApoA-I was iodinated with isotopic 125 Iodide by the iodide monochloride method to a specific activity of 2 X 106 cpm/ ⁇ g.
  • Confluent fibroblasts grown on 24-well plates were incubated with iodinated apoA-I for 3 h at 37°C in the presence and absence of a 50-fold excess of the apolipoprotein A-I and A- ⁇ fractions isolated from HDL. Cells were rapidly washed three times with EMEM BSA at 4°C. Bound iodinated ligands were determined by gamma counting, after dissolving the cell fraction with 0.1 M NaOH and 0.1 %SDS.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Diabetes (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Emergency Medicine (AREA)

Abstract

The present invention relates to nucleic acids corresponding to the various exons and introns of the ABC1 gene, which is a causal gene for pathologies linked to a cholesterol metabolism dysfunction inducing diseases such as atherosclerosis, more particularly disruption in the reverse transport of cholesterol, and more particularly familial HDL deficiencies (FHD), such as Tangier disease. The present invention also relates to ABC1 cDNAs encoding the novel full length ABC1 protein. The invention also relates to means for the detection of polymorphisms in general, and of mutations in particular, in the ABC1 gene or in the corresponding protein produced by the allelic form of the ABC1 gene.

Description

NUCLEIC ACIDS OF THE HUMAN ABCl GENE AND THEIR THERAPEUTIC AND DIAGNOSTIC APPLICATION
FIELD OF THE INVENTION
The present invention relates to nucleic acids corresponding to the various exons and introns of the ABCl gene, which is a causal gene for pathologies linked to a cholesterol metabolism dysfunction inducing diseases such as arteriosclerosis, more particularly disruption in the reverse transport of cholesterol, and more particularly familial HDL deficiencies (FHD), such as Tangier disease. The present invention also relates to ABCl cDNAs encoding the novel full length ABCl protein. The invention also relates to means for the detection of polymoφhisms in general, and of mutations in particular, in the ABCl gene or in the corresponding protein produced by the allelic form of the ABCl gene.
BACKGROUND OF THE INVENTION
Lipids are water-insoluble organic biomolecules, which are essential components of diverse biological functions, including the storage, transport, and metabolism of energy, and membrane structure and fluidity. Lipids are derived from two sources in humans and other animals: some lipids are ingested as dietary fats and oils and other lipids are biosynthesized by the human or animal. In mammals at least 10% of the body weight is lipid, the bulk of which is in the form of triacylglycerols.
Triacylglycerols, also known as triglycerides and triacylglycerides, are made up of three fatty acids esterifϊed to glycerol. Dietary triacylglycerols are stored in adipose tissues as a source of energy, or hydrolyzed in the digestive tract by triacylglycerol Upases, the most important of which is pancreatic lipase. Triacylglycerols are transported between tissues in the form of lipoproteins.
Lipoproteins are micelle-like assemblies found in plasma and contain varying proportions of different types of lipids and proteins (called apoproteins). There are five main classes of plasma lipoproteins, the major function of which is lipid transport. These classes are, in order of increasing density, chylomicrons, very low density lipoproteins (VLDL), intermediate-density lipoproteins (IDL), low density lipoproteins (LDL), and high density lipoproteins (HDL). Although many types of lipid are found associated with each lipoprotein class, each class transports predominantly one type of lipid: triacylglycerols are transported in chylomicrons, VLDL, and IDL; while phospholipids and cholesterol esters are transported in HDL and LDL respectively. Phospholipids are di-fatty acid esters of glycerol phosphate, also containing a polar group coupled to the phosphate. Phospholipids are important structural components of cellular membranes. Phospholipids are hydrolyzed by enzymes called phospholipases.
Phosphatidylcholine, an exemplary phospholipid, is a major component of most eukaryotic cell membranes.
Cholesterol is the metabolic precursor of steroid hormones and bile acids as well as an essential constituent of cell membranes. In humans and other animals, cholesterol is ingested in the diet and also synthesized by the liver and other tissues. Cholesterol is transported between tissues in the form of cholesteryl esters in LDLs and other lipoproteins. Membranes surround every living cell, and serve as a barrier between the intracellular and extracellular compartments. Membranes also enclose the eukaryotic nucleus, make up the endoplasmic reticulum, and serve specialized functions such as in the myelin sheath that surrounds axons. A typical membrane contains about 40% lipid and 60% protein, but there is considerable variation. The major lipid components are phospholipids, specifically phosphatidylcholine and phosphatidylethanolamine, and cholesterol. The physicochemical properties of membranes, such as fluidity, can be changed by modification of either the fatty acid profiles of the phospholipids or the cholesterol content. Modulating the composition and organization of membrane lipids also modulates membrane-dependent cellular functions, such as receptor activity, endocytosis, and cholesterol flux. High-density lipoproteins (HDL) are one of the four major classes of lipoproteins circulating in blood plasma. These lipoproteins are involved in various metabolic pathways such as lipid transport, the formation of bile acids, steroidogenesis, cell proliferation and, in addition, interfere with the plasma proteinase systems.
HDLs are perfect free cholesterol acceptors and, in combination with the cholesterol ester transfer proteins (CETP), lipoprotein lipase (LPL), hepatic lipase (HL) and lecithin:cholesterol acyltransferase (LCAT), play a major role in the reverse transport of cholesterol, that is to say the transport of excess cholesterol in the peripheral cells to the liver for its elimination from the body in the form of bile acid. It has been demonstrated that the HDLs play a central role in the transport of cholesterol from the peripheral tissues to the liver. Various diseases linked to an HDL deficiency have been described, including Tangier and/or FHD disease, HDL deficiency, and LCAT deficiency. In addition, HDL-cholesterol deficiencies have been observed in patients suffering from malaria and diabetes (Kittl et al., 1992; Nilsson et al., 1990; Djoumessi, 1989; Mohanty et al., 1992; Maurois et al., 1985; Grellier et al., 1997; Agbedana et al., 1990; Erel et al., 1998; Cuisinier et al., 1990; Chander et al., 1998; Efthimiou et al., 1992; Baptista et al., 1996; Davis et al., 1993; Davis et al., 1995; Pirich et al., 1993; Tomlinson and Raper, 1996; Hager and Hajduk, 1997, Kwiterovich, 1995, Syvanne et al., 1995a, Syvanne et al., 1995b, and French et al., 1993). The deficiency involved in Tangier and/or FHD disease is linked to a cellular defect in the translocation of cellular cholesterol which causes a degradation of the HDLs and leads to a disruption in the lipoprotein metabolism. Nevertheless, for Tangier and/or FHD disease, the exact nature of the defect has not yet been precisely defined.
Tangier disease is an autosomal co-dominant condition characterized in the homozygous state by the absence of HDL-cholesterol (HDL-C) from plasma, hepatosplenomegaly, peripheral neuropathy, and frequently premature coronary artery disease (CAD). In heterozygotes, HDL-C levels are about one-half those of normal individuals. Impaired cholesterol efflux from macrophages leads to the presence of foam cells throughout the body, which may explain the increased risk of CAD in some Tangier disease families.
In Tangier disease patients, the HDL particles do not incorporate cholesterol from the peripheral cells, are not metabolized correctly, and are rapidly eliminated from the body. The plasma HDL concentration in these patients is therefore, extremely reduced and the HDLs no longer ensure the return of cholesterol to the liver. Cholesterol accumulates in these peripheral cells and causes characteristic clinical manifestations such as the formation of orange-colored tonsils. Furthermore, other lipoprotein disruptions, such as overproduction of triglycerides as well as increased synthesis and intracellular catabolism of phospholipids are also observed in Tangier disease patients. Tangier disease, whose symptoms have been described above, is classified among the familial conditions linked to the metabolism of HDLs, which are the ones most commonly detected in patients affected by coronary diseases. Numerous studies have shown that a reduced level of HDL cholesterol is an excellent indicator of an individual's risk of developing or already having a cardiovascular condition. In this context, syndromes linked to HDL deficiencies have been of increasing interest for the past decade because they make it possible to increase understanding of the role of HDLs in atherogenesis.
Atherosclerosis is defined in histological terms by deposits (lipid or fibrolipid plaques) of lipids and of other blood derivatives in blood vessel walls, especially the large arteries (aorta, coronary arteries, carotid). These plaques, which are more or less calcified according to the degree of progression of the atherosclerotic process, may be coupled with lesions and are associated with the accumulation in the vessels of fatty deposits consisting essentially of cholesterol esters. These plaques are accompanied by a thickening of the vessel wall, hypertrophy of the smooth muscle, appearance of foam cells (lipid-laden cells resulting from uncontrolled uptake of cholesterol by recruited macrophages) and accumulation of fibrous tissue. The atheromatous plaque protrudes markedly from the wall, endowing it with a stenosing character responsible for vascular occlusions by atheroma, thrombosis or embolism, which occur in those patients who are most affected. These lesions can lead to serious cardiovascular pathologies such as infarction, sudden death, cardiac insufficiency, and stroke.
Mutations within genes that play a role in lipoprotein metabolism have been identified. Specifically, several mutations in the apolipoprotein apo A-I gene have been characterized. These mutations are rare and may lead to a lack of production of apo A-I. Mutations in the genes encoding LPL or its activator apo C-II are associated with severe hypertriglyceridemias and substantially reduced HDL-C levels. Mutations in the gene encoding the enzyme LCAT are also associated with a severe HDL deficiency.
In addition, dysfunctions in the reverse transport of cholesterol may be induced by physiological deficiencies affecting one or more of the steps in the transport of stored cholesterol, from the intracellular vesicles to the membrane surface where it is accepted by the HDLs.
Therefore, an increasing need exists in the state of the art to identify genes involved in any of the steps in the metabolism of cholesterol and/or lipoproteins, and in particular, genes associated with dysfunctions in the reverse transport of cholesterol from the peripheral cells to the liver.
Recently, a study was conducted on the segregation of different allelic forms of 343 microsatellite markers distributed over the entire genome and distant from each other by 10.3 cM on average (Rust et al., 1998). This linkage study was carried out on a family comprising five consanguineous lines and which has been well characterized over eleven generations, in which many members are affected by Tangier disease. This study identified a region located in the 9q31 locus of human chromosome 9 that is statistically associated with Tangier disease.
However, the study by Rust et al. (1998) only defined a wide region of the genome whose impairments are likely to be associated with Tangier disease and that the relevant 9q31-34 region contains ESTs but no known gene. It has since been shown that a region of about lcM situated in the 9q31 locus in humans was generally associated with familial HDL deficiencies (Rust et al., 1999 and Brooks-Wilson et al., 1999). More precisely, it has been shown that a gene encoding a protein of the family of ABC transporters, which is located precisely in the region of 1 cM of the 9q31 locus, was involved in pathologies linked to a deficiency in the reverse transport of cholesterol. More particularly, mutations have been described within the gene encoding the ABC-1 transporter in patients impaired in the reverse transport of cholesterol, and most particularly in patients suffering from Tangier and FHD diseases (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999). The ABC (ATP-binding cassette) transport proteins constitute a family of proteins that are extremely well conserved during evolution, from bacteria to humans. The ABC transport proteins are involved in membrane transport of various substrates, for example ions, amino acids, peptides, sugars, vitamins or steroid hormones. The characterization of the complete amino acid sequence of some ABC transporters has made it possible to determine that these proteins had a common general structure, in particular two nucleotide binding folds (NBF) with Walker A and B type units as well as two transmembrane domains, each of the transmembrane domains consisting of six helices. The specificity of the ABC transporters for the various transported molecules appears to be determined by the structure of the transmembrane domains, whereas the energy necessary for the transport activity is provided by the degradation of ATP at the level of the NBF fold.
Several ABC transport proteins that have been identified in humans are associated with various diseases. For example, cystic fibrosis is caused by mutations in the CFTR (cystic fibrosis transmembrane conductance regulator) gene. Moreover, some multiple drug resistance phenotypes in tumor cells have been associated with mutations in the gene encoding the MDR (multi-drug resistance) protein, which also has an ABC transporter structure. Other ABC transporters have been associated with neuronal and tumor conditions (US Patent No. 5,858,719) or potentially involved in diseases caused by impairment of the homeostasis of metals, such as the ABC-3 protein. Likewise, another transport ABC, designated PFIC2, appears to be involved in a progressive familial intrahepatic cholestasia form, this protein being potentially responsible, in humans, for the export of bile salts.
In 1994, a cDNA encoding a new mouse ABC transporter was identified and designated ABCl (Luciani et al., 1994). This protein is characteristic of the ABC transporters in that it has a symmetrical structure comprising two transmembrane domains linked to a highly hydrophobic segment and two NBF units.
In humans, a partial cDNA comprising a 6603 base pair (bp) open reading frame (ORF) of the human ABCl transporter has been identified (Langmann et al., 1999). Based upon this partial cDNA, the human ABCl protein is predicted to comprise 2201 amino acids (aa), which results in a protein of approximately 220 kDa in size (Ibid.). This study also showed that the gene encoding this human ABCl protein isoform is expressed in various tissues, and more particularly at high levels in the placenta, the liver, the lungs, the adrenal glands, as well as several fetal tissues. These authors demonstrated that the expression of the gene encoding the human ABCl protein was induced during the differentiation of monocytes into macrophages in vitro. Furthermore, this study reported that the expression of the gene encoding the ABCl protein is increased when human macrophages are incubated in the presence of acetylated low- density lipoproteins (AcLDLs). However, while it has been shown that patients suffering from Tangier and FHD diseases have a mutated ABCl gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999), the exact role of the human ABCl protein in the lipid transport system is unknown. It is simply assumed that the ABCl protein has a translocase activity for membrane lipid transport. Recently, partial exonic and intronic ABCl genomic DNA and an additional portion of the 3' untranslated region (UTR) of the human ABCl cDNA have been isolated and identified (Rust et al., 1999).
Because patients suffering from Tangier and FHD diseases have been shown to carry a mutated ABCl gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999), the translocase activity of the human ABC 1 protein for membrane lipid transport has been investigated.
The Applicant has discovered and isolated a human ABCl full length cDNA containing additional sequences in the 5' and 3' UTR (untranslated regions) and encoding a ABCl protein, which presents a longer amino acid sequence as to that of Langmann et al. (1999). Full length human ABCl cDNA was used to investigate the mechanisms of cholesterol and phospholipid efflux, demonstrating specific activity and interactions of the full length ABCl protein with various lipid acceptors to promote cellular lipid efflux.
SUMMARY OF THE INVENTION
The present invention relates to nucleic acids corresponding to the various exons and introns of the human ABCl gene, which is a causal gene for pathologies linked to a cholesterol metabolism dysfunction inducing diseases such as arteriosclerosis, more particularly disruption in the reverse transport of cholesterol, and familial HDL deficiencies, such as Tangier and/or FHD disease.
Thus, a first subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ D NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11- 16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a polynucleotide of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence.
The invention also relates to nucleic acids, particularly cDNA molecules, which encode the full length human ABCl protein. Thus, the invention relates to a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in either SEQ ED NO: 69 or SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence. The subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
Another subject of the invention is a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence. According to the invention, a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70 encodes a full length ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71.
Thus, the invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71. In a specific embodiment, the invention also relates to a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
Thus, the invention also relates to a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
The invention also relates to a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO: 71.
The invention also relates to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
The invention also relates to a polypeptide comprising an amino acid sequence having at least 80% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. The invention also relates to a polypeptide having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
Preferably, a polypeptide according to the invention will have a length of 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1 -60 of SEQ ID NO: 71.
Alternatively, a polypeptide according to the invention will comprise a fragment having a length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a polypeptide according to the invention, more particularly of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
The invention also relates to a means for detecting polymoφhisms in general, and mutations in particular, in the ABCl gene or in the corresponding protein produced by the allelic form of the ABCl gene. It has been recently shown that patients suffering from Tangier and FHD diseases have a mutated ABCl gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, and Marcil et al., 1999b). According to the present invention, several additional mutations distributed in different exons of the ABCl gene have been identified in the genome of various patients, in particular patients suffering from a severe form of the disease associated with cardiovascular disorders. Moreover, various polymoφhisms have been found in the introns of the ABCl gene in patients suffering from the mildest forms of the disease, indicating that these patients carry particular alleles of the gene, distinct from the "wild-type" allele(s). Such alleles, partly characterized by these polymoφhisms, are likely to contain substitutions, additions or deletions of nucleotides in the noncoding regions located respectively on the 5' side of the first exon or alternatively on the 3' side of the last exon of the gene, in particular in the regulatory regions, for example, in the promoter sequences or alternatively in the enhancer sequences, of the type which induces defects. These defects may result in either an increase or a decrease in the synthesis of the ABCl polypeptide.
Thus, the invention also relates to a polypeptide encoded by a mutated ABCl gene, and more particularly a mutated ABCl gene in patients suffering from a deficiency in the reverse transport of cholesterol, most particularly in patients suffering from Tangier disease.
The invention therefore relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
The invention also relates to a polypeptide comprising an amino acid sequence as depicted in any one of SEQ ID NOs: 89-102. Thus, another subject of the invention is a nucleic acid encoding a mutated ABCl polypeptide, wherein the nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 72-88, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid encoding a mutated ABCl polypeptide, wherein the nucleic acid comprises a polynucleotide sequence as depicted in any one of SEQ ED NOs: 72-88, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid encoding a polypeptide comprising any one of SEQ ID NOs: 89-102.
According to another aspect, the invention also relates to the nucleotide sequences of the ABCl gene comprising at least one biallelic polymoφhism. Thus, another subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence comprising any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 103 and 109-118, or of a complementary polynucleotide sequence.
Nucleotide probes and primers hybridizing with a nucleic acid sequence located in the region of an ABCl nucleic acid (genomic DNA, messenger RNA, cDNA), in particular, a nucleic acid sequence comprising any one of the mutations or polymoφhisms described above, also form part of the invention.
According to the invention, nucleic acid fragments derived from a nucleic acid comprising a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides
3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-
242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of
SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED
NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ D
NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, are useful for the detection of the presence of at least one copy of a nucleotide sequence of the
ABCl gene or of a fragment or of a variant (containing a mutation or a polymoφhism) thereof in a sample. The nucleotide probes or primers according to the invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ D NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
Preferably, nucleotide probes or primers according to the invention will have a length of 10, 12, 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, in particular of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
Alternatively, a nucleotide probe or primer according to the invention will consist of and/or comprise the fragments having a length of 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, more particularly of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence. The definition of a nucleotide probe or primer according to the invention therefore covers oligonucleotides which hybridize, under the high stringency hybridization conditions defined above, with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The preferred probes and primers according to the invention comprise all or part of a polynucleotide sequence comprising any one of SEQ ED NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence.
The nucleotide primers according to the invention may be used to amplify any one of the nucleic acids according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. Alternatively, the nucleotide primers according to the invention may be used to amplify a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
In a particular embodiment, the nucleotide primers according to the invention may be used to amplify a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant thereof contained in a sample, said method comprising the steps of: a) bringing the sample in which the presence of the target nucleic acid is suspected into contact with a pair of nucleotide primers whose hybridization position is located respectively on the 5' side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.
Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ
ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ
ED NO: 70, or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, contained in a sample, said method comprising the steps of: a) bringing the sample in which the presence of the target nucleic acid is suspected into contact with a pair of nucleotide primers whose hybridization position is located respectively on the 5' side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.
The present invention also relates to a method of detecting the presence of a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence in a sample, said method comprising the steps of:
1) bringing one or more nucleotide probes according to the invention into contact with the sample to be tested; 2) detecting the complex which may have formed between the probe(s) and the nucleic acid present in the sample. According to a specific embodiment of the method of detection according to the invention, the oligonucleotide probes are immobilized on a support.
According to another aspect, the oligonucleotide probes comprise a detectable marker.
Another subject of the invention is a box or kit for amplifying a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) as depicted in any one of SEQ ED NOs: 1, 4-65,
68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, said box or kit comprising: 1) a pair of nucleotide primers in accordance with the invention, whose hybridization position is located respectively on the 5' side and 3' side of the target nucleic acid whose amplification is sought; and optionally,
2) reagents necessary for an amplification reaction.
Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
The subject of the invention is, in addition, a box or kit for amplifying all or part of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, said box or kit comprising:
1) a pair of nucleotide primers in accordance with the invention, whose hybridization position is located respectively on the 5' side and 3' side of the target nucleic acid whose amplification is sought; and optionally, 2) reagents necessary for an amplification reaction. Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
The invention also relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probes according to the invention; b) where appropriate, reagents necessary for a hybridization reaction. According to a first aspect, the detection box or kit is characterized in that the nucleotide probe(s) and primer(s)are immobilized on a support.
According to a second aspect, the detection box or kit is characterized in that the nucleotide probe(s) and primer(s) comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect target nucleic acids of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention. According to preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary nucleic acid sequence. Alternatively, the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. According to a preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 125 and 126, making it possible to amplify the region of exon 5 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 72 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a second preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 127 and 128, making it possible to amplify the region of exon 6 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 73 or 74 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a third preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 131 and 132, making it possible to amplify the region of exon 8 of the ABCl gene carrying the mutations as depicted in SEQ ID NOs: 75-77 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a fourth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 155 and 156, making it possible to amplify the region of exon 27 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 84 described above, or nucleic acids having a complementary polynucleotide sequence. According to a fifth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 159 and 160, making it possible to amplify the region of exon 32 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 85 described above, or nucleic acids having a complementary polynucleotide sequence. According to a sixth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 175 and 176, making it possible to amplify the region of exon 47 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 87 or 88 described above, or nucleic acids having a complementary polynucleotide sequence.
According to another preferred embodiment, a primer according to the invention comprises, generally, all or part of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a complementary sequence.
The invention also relates to a recombinant vector comprising a nucleic acid according to the invention. Preferably, such a recombinant vector will comprise a nucleic acid selected from the group consisting of a) a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1,
4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, b) a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, c) a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence, d) a nucleic acid having at least eight consecutive nucleotides of a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; e) a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ D NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; f) a nucleic acid having 85%, 90%, 95%, or 98% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1- 242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1 -357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; g) a nucleic acid hybridizing, under high stringency hybridization conditions, with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence; h) a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71 ; and i) a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
According to a first embodiment, a recombinant vector according to the invention is used to amplify a nucleic acid inserted therein, following transformation or transfection of a desired cellular host.
According to a second embodiment, a recombinant vector according to the invention corresponds to an expression vector comprising, in addition to a nucleic acid in accordance with the invention, a regulatory signal or nucleotide sequence that directs or controls transcription and/or translation of the nucleic acid and its encoded mRNA.
According to an preferred embodiment, a recombinant vector according to the invention will comprise in particular the following components: (1) an element or signal for regulating the expression of the nucleic acid to be inserted, such as a promoter and/or enhancer sequence;
(2) a nucleotide coding region comprised within the nucleic acid in accordance with the invention to be inserted into such a vector, said coding region being placed in phase with the regulatory element or signal described in (1); and (3) an appropriate nucleic acid for initiation and termination of transcription of the nucleotide coding region of the nucleic acid described in (2).
The present invention also relates to a defective recombinant virus comprising a cDNA nucleic acid encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol. In another preferred embodiment of the invention, the defective recombinant virus comprises a gDNA nucleic acid encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol. Preferably, the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71. More preferably, the ABCl polypeptide comprises amino acids l-60 of SEQ ID NO: 71.
In another preferred embodiment, the invention relates to a defective recombinant virus comprising a nucleic acid encoding an ABCl protein involved in the transport and metabolism of cholesterol under the control of a promoter chosen from RSV-LTR or the CMV early promoter.
According to a specific embodiment, a method of introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue. According to a specific embodiment of the invention, a composition is provided for the in vivo production of the ABCl protein. This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and/or excipient.
Therefore, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements. The present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
Consequently, the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol comprising a nucleic acid encoding the ABC 1 protein, in combination with one or more physiologically compatible excipients.
Preferably, such a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal.
The subject of the invention is, in addition, a pharmaceutical composition intended for the prevention of or treatment of a patient or a subject affected by a dysfunction in the reverse transport of cholesterol comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients. The invention also relates to the use of a nucleic acid according to the invention encoding an ABCl protein for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention also relates to the use of a recombinant vector according to the invention comprising a nucleic acid encoding an ABCl protein for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The subject of the invention is therefore also a recombinant vector comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
The invention also relates to the use of such a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
The present invention also relates to the use of cells genetically modified ex vivo with such a recombinant vector according to the invention, or of cells producing a recombinant vector, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABCl polypeptide. The invention also relates to the use of a nucleic acid according to the invention encoding an ABC 1 protein for the manufacture of a medicament intended for the prevention or treatment of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention also relates to the use of a recombinant vector according to the invention comprising a nucleic acid encoding an ABCl polypeptide according to the invention for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention also relates to the use of a recombinant host cell according to the invention, comprising a nucleic acid encoding an ABCl polypeptide according to the invention for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The present invention also relates to the use of a recombinant vector according to the invention, preferably a defective recombinant virus, for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
The invention relates to the use of such a recombinant vector or defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular disease linked to a deficiency in the reverse transport of cholesterol. Thus, the present invention also relates to a pharmaceutical composition comprising one or more recombinant vectors or defective recombinant viruses according to the invention.
The present invention also relates to the use of cells genetically modified ex vivo with a virus according to the invention, or of cells producing such viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active ABCl protein.
The present invention shows that it is possible to incoφorate a nucleic acid encoding an ABCl polypeptide according to the invention into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature polypeptide. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus incoφorating such a nucleic acid.
In this regard, another subject of the invention relates to any mammalian cell infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to any population of human cells infected with these viruses. These may be in particular cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like. Another subject of the invention relates to an implant comprising mammalian cells infected with one or more defective recombinant viruses according to the invention or cells producing recombinant viruses, and an extracellular matrix. Preferably, the implants according to the invention comprise 105 to 10 ^ cells. More preferably, they comprise 10^ to 10^ cells. More particularly, in the implants of the invention, the extracellular matrix comprises a gelling compound and optionally, a support allowing the anchorage of the cells.
The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly, a nucleic acid comprising either SEQ ID NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence. The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly a nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 69 or.SEQ ID NO: 70, or of a complementary polynucleotide sequence.
Specifically, the invention relates to a recombinant host cell comprising nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71. The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1 -60 of SEQ ED NO: 71.
According to another aspect, the invention also relates to a recombinant host cell comprising a recombinant vector according to the invention. Therefore, the invention also relates to a recombinant host cell comprising a recombinant vector comprising any of the nucleic acids of the invention, and more particularly a nucleic acid comprising a nucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
Specifically, the invention relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
The invention also relates to a method for the production of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, or of a peptide fragment or a variant thereof, wherein the peptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, said method comprising the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) culturing, in an appropriate culture medium, a previously transformed host cell or transfecting a host cell with the recombinant vector of step a); c) recovering the conditioned culture medium or lysing the host cell, for example by sonication or by osmotic shock; d) separating and purifying said polypeptide from said culture medium or alternatively from the cell lysates obtained in step c); and e) where appropriate, characterizing the recombinant polypeptide produced.
A specific embodiment of the invention relates to a method for producing a polypeptide comprising an amino acid sequence of amino acids 1-60 of SEQ ID NO: 71.
A polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ED NO: 71 also forms part of the invention. Such a homologous polypeptide comprises an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ
ID NO: 71.
The ABCl polypeptides according to the invention, in particular 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71.
In a specific embodiment, an antibody according to the invention is directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71.
The present invention relates to an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ED NO: 71 also forms part of the invention, as produced in the trioma technique or the hybridoma technique described by Kozbor et al. (1983b).
Thus, the subject of the invention is, in addition, a method of detecting the presence of a polypeptide according to the invention in a sample, said method comprising the steps of: a) bringing the sample to be tested into contact with an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, and b) detecting the antigen/antibody complex formed.
The invention also relates to a box or kit for diagnosis or for detecting the presence of a polypeptide in accordance with the invention in a sample, said box comprising: a) an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide "homologous" to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, and b) a reagent allowing the detection of the antigen/antibody complexes formed. The invention also relates to a pharmaceutical composition comprising a nucleic acid according to the invention.
The invention also provides pharmaceutical compositions comprising a nucleic acid encoding an ABCl polypeptide according to the invention and pharmaceutical compositions comprising an ABCl polypeptide according to the invention intended for the treatment of diseases linked to a deficiency in the reverse transport of cholesterol, such as Tangier and/or
FHD disease.
The present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, comprising transferring and expressing in vivo nucleic acids encoding an ABCl protein according to the invention. Specifically, the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes. Thus, the present invention offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport and metabolism of cholesterol. Specifically, the present invention provides methods to restore or promote improved reverse transport of cholesterol within a patient or subject.
Consequently, the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a nucleic acid encoding the ABC 1 protein, in combination with one or more physiologically compatible vehicle and/or excipient.
According to a specific embodiment of the invention, a composition is provided for the in vivo production of the ABCl protein. This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically compatible vehicle and/or excipient.
Therefore, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements. The present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
Preferably, such a composition will comprise a nucleic acid comprising a polynucleotide sequence of SEQ ED NO: 69 or SEQ ED NO: 70, placed under the control of appropriate regulatory elements. The invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible vehicle and/or excipient. According to another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a nucleic acid encoding an ABCl polypeptide according to the invention in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
The invention relates to a pharmaceutical composition for the prevention or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, combined with one or more physiologically compatible vehicles and/or excipients.
According to a specific embodiment, a method of introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue.
According to yet another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a therapeutically effective quantity of an ABCl polypeptide according to the invention in said patient, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
Preferably, a pharmaceutical composition comprising an ABCl polypeptide according to the invention will be administered to the patient. Thus, the invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a nucleic acid encoding a normal ABCl polypeptide, in particular an ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71. In a specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
The subject of the invention is, in addition, pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a normal ABCl polypeptide, in particular of a polypeptide comprising an amino acid sequence of SEQ ED NO: 71. In a specific embodiment, the ABCl polypeptide comprises amino acids 1 -60 of SEQ ID NO : 71.
The invention also provides methods for screening small molecules and compounds that act on the ABCl protein to identify agonists and antagonists of ABCl polypeptide that can restore or promote improved reverse transport of cholesterol to effectively combat arteriosclerosis from a therapeutic point of view. These methods are useful to identify small molecules and compounds for therapeutic use in the treatment of diseases due to a deficiency in the metabolism of cholesterol, particularly in the transport of cholesterol, still more particularly in the reverse transport of cholesterol, such as Tangier disease, or more generally, FHD-type conditions.
Therefore, the invention also relates to the use of an ABCl polypeptide or a cell expressing an ABCl polypeptide according to the invention, for screening active ingredients for the prevention or treatment of diseases resulting from a dysfunction in the reverse transport of cholesterol.
The invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) preparing a membrane vesicle comprising an ABCl polypeptide and a lipid substrate comprising a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and/or quantitatively measuring release of the lipid substrate comprising a detectable marker; and d) comparing the release measurement obtained in step b) with a measurement of release of a labeled lipid substrate by a vesicle that has not been previously incubated with the agonist or antagonist candidate compound. In a first specific embodiment, the ABCl polypeptide comprises SEQ ED NO: 71. In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
The invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABC 1 polypeptide, said method comprising the following steps: a) obtaining a cell, for example a cell line, that, either naturally or after transfecting the cell with an ABCl encoding nucleic acid, expresses an ABCl polypeptide; b) incubating the cell of step a) in the presence of an anion labeled with a detectable marker; c) washing the cell of step b) in order to remove the excess of the labeled anion which has not penetrated into these cells; d) incubating the cell obtained in step c) with an agonist or antagonist candidate compound for the ABCl polypeptide; e) measuring efflux of the labeled anion; and f) comparing the value of efflux of the labeled anion determined in step e) with a value of efflux of a labeled anion measured with cell which have not been previously incubated in the presence of the agonist or antagonist candidate compound for the ABCl polypeptide.
In a first specific embodiment, the ABCl polypeptide comprises SEQ ED NO: 71. In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.
The subject of the invention is also a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) culturing cells of a human monocytic line in an appropriate culture medium, in the presence of purified human albumin; b) incubating the cells of step a) simultaneously in the presence of a compound stimulating the production of IL-1 beta and of the agonist or antagonist candidate compound; c) incubating the cells obtained in step b) in the presence of an appropriate concentration of ATP; d) measuring EL-1 beta released into the cell culture supernatant; and e) comparing the value of the release of the EL-1 beta obtained in step d) with the value of the EL-1 beta released into the culture supernatant of cells which have not been previously incubated in the presence of the agonist or antagonist candidate compound.
BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: ABCl 5 'cDNA Extension Strategy;
Figure 2: Agarose Gel Analysis of Primary and Secondary Human ABCl 5' cDNA
Extension PCR Reactions;
Figure 3: Agarose Gel Analysis of Nested Secondary Human ABCl 5' cDNA Extension
Nested PCR Reactions;
Figure 4: Measure of cholesterol efflux in HeLa cell lines expressing human full length
ABC 1 protein in the absence ■ or presence E of apolipoproteins;
Figure 5: Measure of phospholipid efflux in HeLa cell lines expressing human full length
ABCl protein in the absence ■ or presence of apolipoproteins; F Fiigguurree 66AA:: Measure of cholesterol efflux in the absence ■ or presence of apolipoprotein
A-I (Al);
Figure 6B: Measure of phospholipid efflux in the absence ■ or presence ^ of apolipoproteins A-I (Al);
Figure 6C: Measure of cholesterol efflux in the absence ■ or presence of HDL; F Fiigguurree 66DD:: Measure of cholesterol efflux in the absence ■ or presence CI of phosphatidylcholine(PC) ; Figure 7: [125I] apoA-I incubated ABCl cells were placed in the absence of apolipoproteinO , in the presence of apolipoprotein A-I (apoA-I) ■, or in the presence of apolipoprotein A-II (apoA-II)Ξ ;
DETAILED DESCRIPTION OF THE INVENTION
GENERAL DEFINITIONS
The present invention contemplates isolation of a gene encoding an ABC 1 polypeptide of the invention, including a full length, or naturally occurring form of ABCl, and any antigenic fragments thereof from any animal, particularly mammalian or avian, and more particularly human, source.
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., 1989; Glover, 1985; Gait, 1984; Hames and Higgins, 1985; Hames and Higgins, 1984; Freshney, 1986; Perbal, 1984; and F. Ausubel et al., 1994.
Therefore, if appearing herein, the following terms shall have the definitions set out below. As used herein, the term "gene" refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids.
The term "isolated" for the puφoses of the present invention designates a biological material (nucleic acid or protein) which has been removed from its original environment (the environment in which it is naturally present).
For example, a polynucleotide present in the natural state in a plant or an animal is not isolated. The same polynucleotide separated from the adjacent nucleic acids in which it is naturally inserted in the genome of the plant or animal is considered as being "isolated".
Such a polynucleotide may be included in a vector and/or such a polynucleotide may be included in a composition and remains nevertheless in the isolated state because of the fact that the vector or the composition does not constitute its natural environment.
The term "purified" does not require the material to be present in a form exhibiting absolute purity, exclusive of the presence of other compounds. It is rather a relative definition. A polynucleotide is in the "purified" state after purification of the starting material or of the natural material by at least one order of magnitude, preferably 2 or 3 and preferably 4 or 5 orders of magnitude.
For the puφoses of the present description, the expression "nucleotide sequence" may be used to designate either a polynucleotide or a nucleic acid. The expression "nucleotide sequence" covers the genetic material itself and is therefore not restricted to the information relating to its sequence.
The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide sequence" cover RNA, DNA, gDNA or cDNA sequences or alternatively RNA/DNA hybrid sequences of more than one nucleotide, either in the single-stranded form or in the duplex, double-stranded form. A "nucleic acid" is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA. The sequence of nucleotides that encodes a protein is called the sense sequence or coding sequence. The term "nucleotide" designates both the natural nucleotides (A, T, G, C) as well as the modified nucleotides that comprise at least one modification such as (1) an analog of a purine, (2) an analog of a pyrimidine, or (3) an analogous sugar, examples of such modified nucleotides being described, for example, in the PCT application No. WO 95/04 064.
For the puφoses of the present invention, a first polynucleotide is considered as being "complementary" to a second polynucleotide when each base of the first nucleotide is paired with the complementary base of the second polynucleotide whose orientation is reversed. The complementary bases are A and T (or A and U), or C and G.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell. Preferably, the heterologous DNA includes a gene foreign to the cell.
As used herein, the term "homologous" in all its grammatical forms and spelling variations refers to the relationship between proteins that possess a "common evolutionary origin," including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc.) (Reeck et al., 1987). Such proteins (and their encoding genes) have sequence homology, as reflected by their high degree of sequence similarity.
Accordingly, the term "sequence similarity" in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., supra). However, in common usage and in the instant application, the term "homologous," when modified with an adverb such as "highly," may refer to sequence similarity and not a common evolutionary origin.
In a specific embodiment, two DNA sequences are "substantially homologous" or "substantially similar" when at least about 50% (preferably at least about 75%, and more preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; Glover et al., 1985; Hames and Higgins, 1985.
Similarly, in a particular embodiment, two amino acid sequences are "substantially homologous" or "substantially similar" when greater than 30% of the amino acids are identical, or greater than about 60% are similar (functionally identical). Preferably, the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program.
The "percentage identity" between two nucleotide or amino acid sequences, for the puφoses of the present invention, may be determined by comparing two sequences aligned optimally, through a window for comparison. The portion of the nucleotide or polypeptide sequence in the window for comparison may thus comprise additions or deletions (for example "gaps") relative to the reference sequence (which does not comprise these additions or these deletions) so as to obtain an optimum alignment of the two sequences.
The percentage is calculated by determining the number of positions at which an identical nucleic base or an identical amino acid residue is observed for the two sequences (nucleic or peptide) compared, and then by dividing the number of positions at which there is identity between the two bases or amino acid residues by the total number of positions in the window for comparison, and then multiplying the result by 100 in order to obtain the percentage sequence identity.
The optimum sequence alignment for the comparison may be achieved using a computer with the aid of known algorithms contained in the package from the company
WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP
(GCG), 575 Science Doctor , Madison, WISCONSIN.
By way of illustration, it will be possible to produce the percentage sequence identity with the aid of the BLAST software (versions BLAST 1.4.9 of March 1996, BLAST 2.0.4 of February 1998 and BLAST 2.0.6 of September 1998), using exclusively the default parameters
(Altschul et al, 1990; Altschul et al, 1997). Blast searches for sequences similar/homologous to a reference "request" sequence, with the aid of the Altschul et al. algorithm. The request sequence and the databases used may be of the peptide or nucleic types, any combination being possible. The term "corresponding to" is used herein to refer to similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured. A nucleic acid or amino acid sequence alignment may include spaces.
Thus, the term "corresponding to" refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases. A gene encoding an ABCl polypeptide of the invention, whether genomic DNA or cDNA, can be isolated from any source, particularly from a human cDNA or genomic library.
Methods for obtaining genes are well known in the art, as described above (see, e.g., Sambrook et al., 1989).
Accordingly, any animal cell potentially can serve as the nucleic acid source for the molecular cloning of an ABCl gene. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA "library"), and preferably is obtained from a cDNA library prepared from tissues with high level expression of the protein, by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (See, for example, Sambrook et al., 1989; Glover, 1985). Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will not contain intron sequences. Whatever the source, the gene should be molecularly cloned into a suitable vector for propagation of the gene.
In the molecular cloning of the gene from genomic DNA, DNA fragments are generated, some of which will encode the desired gene. The DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication. The linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography. Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired ABCl gene may be accomplished in a number of ways. For example, if an amount of a portion of a ABCl gene or its specific RNA, or a fragment thereof, is available and can be purified and labeled, the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe (Benton and Davis, 1977; Grunstein and Hogness, 1975). For example, a set of oligonucleotides corresponding to the partial amino acid sequence information obtained for the ABCl protein can be prepared and used as probes for DNA encoding ABCl, as was done in a specific example, infra, or as primers for cDNA or mRNA (e.g., in combination with a poly-T primer for RT-PCR). Preferably, a fragment is selected that is highly unique to an ABCl nucleic acid or polypeptide of the invention. Those DNA fragments with substantial homology to the probe will hybridize. As noted above, the greater the degree of homology, the more stringent hybridization conditions can be used. In a specific embodiment, stringency hybridization conditions are used to identify a homologous ABCl gene.
Further selection can be carried out on the basis of the properties of the gene, e.g., if the gene encodes a protein product having the isoelectric, electrophoretic, amino acid composition, or partial amino acid sequence of a ABC 1 protein as disclosed herein. Thus, the presence of the gene may be detected by assays based on the physical, chemical, or immunological properties of its expressed product. For example, cDNA clones, or DNA clones which hybrid- select the proper mRNAs, can be selected which produce a protein that, e.g., has similar or identical electrophoretic migration, isoelectric focusing or non-equilibrium pH gel electrophoresis behavior, proteolytic digestion maps, or antigenic properties as known for ABCl.
An ABCl gene of the invention can also be identified by mRNA selection, i.e., by nucleic acid hybridization followed by in vitro translation. In this procedure, nucleotide fragments are used to isolate complementary mRNAs by hybridization. Such DNA fragments may represent available, purified ABC 1 DNA, or may be synthetic oligonucleotides designed from the partial amino acid sequence information. Immunoprecipitation analysis or functional assays (e.g., tyrosine phosphatase activity) of the in vitro translation products of the products of the isolated mRNAs identifies the mRNA and, therefore, the complementary DNA fragments, that contain the desired sequences. In addition, specific mRNAs may be selected by adsoφtion of polysomes isolated from cells to immobilized antibodies specifically directed against an ABCl polypeptide of the invention.
A radiolabeled ABCl cDNA can be synthesized using the selected mRNA (from the adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA may then be used as a probe to identify homologous ABCl DNA fragments from among other genomic DNA fragments.
"Variant" of a nucleic acid according to the invention will be understood to mean a nucleic acid which differs by one or more bases relative to the reference polynucleotide. A variant nucleic acid may be of natural origin, such as an allelic variant which exists naturally, or it may also be a nonnatural variant obtained, for example, by mutagenic techniques. In general, the differences between the reference (generally, wild-type) nucleic acid and the variant nucleic acid are small such that the nucleotide sequences of the reference nucleic acid and of the variant nucleic acid are very similar and, in many regions, identical. The nucleotide modifications present in a variant nucleic acid may be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid. However, the changes in nucleotides in a variant nucleic acid may also result in substitutions, additions or deletions in the polypeptide encoded by the variant nucleic acid in relation to the polypeptides encoded by the reference nucleic acid. Ln addition, nucleotide modifications in the coding regions may produce conservative or non-conservative substitutions in the amino acid sequence of the polypeptide. Preferably, the variant nucleic acids according to the invention encode polypeptides which substantially conserve the same function or biological activity as the polypeptide of the reference nucleic acid or alternatively the capacity to be recognized by antibodies directed against the polypeptides encoded by the initial reference nucleic acid.
Some variant nucleic acids will thus encode mutated forms of the polypeptides whose systematic study will make it possible to deduce structure-activity relationships of the proteins in question. Knowledge of these variants in relation to the disease studied is essential since it makes it possible to understand the molecular cause of the pathology.
"Fragment" will be understood to mean a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over the common portion, a nucleotide sequence identical to the reference nucleic acid. Such a nucleic acid "fragment" according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length from 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the invention.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester anologs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA- DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double- stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double- stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., supra). The conditions of temperature and ionic strength determine the "stringency" of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a Tm of 55°, can be used, e.g., 5x SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5x SSC, 0.5%> SDS). Moderate stringency hybridization conditions correspond to a higher Tm, e.g., 40% formamide, with 5x or 6x SCC. High stringency hybridization conditions correspond to the highest Tm, e.g., 50% formamide, 5x or 6x SCC. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-0.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-1 1.8). Preferably a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and more preferably the length is at least about 20 nucleotides. In a specific embodiment, the term "standard hybridization conditions" refers to a Tm of
55°C, and utilizes conditions as set forth above. In a preferred embodiment, the Tm is 60°C; in a more preferred embodiment, the Tm is 65 °C.
"High stringency hybridization conditions" for the puφoses of the present invention will be understood to mean the following conditions: 1- Membrane competition and PREHYBRIDIZATION:
- Mix: 40 μl salmon sperm DNA (10 mg/ml)
+ 40 μl human placental DNA (10 mg/ml)
- Denature for 5 minutes at 96°C, then immerse the mixture in ice.
- Remove the 2X SSC and pour 4 ml of formamide mix in the hybridization tube containing the membranes.
- Add the mixture of the two denatured DNAs.
- Incubation at 42°C for 5 to 6 hours, with rotation.
2- Labeled probe competition: - Add to the labeled and purified probe 10 to 50 μl Cot I DNA, depending on the quantity of repeats.
- Denature for 7 to 10 minutes at 95°C.
- Incubate at 65 °C for 2 to 5 hours.
3- HYBRIDIZATION:
- Remove the prehybridization mix.
- Mix 40 μl salmon sperm DNA + 40 μl human placental DNA; denature for 5 min at 96°C, then immerse in ice.
- Add to the hybridization tube 4 ml of formamide mix, the mixture of the two DNAs and the denatured labeled probe/Cot I DNA .
- Incubate 15 to 20 hours at 42°C, with rotation.
4- Washes and Exposure:
- One wash at room temperature in 2X SSC, to rinse. - Twice 5 minutes at room temperature 2X SSC and 0.1% SDS at 65°C.
- Twice 15 minutes at 65°C IX SSC and 0.1% SDS at 65°C. - Envelope the membranes in clear plastic wrap and expose.
The hybridization conditions described above are adapted to hybridization, under high stringency conditions, of a molecule of nucleic acid of varying length from 20 nucleotides to several hundreds of nucleotides. It goes without saying that the hybridization conditions described above may be adjusted as a function of the length of the nucleic acid whose hybridization is sought or of the type of labeling chosen, according to techniques known to one skilled in the art. Suitable hybridization conditions may, for example, be adjusted according to the teaching contained in the manual by Hames and Higgins (1985) or in the manual by F. Ausubel et al. (1999).
As used herein, the term "oligonucleotide" refers to a nucleic acid, generally of at least 15 nucleotides, that is hybridizable to a nucleic acid according to the invention. Oligonucleotides can be labeled, e.g., with 32P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated. In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid encoding an ABCl polypeptide of the invention. In another embodiment, oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of an ABC 1 nucleic acid, or to detect the presence of nucleic acids encoding ABCl. In a further embodiment, an oligonucleotide of the invention can form a triple helix with an ABCl DNA molecule. Generally, oligonucleotides are prepared synthetically, preferably on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.
"Homologous recombination" refers to the insertion of a foreign DNA sequence of a vector in a chromosome. Preferably, the vector targets a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incoφoration of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination. A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3 ' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell. In eukaryotic cells, polyadenylation signals are control sequences.
"Regulatory region" means a nucleic acid sequence which regulates the expression of a nucleic acid. A regulatory region may include sequences which are naturally responsible for expressing a particular nucleic acid (a homologous region) or may include sequences of a different origin (responsible for expressing different proteins or even synthetic proteins). In particular, the sequences can be sequences of eukaryotic or viral genes or derived sequences which stimulate or repress transcription of a gene in a specific or non-specific manner and in an inducible or non-inducible manner. Regulatory regions include origins of replication, RNA splice sites, enhancers, transcriptional termination sequences, signal sequences which direct the polypeptide into the secretory pathways of the target cell, and promoters.
A regulatory region from a "heterologous source" is a regulatory region which is not naturally associated with the expressed nucleic acid. Included among the heterologous regulatory regions are regulatory regions from a different species, regulatory regions from a different gene, hybrid regulatory sequences, and regulatory sequences which do not occur in nature, but which are designed by one having ordinary skill in the art.
A "cassette" refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The segment of DNA encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For puφoses of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then trans-RNA spliced and translated into the protein encoded by the coding sequence. A "signal sequence" is included at the beginning of the coding sequence of a protein to be expressed on the surface of a cell. This sequence encodes a signal peptide, N-terminal to the mature polypeptide, that directs the host cell to translocate the polypeptide. The term "translocation signal sequence" is used herein to refer to this sort of signal sequence. Translocation signal sequences can be found associated with a variety of proteins native to eukaryotes and prokaryotes, and are often functional in both types of organisms.
A "polypeptide" is a polymeric compound comprised of covalently linked amino acid residues. Amino acids have the following general structure:
H
R-C-COOH
I
NH2
Amino acids are classified into seven groups on the basis of the side chain R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.
A "protein" is a polypeptide which plays a structural or functional role in a living cell. The polypeptides and proteins of the invention may be glycosylated or unglycosylated. "Homology" means similarity of sequence reflecting a common evolutionary origin. Polypeptides or proteins are said to have homology, or similarity, if a substantial number of their amino acids are either (1) identical, or (2) have a chemically similar R side chain. Nucleic acids are said to have homology if a substantial number of their nucleotides are identical.
"Isolated polypeptide" or "isolated protein" is a polypeptide or protein which is substantially free of those compounds that are normally associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids). "Isolated" is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.
"Fragment" of a polypeptide according to the invention will be understood to mean a polypeptide whose amino acid sequence is shorter than that of the reference polypeptide and which comprises, over the entire portion with these reference polypeptides, an identical amino acid sequence. Such fragments may, where appropriate, be included in a larger polypeptide of which they are a part. Such fragments of a polypeptide according to the invention may have a length of 10, 15, 20, 30 to 40, 50, 100, 200 or 300 amino acids. "Variant" of a polypeptide according to the invention will be understood to mean mainly a polypeptide whose amino acid sequence contains one or more substitutions, additions or deletions of at least one amino acid residue, relative to the amino acid sequence of the reference polypeptide, it being understood that the amino acid substitutions may be either conservative or nonconservative. A "variant" of a polypeptide or protein is any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or post-translational modification. Variants also include a related protein having substantially the same biological activity, but obtained from a different species.
The skilled artisan can produce variants having single or multiple amino acid substitutions, deletions, additions, or replacements. These variants may include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non- conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin. The techniques for obtaining these variants, including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.
If such allelic variations, analogues, fragments, derivatives, mutants, and modifications, including alternative mRNA splicing forms and alternative post-translational modification forms result in derivatives of the polypeptide which retain any of the biological properties of the polypeptide, they are intended to be included within the scope of this invention. A "vector" is a replicon, such as plasmid, virus, phage or cosmid, to which another
DNA segment may be attached so as to bring about the replication of the attached segment. A
"replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control.
The present invention also relates to cloning vectors containing genes encoding analogs and derivatives of a ABCl polypeptide of the invention, that have the same or homologous functional activity as that ABCl polypeptide, and homologs thereof from other species. The production and use of derivatives and analogs related to ABC 1 are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type an ABCl polypeptide of the invention. ABCl derivatives can be made by altering encoding nucleic acid sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. Preferably, derivatives are made that have enhanced or increased functional activity relative to native ABCl. Alternatively, such derivatives may encode soluble fragments of the ABCl extracellular domain that have the same or greater affinity for the natural ligand of an ABC 1 polypeptide of the invention. Such soluble derivatives may be potent inhibitors of ligand binding to ABCl.
Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as an ABCl gene may be used in the practice of the present invention. These include but are not limited to allelic genes, homologous genes from other species, and nucleotide sequences comprising all or portions of ABCl genes which are altered by the substitution of different codons that encode the same amino acid residue within the sequence, thus producing a silent change. Likewise, the ABCl derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of an ABCl protein including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a conservative amino acid substitution. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or isoelectric point. Particularly preferred substitutions are:
- Lys for Arg and vice versa such that a positive charge may be maintained; - Glu for Asp and vice versa such that a negative charge may be maintained;
- Ser for Thr such that a free -OH can be maintained; and - Gin for Asn such that a free CONH2 can be maintained.
Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property. For example, a Cys may be introduced a potential site for disulfide bridges with another Cys. A His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro may be introduced because of its particularly planar structure, which induces b- rurns in the protein's structure.
The genes encoding ABCl derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, the cloned ABCl gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of ABCl, care should be taken to ensure that the modified gene remains within the same translational reading frame as the ABCl gene, uninterrupted by translational stop signals, in the gene region where the desired activity is encoded.
Additionally, the ABCl -encoding nucleic acids can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Preferably, such mutations enhance the functional activity of the mutated ABCl gene product. Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site-directed mutagenesis (Hutchinson, C, et al., 1978; Zoller and Smith, 1984; Oliphant et al., 1986; Hutchinson et al., 1986; Huygen et al., 1996) use of TAB® linkers (Pharmacia), etc. PCR techniques are preferred for site directed mutagenesis (see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70).
The identified and isolated gene can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Examples of vectors include, but are not limited to, Escherichia coli, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives, e.g., pGEX vectors, pmal-c, pFLAG, etc. The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified. Alternatively, any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated. Preferably, the cloned gene is contained on a shuttle vector plasmid, which provides for expansion in a cloning cell, e.g., Escherichia coli, and facile purification for subsequent insertion into an appropriate expression cell line, if such is desired. For example, a shuttle vector, which is a vector that can replicate in more than one type of organism, can be prepared for replication in both Escherichia coli and Saccharomyces cerevisiae by linking sequences from an Escherichia coli plasmid with sequences form the yeast 2m plasmid.
In an alternative method, the desired gene may be identified and isolated after insertion into a suitable cloning vector in a "shot gun" approach. Enrichment for the desired gene, for example, by size fractionation, can be done before insertion into the cloning vector. The nucleotide sequence coding for an ABCl polypeptide or antigenic fragment, derivative or analog thereof, or a functionally active derivative, including a chimeric protein, thereof, can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. Such elements are termed herein a "promoter." Thus, the nucleic acid encoding an ABCl polypeptide of the invention is operationally associated with a promoter in an expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under control of such regulatory sequences. An expression vector also preferably includes a replication origin.
The necessary transcriptional and translational signals can be provided on a recombinant expression vector, or they may be supplied by a native gene encoding ABCl and/or its flanking regions.
Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
A recombinant ABCl protein of the invention, or functional fragment, derivative, chimeric construct, or analog thereof, may be expressed chromosomally, after integration of the coding sequence by recombination. In this regard, any of a number of amplification systems may be used to achieve high levels of stable gene expression (See Sambrook et al., 1989, supra).
The cell into which the recombinant vector comprising the nucleic acid encoding an ABCl polypeptide according to the invention is cultured in an appropriate cell culture medium under conditions that provide for expression of the ABC 1 polypeptide by the cell.
Any of the methods previously described for the insertion of DNA fragments into a cloning vector may be used to construct expression vectors containing a gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination).
Expression of an ABCl polypeptide may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression. Promoters which may be used to control ABCl gene expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980), the heφes thymidine kinase promoter (Wagner et al., 1981), the regulatory sequences of the metallothionein gene (Brinster et al, 1982); prokaryotic expression vectors such as the b- lactamase promoter (Villa-Kamaroff, et al., 1978), or the tac promoter (DeBoer, et al., 1983); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; and the animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., 1984; Ornitz et al., 1986; MacDonald, 1987); insulin gene control region which is active in pancreatic beta cells (Hanahan, 1985), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., 1984; Adames et al., 1985; Alexander et al., 1987), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., 1986), albumin gene control region which is active in liver (Pinkert et al., 1987), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., 1985; Hammer et al., 1987), alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al., 1987) beta-globin gene control region which is active in myeloid cells (Mogram et al., 1985; Kollias et al., 1986), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al., 1987), myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al., 1986). Expression vectors containing a nucleic acid encoding an ABCl polypeptide of the invention can be identified by four general approaches: (a) polymerase chain reaction (PCR) amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, (d) analyses with appropriate restriction endonucleases, and (e) expression of inserted sequences. In the first approach, the nucleic acids can be amplified by PCR to provide for detection of the amplified product. In the second approach, the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene. In the third approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker" gene functions (e.g., b-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. In another example, if the nucleic acid encoding an ABCl polypeptide is inserted within the "selection marker" gene sequence of the vector, recombinants containing the ABCl nucleic acid insert can be identified by the absence of the ABC 1 gene function. In the fourth approach, recombinant expression vectors are identified by digestion with appropriate restriction enzymes. In the fifth approach, recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein assumes a functionally active conformation.
A wide variety of host/expression vector combinations may be employed in expressing the nucleic acids of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., Escherichia coli plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al, 1988), pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2m plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
For example, in a baculovirus expression systems, both non-fusion transfer vectors, such as but not limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, Smal, Xbal, EcoRI, Notl, Xmalll, BglU, and Pstl cloning site; Invitrogen), pVL1392 (BglE, Pstl, Notl, Xmalll, EcoRI, Xbal, Smal, and Bamrll cloning site; Summers and Invitrogen), and pBlueZtacIII (BamHl, BglU, Pstl, Ncol, and Hindis, cloning site, with blue/white recombinant screening possible; Invitrogen), and fusion transfer vectors, such as but not limited to pAc700 (BamHl and Kpril cloning site, in which the BamHl recognition site begins with the initiation codon; Summers), pAc701 and pAc702 (same as pAc700, with different reading frames), pAc360 (BamHl cloning site 36 base pairs downstream of a polyhedrin initiation codon; Lnvitrogen(195)), and pBlueBacHisA, B, C (three different reading frames, with BamHl, BglU, Pstl, Ncol, and HindUl cloning site, an N-terminal peptide for ProBond purification, and blue/white recombinant screening of plaques; Invitrogen (220) can be used.
Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any expression vector with a DHFR expression vector, or a Z)HER/methotrexate co-amplification vector, such as pED (Pstl, Sail, Sbal, Smal, and EcoRI cloning site, with the vector expressing both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively, a glutamine synthetase/methionine sulfoximine co-amplification vector, such as pΕΕ14 (Hind l, Xbal, Smal, Sbal, EcoRI, and Bell cloning site, in which the vector expresses glutamine synthase and the cloned gene; Celltech). In another embodiment, a vector that directs episomal expression under control of Epstein Barr Virus (EBV) can be used, such as pREP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindUl, Nhel, PvuU, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker; Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Notl, Nhel, HindUl, Nhel, PvuU, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, HindUl, Notl, Xhol, Sfil, BamHl cloning site, inducible methallothionein Eta gene promoter, hygromycin selectable marker: Invitrogen), pREP8 (BamHl, Xhol, Notl, HindUl, Nhel, and Kpnl cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen), pREP9 (Kpnl, Nhel, HindUl, Notl, Xhol, Sfil, and BamHl cloning site, RSV-LTR promoter, G418 selectable marker; Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selectable marker, N- terminal peptide purifiable via ProBond resin and cleaved by enterokinase; Invitrogen). Selectable mammalian expression vectors for use in the invention include pRc/CMV (HindUl, BstXl, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen), pRc/RSV (HindUl, Spel, BstXl, Notl, Xbal cloning site, G418 selection; Invitrogen), and others. Vaccinia virus mammalian expression vectors (see, Kaufman, 1991, supra) for use according to the invention include but are not limited to pSCl l (Smal cloning site, TK- and b-gal selection), pMJ601 (Sail, Smal, Afil, Narl, BspME, BamHl, Apal, Nhel, SacU, Kpnl, and HindUl cloning site; TK- and b-gal selection), and pTKgptFlS (EcoRI, Pstl, Sa l, Accl, HindU, Sbal, BamHl, and Hpa cloning site, TK or XPRT selection). Yeast expression systems can also be used according to the invention to express an
ABCl polypeptide. For example, the non-fusion pYΕS2 vector (Xbal, Sphl, Shol, Notl, Gst l, EcoRI, BstXl, BamHl, Sacl, Kpnl, and HindUl cloning sit; Invitrogen) or the fusion pYΕSHisA, B, C (Xbal, Sphl, Shol, Notl, BstXl, EcoRI, BamHl, Sacl, Kpnl, and HindUl cloning site, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention. Once a particular recombinant DNA molecule is identified and isolated, several methods known in the art may be used to propagate it. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. As previously explained, the expression vectors which can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid and cosmid DNA vectors, to name but a few.
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Different host cells have characteristic and specific mechanisms for the translational and post- translational processing and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of proteins. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an nonglycosylated core protein product. However, the transmembrane ABCl protein expressed in bacteria may not be properly folded. Expression in yeast can produce a glycosylated product. Expression in eukaryotic cells can increase the likelihood of "native" glycosylation and folding of a heterologous protein. Moreover, expression in mammalian cells can provide a tool for reconstituting, or constituting, ABCl activity. Furthermore, different vector/host expression systems may affect processing reactions, such as proteolytic cleavages, to a different extent. Vectors are introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al., 1992; Wu and Wu, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990). A cell has been "transfected" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. A cell has been "transformed" by exogenous or heterologous DNA when the transfected DNA effects a phenotypic change. Preferably, the transforming DNA should be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. A recombinant marker protein expressed as an integral membrane protein can be isolated and purified by standard methods. Generally, the integral membrane protein can be obtained by lysing the membrane with detergents, such as but not limited to, sodium dodecyl sulfate (SDS), Triton X-100 polyoxyethylene ester, Ipagel/nonidet P-40 (NP^IO) (octylphenoxy)-polyethoxyethanol, digoxin, sodium deoxycholate, and the like, including mixtures thereof. Solubilization can be enhanced by sonication of the suspension. Soluble forms of the protein can be obtained by collecting culture fluid, or solubilizing inclusion bodies, e.g., by treatment with detergent, and if desired sonication or other mechanical processes, as described above. The solubilized or soluble protein can be isolated using various techniques, such as polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, 2-dimensional gel electrophoresis, chromatography (e.g., ion exchange, affinity, immunoaffinity, and sizing column chromatography), centrifugation, differential solubility, immunoprecipitation, or by any other standard technique for the purification of proteins.
Alternatively, a nucleic acid or vector according to the invention can be introduced in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al. 1987; Mackey, et al., 1988; Ulmer et al., 1993). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, 1989). Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications W095/18863 and W096/17823, and in U.S. Patent No. 5,459,127. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly preferred in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the puφose of targeting [see Mackey, et. al., supra]. Targeted peptides, e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.
Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., International Patent Publication W095/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO96/25508), or a cationic polymer (e.g., International Patent Publication W095/21931).
It is also possible to introduce the vector in vivo as a naked DNA plasmid (see U.S. Patents 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, Wu et al., 1992; Wu and Wu, 1988; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990; Williams et al., 1991). Receptor-mediated DNA delivery approaches can also be used (Curiel et al., 1992; Wu and Wu, 1987).
"Pharmaceutically acceptable vehicle or excipient " includes diluents and fillers which are pharmaceutically acceptable for method of administration, are sterile, and may be aqueous or oleaginous suspensions formulated using suitable dispersing or wetting agents and suspending agents. The particular pharmaceutically acceptable carrier and the ratio of active compound to carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration, and standard pharmaceutical practice. Any nucleic acid, polypeptide, vector, or host cell of the invention will preferably be introduced in vivo in a pharmaceutically acceptable vehicle or excipient. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "excipient" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as excipients, particularly for injectable solutions. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
Naturally, the invention contemplates delivery of a vector that will express a therapeutically effective amount of an ABCl polypeptide for gene therapy applications. The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to reduce by at least about 15 percent, preferably by at least 50 percent, more preferably by at least 90 percent, and still more preferably prevent, a clinically significant deficit in the activity, function and response of the host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the host.
"Lipid profile" means the set of concentrations of cholesterol, triglyceride, lipoprotein cholesterol and other lipids in the body of a human or other animal.
An "undesirable lipid profile" is the condition in which the concentrations of cholesterol, triglyceride, or lipoprotein cholesterol are outside of the age- and gender-adjusted reference ranges. Generally, a concentration of total cholesterol > 200 mg/dl, of plasma triglycerides > 200 mg/dl, of LDL cholesterol > 130 mg/dl, of HDL cholesterol < 39 mg/dl, or a ratio of total cholesterol to HDL cholesterol > 4.0 is considered to be an undesirable lipid profile. An undesirable lipid profile is associated with a variety of pathological conditions, including hyperlipidaemias, diabetes hypercholesterolaemia, atherosclerosis, and other forms of coronary artery disease.
NUCLEIC ACIDS OF THE ABCl GENE
GENOMIC SEQUENCES
The human ABC 1 gene is thought to comprise 48 exons and 47 introns, if reference is made in particular to the structure of the orthologous ABCl gene in mice. Recently, partial exonic and intronic ABC 1 genomic DNA has been isolated and identified (Rust et al., 1999).
According to the invention, it has now been shown that the human ABCl gene comprises 49 exons and 48 introns.
Several partial genomic nucleotide sequences of the ABCl gene have been isolated and characterized according to the invention, these genomic sequences comprise both new exonic sequences and intronic sequences which may be used in particular for the production of various means of detection of the ABCl gene or of its nucleotide expression products in a sample.
These partial genomic sequences are represented in Table I.
Table I Partial (p) genomic DNA of the human ABCl gene
Thus, a first subject of the invention consists in a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1 and 4-17, or of a complementary polynucleotide sequence. The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a polynucleotide sequence comprising a) any one of SEQ ID NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
The subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 1 and 4-8, and 11-16, or a complementary polynucleotide sequence, b) nucleotides 3154-3200 of SEQ ED NO: 9, or a complementary polynucleotide sequence, c) nucleotides 1-242 of SEQ ED NO: 10, or a complementary polynucleotide sequence, or d) nucleotides 1-1851 of SEQ ED NO: 17, or a complementary polynucleotide sequence.
Several exons of the ABCl gene have been characterized, at least partially, by their nucleotide sequence and are indicated in Table II.
Table II
Human ABCl Exon DNA
Thus, the invention also relates to a nucleic acid comprising any one of SEQ ED NOs: 18-36, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 18-36, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
The subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides l-1657of SEQ ED NO: 36, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 18-26 and 28-35, or a complementary polynucleotide sequence, b) nucleotides 152-198 of SEQ ED NO: 27, or a complementary polynucleotide sequence, or c) nucleotides 1-1657 of SEQ ED NO: 36, or a complementary polynucleotide sequence.
Moreover, several introns of the ABCl gene have been isolated and characterized, at least partially. The intronic nucleic acids of the ABCl gene, as well as their fragments and their variants may also be used as nucleotide probes or primers for detecting the presence of at least one copy of the ABC 1 gene in a sample, or alternatively for amplifying a given target sequence in the ABC 1 gene.
The intronic nucleic acid sequences of the ABCl gene are indicated in Table EQ.
Table m
Human ABCl Intron DNA
Thus, the invention also relates to a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least 8 consecutive nucleotides of a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence.
The subject of the invention is, in addition, a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence. The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ED NO: 53, or a complementary polynucleotide sequence. The invention also relates to a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising a) any one of SEQ ED NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence.
cDNA MOLECULES ENCODING A FULL LENGTH ABCl PROTEIN
As already indicated above, a partial cDNA sequence corresponding to the human ABCl gene has been identified by Langmann et al. (1999). This partial cDNA sequence of ABCl consists of 6880 nucleotides and contains a 6603 nucleotide open reading frame corresponding to a partial 2201 amino acid (aa) ABCl polypeptide produced in subjects not affected by disorders linked to the reverse transport of cholesterol. The cDNA sequence described by Langmann et al. (1999) contains, in addition, a portion of the 5'- untranslated region (UTR) (nucleotides 1 to 120) and a portion of the 3'-UTR (nucleotides 6727 to 6880).
Recently, an additional portion of the 3' -UTR of the human ABCl cDNA has been isolated and identified (Rust et al., 1999).
A cDNA that encodes the full length human ABCl protein has now been identified according to the invention (see Example 2). This novel, human ABCl cDNA (SEQ ID NO: 69) includes a newly identified 5 '-region comprising 244 additional 5' nucleotides and the true initiation ATG codon. According to the invention, the new human ABCl cDNA comprises a larger open reading frame than that previously reported by Langmann et al. (1999) and Rust et al. (1999). In particular, this cDNA nucleic acid molecule of the invention encodes 60 additional amino acids at the N-terminus of the full length human ABCl protein. In addition, this new cDNA molecule of the invention comprises a newly identified 5'UTR.
Specific activity of the full length ABCl protein was tested in vitro, allowing to demonstrate that full length ABCl protein is capable of promoting cellular lipid efflux. In effect, the results presented herein below in Example 16 and Figures 4-7, show that apolipoproteins significantly increase cholesterol and phospholipid efflux in cells that are transfected with the full length ABCl protein. Comparatively, HDL and phosphatidylcholine do not mediate or mediate only partially cholesterol efflux in full length ABCl transfected cells. These results seem to indicate that apolipoproteins are acceptors for ABCl mediated cholesterol and phospholipid efflux. Moreover, Figure 7 unambiguously demonstrates a specific binding of apo A-I and A-E to full length ABCl transfected cells, thereby suggesting that full length ABCl protein act via direct interaction with apolipoproteins, and that these interactions are required for the lipid efflux facilitated by apolipoproteins and the full length ABCl protein. It is thus conceivable that in vivo apolipoproteins from the liver and intestine circulate and interact with full length ABCl protein on the cell surface to recruit lipid efflux from peripheral cells.
Specifically, a cDNA molecule of the human ABCl gene having the polynucleotide sequence of SEQ ED NO: 69 comprises an open reading frame beginning from the nucleotide at position 185 (base A of the ATG codon for initiation of translation) to the nucleotide at position 6967. A polyadenylation signal (having the sequence ATTAAA) is present, starting from the nucleotide at position 9698 of the sequence SEQ ED NO: 69. According to the invention, the ABCl cDNA comprising SEQ ED NO: 69 encodes a full length ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71. Consequently, the invention also relates to a nucleic acid comprising SEQ ED NO: 69, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in SEQ ED NO: 69, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid molecule comprising nucleotides 1-244 of SEQ ID NO: 69, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69, or a complementary polynucleotide sequence.
The subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69, or a nucleic acid having a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a nucleotides 1-244 of SEQ ED NOs: 69, or a nucleic acid having a complementary polynucleotide sequence.
Another subject of the invention is a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69, or a nucleic acid having a complementary polynucleotide sequence.
A search of the GenBank Database (www.ncbi.nlm.nih.gov) revealed an expressed sequence tag (EST), accession number Z44377, from normalized infant brain that overlapped with nucleotides 1-179 of SEQ ED NO: 69 at nucleotides 114-292 of the EST. Until the cDNA molecule according to the invention was identified, no connection between this EST and ABCl was known. Therefore, this EST represents additional 5' UTR nucleotides of the human ABCl cDNA. Thus, the invention also relates to a cDNA molecule comprising nucleotides 1-113 of
EST (GenBank Accession # Z44377) and nucleotides 1-9741 (SEQ ED NO: 69) of the ABCl cDNA molecule. This second cDNA molecule comprises the nucleotide sequence of SEQ ED NO: 70. The ORF of this second cDNA molecule is located from nucleotide 298 to nucleotide 7080 of SEQ ED NO: 70 and the polyadenylation signal (having the sequence ATTAAA) is located beginning at nucleotide 9811 of SEQ ED NO: 70. The nucleic acid comprising SEQ ID NO: 70 also encodes the full length human ABCl protein comprising an amino acid sequence of SEQ ID NO: 71.
Consequently, the invention also relates to a nucleic acid comprising SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The subject of the invention is also a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% nucleotide identity with a nucleic acid comprising a nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
Another subject of the invention is a nucleic acid hybridizing, under high stringency conditions, with a nucleic acid comprising nucleotides 1-357 of SEQ ED NO: 70, or a nucleic acid having a complementary polynucleotide sequence.
According to the invention, a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70 encodes a full length human ABCl polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ED NO: 71.
Thus, the invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
The invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence as depicted in SEQ ID NO: 71.
In a specific embodiment, the invention also relates to a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. The invention also relates to a polypeptide comprising amino acid sequence of SEQ ED
NO: 71. The invention also relates to a polypeptide comprising amino acid sequence as depicted in SEQ ID NO: 71.
The invention relates to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
The invention also relates to a polypeptide comprising an amino acid sequence having at least 80% amino acid identity with a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71, or a peptide fragment thereof.
The invention also relates to a polypeptide having at least 85%, preferably 90%, more preferably 95% and still more preferably 98% amino acid identity with a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
Preferably, a polypeptide according to the invention will have a length of 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
Alternatively, a polypeptide according to the invention will comprise a fragment having a length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a polypeptide according to the invention, more particularly of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71.
POLYMORPHISMS WITHIN THE ABCl GENE MUTATIONS
The analysis of mutations in the ABCl gene may be carried out on genomic DNA from several individuals belonging to a family of which several members suffer from Tangier and/or FHD disease with premature coronary disorders. According to the invention, several mutations have been identified in regions of the ABCl gene, which encode the ABCl polypeptide. These mutations have been found particularly in patients suffering from severe forms of Tangier disease, associated with serious coronary disorders. Seventeen mutations are described in Table EV. The mutation of the wild-type (WT) sequence is indicated in Table EV for each mutant sequence.
Table TV
Mutations found in the ABCl gene
The structural characteristics which make it possible to differentiate the normal sequences from the mutated sequences of ABCl (genomic sequences, messenger RNAs, cDNA) may be exploited in order to produce means of detection of the mutated sequences of ABCl in a sample, in particular, probes specifically hybridizing with the mutated sequences of ABC 1 or pairs of primers making it possible to selectively amplify the regions of the ABC 1 gene carrying the mutations described above, it being possible to carry out the detection of the presence of these mutations in particular by distinguishing the length of the amplified nucleic acid fragments, by hybridization of the amplified fragments with the aid of the specific probes described above, or by direct sequencing of these amplified fragments.
Thus, the invention relates to a nucleic acid comprising any one of SEQ ED NOs: 72-88, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 72-88, or a complementary polynucleotide sequence. A further subject of the invention is a nucleic acid encoding a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
The invention also relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
OTHER POL YMORPHISMS
Other polymoφhisms have been found within the ABCl gene, in particular nucleotide substitutions located in the noncoding regions (introns). Each of the eight polymoφhisms identified in the ABCl gene are represented in Table V. Table V depicts the wild type (WT) allele and the mutant allele, with the polymoφhism itself being defined by the two nucleotide sequences corresponding respectively to each of the alleles.
Table V Polymorphisms found in the ABCl gene
According to another aspect, the invention also relates to nucleic acids of the ABC 1 gene comprising a nucleotide sequence comprising at least one biallelic polymoφhism as described in Table V.
Thus, the invention relates to a nucleic acid comprising any one of SEQ ED NOs: 103 and 109-118, or a complementary polynucleotide sequence.
The invention also relates to a nucleic acid comprising a nucleotide sequence as depicted in SEQ ED NOs: 103 and 109-118, or a complementary polynucleotide sequence. The detection of these ABCl gene polymoφhisms within a DNA sample obtained from a subject may, for example, be carried out by a specific amplification of the nucleotide region of ABCl containing the polymoφhic base, and then sequencing the amplified fragment in order to determine the nature of the allele or of the alleles carried by said subject.
The detection of these polymoφhisms in a DNA sample obtained from a subject may also be carried out with the aid of nucleotide probes or primers specifically hybridizing with a given allele containing one of the polymoφhic bases of a polymoφhism of the ABC 1 gene according to the invention.
By way of illustration, appropriate nucleotide primers are for example primers whose base at the 3' end hybridizes with the base located immediately on the 5' side of the polymoφhic base of the fragment comprising said polymoφhism. After the step of hybridization of the specific primer, a step of extension with a mixture of the two dideoxynucleotides complementary to the polymoφhic base of said polymoφhism, for example differentially labeled by fluorescence, and then a step detection of the fluorescence signal obtained makes it possible to determine which of the two differentially labeled fluorescent dideoxynucleotides has been incoφorated and to directly deduce the nature of the polymoφhic base present at the level of this polymoφhism.
Various approaches may be used for the labeling and detection of the dideoxynucleotides. A method in homogeneous phase based on FRET ("Fluorescence resonance energy transfer") has been described by Chen and Kwok (1997). According to this method, the amplified fragments of genomic DNA containing polymoφhisms are incubated with a primer labeled with fluorescein at the 5' end in the presence of labeled dideoxynucleotide triphosphate and a modified Taq polymerase. The labeled primer is extended by one base by incoφoration of the labeled dideoxynucleotide specific for the allele present on the complementary genomic DNA sequence. At the end of this genotyping reaction, the fluorescence intensities for the two labeling compounds for the labeled dideoxynucleotides are directly analyzed without separation or purification. All these steps may be carried out in the same tube and the modifications of the fluorescence signal monitored in real time. According to another embodiment, the extended primer may be analyzed by MALDI-TOF type mass spectrometry. The base located at the level of the polymoφhic site is identified by measuring the mass added to the microsequencing primer (Haff and Smirnov, 1997). Such nucleotide primers may, for example, be immobilized on a support. Furthermore, it is possible to immobilize on a support, for example in an orderly manner, multiple specific primers as described above, each of the primers being suited to the detection of one of the polymoφhisms of the ABCl gene according to the invention.
The polymoφhisms of the ABCl gene according to the invention are useful in particular as genetic markers in studies of association between the presence of a given allele in a subject and the predisposition of this subject to a given pathology, in particular to one of the pathologies already associated with the chromosomal region 9q31 preferably with a pathology linked to a dysfunction in the reverse transport of cholesterol.
The methods for the genetic analysis of complex characters (phenotypes) are of various types (Lander and Schork, 1994). In general, the biallelic polymoφhisms according to the invention are useful in any of the methods described in the state of the art intended to demonstrate a statistically significant correlation between a genotype and a phenotype. The biallelic polymoφhisms may be used in linkage analyses and in allele sharing methods. Preferably, the biallelic polymoφhisms according to the invention are used to identify genes associated with detectable characters (phenotypes) in use for studies of association, an approach which does not require the use of families affected by the character, and which allows, in addition, the identification of genes associated with complex and sporadic characters.
Other statistical methods using biallelic polymoφhisms according to the invention are for example those described by Forsell et al. (1997), Xiong et al. (1999), Horvath et al. (1998), Sham et al. (1995) or Nickerson et al. (1992).
NUCLEOTIDE PROBES AND PRIMERS
Nucleotide probes and primers hybridizing with a nucleic acid (genomic DNA, messenger RNA, cDNA) according to the invention also form part of the invention. According to the invention, nucleic acid fragments derived from a polynucleotide comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, are useful for the detection of the presence of at least one copy of a nucleotide sequence of the ABCl gene or of a fragment or of a variant (containing a mutation or a polymoφhism) thereof in a sample.
The nucleotide probes or primers according to the invention comprise a nucleotide sequence comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
The nucleotide probes or primers according to the invention comprise at least 8 consecutive nucleotides of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
Preferably, nucleotide probes or primers according to the invention will have a length of 10, 12, 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, in particular of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence. Alternatively, a nucleotide probe or primer according to the invention will consist of and/or comprise the fragments having a length of 12, 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 consecutive nucleotides of a nucleic acid according to the invention, more particularly of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
The definition of a nucleotide probe or primer according to the invention therefore covers oligonucleotides which hybridize, under the high stringency hybridization conditions defined above, with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
According to a preferred embodiment, a nucleotide primer according to the invention comprises a nucleotide sequence of any one of SEQ ED NOs: 119-136, 138, and 141-152, or of a complementary nucleic acid sequence.
Examples of primers and pairs of primers which make it possible to amplify various regions of the ABCl gene are presented in Table VI below. The location of each primer of SEQ ID NOs: 119-136, 138, and 141-152 within SEQ ED NOs: 1, 4-9, 11, and 13-16, and its hybridizing region is indicated in Table VI. The abbreviation "Comp" refers to the complementary nucleic acid sequence.
Table VI Primers for the amplification of nucleic fragments of the ABCl gene
According to a specific embodiment of preferred probes and primers according to the invention, they comprise all or part of a polynucleotide sequence comprising any one of SEQ ED NOs: 119-136, 138, and 141-152, or a nucleic acid having a complementary nucleic acid sequence.
A nucleotide primer or probe according to the invention may be prepared by any suitable method well known to persons skilled in the art, including by cloning and action of restriction enzymes or by direct chemical synthesis according to techniques such as the phosphodiester method by Narang et al. (1979) or by Brown et al. (1979), the diethylphosphoramidite method by Beaucage et al. (1980) or the technique on a solid support described in EU patent No. EP 0,707,592.
Each of the nucleic acids according to the invention, including the oligonucleotide probes and primers described above, may be labeled, if desired, by incoφorating a marker which can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, such markers may consist of radioactive isotopes (32P, 33P, H, 35S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or ligands such as biotin. The labeling of the probes is preferably carried out by incoφorating labeled molecules into the polynucleotides by primer extension, or alternatively by addition to the 5' or 3' ends. Examples of nonradioactive labeling of nucleic acid fragments are described in particular in French patent No. 78 109 75 or in the articles by Urdea et al. (1988) or Sanchez-pescador et al. (1988).
Preferably, the nucleotide probes and primers according to the invention may have structural characteristics of the type to allow amplification of the signal, such as the probes described by Urdea et al. (1991) or alternatively in European patent No. EP-0,225,807 (CHIRON).
The oligonucleotide probes according to the invention may be used in particular in Southern-type hybridizations with the genomic DNA or alternatively in hybridizations with the corresponding messenger RNA when the expression of the corresponding transcript is sought in a sample.
The probes and primers according to the invention may also be used for the detection of products of PCR amplification or alternatively for the detection of mismatches.
Nucleotide probes or primers according to the invention may be immobilized on a solid support. Such solid supports are well known to persons skilled in the art and comprise surfaces of wells of microtiter plates, polystyrene beds, magnetic beds, nitrocellulose bands or microparticles such as latex particles.
Consequently, the present invention also relates to a method of detecting the presence of a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68- 70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, or a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence in a sample, said method comprising the steps of:
1) bringing one or more nucleotide probes or primers according to the invention into contact with the sample to be tested; 2) detecting the complex which may have formed between the probe(s) and the nucleic acid present in the sample.
According to a specific embodiment of the method of detection according to the invention, the oligonucleotide probes and primers are immobilized on a support.
According to another aspect, the oligonucleotide probes and primers comprise a detectable marker.
The invention relates, in addition, to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probe(s) or primer(s) as described above; b) where appropriate, the reagents necessary for the hybridization reaction. According to a first aspect, the detection box or kit is characterized in that the probe(s) or primer(s) are immobilized on a support.
According to a second aspect, the detection box or kit is characterized in that the oligonucleotide probes comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect a target nucleic acid of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention, more particularly of nucleic acids comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. Thus, the probes according to the invention, immobilized on a support, may be ordered into matrices such as "DNA chips". Such ordered matrices have in particular been described in US patent No. 5,143,854, in published PCT applications WO 90/15070 and WO 92/10092.
Support matrices on which oligonucleotide probes have been immobilized at a high density are for example described in US patent No. 5,412,087 and in published PCT application WO 95/11995.
The nucleotide primers according to the invention may be used to amplify any one of the nucleic acids according to the invention, and more particularly a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. Alternatively, the nucleotide primers according to the invention may be used to amplify a nucleic acid fragment or variant of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
In a particular embodiment, the nucleotide primers according to the invention may be used to amplify a nucleic acid comprising a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence, h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. Another subject of the invention relates to a method of amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, contained in a sample, said method comprising the steps of: a) bringing the sample in which the presence of the target nucleic acid is suspected into contact with a pair of nucleotide primers whose hybridization position is located respectively on the 5' side and on the 3' side of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.
To carry out the amplification method as defined above, use will be preferably made of any of the nucleotide primers described above. The subject of the invention is, in addition, a box or kit for amplifying a nucleic acid according to the invention, and more particularly a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, or i) as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, said box or kit comprising: a) a pair of nucleotide primers in accordance with the invention, whose hybridization position is located respectively on the 5' side and 3' side of the target nucleic acid whose amplification is sought; and optionally, b) reagents necessary for the amplification reaction.
Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above.
The subject of the invention is, in addition, a box or kit for amplifying all or part of a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence, said box or kit comprising:
1) a pair of nucleotide primers in accordance with the invention, whose hybridization position is located respectively on the 5' side and 3' side of the target nucleic acid whose amplification is sought; and optionally,
2) reagents necessary for an amplification reaction.
Such an amplification box or kit will preferably comprise at least one pair of nucleotide primers as described above. The invention also relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) one or more nucleotide probes according to the invention; b) where appropriate, reagents necessary for a hybridization reaction.
According to a first aspect, the detection box or kit is characterized in that the nucleotide probe(s) and primer(s)are immobilized on a support. According to a second aspect, the detection box or kit is characterized in that the nucleotide probe(s) and primer(s) comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such a kit will comprise a plurality of oligonucleotide probes and/or primers in accordance with the invention which may be used to detect target nucleic acids of interest or alternatively to detect mutations in the coding regions or the non-coding regions of the nucleic acids according to the invention. According to preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary nucleic acid sequence. Alternatively, the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
According to a preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 125 and 126, making it possible to amplify the region of exon 5 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 72 described above, or nucleic acids having a complementary polynucleotide sequence. According to a second preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 127 and 128, making it possible to amplify the region of exon 6 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 73 or 74 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a third preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 131 and 132, making it possible to amplify the region of exon 8 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 75-77 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a fourth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 155 and 156, making it possible to amplify the region of exon 27 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 84 described above, or nucleic acids having a complementary polynucleotide sequence.
According to a fifth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 159 and 160, making it possible to amplify the region of exon 32 of the ABCl gene carrying the mutation as depicted in SEQ ED NO: 85 described above, or nucleic acids having a complementary polynucleotide sequence. According to a sixth preferred embodiment, two primers according to the invention comprise all or part of SEQ ED NOs: 175 and 176, making it possible to amplify the region of exon 47 of the ABCl gene carrying the mutations as depicted in SEQ ED NOs: 87 or 88 described above, or nucleic acids having a complementary polynucleotide sequence. According to another preferred embodiment, a primer according to the invention comprise, generally, all or part of any one of SEQ ED NOs: 119-136, 138, and 141-152, or a complementary sequence.
The nucleotide primers according to the invention are particularly useful in methods of genotyping subjects and/or of genotyping populations, in particular in the context of studies of association between particular allele forms or particular forms of groups of alleles (haplotypes) in subjects and the existence of a particular phenotype (character) in these subjects, for example the predisposition of these subjects to develop diseases linked to a deficiency in the reverse transport of cholesterol, or alternatively the predisposition of these subjects to develop a pathology whose candidate chromosomal region is situated on chromosome 9, more precisely on the 9q arm and still more precisely in the 9q31 locus.
RECOMBINANT VECTORS
The invention also relates to a recombinant vector comprising a nucleic acid according to the invention. "Vector" for the puφoses of the present invention will be understood to mean a circular or linear DNA or RNA molecule which is either in single-stranded or double-stranded form.
Preferably, such a recombinant vector will comprise a nucleic acid chosen from the following nucleic acids: a) a nucleic acid comprising a polynucleotide sequence of any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, b) a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence, c) a nucleic acid comprising nucleotides 1-244 of SEQ D NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence, d) a nucleic acid having at least eight consecutive nucleotides of a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; e) a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; f) a nucleic acid having 85%, 90%, 95%, or 98% nucleotide identity with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28- 35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1- 242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; g) a nucleic acid hybridizing, under high stringency hybridization conditions, with a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; 2) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; 3) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; 4) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; 5) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; 6) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; 7) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence; h) a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71; and i) a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71. According to a first embodiment, a recombinant vector according to the invention is used to amplify a nucleic acid inserted therein, following transformation or transfection of a desired cellular host.
According to a second embodiment, a recombinant vector according to the invention corresponds to an expression vector comprising, in addition to a nucleic acid in accordance with the invention, a regulatory signal or nucleotide sequence that directs or controls transcription and/or translation of the nucleic acid and its encoded mRNA.
According to a preferred embodiment, a recombinant vector according to the invention will comprise in particular the following components:
(1) an element or signal for regulating the expression of the nucleic acid to be inserted, such as a promoter and/or enhancer sequence;
(2) a nucleotide coding region comprised within the nucleic acid in accordance with the invention to be inserted into such a vector, said coding region being placed in phase with the regulatory element or signal described in (1); and
(3) an appropriate nucleic acid for initiation and termination of transcription of the nucleotide coding region of the nucleic acid described in (2).
In addition, the recombinant vectors according to the invention may include one or more origins for replication in the cellular hosts in which their amplification or their expression is sought, markers or selectable markers.
By way of example, the bacterial promoters may be the Lad or LacZ promoters, the T3 or T7 bacteriophage RNA polymerase promoters, the lambda phage PR or PL promoters.
The promoters for eukaryotic cells will comprise the heφes simplex virus (HSV) virus thymidine kinase promoter or alternatively the mouse metallothionein-L promoter.
Generally, for the choice of a suitable promoter, persons skilled in the art can preferably refer to the book by Sambrook et al. (1989) cited above or to the techniques described by Fuller et al. (1996).
When the expression of the genomic sequence of the ABCl gene will be sought, use will preferably be made of the vectors capable of containing large insertion sequences. In a particular embodiment, bacteriophage vectors such as the PI bacteriophage vectors such as the vector pl58 or the vector pl58/neo8 described by Stemberg (1992, 1994) will be preferably used. The preferred bacterial vectors according to the invention are for example the vectors pBR322(ATCC37017) or alternatively vectors such as pAA223-3 (Pharmacia, Uppsala, Sweden), and pGEMl (Promega Biotech, Madison, WI, UNITED STATES).
There may also be cited other commercially available vectors such as the vectors pQE70, pQE60, pQE9 (Qiagen), psiX174, pBluescript SN pΝH8N pNH16A, pNH18A, pNH46A, pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene).
They may also be vectors of the baculovirus type such as the vector pVL1392/1393 (Pharmingen) used to transfect cells of the Sf9 line (ATCC No. CRL 1711) derived from Spodoptera frugiperda. They may also be adenoviral vectors such as the human adenovirus of type 2 or 5.
A recombinant vector according to the invention may also be a retroviral vector or an adeno-associated vector (AAV). Such adeno-associated vectors are for example described by Flotte et al. (1992), Samulski et al. (1989), or McLaughlin BA et al. (1996).
To allow the expression of a polynucleotide according to the invention, the latter must be introduced into a host cell. The introduction of a polynucleotide according to the invention into a host cell may be carried out in vitro, according to the techniques well known to persons skilled in the art for transforming or transfecting cells, either in primer culture, or in the form of cell lines. It is also possible to carry out the introduction of a polynucleotide according to the invention in vivo or ex vivo, for the prevention or treatment of diseases linked to a deficiency in the reverse transport of cholesterol.
To introduce a polynucleotide or vector of the invention into a host cell, a person skilled in the art can preferably refer to various techniques, such as the calcium phosphate precipitation technique (Graham et al., 1973 ; Chen et al., 1987), DEAE Dextran (Gopal, 1985), electroporation (Tur-Kaspa, 1896 ; Potter et al., 1984), direct microinjection (Harland et al., 1985), liposomes charged with DNA (Nicolau et al., 1982, Fraley et al., 1979).
Once the polynucleotide has been introduced into the host cell, it may be stably integrated into the genome of the cell. The intregration may be achieved at a precise site of the genome, by homologous recombination, or it may be randomly integrated. In some embodiments, the polynucleotide may be stably maintained in the host cell in the form of an episome fragment, the episome comprising sequences allowing the retention and the replication of the latter, either independently, or in a synchronized manner with the cell cycle.
According to a specific embodiment, a method of introducing a polynucleotide according to the invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" polynucleotide according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" polynucleotide being absorbed by the cells of this tissue.
Compositions for use in vitro and in vivo comprising "naked" polynucleotides are for example described in PCT Application No. WO 95/11307 (Institut Pasteur, Inserm, University of Ottawa) as well as in the articles by Tacson et al. (1996) and Huygen et al. (1996) .
According to a specific embodiment of the invention, a composition is provided for the in vivo production of the ABCl protein. This composition comprises a polynucleotide encoding the ABC 1 polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vector. The quantity of vector which is injected into the host organism chosen varies according to the site of the injection. As a guide, there may be injected between about 0.1 and about 100 μg of polynucleotide encoding the ABCl protein into the body of an animal, preferably into a patient likely to develop a disease linked to a deficiency in the reverse transport of cholesterol or who has already developed this disease, in particular a patient having a predisposition to Tangier disease or a patient who has already developed the disease.
Consequently, the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol comprising a nucleic acid encoding the ABCl protein, in combination with one or more physiologically compatible excipients. Preferably, such a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal.
The subject of the invention is, in addition, a pharmaceutical composition intended for the prevention of or treatment of a patient or a subject affected by a dysfunction in the reverse transport of cholesterol comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients.
The invention also relates to the use of a nucleic acid according to the invention, encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention also relates to the use of a recombinant vector according to the invention, comprising a nucleic acid encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol. The subject of the invention is therefore also a recombinant vector comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
The invention also relates to the use of such a recombinant vector for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
The present invention also relates to the use of cells genetically modified ex vivo with such a recombinant vector according to the invention, or of cells producing a recombinant vector, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABC 1 polypeptide.
Vectors useful in methods of somatic gene therapy and compositions containing such vectors
The present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol. It provides an advantageous solution to the disadvantages of the prior art, by demonstrating the possibility of treating the pathologies linked to the transport of cholesterol by gene therapy, by the transfer and expression in vivo of a gene encoding an ABCl protein involved in the transport and the metabolism of cholesterol. The invention thus offers a simple means allowing a specific and effective treatment of related pathologies such as, for example, atherosclerosis.
Gene therapy consists in correcting a deficiency or an abnormality (mutation, aberrant expression and the like) and in bringing about the expression of a protein of therapeutic interest by introducing genetic information into the affected cell or organ. This genetic information may be introduced either ex vivo into a cell extracted from the organ, the modified cell then being reintroduced into the body, or directly in vivo into the appropriate tissue. In this second case, various techniques exist, among which various transfection techniques involving complexes of DNA and DEAE-dextran (Pagano et al., 1967), of DNA and nuclear proteins (Kaneda et al., 1989), of DNA and lipids (Feigner et al., 1987), the use of liposomes (Fraley et al., 1980), and the like. More recently, the use of viruses as vectors for the transfer of genes has appeared as a promising alternative to these physical transfection techniques. In this regard, various viruses have been tested for their capacity to infect certain cell populations. In particular, the retroviruses (RSV, HMS, MMS, and the like), the HSV virus, the adeno-associated viruses and the adeno viruses. The present invention therefore also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, consisting in transferring and in expressing in vivo genes encoding ABCl . Specifically, the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes. In a particularly preferred manner, the applicant has now found that it is possible to construct recombinant vectors comprising a nucleic acid encoding an ABC 1 protein involved in the metabolism of cholesterol, to administer these recombinant vectors in vivo, and that this administration allows a stable and effective expression of a biologically active ABC 1 protein in vivo, with no cytopathological effect.
The present invention also results from the demonstration that adenoviruses constitute particularly efficient vectors for the transfer and the expression of the ABCl gene. Ln particular, the present invention shows that the use of recombinant adenoviruses as vectors makes it possible to obtain sufficiently high levels of expression of this gene to produce the desired therapeutic effect. Other viral vectors such as retroviruses or adeno-associated viruses (AAV) allowing a stable expression of the gene are also claimed.
The present invention thus offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport of cholesterol. The subject of the invention is therefore also a defective recombinant virus comprising a nucleic acid according to the invention that encodes an ABCl protein or polypeptide involved in the metabolism of cholesterol.
The invention also relates to the use of such a defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular diseases or conditions associated with HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
The present invention also relates to the use of cells genetically modified ex vivo with such a defective recombinant virus according to the invention, or of cells producing a defective recombinant virus, wherein the cells are implanted in the body, to allow a prolonged and effective expression in vivo of a biologically active ABCl polypeptide.
The present invention shows that it is possible to incoφorate a DNA sequence encoding ABCl into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature form. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus incoφorating such a DNA.
The present invention is particularly advantageous because it makes it possible to induce a controlled expression, and with no harmful effect, of ABCl in organs which are not normally involved in the expression of this protein. In particular, a significant release of the
ABCl protein is obtained by implantation of cells producing vectors of the invention, or infected ex vivo with vectors of the invention.
The activity of transport of cholesterol produced in the context of the present invention may be of the human or animal ABC 1 type. The nucleic sequence used in the context of the present invention may be a cDNA, a genomic DNA (gDNA), an RNA (in the case of retroviruses) or a hybrid construct consisting, for example, of a cDNA into which one or more introns (gDNA) would be inserted. It may also involve synthetic or semisynthetic sequences. In a particularly advantageous manner, a cDNA or a gDNA is used. In particular, the use of a gDNA allows a better expression in human cells. To allow their incoφoration into a viral vector according to the invention, these sequences are preferably modified, for example by site- directed mutagenesis, in particular for the insertion of appropriate restriction sites. The sequences described in the prior art are indeed not constructed for use according to the invention, and prior adaptations may prove necessary, in order to obtain substantial expressions. In the context of the present invention, the use of a nucleic sequence encoding a human ABCl protein is preferred. Moreover, it is also possible to use a construct encoding a derivative of these ABCl proteins. A derivative of these ABCl proteins comprises, for example, any sequence obtained by mutation, deletion and/or addition relative to the native sequence, and encoding a product retaining the cholesterol transport activity. These modifications may be made by techniques known to a person skilled in the art (see general molecular biological techniques below). The biological activity of the derivatives thus obtained can then be easily determined, as indicated in particular in the examples of the measurement of the efflux of cholesterol from cells. The derivatives for the puφoses of the invention may also be obtained by hybridization from nucleic acid libraries, using as probe the native sequence or a fragment thereof. These derivatives are in particular molecules having a higher affinity for their binding sites, molecules exhibiting greater resistance to proteases, molecules having a higher therapeutic efficacy or fewer side effects, or optionally new biological properties. The derivatives also include the modified DNA sequences allowing improved expression in vivo.
In a first embodiment, the present invention relates to a defective recombinant virus comprising a cDNA encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol. In another preferred embodiment of the invention, a defective recombinant virus comprises a genomic DNA (gDNA) encoding an ABCl polypeptide involved in the transport and metabolism of cholesterol. Preferably, the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71. More preferably, the ABCl polypeptide comprised amino acids l-60 of SEQ ID NO:71. The vectors of the invention may be prepared from various types of viruses.
Preferably, vectors derived from adenoviruses, adeno-associated viruses (AAV), heφesviruses (HSV) or retroviruses are used. It is preferable to use an adenovirus, for direct administration or for the ex vivo modification of cells intended to be implanted, or a retrovirus, for the implantation of producing cells. The viruses according to the invention are defective, that is to say that they are incapable of autonomously replicating in the target cell. Generally, the genome of the defective viruses used in the context of the present invention therefore lacks at least the sequences necessary for the replication of said virus in the infected cell. These regions may be either eliminated (completely or partially), or made nonfunctional, or substituted with other sequences and in particular with the nucleic sequence encoding the ABCl protein. Preferably, the defective virus retains, nevertheless, the sequences of its genome which are necessary for the encapsidation of the viral particles.
As regards more particularly adenoviruses, various serotypes, whose structure and properties vary somewhat, have been characterized. Among these serotypes, human adenoviruses of type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin (see Application WO 94/26914) are preferably used in the context of the present invention. Among the adenoviruses of animal origin which can be used in the context of the present invention, there may be mentioned adenoviruses of canine, bovine, murine (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine, avian or simian (example: SAV) origin. Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan or A26/61 strain (ATCC VR-800) for example]. Preferably, adenoviruses of human or canine or mixed origin are used in the context of the invention. Preferably, the defective adenoviruses of the invention comprise the ITRs, a sequence allowing the encapsidation and the sequence encoding the ABCl protein. Preferably, in the genome of the adenoviruses of the invention, the El region at least is made nonfunctional. Still more preferably, in the genome of the adenoviruses of the invention, the El gene and at least one of the E2, E4 and L1-L5 genes are nonfunctional. The viral gene considered may be made nonfunctional by any technique known to a person skilled in the art, and in particular by total suppression, by substitution, by partial deletion or by addition of one or more bases in the gene(s) considered. Such modifications may be obtained in vitro (on the isolated DNA) or in situ, for example, by means of genetic engineering techniques, or by treatment by means of mutagenic agents. Other regions may also be modified, and in particular the E3 (WO95/02697), E2 (W094/28938), E4 (W094/28152, W094/12649, WO95/02697) and L5 (WO95/02697) region. According to a preferred embodiment, the adenovirus according to the invention comprises a deletion in the El and E4 regions and the sequence encoding ABCl is inserted at the level of the inactivated El region. According to another preferred embodiment, it comprises a deletion in the El region at the level of which the E4 region and the sequence encoding ABCl (French Patent Application FR94 13355) are inserted.
The defective recombinant adenoviruses according to the invention may be prepared by any technique known to persons skilled in the art (Levrero et al., 1991, EP 185 573; and Graham, 1984). In particular, they may be prepared by homologous recombination between an adenovirus and a plasmid carrying, inter alia, the nucleic acid encoding the ABCl protein. The homologous recombination occurs after cotransfection of said adenoviruses and plasmid into an appropriate cell line. The cell line used must preferably (i) be transformable by said elements, and (ii), contain the sequences capable of complementing the part of the defective adenovirus genome, preferably in integrated form in order to avoid the risks of recombination. By way of example of a line, there may be mentioned the human embryonic kidney line 293 (Graham et al., 1977), which contains in particular, integrated into its genome, the left part of the genome of an Ad5 adenovirus (12%) or lines capable of complementing the El and E4 functions as described in particular in Applications No. WO 94/26914 and WO95/02697. Next, the adenoviruses which have multiplied are recovered and purified according to conventional molecular biological techniques, as illustrated in the examples.
As regards the adeno-associated viruses (AAV), they are DNA viruses of a relatively small size, which integrate into the genome of the cells which they infect, in a stable and site- specific manner. They are capable of infecting a broad spectrum of cells, without inducing any effect on cellular growth, moφhology or differentiation. Moreover, they do not appear to be involved in pathologies in humans. The genome of AAVs has been cloned, sequenced and characterized. It comprises about 4700 bases, and contains at each end an inverted repeat region (ITR) of about 145 bases, serving as replication origin for the virus. The remainder of the genome is divided into 2 essential regions carrying the encapsidation functions: the left hand part of the genome, which contains the rep gene, involved in the viral replication and the expression of the viral genes; the right hand part of the genome, which contains the cap gene encoding the virus capsid proteins.
The use of vectors derived from AAVs for the transfer of genes in vitro and in vivo has been described in the literature (see in particular WO 91/18088; WO 93/09239; US 4,797,368, US5, 139,941, EP 488 528). These applications describe various constructs derived from AAVs, in which the rep and/or cap genes are deleted and replaced by a gene of interest, and their use for transferring in vitro (on cells in culture) or in vivo (directly into an organism) said gene of interest. However, none of these documents either describes or suggests the use of a recombinant AAV for the transfer and expression in vivo or ex vivo of an ABC 1 protein, or the advantages of such a transfer. The defective recombinant AAVs according to the invention may be prepared by cotransfection, into a cell line infected with a human helper virus (for example an adenovirus), of a plasmid containing the sequence encoding the ABCl protein bordered by two AAV inverted repeat regions (ITR), and of a plasmid carrying the AAV encapsidation genes (rep and cap genes). The recombinant AAVs produced are then purified by conventional techniques. As regards the heφesviruses and the retroviruses, the construction of recombinant vectors has been widely described in the literature: see in particular Breakfield et al., (1991); EP 453242, EP178220, Bernstein et al. (1985); McCormick, (1985), and the like.
In particular, the retroviruses are integrating viruses, infecting dividing cells. The genome of the retroviruses essentially comprises two long terminal repeats (LTRs), an encapsidation sequence and three coding regions (gag, pol and env). In the recombinant vectors derived from retroviruses, the gag, pol and env genes are generally deleted, completely or partially, and replaced with a heterologous nucleic acid sequence of interest. These vectors may be produced from various types of retroviruses such as in particular MoMuLV ("murine moloney leukemia virus"; also called MoMLV), MSV ("murine moloney sarcoma virus"), HaSV ("harvey sarcoma virus"); SNV ("spleen necrosis virus"); RSV ("rous sarcoma virus") or Friend's virus.
To construct recombinant retroviruses containing a sequence encoding the ABCl protein according to the invention, a plasmid containing in particular the LTRs, the encapsidation sequence and said coding sequence is generally constructed, and then used to transfect a so-called encapsidation cell line, capable of providing in trans the retroviral functions deficient in the plasmid. Generally, the encapsidation lines are therefore capable of expressing the gag, pol and env genes. Such encapsidation lines have been described in the prior art, and in particular the PA317 line (US 4,861,719), the PsiCRIP line (WO 90 /02806) and the GP+envAm-12 line (WO 89/07150). Moreover, the recombinant retroviruses may contain modifications at the level of the LTRs in order to suppress the transcriptional activity, as well as extended encapsidation sequences, containing a portion of the gag gene (Bender et al., 1987). The recombinant retroviruses produced are then purified by conventional techniques.
To carry out the present invention, it is preferable to use a defective recombinant adenovirus. The particularly advantageous properties of adenoviruses are preferred for the in vivo expression of a protein having a cholesterol transport activity. The adenoviral vectors according to the invention are particularly preferred for a direct administration in vivo of a purified suspension, or for the ex vivo transformation of cells, in particular autologous cells, in view of their implantation. Furthermore, the adenoviral vectors according to the invention exhibit, in addition, considerable advantages, such as in particular their very high infection efficiency, which makes it possible to carry out infections using small volumes of viral suspension.
According to another particularly preferred embodiment of the invention, a line producing retroviral vectors containing the sequence encoding the ABCl protein is used for implantation in vivo. The lines which can be used to this end are in particular the PA317 (US 4,861,719), PsiCrip (WO 90/02806) and GP+envAm-12 (US 5,278,056) cells modified so as to allow the production of a retrovirus containing a nucleic sequence encoding an ABCl protein according to the invention. For example, totipotent stem cells, precursors of blood cell lines, may be collected and isolated from a subject. These cells, when cultured, may then be transfected with the retroviral vector containing the sequence encoding the ABCl protein under the control of viral, nonviral or nonviral promoters specific for macrophages or under the control of its own promoter. These cells are then reintroduced into the subject. The differentiation of these cells will be responsible for blood cells expressing the ABCl protein, in particular for monocytes which, when transformed to macrophages, participate in the removal of cholesterol from the arterial wall. These macrophages expressing the ABCl protein will have an increased capacity to metabolize cholesterol in excess and will make it available to the cell surface for its removal by the primary acceptors of membrane cholesterol.
Preferably, in the vectors of the invention, the sequence encoding the ABCl protein is placed under the control of signals allowing its expression in the infected cells. These may be expression signals which are homologous or heterologous, that is to say signals different from those which are naturally responsible for the expression of the ABCl protein. They may also be in particular sequences responsible for the expression of other proteins, or synthetic sequences. In particular, they may be sequences of eukaryotic or viral genes or derived sequences, stimulating or repressing the transcription of a gene in a specific manner or otherwise and in an inducible manner or otherwise. By way of example, they may be promoter sequences derived from the genome of the cell which it is desired to infect, or from the genome of a virus, and in particular the promoters of the El A or major late promoter (MLP) genes of adenoviruses, the cytomegalo virus (CMV) promoter, the RSV-LTR and the like. Among the eukaryotic promoters, there may also be mentioned the ubiquitous promoters (HPRT, vimentin, α-actin, tubulin and the like), the promoters of the intermediate filaments (desmin, neurofilaments, keratin, GFAP, and the like), the promoters of therapeutic genes (of the MDR, CFTR or factor Viπ type, and the like), tissue-specific promoters (pyruvate kinase, villin, promoter of the fatty acid binding intestinal protein, promoter of the smooth muscle cell α-actin, promoters specific for the liver; Apo Al, Apo All, human albumin and the like) or promoters corresponding to a stimulus (steroid hormone receptor, retinoic acid receptor and the like). In addition, these expression sequences may be modified by addition of enhancer or regulatory sequences and the like. Moreover, when the inserted gene does not contain expression sequences, it may be inserted into the genome of the defective virus downstream of such a sequence.
In a specific embodiment, the invention relates to a defective recombinant virus comprising a nucleic acid encoding an ABCl protein involved in the metabolism of cholesterol under the control of a promoter chosen from RSV-LTR or the CMV early promoter. As indicated above, the present invention also relates to any use of a virus as described above for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
The present invention also relates to a pharmaceutical composition comprising one or more defective recombinant viruses as described above. These pharmaceutical compositions may be formulated for administration by the topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular or transdermal route and the like. Preferably, the pharmaceutical compositions of the invention comprises a pharmaceutically acceptable vehicle or physiologically compatible excipient for an injectable formulation, in particular for an intravenous injection, such as for example into the patient's portal vein. These may relate in particular to isotonic sterile solutions or dry, in particular, freeze-dried, compositions which, upon addition depending on the case of sterilized water or physiological saline, allow the preparation of injectable solutions. Direct injection into the patient's portal vein is preferred ecause it makes it possible to target the infection at the level of the liver and thus to concentrate the therapeutic effect at the level of this organ. The doses of defective recombinant virus used for the injection may be adjusted as a function of various parameters, and in particular as a function of the viral vector, of the mode of administration used, of the relevant pathology or of the desired duration of treatment. In general, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses of between 10^ and 10^ pfu/ml, and preferably 10" to 10^υ pfu ml. The term "pfu" (plaque forming unit) corresponds to the infectivity of a virus solution, and is determined by infecting an appropriate cell culture and measuring, generally after 48 hours, the number of plaques that result from infected cell lysis. The techniques for determining the pfu titer of a viral solution are well documented in the literature.
As regards retroviruses, the compositions according to the invention may directly contain the producing cells, with a view to their implantation. In this regard, another subject of the invention relates to any mammalian cell infected with one or more defective recombinant viruses according to the invention. More particularly, the invention relates to any population of human cells infected with such viruses. These may be in particular cells of blood origin (totipotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.
The cells according to the invention may be derived from primary cultures. These may be collected by any technique known to persons skilled in the art and then cultured under conditions allowing their proliferation. As regards more particularly fibroblasts, these may be easily obtained from biopsies, for example according to the technique described by Ham (1980). These cells may be used directly for infection with the viruses, or stored, for example by freezing, for the establishment of autologous libraries, in view of a subsequent use. The cells according to the invention may be secondary cultures, obtained for example from pre- established libraries (see for example EP 228458, EP 289034, EP 400047, EP 456640).
The cells in culture are then infected with a recombinant virus according to the invention, in order to confer on them the capacity to produce a biologically active ABCl protein. The infection is carried out in vitro according to techniques known to persons skilled in the art. In particular, depending on the type of cells used and the desired number of copies of virus per cell, persons skilled in the art can adjust the multiplicity of infection and optionally the number of infectious cycles produced. It is clearly understood that these steps must be carried out under appropriate conditions of sterility when the cells are intended for administration in vivo. The doses of recombinant virus used for the infection of the cells may be adjusted by persons skilled in the art according to the desired aim. The conditions described above for the administration in vivo may be applied to the infection in vitro. For the infection with a retrovirus, it is also possible to co-culture a cell to be infected with a cell producing the recombinant retrovirus according to the invention. This makes it possible to eliminate purification of the retrovirus.
Another subject of the invention relates to an implant comprising mammalian cells infected with one or more defective recombinant viruses according to the invention or cells producing recombinant viruses, and an extracellular matrix. Preferably, the implants according to the invention comprise 10^ to 10iυ cells. More preferably, they comprise 10" to 10° cells.
More particularly, in the implants of the invention, the extracellular matrix comprises a gelling compound and optionally a support allowing the anchorage of the cells.
For the preparation of the implants according to the invention, various types of gelling agents may be used. The gelling agents are used for the inclusion of the cells in a matrix having the constitution of a gel, and for promoting the anchorage of the cells on the support, where appropriate. Various cell adhesion agents can therefore be used as gelling agents, such as in particular collagen, gelatin, glycosaminoglycans, fibronectin, lectins and the like. Preferably, collagen is used in the context of the present invention. This may be collagen of human, bovine or murine origin. More preferably, type I collagen is used. As indicated above, the compositions according to the invention preferably comprise a support allowing the anchorage of the cells. The term anchorage designates any form of biological and/or chemical and/or physical interaction causing the adhesion and/or the attachment of the cells to the support. Moreover, the cells may either cover the support used, or penetrate inside this support, or both. It is preferable to use in the context of the invention a solid, nontoxic and/or biocompatible support. In particular, it is possible to use polytetrafluoroethylene (PTFE) fibers or a support of biological origin.
The present invention thus offers a very effective means for the treatment or prevention of pathologies linked to the transport of cholesterol, in particular obesity, HDL deficiency, hypertriglyceridemia, atherosclerosis, or, in the field of cardiovascular conditions, myocardial infarction, angina, sudden death, cardiac decompensation and cerebrovascular accidents.
In addition, this treatment may be applied to both humans and any animals such as ovines, bovines, domestic animals (dogs, cats and the like), horses, fish and the like.
RECOMBINANT HOST CELLS
The invention relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly, a nucleic acid comprising a polynucleotide sequence of either SEQ ID NO: 69 or SEQ ID NO: 70, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, and more particularly a nucleic acid comprising a nucleotide sequence as depicted in SEQ ID NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
Specifically, the invention relates to a recombinant host cell comprising nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. The invention also relates to a recombinant host cell comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence. The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. According to another aspect, the invention also relates to a recombinant host cell comprising a recombinant vector according to the invention. Therefore, the invention also relates to a recombinant host cell comprising a recombinant vector comprising any of the nucleic acids of the invention, and more particularly a nucleic acid comprising a nucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, or of a complementary polynucleotide sequence.
Specifically, the invention relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ED NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1- 357 of SEQ ID NO: 70, or of a complementary polynucleotide sequence.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71.
The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
The preferred host cells according to the invention are for example the following: a) prokaryotic host cells: strains of Escherichia coli (strain DH5-α), of Bacillus subtilis, of Salmonella typhimurium, or strains of genera such as Pseudomonas, Streptomyces and Staphylococus ; b) eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No. CCL70), COS cells (ATCC No. CRL 1650), Sf-9 cells (ATCC No. CRL 1711), CHO cells (ATCC No. CCL-61) or 3T3 cells (ATCC No. CRL-6361). MUTATED ABCl POLYPEPTEDES
According to another aspect, the invention relates to a polypeptide encoded by a mutated ABCl gene, and more particularly a mutated ABCl gene in patients suffering from a deficiency in the reverse transport of cholesterol, more particularly in patients suffering from Tangier disease.
As indicated above, seventeen mutations have been identified in the ABCl gene according to the invention (see Table EV).
The polypeptides as depicted in SEQ ID NOs: 89-102 correspond to the non-silent ABCl gene mutations, and are useful in particular for the preparation of antibodies specifically recognizing them. Such antibodies constitute a means for detecting the production of mutated ABC 1 polypeptides in a sample obtained from a subject to be tested, preferably a patient having symptoms characteristic of a deficiency in the reverse transport of cholesterol, and more preferably in a patient having the symptoms characteristic of Tangier and/or FHD disease.
According to another aspect, the invention also relates to a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 89-102.
According to another aspect, the invention also relates to a polypeptide comprising an amino acid sequence as depicted in any one of SEQ ID NOs: 89-102.
Generally, the polypeptides according to the invention are provided in an isolated or purified form.
METHODS FOR PRODUCING ABCl POLYPEPTIDES
The invention also relates to a method for the production of a polypeptide comprising an amino acid sequence of any one of SEQ D NOs: 71 and 89-102, said method comprising the steps of: a) inserting a nucleic acid encoding said polypeptide into an appropriate vector; b) culturing, in an appropriate culture medium, a previously transformed host cell or transfecting a host cell with the recombinant vector of step a); c) recovering the conditioned culture medium or lysing the host cell, for example by sonication or by osmotic shock; d) separating and purifying said polypeptide from said culture medium or alternatively from the cell lysates obtained in step c); and e) where appropriate, characterizing the recombinant polypeptide produced.
A specific embodiment of the invention relates to a method for producing a polypeptide comprising an amino acid sequence of amino acids 1-60 of SEQ ID NO: 71. The polypeptides according to the invention may be characterized by binding to an immunoaffinity chromatography column on which the antibodies directed against this polypeptide or against a fragment or a variant thereof have been previously immobilized.
According to another aspect, a recombinant polypeptide according to the invention may be purified by passing it over an appropriate series of chromatography columns, according to methods known to persons skilled in the art and described for example in F. Ausubel et al (1989).
A polypeptide according to the invention may also be prepared by conventional chemical synthesis techniques either in homogeneous solution or in solid phase. By way of illustration, a polypeptide according to the invention may be prepared by the technique either in homogeneous solution described by Houben Weyl (1974) or the solid phase synthesis technique described by Merrifield (1965a; 1965b).
A polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ED NO: 71 also forms part of the invention. Such a homologous polypeptide comprises an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ
ED NO: 71.
An "equivalent amino acid" according to the present invention will be understood to mean for example replacement of a residue in the L form by a residue in the D form or the replacement of a glutamic acid (E) by a pyro-glutamic acid according to techniques well known to persons skilled in the art. By way of illustration, the synthesis of peptide containing at least one residue in the D form is described by Koch (1977). According to another aspect, two amino acids belonging to the same class, that is to say two uncharged polar, nonpolar, basic or acidic amino acids, are also considered as equivalent amino acids. Polypeptides comprising at least one nonpeptide bond such as a retro-inverse bond
(NHCO), a carba bond (CH2CH2) or a ketomethylene bond (CO-CH2) also form part of the invention.
Preferably, the polypeptides according to the invention comprising one or more additions, deletions, substitutions of at least one amino acid will retain their capacity to be recognized by antibodies directed against the nonmodified polypeptides.
ANTD30DEES
The ABCl polypeptides according to the invention, in particular 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, may be used for the preparation of an antibody, in particular for detecting the production of a normal or altered form of an ABCl polypeptide in a patient. An antibody directed against a polypeptide comprising amino acids 1-60 of SEQ ID
NO: 71, also forms part of the present invention.
An antibody directed against a polypeptide termed "homologous" to a polypeptide having an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71 also forms part of the invention. Such an antibody is directed against a homologous polypeptide comprising an amino acid sequence possessing one or more substitutions of an amino acid by an equivalent amino acid, relative to amino acids 1-60 of SEQ ID NO: 71.
"Antibody" for the puφoses of the present invention will be understood to mean in particular polyclonal or monoclonal antibodies or fragments (for example the F(ab)'2 and Fab fragments) or any polypeptide comprising a domain of the initial antibody recognizing the target polypeptide or polypeptide fragment according to the invention.
Monoclonal antibodies may be prepared from hybridomas according to the technique described by Kohler and Milstein (1975).
According to the invention, a polypeptide produced recombinantly or by chemical synthesis, and fragments or other derivatives or analogs thereof, including fusion proteins, may be used as an immunogen to generate antibodies that recognize a polypeptide according to the invention. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. The anti-ABC 1 antibodies of the invention may be cross reactive, e.g., they may recognize an ABCl polypeptide from different species. Polyclonal antibodies have greater likelihood of cross reactivity. Alternatively, an antibody of the invention may be specific for a single form of ABCl. Preferably, such an antibody is specific for human ABCl.
Various procedures known in the art may be used for the production of polyclonal antibodies to an ABCl polypeptide or derivative or analog thereof. For the production of antibody, various host animals can be immunized by injection with an ABCl polypeptide, or a derivative (e.g., fragment or fusion protein) thereof, including but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, the ABCl polypeptide or fragment thereof can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
For preparation of monoclonal antibodies directed toward the ABCl polypeptide, or fragment, analog, or derivative thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (1975), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983a); Cote et al. (1983), and the EBV-hybridoma technique to produce human monoclonal antibodies [Cole et al., 1985). In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals [International Patent Publication No. WO 89/12690, published 28 December 1989]. In fact, according to the invention, techniques developed for the production of "chimeric antibodies" [Morrison et al., (1984); Neuberger et al., (1984); Takeda et al., (1985)] by splicing the genes from a mouse antibody molecule specific for an ABCl polypeptide together with genes from a human antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. Such human or humanized chimeric antibodies are preferred for use in therapy of human diseases or disorders (described infra), since the human or humanized antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves.
According to the invention, techniques described for the production of single chain antibodies [U.S. Patent Nos. 5,476,786 and 5,132,405 to Huston; U.S. Patent 4,946,778] can be adapted to produce ABCl polypeptide-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., 1989) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an ABCl polypeptide, or its derivatives, or analogs. Antibody fragments which contain the idiotype of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies which recognize a specific epitope of an ABCl polypeptide, one may assay generated hybridomas for a product which binds to an ABCl polypeptide fragment containing such epitope. For selection of an antibody specific to an ABCl polypeptide from a particular species of animal, one can select on the basis of positive binding with an ABCl polypeptide expressed by or isolated from cells of that species of animal.
The foregoing antibodies can be used in methods known in the art relating to the localization and activity of an ABCl polypeptide, e.g., for Western blotting, ABCl polypeptide in situ, measuring levels thereof in appropriate physiological samples, etc. using any of the detection techniques mentioned above or known in the art.
In a specific embodiment, antibodies that agonize or antagonize the activity of an ABCl polypeptide can be generated. Such antibodies can be tested using the assays described infra for identifying ligands.
The present invention relates to an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ED NO: 71, also forms part of the invention, as produced in the trioma technique or the hybridoma technique described by Kozbor et al. (1983b).
The invention also relates to single-chain Fv antibody fragments (ScFv) as described in US patent No. 4,946,778 or by Martineau et al. (1998).
The antibodies according to the invention also comprise antibody fragments obtained with the aid of phage libraries as described by Ridder et al., (1995) or humanized antibodies as described by Reinmann et al. (1997) and Leger et al., (1997).
The antibody preparations according to the invention are useful in immunological detection tests intended for the identification of the presence and/or of the quantity of antigens present in a sample. An antibody according to the invention may comprise, in addition, a detectable marker which is isotopic or nonisotopic, for example fluorescent, or may be coupled to a molecule such as biotin, according to techniques well known to persons skilled in the art.
Thus, the subject of the invention is, in addition, a method of detecting the presence of a polypeptide according to the invention in a sample, said method comprising the steps of: a) bringing the sample to be tested into contact with an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1- 60 of SEQ ID NO: 71, and b) detecting the antigen/antibody complex formed.
The invention also relates to a box or kit for diagnosis or for detecting the presence of a polypeptide in accordance with the invention in a sample, said box comprising: a) an antibody directed against 1) a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, 3) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ED NO: 71, or 4) a polypeptide termed "homologous" to a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, and b) a reagent allowing the detection of the antigen/antibody complexes formed.
PHARMACEUTICAL COMPOSITIONS AND THERAPEUTIC METHODS OF TREATMENT
The invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a polynucleotide capable of giving rise to the production of an effective quantity of the normal ABCl polypeptide, in particular a polypeptide comprising an amino acid sequence of SEQ ED NO: 71. In a preferred embodiment, the ABCl polypeptide comprises amino acids 1- 60 of SEQ ID NO: 71.
The subject of the invention is, in addition, pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of the normal ABC 1 polypeptide, in particular a polypeptide comprising an amino acid sequence of SEQ ED NO: 71. In a preferred embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ED NO: 71. The invention also relates to the use of the ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ED NO: 71 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention relates to a pharmaceutical composition for the prevention or treatment of subjects affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of the polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71.
According to yet another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a therapeutically effective quantity of the ABCl polypeptide in said patient, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients. Preferably, a pharmaceutical composition comprising a polypeptide according to the invention will be administered to the patient. Thus, the invention also relates to pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a polynucleotide capable of giving rise to the production of an effective quantity of a normal ABCl polypeptide, in particular of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ED NO: 71.
The subject of the invention is, in addition, pharmaceutical compositions intended for the prevention or treatment of a deficiency in the metabolism of cholesterol such as atherosclerosis, particularly in the transport of cholesterol, and still more particularly in the reverse transport of cholesterol, characterized in that they comprise a therapeutically effective quantity of a normal ABCl polypeptide, in particular of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71.
Such pharmaceutical compositions will be preferably suitable for the administration, for example by the parenteral route, of a quantity of the ABCl polypeptide ranging from 1 μg/kg/day to 10 mg/kg/day, preferably at least 0.01 mg/kg/day and more preferably between 0.01 and 1 mg/kg/day.
The invention also provides pharmaceutical compositions comprising a nucleic acid encoding an ABCl polypeptide according to the invention and pharmaceutical compositions comprising an ABCl polypeptide according to the invention intended for the treatment of diseases linked to a deficiency in the reverse transport of cholesterol, such as Tangier and/or
FHD disease.
The present invention also relates to a new therapeutic approach for the treatment of pathologies linked to the transport of cholesterol, comprising transferring and expressing in vivo nucleic acids encoding an ABCl protein according to the invention. Specifically, the present invention provides a new therapeutic approach for the treatment and/or prevention of HDL deficiency, such as the HDL deficiency associated with Tangier and/or FHD disease, HDL deficiency, LCAT deficiency, malaria, and diabetes.
Thus, the present invention offers a new approach for the treatment and prevention of cardiovascular and neurological pathologies linked to the abnormalities of the transport and metabolism of cholesterol. Specifically, the present invention provides methods to restore or promote improved reverse transport of cholesterol within a patient or subject.
Consequently, the invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a nucleic acid encoding the ABCl protein, in combination with one or more physiologically compatible vehicle and/or excipient.
According to a specific embodiment of the invention, a composition is provided for the in vivo production of the ABCl protein. This composition comprises a nucleic acid encoding the ABCl polypeptide placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and/or excipient.
Therefore, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
The present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.
Preferably, such a composition will comprise a nucleic acid comprising a polynucleotide sequence of either SEQ ED NO: 69 or SEQ ED NO: 70, placed under the control of appropriate regulatory elements. According to another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient a nucleic acid encoding an ABC 1 polypeptide according to the invention in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
The invention also relates to a pharmaceutical composition intended for the prevention of or treatment of subjects affected by, a dysfunction in the reverse transport of cholesterol, comprising a recombinant vector according to the invention, in combination with one or more physiologically compatible excipients. According to a specific embodiment, a method of introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained from a mammal, in vivo, comprises a step during which a preparation comprising a pharmaceutically compatible vector and a "naked" nucleic acid according to the invention, placed under the control of appropriate regulatory sequences, is introduced by local injection at the level of the chosen tissue, for example a smooth muscle tissue, the "naked" nucleic acid being absorbed by the cells of this tissue.
The invention also relates to the use of a nucleic acid according to the invention, encoding the ABCl protein, for the manufacture of a medicament intended for the prevention or treatment of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
The invention also relates to the use of a recombinant vector according to the invention, comprising a nucleic acid encoding the ABCl protein, for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol. As indicated above, the present invention also relates to the use of a defective recombinant virus according to the invention for the preparation of a pharmaceutical composition for the treatment and/or prevention of pathologies linked to the transport of cholesterol.
The invention relates to the use of such a defective recombinant virus for the preparation of a pharmaceutical composition intended for the treatment and/or for the prevention of cardiovascular disease linked to a deficiency in the reverse transport of cholesterol. Thus, the present invention also relates to a pharmaceutical composition comprising one or more defective recombinant viruses according to the invention.
The present invention also relates to the use of cells genetically modified ex vivo with a virus according to the invention, or of producing cells such as viruses, implanted in the body, allowing a prolonged and effective expression in vivo of a biologically active ABCl protein. The present invention shows that it is possible to incoφorate a nucleic acid encoding an ABCl polypeptide into a viral vector, and that these vectors make it possible to effectively express a biologically active, mature form. More particularly, the invention shows that the in vivo expression of ABCl may be obtained by direct administration of an adenovirus or by implantation of a producing cell or of a cell genetically modified by an adenovirus or by a retrovirus incoφorating such a DNA.
Preferably, the pharmaceutical compositions of the invention comprise a pharmaceutically acceptable vehicle or physiologically compatible excipient for an injectable formulation, in particular for an intravenous injection, such as for example into the patient's portal vein. These may relate in particular to isotonic sterile solutions or dry, in particular, freeze-dried, compositions which, upon addition depending on the case of sterilized water or physiological saline, allow the preparation of injectable solutions. Direct injection into the patient's portal vein is preferred because it makes it possible to target the infection at the level of the liver and thus to concentrate the therapeutic effect at the level of this organ. A "pharmaceutically acceptable vehicle or excipient " includes diluents and fillers which are pharmaceutically acceptable for method of administration, are sterile, and may be aqueous or oleaginous suspensions formulated using suitable dispersing or wetting agents and suspending agents. The particular pharmaceutically acceptable carrier and the ratio of active compound to carrier are determined by the solubility and chemical properties of the composition, the particular mode of administration, and standard pharmaceutical practice.
Any nucleic acid, polypeptide, vector, or host cell of the invention will preferably be introduced in vivo in a pharmaceutically acceptable vehicle or excipient. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "excipient" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as excipients, particularly for injectable solutions. Suitable pharmaceutical excipients are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. The pharmaceutical compositions according to the invention may be equally well administered by the oral, rectal, parenteral, intravenous, subcutaneous or intradermal route. The invention also relates to the use of the ABCl polypeptide having an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ID NO: 71 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol.
The invention finally relates to a pharmaceutical composition for the prevention or treatment of a patient or subject affected by a dysfunction in the reverse transport of cholesterol, comprising a therapeutically effective quantity of a polypeptide having an amino acid sequence of SEQ ED NO: 71 or a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, combined with one or more physiologically compatible vehicles and/or excipients.
According to another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient or subject a nucleic acid encoding an ABCl polypeptide in said patient, said nucleic acid being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients.
According to yet another aspect, the subject of the invention is also a preventive or curative therapeutic method of treating diseases caused by a deficiency in the metabolism of cholesterol, more particularly in the transport of cholesterol and still more particularly in the reverse transport of cholesterol, such a method comprising a step in which there is administered to a patient or subject a therapeutically effective quantity of an ABCl polypeptide according to the invention in said patient or subject, said polypeptide being, where appropriate, combined with one or more physiologically compatible vehicles and/or excipients. In another embodiment, the nucleic acids, polypeptides, recombinant vectors, and compositions according to the invention can be delivered in a vesicle, in particular a liposome (see Langer, 1990; Treat et al., 1989; and Lopez-Berestein, 1989).
In yet another embodiment, the nucleic acids, polypeptides, recombinant vectors, recombinant cells, and compositions according to the invention can be delivered in a controlled release system. For example, the polypeptide may be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (see Langer, 1990; Sefton, 1987; Buchwald et al., 1980; Saudek et al., 1989). In another embodiment, polymeric materials can be used (Langer and Wise, 1974; Smolen and Ball, 1984; Ranger and Peppas, 1983; Levy et al., 1985; During et al., 1989; and Howard et al., 1989). In yet another embodiment, a controlled release system can be placed in proximity of the target tissue or organ, i.e., the cardiovascular system, thus requiring only a fraction of the systemic dose (see Goodson, 1984). Other controlled release systems are discussed in the review by Langer (1990).
In a further aspect, recombinant cells that have been transformed with a nucleic acid according to the invention and that express high levels of an ABCl polypeptide according to the invention can be transplanted in a subject in need of ABCl polypeptide. Preferably autologous cells transformed with an ABCl encoding nucleic acid according to the invention are transplanted to avoid rejection; alternatively, technology is available to shield non- autologous cells that produce soluble factors within a polymer matrix that prevents immune recognition and rejection. Thus, the ABCl polypeptide can be delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration. Alternatively, the ABCl polypeptide, properly formulated, can be administered by nasal or oral administration. A constant supply of ABCl can be ensured by providing a therapeutically effective dose (i.e., a dose effective to induce metabolic changes in a subject) at the necessary intervals, e.g., daily, every 12 hours, etc. These parameters will depend on the severity of the disease condition being treated, other actions, such as diet modification, that are implemented, the weight, age, and sex of the subject, and other criteria, which can be readily determined according to standard good medical practice by those of skill in the art.
A subject in whom administration of the nucleic acids, polypeptides, recombinant vectors, recombinant host cells, and compositions according to the invention is performed is preferably a human, but can be any animal. Thus, as can be readily appreciated by one of ordinary skill in the art, the methods and pharmaceutical compositions of the present invention are particularly suited to administration to any animal, particularly a mammal, and including, but by no means limited to, domestic animals, such as feline or canine subjects, farm animals, such as but not limited to bovine, equine, caprine, ovine, and porcine subjects, wild animals (whether in the wild or in a zoological garden), research animals, such as mice, rats, rabbits, goats, sheep, pigs, dogs, cats, etc., avian species, such as chickens, turkeys, songbirds, etc., i.e., for veterinary medical use.
Preferably, a pharmaceutical composition comprising a nucleic acid, a recombinant vector, a polypeptide, or a recombinant host cell, as defined above, will be administered to the patient or subject.
METHODS OF SCREENING AN AGONIST OR ANTAGONIST COMPOUND FOR THE ABCl POLYPEPTIDE According to another aspect, the invention also relates to various methods of screening compounds or small molecules for therapeutic use which are useful in the treatment of diseases due to a deficiency in the metabolism of cholesterol, particularly in the transport of cholesterol, still more particularly in the reverse transport of cholesterol, such as Tangier disease, or more generally FHD-type conditions.
The invention therefore also relates to the use of an ABC 1 polypeptide, or of cells expressing an ABCl polypeptide, for screening active ingredients for the prevention or treatment of diseases resulting from a dysfunction in the reverse transport of cholesterol. The catalytic sites and oligopeptide or immunogenic fragments of an ABC 1 polypeptide can serve for screening product libraries by a whole range of existing techniques. The polypeptide fragment used in this type of screening may be free in solution, bound to a solid support, at the cell surface or in the cell. The formation of the binding complexes between the ABCl polypeptide fragments and the tested agent can then be measured.
Another product screening technique which may be used in high-flux screenings giving access to products having affinity for the protein of interest is described in application WO84/03564. En this method, applied to an ABCl protein, various products are synthesized on a solid surface. These products react with the ABCl protein or fragments thereof and the complex is washed. The products binding the ABCl protein are then detected by methods known to persons skilled in the art. Non-neutralizing antibodies can also be used to capture a peptide and immobilize it on a support.
Another possibility is to perform a product screening method using an ABCl neutralizing antibody competition, an ABCl protein and a product potentially binding the ABCl protein. In this manner, the antibodies may be used to detect the presence of a peptide having a common antigenic unit with an ABCl polypeptide or protein.
Of the products to be evaluated for their ability to increase ABCl activity, there may be mentioned in particular kinase-specific ATP homologs involved in the activation of the molecules, as well as phosphatases, which may be able to avoid the dephosphorylation resulting from said kinases. There may be mentioned in particular inhibitors of the phosphodiesterase (PDE) theophylline and 3-isobutyl-l-methylxanthine type or the adenylcyclase forskolin activators.
Accordingly, this invention relates to the use of any method of screening products, i.e., compounds, small molecules, and the like, based on the method of translocation of cholesterol (see Example 13) between the membranes or vesicles, this being in all synthetic or cellular types, that is to say of mammals, insects, bacteria, or yeasts expressing constitutively or having incoφorated a human ABCl encoding nucleic acid. To this effect, labeled lipid analogs may be used. Likewise, it has been described that the ABCl protein allowed anion transport
(Becq et al., 1997 and Yamon et al., 1997) and this transport was activated by phosphatase inhibitors such as okadaic acid and orthovanadate as well as part of the elevation of cAMP by agents such as forskolin. The present invention also relates to the use of such a system for screening molecules modulating the activity of the ABCl protein (see Example 14).
Yamon et al (1997) have demonstrated that the mouse ABCl protein was involved in the secretion of a proinflammatory cytokine EL-1 beta in mouse peritoneal macrophages. It is therefore also possible to provide a method of screening products modulating the activity of the
ABCl protein by determining the release of EL-lbeta from any cell type expressing two proteins
(see Example 15).
Furthermore, knowing that the disruption of numerous transporters have been described (van den Hazel et al., 1999), it is possible to think of using cellular mutants having a characteristic phenotype and to complement the function thereof with ABCl and to use the whole for screening puφoses.
The invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) preparing a membrane vesicle comprising an ABCl polypeptide and a lipid substrate comprising a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and/or quantitatively measuring release of the lipid substrate comprising a detectable marker; and d) comparing the release measurement obtained in step b) with a measurement of release of labeled lipid substrate by a vesicle that has not been previously incubated with the agonist or antagonist candidate compound. In a first specific embodiment, the ABCl polypeptide comprises an amino acid sequence of SEQ ED NO: 71.
In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of SEQ ED NO: 71.
According to a first aspect of the above screening method, the membrane vesicle is a synthetic lipid vesicle, which may be prepared according to techniques well known to a person skilled in the art. According to this particular aspect, the ABCl protein may be a recombinant ABCl protein.
According to a second aspect, the membrane vesicle is a vesicle of a plasma membrane derived from cells expressing an ABC 1 polypeptide. These may be cells naturally expressing an ABCl polypeptide or cells transfected with a nucleic acid encoding an ABCl polypeptide or recombinant vector comprising a nucleic acid encoding an ABC 1 polypeptide. According to a third aspect of the above screening method, the lipid substrate is chosen from cholesterol or phosphatidylcholine.
According to a fourth aspect, the lipid substrate is radioactively labeled, for example with an isotope chosen from 3H or 125I. According to a fifth aspect, the lipid substrate is labeled with a fluorescent compound, such as NBD or pyrene.
According to a sixth aspect, the membrane vesicle comprising the labeled lipid substrate and the ABCl polypeptide is immobilized at the surface of a solid support prior to step b). According to a seventh aspect, the measurement of the fluorescence or of the radioactivity released by the vesicle is the direct reflection of the activity of lipid substrate transport by the ABCl polypeptide.
The invention also relates to a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) obtaining cells, for example a cell line, that, either naturally or after transfecting the cell with an ABCl encoding nucleic acid, expresses an ABCl polypeptide; b) incubating the cells of step a) in the presence of an anion labeled with a detectable marker; c) washing the cells of step b) in order to remove the excess of the labeled anion which has not penetrated into these cells; d) incubating the cells obtained in step c) with an agonist or antagonist candidate compound for the ABCl polypeptide; e) measuring efflux of the labeled anion; and f) comparing the value of efflux of the labeled anion determined in step e) with a value of the efflux of a labeled anion measured with cells that have not been previously incubated in the presence of the agonist or antagonist candidate compound for the ABCl polypeptide.
In a first specific embodiment, the ABCl polypeptide comprises an amino acid sequence of SEQ ID NO: 71. In a second specific embodiment, the ABCl polypeptide comprises amino acids 1-60 of
SEQ ID NO: 71.
According to a first aspect of the above screening method, the cells used are cells naturally expressing an ABCl polypeptide. They may be human monocytes in primary culture, purified from a population of human blood mononuclear cells. They may also be human » monocytic cell lines, such as the monocytic leukemia line THP 1. According to a second aspect, the cells used in the screening method described above may be cells not naturally expressing, or alternatively expressing at a low level, an ABCl polypeptide, said cells being transfected with a recombinant vector according to the invention capable of directing the expression of a nucleic acid encoding an ABCl polypeptide. According to a third aspect, the cells may be cells having a natural deficiency in anion transport, or cells pretreated with one or more anion channel inhibitors such as Verapamil™ or tetraethylammonium.
According to a fourth aspect of said screening method, the anion is a radioactively labeled iodide, such as the salts K125I or Na125I. According to a fifth aspect, the measurement of efflux of the labeled anion is determined periodically over time during the experiment, thus making it possible to also establish a kinetic measurement of this efflux.
According to a sixth aspect, the value of efflux of the labeled anion is determined by measuring the quantity of labeled anion present at a given time in the cell culture supernatant. According to a seventh aspect, the value of efflux of the labeled anion is determined as the proportion of radioactivity found in the cell culture supernatant relative to the total radioactivity corresponding to the sum of the radioactivity found in the cell lysate and the radioactivity found in the cell culture supernatant.
The subject of the invention is also a method of screening a compound or small molecule active on the metabolism of cholesterol, an agonist or antagonist of an ABCl polypeptide, said method comprising the following steps: a) culturing cells of a human monocytic line in an appropriate culture medium, in the presence of purified human albumin; b) incubating the cells of step a) simultaneously in the presence of a compound stimulating the production of IL-1 beta and of an agonist or antagonist candidate compound; c) incubating the cells obtained in step b) in the presence of an appropriate concentration of ATP; d) measuring EL-1 beta released into the cell culture supernatant; and e) comparing the value of the release of the EL-1 beta obtained in step d) with the value of the EL-1 beta released into the culture supernatant of cells which have not been previously incubated in the presence of the agonist or antagonist candidate compound.
According to a first aspect of the screening method described above, the cells used belong to the human leukemic monocytic line THP1.
According to a second aspect of the screening method, the compound stimulating the production of IL-1 beta is a lipopolysaccharide. According to a third aspect of said method, the production of EL-1 alpha, EL-6 and TNF alpha by these cells is also qualitatively and/or quantitatively determined.
According to a fourth aspect, the level of expression of the messenger RNA encoding EL-1 beta is also determined.
The following examples are intended to further illustrate the present invention but do not limit the invention.
EXAMPLES
EXAMPLE 1: Tissue distribution of the transcripts of the ABCl gene according to the invention.
The profile of expression of the polynucleotides according to the present invention is determined according to the protocols for PCR-coupled reverse transcription and Northern blot analysis described in particular by Sambrook et al. (1989).
For example, in the case of an analysis by reverse transcription, a pair of primers as described above may be synthesized from a cDNA of the human ABCl gene comprising a polynucleotide sequence as depicted in SEQ ED NOs: 69 and 70. This primer pair may be used to detect the corresponding ABCl cDNA. Specifically, two oligonucleotide primers specific for ABCl and comprising either 1) a sequence contained within nucleotide region 1-184 of SEQ ID NO: 69 and a complementary sequence contained within nucleotide region 6968-9741 of SEQ ID NO: 69, or 2) a sequence contained within nucleotide region 1-297 of SEQ ED NO: 70 and a complementary sequence contained within nucleotide region 7081-9854 of SEQ ED NO: 70, may be used to isolate the ABC 1 cDNA.
The polymerase chain reaction (PCR) is carried out on cDNA templates corresponding to retrotranscribed polyA+ mRNAs (Clontech). The reverse transcription to cDNA is carried out with the enzyme SUPERSCRIPT Q (GibcoBRL, Life Technologies) according to the conditions described by the manufacturer. The polymerase chain reaction is carried out according to standard conditions, in 20 μl of reaction mixture with 25 ng of cDNA preparation. The reaction mixture is composed of 400 μM of each of the dNTPs, 2 units of Thermus aquaticus (Taq) DNA polymerase (Ampli Taq Gold; Perkin Elmer), 0.5 μM of each primer, 2.5 mM MgC12, and PCR buffer. Thirty four PCR cycles [denaturing 30 seconds at 94°C, annealing of 30 seconds divided up as follows during the 34 cycles: 64°C (2 cycles), 61°C (2 cycles), 58°C (2 cycles), and 55°C (28 cycles), and an extension of one minute per kilobase at 72°C] are carried out after a first step of denaturing at 94°C for 10 minutes using a Perkin Elmer 9700 thermocycler. The PCR reactions are visualized on agarose gel by electrophoresis. The cDNA fragments obtained may be used as probes for a Northern blot analysis and may also be used for the exact determination of the polynucleotide sequence.
In the case of a Northern Blot analysis, a cDNA probe produced as described above is labeled with 32P by means of the DNA labeling system High Prime (Boehringer) according to the instructions indicated by the manufacturer. After labeling, the probe is purified on a
Sephadex G50 microcolumn (Pharmacia) according to the instructions indicated by the manufacturer. The labeled and purified probe is then used for the detection of the expression of the mRNAs in various tissues. The Northern blot containing samples of RNA of different human tissues (Multiple
Tissue Northern, MTN, Clontech) Blot 2, reference 77759-1) is hybridized with the labeled probe. The protocol followed for the hybridizations and washes may be either directly as that described by the manufacturer (Instruction manual PT 1200-1) or an adaptation of this protocol using methods known to persons skilled in the art and described for example in F. Ausubel et al (1999). It is thus possible to vary, for example, the prehybridization and hybridization temperatures in the presence of formamide.
For example, it may be possible to use the following protocol:
1- Membrane competition and PREHYBRIDIZATION:
- Mix: 40 μl salmon sperm DNA (10 mg/ml) + 40 μl human placental DNA ( 10 mg/ml)
- Denature for 5 minutes at 96°C, then immerse the mixture in ice.
- Remove the 2X SSC and pour 4 ml of formamide mix in the hybridization tube containing the membranes.
- Add the mixture of the two denatured DNAs. - Incubation at 42°C for 5 to 6 hours, with rotation.
2- Labeled probe competition:
- Add to the labeled and purified probe 10 to 50 μl Cot I DNA, depending on the quantity of repeat sequences. - Denature for 7 to 10 minutes at 95°C.
- Incubate at 65 °C for 2 to 5 hours.
3- HYBRIDIZATION:
- Remove the prehybridization mix. - Mix 40 μl salmon sperm DNA + 40 μl human placental DNA; denature for 5 min at 96°C, then immerse in ice. - Add to the hybridization tube 4 ml of formamide mix, the mixture of the two DNAs and the denatured labeled probe/Cot I DNA.
- Incubate 15 to 20 hours at 42°C, with rotation.
4- Washes:
- One wash at room temperature in 2X SSC, to rinse.
- Twice 5 minutes at room temperature 2X SSC and 0.1% SDS at 65°C.
- Twice 15 minutes at 65°C IX SSC and 0.1% SDS at 65°C.
After hybridization and washing, the blot is analyzed after overnight exposure in contact with a phosphorus screen revealed with the aid of Storm (Molecular Dynamics, Sunnyvale, CA).
EXAMPLE 2 : 5' Extension of the human ABCl cDNA.
This Example describes the isolation and identification of cDNA molecules encoding the full length human ABCl protein. 5' extension of the partial ABCl cDNA sequence (GenBank Accession # AJ012376, Langmann et al., 1999) was performed using a modified 5' RACE approach.
Experimental design:
A human monocytic THP1 cDNA library (in the Lambda phage vector LZip-lox, Life Tech®) which had previously been made from THP1 cells that were differentiated with phorbol ester and then loaded with acetylated LDL to convert them to the foam cell phenotype was used in this Example. It has been shown that THP1 cells, when loaded with cholesterol, strongly up- regulate the expression of the human ABCl gene (Langmann et al., 1999). This THP1 cDNA library was used to 5' extend the human ABCl cDNA, since it should be enriched for ABCl cDNA. A set of nested PCR primers (SEQ D NOs: 155 and 156) which hybridize to nucleotides of the 5' published sequence region of human ABCl cDNA (Langmann et al., 1999) was used to elongate the ABCl cDNA in the 5' direction (see Table VH). Two sets of nested vector arm specific primers (SEQ ED NOs: 2, 140, 153, and 154) were designed for the reverse synthesis in the direction towards the human ABCl cDNA specific primer (see Table VII and Figure 1). Within Table , the term "Comp" refers to the complementary nucleotide sequence of the nucleotide positions indicated. In this manner, a PCR product corresponding to the true 5' end of the human ABCl cDNA can be obtained, regardless of its orientation within the vector.
TABLE VII
5' ABCl cDNA EXTENSION PRIMERS
Materials and Methods:
Primary PCR. An aliquot of the TTTP1 cDNA library (cleared bacterial lysate, containing approximately 5 xlO9 pfu ml of λZip-lox-THPl-FC library phage, 2.5xl06 recombinants, with an average insert size of 1.5kb) was heated to 95°C for 10 minutes to lyse the phage and release its DNA. Four ul of the lysed phage was then used in a 50ul PCR reaction containing 20mM Tris pH8.4, 50mM KCl, 1.5mM MgCl2 , 0.2mM dNTPs, 2.5units of Platinum® Taq ploymerase-HF (BRL), and 0.2uM of each primer [ABC 1-3' (SEQ DD NO: 155), and either λZip-forward (SEQ ID NO: 140) or λZip-reverse (SEQ ED NO: 153)]. Amplification was performed for 35 cycles of 94°C for 10 seconds, 58°C for 20 seconds, and 72°C for 2.5 minutes. Five ul of the PCR reaction were electrophoresed on a 0.8% agarose /TBE gel containing .02 ug/ml of ethidium bromide. The gel was photographed and examined for evidence of product. Secondary PCR. From selected primary PCR reactions, lul of the reaction was removed and diluted into 50ul of lOmM Tris pH 8.5. One ul of the diluted primary PCR reaction was used in a secondary PCR reaction using a nested ABCl primer (ABC 1-9, SEQ ED NO: 156) and the appropriate nested arm primer λZip-seq-1 (SEQ ED NO: 154) or λZip-seq-2 (SEQ ED NO: 2). The PCR reaction was amplified as above except the cycling parameters were adjusted as follows: 25 cycles at 94°C for 20 seconds, 56°C for 20 seconds, and 72°C for 1.5 minutes. Five ul of the secondary PCR reaction were analyzed on an agarose gel as described above.
Gel Purification of PCR product. The secondary PCR reactions which appeared to have a product of the appropriate size were then analyzed on an agarose gel and the bands corresponding to the ABCl cDNA 5' extension product were excised and purified using the Qiagen Qiaquick™ gel extraction purification system. The purified DNA fragments were eluted in a volume of 30ul of lOmM Tris pH 8.5. Five ul of the eluted PCR products were analyzed on an agarose gel to determine the approximate yields.
Sequencing. Five ul of each of the purified PCR products along with 20ng of ABC 1-7 sequencing primer (SEQ ED NO: 139) using BigDye™ terminator cycle sequencing on an ABI 377 sequencing apparatus. The purified 5' extended human ABCl cDNA PCR products' sequence results were analyzed using the Lasergene DNA Star software package and the BLAST program at the NCBI web site (http://www.ncbi.nlm.nih.gov).
Results and Discussion:
The primary PCR reactions yielded only faint bands, other than the primers staining (see Figure 2-a). Therefore, a secondary nested PCR reaction was performed. The secondary PCR reactions (Figure 2-b) produced an intensely stained, single band of approximately 800bp using primers ABC 1-9 (SEQ ED NO: 156) and λZip-seq-2 (SEQ ED NO: 2) in two of the reactions (see lanes 3 and 6, Figure 2-b), while there was a fainter band of approximately 750bp in lane 7 using primers ABC1-9 (SEQ ID NO: 156) and λZip-seq-1 (SEQ ID NO: 154).
To verify that the PCR products were authentic and specific for human ABCl cDNA, an additional nested PCR reaction was performed using the diluted primary PCR reactions that had yielded the bands obtained in the secondary PCR reactions (lanes 3, 6, and 7 of Figure 2-b) using primers ABC 1-7 (SEQ ED NO: 139) and λZip-seq-2 (SEQ ED NO: 154) or λZip-seq-1 (SEQ ED NO: 2), respectively. This additional nested PCR reaction should yield a product that is 254bp smaller than the one obtained in the secondary PCR reactions. This was indeed the case for the samples corresponding to lanes 3 and 6. However, the sample of lane 7 yielded no such product and therefore, was not likely to be ABCl cDNA specific and was not analyzed further.
An additional lOOul PCR reaction was performed to generate more of the product obtained in the secondary PCR reaction corresponding to the sample in lane 3. The secondary PCR reactions consisting of the first sample 3, the lOOul scale-up of sample 3, and sample 6 were gel purified in preparation for cloning and sequencing (see Figure 3). Following purification, 5ul of the three gel purified samples were sequenced using the ABC 1-7 oligonucleotide (SEQ ED NO: 139) as a primer. In addition, the purified products were each cloned into the plasmid, PCR2.1 (Invitrogen). The sequencing results revealed that a nucleic acid comprising an additional 244 nucleotides (SEQ ED NO: 3) 5' of the published partial human ABCl cDNA had been obtained. An open reading frame search was performed on this nucleic acid and a new ORF was identified that was contiguous with the previously published open reading frame. This new open reading frame extended the human ABCl protein by an additional 60 amino acid residues (amino acids 1-60 of SEQ ED NO: 71) as compared to the sequence of Langmann et al. (1999). The newly identified initiator ATG codon (nucleotides 185-187 of SEQ ID NO: 3) conformed well with the Kozak consensus sequence for eukaryotic translation initiation and significantly, there was an in-frame TGA terminator nine bases upstream (nucleotides 176-178 of SEQ ED NO: 3) of the new ATG initiation codon. Thus, the invention provides nucleic acids encoding the full length human ABCl protein (SEQ ED NO: 71). In particular, the present invention provides nucleic acids encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
In addition, two, third position nucleotide differences were also identified compared to the published sequence at new positions 260 and 262 of SEQ ID NO: 3 [corresponding to nucleotide positions 16 and 18 of Langmann et al. (1999)]. These nucleotide differences are conservative changes: 260:T→C and 262:A→G; and do not lead to any codon changes. SEQ
ED NOs: 69 and 70 comprise the new 5' extended ABCl cDNA region (SEQ ED NO: 3) obtained within this Example. Specifically, nucleotides 1-244 of SEQ ED NO: 3 correspond to nucleotides 1-244 of SEQ ID NO: 69 and nucleotides 114-357 of SEQ ID NO: 70, respectively.
Various other approaches may be used to isolate the cDNA corresponding to the complete cDNA of ABCl. For example, a complete clone may be directly isolated by hybridization by screening a cDNA library by means of a polynucleotide probe specific for the sequence of the gene of interest. In particular, a specific probe of 30-40 nucleotides is synthesized using a synthesizer of the Applied Biosystem/Perkin Elmer trademark depending on the chosen sequence. The oligonucleotide obtained is radiolabeled, for example with [γ-32P]ATP using T4 polynucleotide kinase and is purified according to the customary methods (e.g. Maniatis et al., 1982 or F. Ausubel et al., 1989).
The clone library containing the cDNA that is desired to screen is established on a culture medium in a Petri dish (1.5% agar) containing the appropriate antibiotics according to the customary methods cited above (F. Ausubel et al.). The colonies thus produced after incubation are transferred on nitrocellulose filters and screened by means of the radiolabeled nucleotide probe, according to the customary methods and the colonies hybridizing with the probe are isolated and subcloned.
The DNA of the clones thus identified is prepared and analyzed by sequencing. The clones containing the fragments corresponding to the complete cDNA are purified and recloned into the vector pcDNA3 according to the protocols known to persons skilled in the art and presented for example in F. Ausubel et al (1989).
Various methods are known for identifying the 5' and 3' ends of the cDNA corresponding to the genes described in the present application. These methods include but are not limited to hybridization cloning, to cloning using protocols similar or identical to 3' or 5'
RACE-PCR (Rapid Amplification of cDNA End-PCR) which are well known to persons skilled in the art.
For example, it will be possible to use the kit marketed by the company Clontech (Marathon Ready™ cDNA kit, protocol identified by the reference PT1156-1) or alternatively a method similar to 5 'RACE is available for characterizing any absent 5' end of a cDNA (Fromont-Racine et al., 1993). Briefly, an RNA oligonucleotide is ligated to the 5' end of an mRNA population. After retrotranscription to cDNA, a set of primers specific respectively for the adaptor ligated in 5' and for a sequence situated in 3' of the gene of interest is used in PCR to amplify the 5' portion of the desired cDNA. The amplified fragment is then used to reconstruct the complete cDNA.
EXAMPLE 3 : Analysis of the gene expression profile for Tangier disease
The verification of the impairment of the level of expression of the ABCl gene causing the Tangier cellular phenotype may be determined by hybridizing these sequences with probes corresponding to the mRNAs obtained from fibroblasts of subjects suffering or otherwise from the disease, according to the methods described below:
1. Preparation of the total RNAs. of the poly(A)+ mRNAs and of cDNA probes The total RNAs are obtained from cell cultures of the fibroblasts of normal subjects or subjects suffering from Tangier disease by the guanidine isothiocyanate method (Chomczynski & Sacchi, 1987). The poly(A)+ mRNAs are obtained by affinity chromatography on oligo(dT)- cellulose columns (Sambrook et al., 1989) and the cDNAs used as probes are obtained by RT-PCR (DeRisi et al., 1997) with oligonucleotides labeled with a fluorescent product (Amersham Pharmacia Biotech ; CyDye™).
2. Hvdridization and detection of the expression levels
The glass membranes containing the sequences presented in this patent application, corresponding to the Tangier gene are hybridized with the cDNA probes obtained from fibroblasts (Iyer et al., 1999). The use of the Amersham/molecular Dynamics system (Avalanche Microscanner™) allows the quantification of the expressions of the products of sequences on healthy or affected cell types.
EXAMPLE 4 : Construction of the expression vector containing the complete cDNA of ABCl in mammalian cells
The ABCl gene may be expressed in mammalian cells. A typical eukaryotic expression vector contains a promoter which allows the initiation of the transcription of the mRNA, a sequence encoding the protein, and the signals required for the termination of the transcription and for the polyadenylation of the transcript. It also contains additional signals such as enhancers, the Kozak sequence and sequences necessary for the splicing of the mRNA. An effective transcription is obtained with the early and late elements of the SV40 virus promoters, the retroviral LTRs or the CMV virus early promoter. However, cellular elements such as the actin promoter may also be used. Many expression vectors may be used to carry out the present invention, an example of such a vector is pcDNA3 (Invitrogen).
EXAMPLE 5 : Production of normal and mutated ABCl polypeptides.
The normal ABCl polypeptide encoded by the complete cDNA of ABCl whose isolation is described in Example 2 (cloning of the complete cDNA), or the mutated ABCl polypeptides whose complete cDNA may also be obtained according to the techniques described in Example 2, may be easily produced in a bacterial or insect cell expression system using the baculovirus vectors or in mammalian cells with or without the vaccinia virus vectors. All the methods are now widely described and are known to persons skilled in the art. A detailed description thereof will be found for example in F. Ausubel et al. (1989). EXAMPLE 6 : Production of an antibody directed against one of the mutated ABCl polypeptides.
The antibodies in the present invention may be prepared by various methods (Current Protocols In Molecular Biology Volume 1 edited by Frederick M. Ausubel, Roger Brent, Robert E. Kingston, David D. Moore, J.G. Seidman, John A. Smith, Kevin Struhl - Massachusetts General Hospital Harvard Medical School, chapter 11, 1989). For example, the cells expressing a polypeptide of the present invention are injected into an animal in order to induce the production of serum containing the antibodies. In one of the methods described, the proteins are prepared and purified so as to avoid contaminations. Such a preparation is then introduced into the animal with the aim of producing polyclonal antisera having a higher activity. In the preferred method, the antibodies of the present invention are monoclonal antibodies. Such monoclonal antibodies may be prepared using the hybridoma technique (Kόhler et al, 1975 ; Kόhler et al, 1976 ; Kohler et al, 1976 ; Hammeling et al., 1981). In general, such methods involve immunizing the animal (preferably a mouse) with a polypeptide or better still with a cell expressing the polypeptide. These cells may be cultured in a suitable tissue culture medium. However, it is preferable to culture the cells in an Eagle medium (modified Earle) supplemented with 10% fetal bovine serum (inactivated at 56°C) and supplemented with about 10 g /l of nonessential amino acids, 1000 U/ml of penicillin and about 100 μg/ml of streptomycin.
The splenocytes of these mice are extracted and fused with a suitable myeloma cell line. However, it is preferable to use the parental myeloma cell line (SP20) available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described by Wands et al. (1981). The hybridoma cells obtained after such a selection are tested in order to identify the clones secreting antibodies capable of binding to the polypeptide. Moreover, other antibodies capable of binding to the polypeptide may be produced according to a 2-stage procedure using anti-idiotype antibodies such a method is based on the fact that the antibodies are themselves antigens and consequently it is possible to obtain an antibody recognizing another antibody. According to this method, the antibodies specific for the protein are used to immunize an animal, preferably a mouse. The splenocytes of this animal are then used to produce hybridoma cells, and the latter are screened in order to identify the clones which produce an antibody whose capacity to bind to the specific antibody-protein complex may be blocked by the polypeptide. These antibodies may be used to immunize an animal in order to induce the formation of antibodies specific for the protein in a large quantity. It is preferable to use Fab and F(ab')2 and the other fragments of the antibodies of the present invention according to the methods described here. Such fragments are typically produced by proteolytic cleavage with the aid of enzymes such as Papaϊn (in order to produce the Fab fragments) or Pepsin (in order to produce the F(ab')2 fragments). Otherwise, the secreted fragments recognizing the protein may be produced by applying the recombinant DNA or synthetic chemistry technology.
For the in vivo use of antibodies in humans, it would be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies may be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. The methods for producing the chimeric antibodies are known to persons skilled in the art (for a review, see : Morrison, (1985) ; Oi et al., (1986) ; Cabilly et al., US patent No. 4,816,567 ; Taniguchi et al., EP 171496 ; Morrison et al., EP 173494 ; Neuberger et al., WO 8601533 ; Robinson et al., WO 8702671 ; Boulianne et al ; (1984) ; and Neuberger et al., (1985).
EXAMPLE 7 : Correction of the cellular phenotype of the Tangier disease
The Tangier disease is characterized by an accelerated catabolism of the high-density lipoprotein (HDL) particles and an accumulation of cholesterol in the tissues. In particular, the fibroblasts of the skin of patients suffering from Tangier disease have a reduced capacity to eliminate their cholesterol content by the process of efflux of cholesterol carried out by apolipoprotein A-I (apoA-I), the major protein of the HDLs (Francis et al., 1995). This characteristic corresponding to a loss of function is also found in other fibroblast cells of patients suffering from familial HDL deficiency (Marcil et al., 1999a).
The correction of the phenotype of the Tangier fibroblasts can be carried out by the transfection of the complete cDNA of ABCl according to the invention, into said cells. The cDNA is inserted into an expression vector which is then transfected according to the methods described below :
1. Preparation of the fibroblast cultures of normal subjects and of subjects suffering from Tangier disease
The primary fibroblasts of human skin are obtained by culturing a skin biopsy obtained from the forearm. These biopsies are performed on patients suffering from Tangier disease having the clinical and biochemical features of the "homozygotes", that is to say orange-colored tonsils, plasma concentrations of apoA-I and of cholesterol-HDL less than the 5th percentile. The normal fibroblast lines are obtained from the American Type Culture Collection (Rockville, MD). The fibroblasts are cultured in an EMMEM (Eagle-modified minimium essential medium ; GEBCO) medium supplemented with 10% fetal calf serum, 2 mM glutamine, 100 EU/ml of penicillin and 100 μg/ml of steptomycin (medium designated EMMEM10). In order to carry out the study of the efflux of cholesterol, these cells are preloaded with cholesterol by incubating for 24 hours with 50 μg/ml of cholesterol in the medium described above without calf serum but containing 2 mg/ml of bovine albumin (BSA, fraction V).
2. Study of the efflux of cholesterol The fibroblasts preloaded with cholesterol at confluence on 24-well plates are incubated in the EMMEM 10 medium and 1 μCi/ml of l,2-3H-cholesterol (50 Ci/mmol ; Dupont ; Wilmington, DE) for 48 hours. About 100,000 counts per minute are obtained per well or 1000 counts per minute and per μg of cellular protein. The cells are washed three times with EMMEM/BSA medium, and incubated with this medium for 24 hours before transfecting the gene of interest and starting the efflux by adding 10 μg/ml of proteoliposome containing apo A-I in EMMEM/BSA medium. These proteoliposomes are prepared by sonication of phosphatidylcholine and purified human apoA-I (Jonas, 1986). The cell transfection is carried out by the calcium phosphate precipitation technique (Sambrook et al., 1989). After the period of efflux, in general 20 hours, the medium is collected, centrifuged (1000 g, 5 min), and the radioactivity determined by liquid scintillation counting. The residual radioactivity in the cells is also determined overnight after extraction of the lipids in isopropanol. The percentage efflux is calculated by dividing the radioactivity measured in the supernatant by the sum of the radioactivities measured, in the supernatant and the cellular extract. An internal standard is prepared by transfection of a marker gene and incubation for 24 hours with an EMMEM/BSA medium without proteoliposome containing apoA-I. The efflux of cellular cholesterol from normal fibroblasts transfected with a control gene correspond to 6±2% whereas that obtained from fibroblasts suffering from Tangier disease and transfected with this control gene is less than 1%. On the other hand, the transfection of the fibroblasts suffering from Tangier disease with a plasmid containing the complete cDNA or the genomic DNA for ABCl according to the invention could make it possible to restore the capacity of these cells to eliminate their excess of cholesterol at a level corresponding to that of normal fibroblasts. EXAMPLE 8 : Isolation and characterization of genomic fragments of the human ABCl gene.
A fragment of about 3 kb of the human ABC 1 cDNA was obtained from the cDNA clone designated "pflO" containing the first ATP-binding domain of ABCl, this cDNA clone being described in the article by Luciani et al. (1994).
This cDNA fragment obtained by digestion of the clone pflO with the aid of the restriction endonuclease EcoRI, was isolated on an agarose gel after electrophoresis, then labeled with digoxigenin according to the manufacturer's instructions (kit marketed by Boehringer Mannheim, reference 1 585 614)
The labeled cDNA fragment was used to screen the LLNL (Lawrence Livermore National Labs) cosmid library of chromosome 9, immobilized on a Nylon™ filter.
Six positive clones were identified. For these six cosmids, the probe hybridized with single colonies.
A representative clone was isolated from each of these colonies. The clones LLNLC 131J087 Q2 (designated here cos3a) and LLNLc 13101165 Q2 (designated here cos6f) were analyzed in greater detail.
The clone cos3a was subcloned in the form of an EcoRI fragment into the vector Gen3zf(-) and sequenced at both ends using the Big Dye Terminator technology on an ABI377 type sequencer (Applied Biosystems, Perkin Elmer).
The clones containing distinct inserts (determined after sequencing of the ends of the various inserts or by determining the size thereof) which were too long to be completely sequenced with the aid of the primers hybridizing with the sequences of the vector, were analyzed more before by the technique of transposon insertion and then of sequencing with the aid of primers specific to the transposon ("GPS" system marketed by the company New England Biolabs).
Ln this manner, genomic sequences corresponding to the human ABCl gene were isolated and characterized. These sequences were compared with human and mouse sequences identified by references in the databases making it possible to determine the intron-exon junctions.
Primers for the amplification of the DNA of the patients were designed from nonrepetitive sequences of the intron DNA of the ABCl gene, in such a way that an amplification of the intron-exon junctions as well as the bases essential for the formation of the secondary structure during the splicing step are included in the amplified fragments. The genomic DNA of the patients was amplified with the aid of the primers described above using Qiagen's Star Taq kit or the Supertaq kit, using the hybridization conditions and the amplification cycle conditions recommended by the manufacturer.
The amplified PCR products were then purified using a kit marketed by the company Qiagen, and then sequenced by the Big Dye Terminator method on an ABI377 sequencer.
EXAMPLE 9 : Determination of polymorphisms/mutations in the ABCl gene.
The detection of polymoφhisms or of mutations in the sequences of the transcripts or in the genomic sequence of the ABCl gene may be carried out according to various protocols. The preferred method is direct sequencing.
For patients from whom it is possible to obtain an mRNA preparation, the preferred method consists in preparing the cDNAs and sequencing them directly. For patients for whom only DNA is available, and in the case of a transcript where the structure of the corresponding gene is unknown or partially known, it is necessary to precisely determine its intron-exon structure as well as the genomic sequence of the corresponding gene. This therefore involves, in a first instance, isolating the genomic DNA BAC or cosmid clone(s) corresponding to the transcript studied according to the method described in Example 8, sequencing the insert of the corresponding clone(s) and determining the intron-exon structure by comparing the cDNA sequence to that of the genomic DNA obtained.
The technique of detection of mutations by direct sequencing consists in comparing the genomic sequences of the ABCl gene obtained from homozygotes for the disease or from at least 8 individuals (4 individuals affected by the pathology studied and 4 individuals not affected). The sequence divergences constitute polymoφhisms. All those modifying the amino acid sequence of the wild-type protein may be mutations capable of affecting the function of said protein which it is preferred to consider more particularly for the study of cosegregation of the mutation and of the disease (denoted genotype-phenotype correlation) in the pedigree or in the studies of case/control association for the analysis of the sporadic cases.
EXAMPLE 10 : Identification of a causal gene for a disease linked to a deficiency in the reverse transport of cholesterol by causal mutation or a transcriptional difference
Among the mutations identified according to the method described in Example 9, all those associated with the disease phenotype are capable of being causal. Validation of these results is made by sequencing the gene in all the affected individuals and their relations (whose DNA is available). Moreover, Northern blot or RT-PCR analysis, according to the methods described in Example 1, using RNA specific to affected or nonaffected individuals makes it possible to detect notable variations in the level of expression of the gene studied, in particular in the absence of transcription of the gene.
EXAMPLE 11 : Identification of biallelic polymorphisms in the ABCl gene
Primers for the amplification of the DNA of the patients were designed from nonrepetitive sequences of the intron DNA of the ABCl gene, in such a way that an amplification of the intron-exon junctions as well as the bases essential for the formation of the secondary structure during the RNA splicing step are included in the amplified fragments.
The various pairs of primers specifically developed are presented in Table VI. The results found on the DNA from 7 families containing cases of Tangier or FHD disease are shown in Table V. The genomic DNA of the patients was amplified with the aid of the primers described above using Qiagen's Star Taq kit or the Supertaq kit, using the hybridization conditions and the amplification cycle conditions recommended by the manufacturer.
The amplified PCR products were then purified using a kit marketed by the company Qiagen, and then sequenced by the Big Dye Terminator method on an ABI377 sequencer (Applied Biosystems, Perkin Elmer).
EXAMPLE 12 : Construction of recombinant vectors comprising a nucleic acid encoding a ABCl protein
I. Synthesis of a nucleic acid encoding a human ABCl protein:
Total RNA (500 ng) isolated from a human cell (i.e., placental tissue, Clontech, Palo Alto, CA, USA, or THPl cells) may be used as source for the synthesis of the cDNA of the human ABCl gene. Methods to reverse transcribe mRNA to cDNA are well known in the art. For example, one may use the system "Superscript one step RT-PCR (Life Technologies, Gaithersburg, MD, USA).
Oligonucleotide primers specific for ABCl cDNA may be used for this puφose. Specifically, two oligonucleotide primers specific for ABCl (0.25 μM) comprising either 1) a sequence contained within nucleotide region 1-184 of SEQ ID NO: 69 and a complementary sequence contained within nucleotide region 6968-9741 of SEQ ED NO: 69, or 2) a sequence contained within nucleotide region 1-297 of SEQ ED NO: 70 and a complementary sequence contained within nucleotide region 7081-9854 of SEQ ED NO: 70, may be used to isolate a nucleic acid encoding an ABC 1 protein.
These oligonucleotide primers may be synthesized by the phosphoramidite method on a DNA synthesizer of the ABI 394 type (Applied Biosystems, Foster City, CA, USA). Sites recognized by the restriction enzyme Notl may be incoφorated into the amplified
ABC 1 cDNA to flank the ABC 1 cDNA region desired for insertion into the recombinant vector by a second amplification step using 50 ng of human ABCl cDNA as template, and 0.25 μM of the ABCl specific oligonucleotide primers used above containing, at their 5' end, the site recognized by the restriction enzyme Notl (5'-GCGGCCGC-3'), in the presence of 200 μM of each of said dideoxynucleotides dATP, dCTP, dTTP and dGTP as well as the Pyrococcus furiosus DNA polymerase (Stratagene, Inc. La Jolla, CA, USA).
The PCR reaction may be carried out over 30 cycles each comprising a step of denaturation at 95°C for one minute, a step of renaturation at 50°C for one minute and a step of extension at 72°C for two minutes, in a thermocycler apparatus for PCR (Cetus Perkin Elmer Norwalk, CT, USA).
H. Cloning of the cDNA of the human ABCl gene into an expression vector:
The human ABCl cDNA insert may then be cloned into the Notl restriction site of an expression vector, for example, the pCMV vector containing a cytomegalovirus (CMV) early promoter and an enhancer sequence as well as the SV40 polyadenylation signal (Beg et al., 1990; Applebaum-Boden, 1996), in order to produce an expression vector designated pABCl.
The sequence of the cloned cDNA can be confirmed by sequencing on the two strands using the reaction set "ABI Prism Big Dye Terminator Cycle Sequencing ready" (marketed by Applied Biosystems, Foster City, CA, USA) in a capillary sequencer of the ABI 310 type (Applied Biosystems, Foster City, CA, USA).
HI. Construction of a recombinant adenoviral vector containing the cDNA of the human ABCl gene:
A- Modification of the expression vector pCMV-β :
The β-galactosidase cDNA of the expression vector pCMV-β (Clontech, Palo Alto,
CA, USA, Gene Bank Accession No. U02451) may be deleted by digestion with the restriction endonuclease Notl and replaced with a multiple cloning site containing, from the 5' end to the
3' end, the following sites: Notl, Ascl, RsrEI, Avrll, Swal, and Notl, cloned at the region of the Notl restriction site. The sequence of this multiple cloning site is: 5'-CGGCCGCGGCGCGCCCGGACCGCCTAGGATTTAAATCGCGGCCCGCG-3' (SEQ ED NO: 66).
The DNA fragment between the EcoRI and Sanl sites of the modified expression vector pCMV may be isolated and cloned into the modified Xbal site of the shuttle vector pXCXII (McKinnon et al., 1982; McGrory et al., 1988).
B-modification of the shuttle vector pXCXH: A multiple cloning site comprising, from the 5' end to the 3 end the Xbal, EcoRI, Sfil,
Pmel, Nhel, Srfl, Pad, Sail and Xbal restriction sites having the sequence:
5'-GCTCTAGAATTCGGCCTCCGTGGCCGTTTAAACGCTAGCGCCCGGGCTTAATTAA
GTCGACTCTAGAGC-3' (SEQ ED NO: 67).
may be inserted at the level of the Xbal site (nucleotide at position 3329) of the vector pXCXII
(McKinnon et al., 1982; McGrory et al., 1988).
The EcoRI-Sall DNA fragment isolated from the modified vector pCMV-β containing the CMV promoter/enhancer, the donor and acceptor splicing sites of FV40 and the polyadenylation signal of FV40 may then be cloned into the EcoRI-Sall site of the modified shuttle vector pXCX, designated pCMV-11.
C- Preparation of the shuttle vector pAD12-ABCl:
The human ABCl cDNA is obtained by an RT-PCR reaction, as described above, and cloned at the level of the Notl site into the vector pCMV-12, resulting in the obtaining of the vector pCMV-ABCl.
D. Construction of the ABCl recombinant adenovirus:
The ABCl-rldV recombinant adenovirus containing the human ABCl cDNA may be constructed according to the technique described by McGrory et al. (1988).
Briefly, the vector pAD12-ABCl is cotransfected with the vector tGM17 according to the technique of Chen and Okayama (1987).
Likewise, the vector pAD12-Luciferase was constructed and cotransfected with the vector pJM 17. The recombinant adenoviruses are identified by PCR amplification and subjected to two purification cycles before a large-scale amplification in the human embryonic kidney cell line HEK 293 (American Type Culture Collection, Rockville, MD, USA).
The infected cells are collected 48 to 72 hours after their infection with the adenoviral vectors and subjected to five freeze-thaw lysing cycles.
The crude lysates are extracted with the aid of Freon (Halocarbone 113, Matheson
Product, Scaucus, N.J. USA), sedimented twice in cesium chloride supplemented with 0.2% murine albumine (Sigma Chemical Co., St Louis, MO, USA) and dialysed extensively against buffer composed of 150 nM NaCl, 10 mM Hepes (pH 7,4), 5 mM KCl, 1 mM MgCl2, and 1 mM CaCl2.
The recombinant adenoviruses are stored at -70°C and titrated before their administration to animals or their incubation with cells in culture.
The absence of wild-type contaminating adenovirus is confirmed by screening with the aid of PCR amplification using oligonucleotide primers located in the structural portion of the deleted region.
TV Validation of the expression of the human ABCl cDNA:
Polyclonal antibodies specific for a human ABCl polypeptide may be prepared as described above in rabbits and chicks by injecting a synthetic polypeptide fragment derived from an ABCl protein, comprising all or part of an amino acid sequence as described in SEQ
ED NO: 71. These polyclonal antibodies are used to detect and/or quantify the expression of the human ABCl gene in cells and animal models by immunoblotting and/or immunodetection.
The biological activity of ABCl may be monitored by quantifying the cholesterol fluxes induced by apoA-I using cells transfected with the vector pCMV-ABCI which have been loaded with cholesterol (Remaley et al., 1997).
V. Expression in vitro of the human ABCl cDNA in cells:
Cells of the HEK293 line and of the COS-7 line (American Tissue Culture Collection,
Bethesda, MD, USA), as well as fibroblasts in primary culture derived from Tangier patients or from patients suffering from hypo-alphalipoproteinemia are transfected with the expression vector pCMV-ABCl (5-25 μg) using Lipofectamine (BRL, Gaithersburg, MD, USA) or by coprecipitation with the aid of calcium chloride (Chen et al., 1987).
These cells may also be infected with the vector pABCl-AdV (Index of infection, MOI=10). The expression of human ABC 1 may be monitored by immunoblotting as well as by quantification of the efflux of cholesterol induced by apoA-1 using transfected and/or infected cells.
The complementation of the genetic defect from which the Tangier patients and the hypo-alphalipoproteinemic patients are suffering using fibroblasts of these patients, may be confirmed by the detection of the expression of the normal ABCl gene, which makes it possible to establish the functional importance of this receptor.
VI. Expression in vivo of the ABCl gene in various animal models: An appropriate volume (100 to 300 μl) of a medium containing the purified recombinant adenovirus (pABCl-AdV or pLucif-AdV) containing from 108 to 109 lysis plaque- forming units (pfu) are infused into the Saphenous vein of mice (C57BL/6, both control mice and models of transgenic or knock-out mice) on day 0 of the experiment.
The evaluation of the physiological role of the ABCl protein in the metabolism of lipoproteins is carried out by determining the total quantity of cholesterol, of triglycerides, of phospholipids and of free cholesterol (Sigma and Wako Chemicals, Richmond, VA, USA), of cholesterol-HDL (CEBA-Corning, Oberlin, OH, USA) and apolipoproteins A-I, A-Q, E and B from mice (Foger et al., 1997), before (day zero) and after (days 2, 4, 7, 10, 14) the administration of the adenovirus. Kinetic studies with the aid of radioactively labelled produces such as apoA-I-HDL,
CE-HDL as well as apoB-LDL and CE-LDL are carried out on day 5 after the administration of the vectors rLucif-AdV and rABCl-AdV in order to evaluate the effect of the expression of ABCl on the metabolism of the HDLs and of the LDLs as well as on the release of cholesterol toward the liver. The effect of the expression of ABCl on the development of atherosclerosis may be evaluated by quantifying the mean surface area of aortic lesion in apoE mice after administration of the vector rABCl-Adv.
Furthermore, transgenic mice and rabbits overexpressing the ABCl gene may be produced, in accordance with the teaching of Vaisman (1995) and Hoeg (1996) using constructs containing the human ABCl cDNA under the control of endogenous promoters such as ABCl, CMV or apoE.
The evaluation of the long-term effect of the expression of ABCl on the kinetics of the plasma lipids, lipoproteins and apolipoproteins and on atherosclerosis may be carried out as described above. EXAMPLE 13 : Use of vesicles for screening for agonist and antagonist molecules of an ABCl protein.
The basis of this screening test is the reconstitution of membranes which have incoφorated the ABCl protein and containing substrates such as cholesterol or phospholipids.
The ABCl protein may then be activated or its function repressed by the addition of molecules of interest. The outflow of the substrates through the channel formed by the ABCl protein is then detected.
a) Reconstitution of a membrane comprising an ABCl protein and a labeled lipid substrate.
Various strategies may be used to manufacture these membranes, methods using organic solvents, mechanical means such as sonication, the "French press", or by freeze-thaw cycles or using detergents (cholates, Chaps, Chapso) (see Rigaud et al., 1995). More particularly, a lipid substrate such as phospholipids, cholesterol or cholesterol ester, a radioactive substrate of the 3H-cholesterol, 125I-cholesterol or 3H-phosphatidylcholine type or a fluorescent substrate with NBD or pyrene (Molecular Probes ; http ://www.probes.com) and phospatidylcholine from eggs (1 mM) are dried on the pellet of a glass flask. Sodium cholate and the ABCl protein are mixed in this flask in a mol to mol ratio of 0.3. The whole is vortex-mixed for 5 minutes and then incubated at 25°C for 30 minutes and then dialysed against a saline buffer. The proteoliposome produced according to this protocol is monitored by turbidimetry in order to verify that its manufacture is good.
b) Capture of the proteoliposome on a solid surface. This step may be carried out by incoφorating binding proteins of the integrin type. In this protocol, a capture by the antibodies directed against the ABCl protein and previous adsorbed on a 96- or 384-well plate is used.
A solution containing these antibodies at the concentration of 100 μg/1 are absorbed on these multi-well plates by incubating overnight at 4°C. After washing, the plate is then saturated with bovine albumin at 1 mg/ml incubated for 2 hours at 37°C. The whole is then washed and incubated with the proteoliposomes containing ABCl for 2 hours at 37°C.
c) Binding to the molecules of interest.
This step is carried out by incubation of products for 1 hour at 37°C.
d) Determination of the activation or inhibition of the ABCl protein. If the substrate if fluorescent, the fluorescence of the supernatant shows us the activity of a product in inducing a transport of lipid to the outside of the proteoliposome. Alternatively, the use of a Confocal system gives us information on the quantities of substrate inside and outside the proteoliposome. If the substrate is radioactive, the use of CytoStar-type plates having a bottom with scintillation liquid makes it possible to reveal the substrate still sequestered in the proteoliposome.
EXAMPLE 14 : Use of anion transport for screening of agonist and antagonist molecules of an ABCl protein.
The principle of this test lies in the property that the ABCl protein has for transporting the anions during its activation.
a) The macrophage cells of the THP-1 lines, monocytic leukemia human cells, are a model of differentiated macrophages. The cells are cultured in an RPMI 1640 medium supplemented with 10% fetal calf serum in 48-multiwell plates at the density of 2 x 105 cells per well. The fibroblast cells of patients suffering from Tangier disease may be used as a negative control because their ABCl protein is not functional. Another negative control may be obtained by the addition of anti-ABC 1 antibodies.
b) The use of anion transport defective cells or cells treated with anion channel inhibitors (Verapamil type, an inhibitor of P-glycoprotein or tetraethylammonium, a potassium channel inhibitor) may also be used.
c) For the actual test itself, the cells are then washed with an Earles's modified salt solution (ESS) medium preloaded with 1 ml of Kl at 1 μmol L (0.1 μCi/ml of NaI125) in this ESS medium for 30 minutes at 37°C. The products are then added to the extracellular medium. The cells are then washed with the ESS medium. d) The quantity of iodide in the medium is detected every minute for 11 minutes. The first two points correspond to the basal efflux. At the end of the incubation, the medium is taken up and the quantity of iodine remaining in the cells is counted following lysis of the cells in 1 molar NaOH.
e) The total quantity of radioactivity at time zero is equal to the sum of the radioactivity found in the supernatant and the residual radioactivity in the cells. The efflux curves are constructed by plotting the percentage of radioactivity released into the medium as a function of time.
EXAMPLE 15 : Use of THP-1 macrophages expressing EL-lbeta to screen for agonist and antagonist molecules of an ABCl protein.
The principle of this test is that any substance that modulates the activity of an ABC 1 protein will have an effect on the synthesis of EL-lbeta.
a) The macrophage cells of the THP-1 lines, monocytic leukemia human cells, are a model of differentiated macrophages. The cells are cultured in an RPMI 1640 medium supplemented with 10% fetal calf serum in multiwell plates at the density of 2 105 cells per well.
b) For the actual test itself, the cells are then washed and placed in an RPMI 1640 medium containing 1 mg/ml of purified human albumin fraction EV.
c) The products are added to the extracellular medium. Simultaneously, the cells are then activated by addition of lipopolysaccharide (LPS) over 3 hours at 1 μg/ml followed by an incubation of 30 minutes in the presence of ATP at 5 mmol L.
d) The concentrations of EL-lbeta and of control EL-1 alpha, tumor necrosis factor alpha (TNFalpha) and EL-6 are determined by ELISA kits according to the manufacturers' instructions (R&D Sytem ; human EL-lbeta Chemiluminescent ELISA reference QLB00). The variations of mRNA for EL-lbeta which is not supposed to be affected are evaluated by the Northern blotting technique with the corresponding probe.
EXAMPLE 16 : ABCl mediated phospholipid and cholesterol efflux
I - Culture Cell
Human Hela Tet-Off® cells (Clontech, Palo Alto, CA) were grown in Dulbecco- modified Minimum Essential Medium (DMEM) (GEBCO BRL, Rockville, MD) supplemented with 10%) fetal calf serum, 2 mM glutamine, 100 IU/ml of penicillin, 100 μg/ml of streptomycin
(EMEM10), and 250 μg/mL of G418. Cell lines stably expressing human ABC1-GFP fusion protein were obtained by co-transfection with the pTR2 plasmid (Clontech, Palo Alto, CA), containing the cDNA of the fusion protein, and pHygro, which encodes a resistance marker for hygromycin. Approximately 2 weeks after selection with lmg/mL of hygromycin, cells positive for GFP, as assessed by fluorescence microscopy, were cloned and expanded.
II- Cholesterol Efflux Assay
The cholesterol efflux assay was essentially performed as described by Oram et al. (1986) and Rothblat et al. (1986).
Confluent cholesterol-loaded fibroblasts grown on 24-well plates were incubated with EMEM10 containing 1 μCi/ml of 1,2- 3H-cholesterol (50 Ci/mmol)(Dupont, Wilmington, DE) for 48 h. Typically, this labeling protocol resulted in approximately 100,000 CPM/well or 1000 CPM/ug protein. Cells were washed three times with EMEM/BSA and EMEM/BSA media in presence or absence of 10 μg/ml cholesterol acceptors, Le±, apoA-I, apoA-Q, apoA-IV, apoC-I, apoC-Q, apoC-EQ, apoE were added and incubated for 24 h at 37°C, prior to efflux with cholesterol. After the efflux period (18 h), media was collected and centrifuged (10,000 X g for 5 min), and an aliquot of the media was counted for radioactivity by liquid scintillation counting. The residual radioactive count in the cell fraction was determined after an over night extraction with isopropanol. The percent efflux was calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the media plus the cell fraction. Unless indicated, EMEM/BSA media was used as a blank and the results from the blank were subtracted from the radioactive counts obtained in the presence of a cholesterol acceptor.
The results as presented in Figure 4, clearly demonstrate that addition of various apolipoproteins A-I, A-EJ, A-EV, C-I, C-Q, C-EQ, and E3 markedly increases cholesterol efflux in ABCl transfected cells, thereby indicating that full length ABCl protein according to the present invention is capable of promoting cholesterol efflux mediated by various apolipoproteins A-I, A-EI, A-EV, C-I, C-Q, C-EQ, and E3.
HI- Phospholipid Efflux Assay
The phospholipid efflux assay was essentially performed as described by Mendez et al.
(1994).
Choline-containing phospholipids were labeled by incubating confluent cholesterol- loaded fibroblasts grown on 24 well plates with EMEM10 medium containing 5 μCi/ml of methyl-3Hcholine chloride (84Ci/mmol (Amersham; Arlington Heights, 111) for 24 h. Cells were washed three times with EMEM/BSA, followed by a lh pre-incubation in EMEM/BSA, prior to incubation with EMEM/BSA media in presence or absence of 10 μg/ml phospholipid acceptors, i.e.. apoA-I, apoA-Q, apoA-EV, apoC-I, apoC-Q, apoC-QI, apoE3. Typically, this labeling protocol resulted in approximately 500,000 CPM/well or 5000 CPM/ug protein. After the efflux period (18 h), media was collected and centrifuged (10,000 X g; 5 min). An aliquot of the supernatant was extracted with chloroform:methanol (2: 1), and radioactivity was determined by liquid scintillation counting of the organic phase. The remaining counts in the cell fraction was determined after an overnight extraction with isopropanol, followed by a 1 h extraction with hexane: isopropanol (3:2).
The percent efflux is calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the efflux media plus the cell fraction. Unless indicated, EMEM/BSA media was used as a blank and the results from the blank were subtracted from the radioactive counts obtained in the presence of a phospholipid acceptor.
The results as presented in Figure 5, clearly demonstrate that addition of various apolipoproteins A-I, A-EI, A-EV, C-I, C-Q, C-EQ, and E3 markedly increases phospholipid efflux in ABCl transfected cells, thereby indicating that full length ABCl protein according to the present invention is also involved in apolipoproteins A-I, A-II, A-EV, C-I, C-Q, C-EQ, and E3 mediated cellular phospholipid efflux.
TV- Lipoprotein, Apoliprotein Vesicles Preparation
HDL (d = 1.063- 1.021 g/ml) was isolated from human plasma by density gradient ultracentrifugation, as described by Shumaker et al.
Apolipoproteins were purified from human plasma by column chromatography as described by Brewer et al. (1986) and were determined to be over 99 % pure, as assessed by
SDS-polyacrylamide gel electrophoresis and aminoterminal sequence analysis.
Phosphatidylcholine vesicles and reconstitution of apoA-I with egg yolk phosphatidylcholine at a ratio of 1:2.5 (w/w) was performed by sonication, as previously described by Jonas et al.
(1986). Results in Figure 6, show that apoA-I and HDL respectively fully and partially mediate cholesterol efflux in ABCl transfected cells. In addition, apoA-I mediates phospholipid efflux in ABCl transfected cells. However, phosphatidylcholine (PC) does not mediate cholesterol efflux in ABCl transfected cells. V- ApoA-I and ApoA-π binding to ABCl
ApoA-I was iodinated with isotopic 125 Iodide by the iodide monochloride method to a specific activity of 2 X 106 cpm/μg. Confluent fibroblasts grown on 24-well plates were incubated with iodinated apoA-I for 3 h at 37°C in the presence and absence of a 50-fold excess of the apolipoprotein A-I and A-ϋ fractions isolated from HDL. Cells were rapidly washed three times with EMEM BSA at 4°C. Bound iodinated ligands were determined by gamma counting, after dissolving the cell fraction with 0.1 M NaOH and 0.1 %SDS.
REFERENCES CITED
Adames et al, 1985, Nature 318:533-538.
Agbedana et al., 1990. Ann Trop Med Parasitol., 84:529-30.
Alexander et al., 1987, Mol. Cell. Biol. 7: 1436-1444.
Altschul et al, 1990. J. Mol. Biol., 215:403-410. Altschul et al, 1997. Nucleic Acids Res., 25:3389-3402.
Applebaum-Boden, 1996. JCI 97.
Ausubel et al., 1989. Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y.
Baptista et al., 1996. Parasite, 3:335-40. Beard et al., 1990. Virology, 75:81.
Beaucage et al., 1981. Tetrahedron Lett, 22: 1859-1862.
Becq et al., 1997. Journal of Biological Chemistry, 272:2695-2699.
Beg et al., 1990. PNAS, 87:3473.
Bender et al, 1987. J. Virol., 61:1639. Benoist and Chambon, 1981, Nature 290:304-310.
Benton and Davis, 1977, Science 196: 180.
Bernstein et al., 1985. Genet. Eng., 7:235.
Bodzioch et al., 1999. Nature Genetics, 22:347-351.
Boulianne et al., 1984. Nature, 312:643. Breakfield et al., 1991. New Biologist, 3:203.
Brewer et al., 1986. Methods of Enzymology. J.P. Segrest, J.J. Albers, editors. Academic Press . Inc., Londonl28: 223-246
Brinster et al., 1982, Nature 296:39-42. Brooks et al., 1999. Nature Genetics, 22:336-345.
Brown EL, Belagaje R, Ryan MJ, Khorana HG, 1979. Methods Enzymol, 68: 109-151.
Buchwald et al., 1980. Surgery 88:507.
Cabilly et al., US patent No. 4,816,567.
Chander et al., 1998. Indian J Exp Biol., 36:371-4. Chen and Kwok, 1997. Nucleic Acids Research 25:347-353.
Chen and Okayama, 1987. Mol Cell Biol., 7:2745-2752.
Chen et al., 1997. Proc. Natl. Acad. Sci. USA, 94/20: 10756-10761.
Chen et al., 1987. Mol. Cell. Biol., 7 : 2745-2752.
Chomczynski, P. and Sacchi, 1987. Anal. Biochem., 162:156-159. Cole et al., 1985. In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77- 96.
Cote et al., 1983. Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030.
Cuisinier et al., 1990. Med Trop (Mars). 50:91-5.
Curiel et al., 1992. Hum. Gene Ther. 3:147-154. Davis et al., 1993. J. Infect. 26:279-85.
Davis et al., 1995. J. Infect. 31 :181-8.
DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25.
DeRisi J. et al., 1997. Science, 278:680-686.
Dib C. et al., 1996. Nature, 380:152-154. Djoumessi, 1989. Pathol Biol., 37:909-11.
During et al., 1989. Ann. Neurol. 25:351.
Efthimiou et al., 1992. Wein Klin Wochenschr., 104:705-6.
Erel et al., 1998. Haematologia (Budap)., 29:207-12. Feigner et al., 1987. PNAS 84:7413.
Feigner and Ringold, 1989. Science 337:387-388.
Flotte et al., 1992. Am. J. Respir. Cell Mol. Biol., 7:349-356.
Foger et al., 1997. J. Biol. Chem., 272:27393-400. Forsell Y. et al., 1997. Biol. Psychiatry, 42:898-903.
Fraley et al., 1979. Proc. Natl. Acad. Sci. USA, 76:3348-3352.
Fraley et al., 1980. J.Biol.Chem., 255:10431.
Francis et al., 1995. J. Clin. Invest., 96:78-87.
French et al., 1993. Am J Cardiol. 71:505-510. Freshney (ed.), 1986. Immobilized Cells And Enzymes, IRL Press.
Fromont-Racine et al, 1993. Nucleic Acid Res.21(7): 1683- 1684.
Fuller S.A. et al., 1996. Immunology, In: Current Protocols in Molecular Biology, Ausubel et al.(eds.).
Gait (ed.), 1984. Nucleic Acid Hybridization. Glover (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis, MRL Press, Ltd., Oxford, U.K.
Goodson, 1984. In: Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley: New York , vol. 2, pp. 115-138.
Gopal, 1985. Mol. Cell. Biol., 5:1188-1190. Graham et al., 1973. Virology, 52:456^157.
Graham et al., 1977. J. Gen. Virol., 36:59.
Graham, 1984. EMBO J., 3:2917.
Grellier et al., 1997. Vox Sang., 72:211-20.
Grosschedl et al., 1984, Cell 38:647-658. Grunstein and Hogness, 1975, Proc.Natl. Acad. Sci. U.S.A. 72:3961.
Haff L.A. and Smirnov I.P., 1997. Genome Research, 7:378-388.
Hager and Hajduk, 1997. Nature 385:823-6.
Ham, 1980. Methods Cell. Biol., 21a:255. Hames and Higgins (eds.), 1984. Animal Cell Culture.
Hames and Higgins (eds.), 1985. Transcription And Translation.
Hames BD and Higgins SJ, 1985. Nucleic acid hybridization : a practical approach, Hames and Higgins Ed., ERL Press, Oxford.
Hammeling et al., 1981. In : Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681.
Hammer et al., 1987, Science 235:53-58.
Hanahan, 1985, Nature 315: 115-122. Harland et al., 1985. J. Cell. Biol., 101 : 1094-1095.
Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990.
Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70.
Hoeg, 1996. PNAS, 93: 11448. Horvath S. et al., 1998. Am. J. Hum. Genet., 63: 1886-1897.
Houben Weyl, 1974. In: Meuthode der Organischen Chemie, E. Wunsch Ed., 15-1: 15-11.
Howard et al., 1989. J. Neurosurg. 71 : 105.
Huse et al., 1989. Science 246:1275-1281.
Hutchinson, C, et al., 1978, J. Biol. Chem. 253:6551. Hutchinson et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:710.
Huygen et al., 1996. Nature Medicine, 2(8):893-898.
Jonas et al., 1986. Methods Enzymol., 128:553-82.
Kaneda et al., 1989. Science 243:375.
Kaufman, 1991. Current Protocols in Molecular Biology, 16.12. Kelsey et al., 1987, Genes and Devel. 1:161-171.
Kim et al., 1996. Genomics, 34:213-218.
Kittl, et al., 1992. Wein Klin Wochenschr 104:2 .
Koch Y., 1977. Biochem. Biophys. Res. Commun., 74:488-491.
Kόhler et al, 1976. Eur. J. Immunol., 6:511. Kόhler et al., 1976. Eur. J. Immunol. 6:292.
Kϋhler et al., 1975. Nature, 256:495.
Kohler G. and Milstein C, 1975. Nature, 256:495-497.
Kollias et al, 1986, Cell 46:89-94. Kozbor et al, 1983a. Immunology Today, 4:72.
Kozbor et al, 1983b. Hybridoma, 2(1):7-16.
Krumlauf et al, 1985, Mol. Cell. Biol. 5: 1639-1648.
Kwiterovich, 1995. Ann NY Acad Sci, 748:313-30; discussion 331-2. Lander and Schork, 1994. Science, 265:2037-2048.
Langer, 1990. Science, 249: 1527-1533.
Langer and Wise (eds.), 1974. In: Medical Applications of Controlled Release, CRC Press: Boca Raton, Florida.
Langmann T. et al, 1999. Biochem. Biophys. Res. Comm, 257:29-33. Lawn et al, 1999. J. Clin. Invest, 104:R25-R31.
Leder et al, 1986, Cell 45:485-495.
Leger OJ, et al, 1997. Hum Antibodies, 8(1):3-16.
Levrero et al, 1991. Gene 101.
Levy et al, 1985. Science 228: 190. Lopez-Berestein, 1989. In: Liposomes in the Therapy of Infectious Disease and Cancer, Lopez- Berestein and Fidler (eds.), Liss: New York, pp. 317-327.
Luciani M.F.et al, 1994. Genomics, 21:150-159.
Lyer V. et al, 1999. Science, 283:83-87.
MacDonald, 1987, Hepatology 7:425-515. Mackey, et al, 1988. Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031. MacKinnon et al, 1982. Gene 19:33.
Maniatis et al, 1982. Molecular cloning : A Laboratory Manual, Cold Spring Harbor Press, Cold Spring, NY.
Marcil M. et al, 1999a. Artreriosclerosis Throbosis and Vascular Biology, 17:1813-1821. Marcil et al, 1999b. Lancet, 354:1341^6.
Martineau P, Jones P, Winter G, 1998. J Mol Biol, 280(1): 117-127.
Mason et al, 1986, Science 234: 1372-1378.
Maurois et al, 1985. Biochimie, 67:227-39. McCormick, 1985. BioTechnology, 3:689.
McGrory et al, 1988. Virology, 163:614.
McLaughlin BA et al, 1996. Am. J. Hum. Genet, 59:561-569.
Mendez AJ et al, 1994. J. Clin. Invest. 94, 1698-1705 Merrifield RB, 1965a. Nature, 207(996):522-523. Merrifϊeld RB, 1965b. Science, 150(693):178-185.
Mogram et al, 1985, Nature 315:338-340.
Mohanty, et al, 1992. Ann Trop Med Parasitol, 86:601-6.
Morrison et al, EP 173494. Morrison et al, 1984. J. Bacteriol. 159:870.
Morrison, 1985. Science 229:1202.
Narang SA, Hsiung HM, Brousseau R, 1979. Methods Enzymol, 68:90-98.
Neuberger et al, 1984. Nature, 312:604-608.
Neuberger et al, 1985. Nature, 314:268. Neuberger et al, WO 8601533.
Nickerson D.A. et al, 1992. Genomics, 12:377-387.
Nicolau C. et al, 1987. Methods Enzymol, 149:157-76.
Nilsson et al, 1990. J Intern Med, 227:151-5.
Oi et al, 1986. Biotechnique, 4:214. Okayama, 1987. Mol Cell. Biol, 7:2745.
Oliphant et al, 1986, Gene 44: 177.
Oram et al, 1986, Oram, J.F. (1986). Methods Enzymology. J.P. Segrest, J.J. Albers, Editors. Academic Press Inc., London. 129:645-659
Ornitz et al, 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409. Pagano et al, 1967. J.Virol, 1:891. Perbal, 1984. -A Practical Guide To Molecular Cloning. Pinkert et al, 1987, Genes and Devel. 1:268-276. Pirich et al, 1993. Semin Thromb Hemost, 19:138-43.
Potter et al, 1984. Proc Natl Acad Sci U S A, 81(22):7161-5.
Ranger and Peppas, 1983. J. Macromol. Sci. Rev. Macromol. Chem. 23:61.
Readhead et al, 1987, Cell 48:703-712. Reeck et al, 1987, Cell 50:667.
Reimann KA, et al, 1997. AIDS Res Hum Retroviruses, 13(11):933-943.
Remaley et al, 1997. ATVB, 17:1813.
Ridder R, Schmitz R, Legay F, Gram H, 1995. Biotechnology (NY), 13(3):255-260.
Rigaud et al, 1995. Biochimica et Biophysica Acta, 1231 :223-246. Robinson et al, WO 8702671.
Rothblat et al.,1986. Methods of Enzymology. J.P. Segrest, J.J. Albers, editors. Academic Press Inc., London 129:628-644.
Rust S. et al, 1998. Nature Genetics, 20:96-98. Rust et al, 1999. Nature Genetics, 22:352-355.
Sambrook, J. Fritsch, E. F, and T. Maniatis, 1989. Molecular cloning: a laboratory manual. 2ed. Cold Spring Harbor Laboratory, Cold spring Harbor, New York.
Samulski et al, 1989. J. Virol, 63:3822-3828.
Sanchez-Pescador R, 1988. J. Clin. Microbiol, 26(10):1934-1938. Sani, 1985, Nature 314:283-286.
Saudek et al, 1989 N. Engl. J. Med. 321:574.
Sefton, 1987. CRC Crit. Ref. Biomed. Eng. 14:201.
Schumaker et al, 1986. Methods of Enzymology. J.P. Segrest, J.J. Albers, editors. Academic Press Inc., London 128: 155-169 Sham P.C. et al, 1995. Ann. Hum. Genet, 59:323-336.
Smith et al, 1988, Gene 67:31-40.
Smolen and Ball (eds.), 1984. Controlled Drug Bioavailability, Drug Product Design and Performance, Wiley: New York .
Stemberg N.L, 1992. Trends Genet, 8: 1-16. Stemberg N.L, 1994. Mamm. Genome, 5:397-404.
Strautnieks S.S. et al, 1998. Nature Genetics, 20:233-235.
Swift et al, 1984, Cell 38:639-646.
Syvanne et al, 1995a. Circulation, 92:364-70.
Syvanne et al, 1995b. J. Lipid Res, 36:573-82.
Tacson et al, 1996. Nature Medicine, 2(8):888-892.
Takeda et al, 1985. Nature 314:452-454.
Taniguchi et al, EP 171496. Tomlinson and Raper, 1996. Nat. Biotechnol, 14:717-21.
Treat et al, 1989. In: Liposomes in the Therapy of Infectious Disease and Cancer, Lopez- Berestein and Fidler (eds.), Liss: New York, pp. 353-365.
Tur-Kaspa et al, 1986. Mol. Cell. Biol, 6:716-718.
Ulmer et al, 1993. Science 259:1745-1748. Urdea M.S., 1988. .Nucleic Acids Research, 11:4937-4957.
Urdea MS et al, 1991. Nucleic Acids Symp Ser, 24: 197-200.
Vaisman, 1995. J.Biol. Chem, 270: 12269.
Van, den Hazel. H, H. Pichler, V. M. M. do, E. Leitner, A. Goffeau, and G. Daum, 1999. J Biol Chem, 274: 1934-41. Villa-Kamaroff, et al, 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731.
Wagner et al, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445.
Wands et al, 1981. Gastroenterology, 80:225-232.
Williams et al, 1991. Proc. Natl. Acad. Sci. USA 88:2726-2730. Wu et al, 1992, J. Biol. Chem. 267:963-967. Wu and Wu, 1987. J. Biol. Chem. 262:4429-4432.
Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624.
Xiong M. et al, 1999. Am. J. Hum. Genet, 64:629-640.
Yamamoto, et al, 1980, Cell 22:787-797.
Yamon et al, 1997. Blood, 90:2911-2915. Zoller and Smith, 1984, DNA 3:479-488.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Various publications are cited herein, the disclosures of which are incoφorated by reference in their entireties.

Claims

1. An isolated nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70,
72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence. 2. An isolated nucleic acid comprising at least eight consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54- 65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence.
3. An isolated nucleic acid comprising at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65,
68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ID NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence.
4. The isolated nucleic acid according to claim 3, wherein the nucleic acid comprises an 85%, 90%, 95%, or 98% nucleotide identity with the nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence.
5. An isolated nucleic acid that hybridizes under high stringency conditions with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence.
6. An isolated nucleic acid comprising a polynucleotide sequence as depicted in any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or of a complementary polynucleotide sequence.
7. An isolated nucleic acid comprising nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1 -357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
8. An isolated nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ DD NO: 70, or a complementary polynucleotide sequence.
9. An isolated nucleic acid comprising at least 80% nucleotide identity with nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
10. The isolated nucleic acid according to claim 9 comprising an 85%, 90%, 95%, or 98%> nucleotide identity with nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.
11. An isolated nucleic acid that hybridizes under high stringency conditions with nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
12. A nucleotide probe or primer specific for an ABCl gene, wherein the nucleotide probe or primer comprises at least 15 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ED NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ED NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence.
13. A nucleotide probe or primer specific for an ABCl gene, wherein the nucleotide probe or primer comprises at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a complementary polynucleotide sequence.
14. A nucleotide probe or primer specific for an ABCl gene, wherein the nucleotide probe or primer comprises any one of SEQ ID NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence.
15. A method of amplifying a region of the nucleic acid according to claim 1, wherein the method comprises: a) contacting the nucleic acid with two nucleotide primers, wherein the first nucleotide primer hybridizes at a position 5' of the region of the nucleic acid, and the second nucleotide primer hybridizes at a position 3' of the region of the nucleic acid, in the presence of reagents necessary for an amplification reaction; and b) detecting the amplified nucleic acid region.
16. A method of amplifying a region of the nucleic acid according to claim 15, wherein the two nucleotide primers are selected from the group consisting of
A) a nucleotide primer comprising at least 15 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54- 65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ tt) NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ Q) NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence,
B) a nucleotide primer comprising at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ED NO: 70, or a nucleic acid having a complementary sequence, and C) a nucleotide primer comprising a polynucleotide sequence of any one of
SEQ ED NOs: 119-136, 138, and 141-152, or a nucleic acid having a complementary sequence.
17. A kit for amplifying the nucleic acid according to claim 1, wherein the kit comprises: a) two nucleotide primers whose hybridization position is located respectively 5' and 3' of the region of the nucleic acid; and optionally, b) reagents necessary for an amplification reaction.
18. The kit according to claim 17, wherein the two nucleotide primers are selected from the group consisting of
A) a nucleotide primer comprising at least 15 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-
65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ID NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence,
B) a nucleotide primer comprising at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and C) a nucleotide primer comprising a polynucleotide sequence of any one of SEQ ED
NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence.
19. The nucleotide probe or primer according to claim 12, wherein the nucleotide probe or primer comprises a marker compound.
20. The nucleotide probe or primer according to claim 13, wherein the nucleotide probe or primer comprises a marker compound.
21. The nucleotide probe or primer according to claim 14, wherein the nucleotide probe or primer comprises a marker compound.
22. A method of detecting a nucleic acid according to claim 1, wherein the method comprises: A) contacting the nucleic acid with a nucleotide probe selected from the group consisting of
1) a nucleotide probe comprising at least 15 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ ED NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54- 65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ED NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ED NO: 53, or of a complementary polynucleotide sequence,
2) a nucleotide primer comprising at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and
3) a nucleotide probe comprising a polynucleotide sequence of any one of SEQ ID NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence, and B) detecting a complex formed between the nucleic acid and the probe.
23. The method of detection according to claim 22, wherein the probe is immobilized on a support.
24. A kit for detecting the nucleic acid according to claim 1, wherein the kit comprises
A) a nucleotide probe selected from the group consisting of
1) a nucleotide probe comprising at least 15 consecutive nucleotides of a polynucleotide sequence of a) any one of SEQ Q) NOs: 1, 4-8, 1 1-16, 18-26, 28-35, 37-52, 54- 65, 68, and 137, or of a complementary polynucleotide sequence; b) nucleotides 3154-3200 of SEQ ID NO: 9 or of a complementary polynucleotide sequence; c) nucleotides 1-242 of SEQ ID NO: 10 or of a complementary polynucleotide sequence; d) nucleotides 1-1851 of SEQ ED NO: 17; or of a complementary polynucleotide sequence; e) nucleotides 152-198 of SEQ ED NO: 27, or of a complementary polynucleotide sequence; f) nucleotides 1-1657 of SEQ ID NO: 36, or of a complementary polynucleotide sequence; or g) nucleotides 1-242 of SEQ ID NO: 53, or of a complementary polynucleotide sequence,
2) a nucleotide primer comprising at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ED NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and
3) a nucleotide probe comprising any one of SEQ ID NOs: 119-136, 138, and 141-152, or of a complementary polynucleotide sequence, and optionally,
B) reagents necessary for a hybridization reaction.
25. The kit according to claim 24, wherein the probe is immobilized on a support.
26. A recombinant vector comprising the nucleic acid according claim 1.
27. The vector according to claim 26, wherein the vector is an adenovirus.
28. A recombinant vector comprising the nucleic acid according claim 6.
29. The vector according to claim 28, wherein the vector is an adenovirus.
30. A recombinant vector comprising the nucleic acid according claim 7.
31. The vector according to claim 30, wherein the vector is an adenovirus.
32. A recombinant host cell comprising the nucleic acid according claim 1.
33. A recombinant host cell comprising the recombinant vector according to claim 26.
34. A recombinant host cell comprising the nucleic acid according claim 6.
35. A recombinant host cell comprising the recombinant vector according to claim 28.
36. A recombinant host cell comprising the nucleic acid according claim 7.
37. A recombinant host cell comprising the recombinant vector according to claim 30.
38. An isolated nucleic acid encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
39. An isolated nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71.
40. A recombinant vector comprising the nucleic acid according to claim 38.
41. A recombinant vector comprising the nucleic acid according to claim 39.
42. A recombinant host cell comprising the nucleic acid according to claim 38.
43. A recombinant host cell comprising the nucleic acid according to claim 39.
44. A recombinant host cell comprising the recombinant vector according to claim 40.
45. A recombinant host cell comprising the recombinant vector according to claim 41.
46. An isolated polypeptide selected from the group consisting of a) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, b) a polypeptide comprising amino acids 1-60 of SEQ ED NO: 71, c) a polypeptide fragment or variant of a polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, and d) a polypeptide homologous to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.
47. An antibody directed against the isolated polypeptide according to claim 46.
48. The antibody according to claim 47, wherein the antibody comprises a detectable compound.
49. A method of detecting a polypeptide, wherein the method comprises a) contacting the polypeptide with an antibody according to claim 47; and b) detecting an antigen/antibody complex formed between the polypeptide and the antibody.
50. A diagnostic kit for detecting a polypeptide, wherein the kit comprises a) the antibody according to claim 47; and b) a reagent allowing detection of an antigen/antibody complex formed between the polypeptide and the antibody.
51. A pharmaceutical composition comprising the nucleic acid according to claim 1 and a physiologically compatible excipient.
52. A pharmaceutical composition comprising the nucleic acid according to claim 6 and a physiologically compatible excipient.
53. A pharmaceutical composition comprising the nucleic acid according to claim 7 and a physiologically compatible excipient.
54. A pharmaceutical composition comprising the nucleic acid according to claim
38 and a physiologically compatible excipient.
55. A pharmaceutical composition comprising the nucleic acid according to claim
39 and a physiologically compatible excipient.
56. A pharmaceutical composition comprising the recombinant vector according to claim 26 and a physiologically compatible excipient.
57. A pharmaceutical composition comprising the recombinant vector according to claim 28 and a physiologically compatible excipient.
58. A pharmaceutical composition comprising the recombinant vector according to claim 30 and a physiologically compatible excipient.
59. A pharmaceutical composition comprising the recombinant vector according to claim 40 and a physiologically compatible excipient.
60. A pharmaceutical composition comprising the recombinant vector according to claim 41 and a physiologically compatible excipient.
61. Use of the nucleic acid according to claim 1 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
62. Use of the nucleic acid according to claim 6 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
63. Use of the nucleic acid according to claim 7 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
64. Use of the nucleic acid according to claim 38 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
65. Use of the nucleic acid according to claim 39 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
66. Use of a recombinant vector according to claim 26 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
67. Use of a recombinant vector according to claim 28 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
68. Use of a recombinant vector according to claim 30 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
69. Use of a recombinant vector according to claim 40 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
70. Use of a recombinant vector according to claim 41 for the manufacture of a medicament for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
71. Use of an isolated ABCl polypeptide comprising an amino acid sequence of SEQ ED NO: 71 or amino acids 1-60 of SEQ ED NO: 71 for the manufacture of a medicament intended for the prevention of atherosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
72. A pharmaceutical composition comprising a polypeptide comprising an amino acid sequence of SEQ ED NO: 71 and a physiologically compatible excipient.
73. A pharmaceutical composition comprising a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71 and a physiologically compatible excipient.
74. A pharmaceutical composition comprising a polypeptide comprising an amino acid sequence of any one of SEQ W NOs: 71 and 89-102, and a physiologically compatible excipient.
75. Use of an isolated ABCl polypeptide comprising an amino acid sequence of any one of SEQ ED NOs: 71 and 89-102 for screening an active ingredient for the prevention or treatment of a disease resulting from a dysfunction in the reverse transport of cholesterol.
76. Use of a recombinant host cell expressing an ABCl polypeptide comprising an amino acid sequence of SEQ Q) NOs: 71 and 89-102 for screening an active ingredient for the prevention or treatment of a disease resulting from a dysfunction in the reverse transport of cholesterol.
77. A method of screening a compound active on cholesterol metabolism, an agonist, or an antagonist of an ABCl polypeptide, wherein the method comprises a) preparing a membrane vesicle comprising an ABCl polypeptide and a lipid substrate comprising a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and/or quantitatively measuring a release of the lipid substrate comprising the detectable marker; and d) comparing the release of the lipid substrate measured in step b) with a measurement of a release of a labeled lipid substrate by a membrane vesicle that has not been previously incubated with the agonist or antagonist candidate compound.
78. A method of screening a compound active on cholesterol metabolism, an agonist, or an antagonist of a ABCl polypeptide, wherein the method comprises a) incubating a cell that expresses an ABCl polypeptide with an anion labeled with a detectable marker; b) washing the cell of step a) whereby excess labeled anion that has not penetrated into the cell is removed; c) incubating the cell obtained in step b) with an agonist or antagonist candidate compound for the ABC 1 polypeptide; d) measuring efflux of the labeled anion from the cell; and e) comparing the efflux of the labeled anion determined in step d) with efflux of a labeled anion measured with a cell that has not been previously incubated with the agonist or antagonist candidate compound.
79. A method of screening a compound active on cholesterol metabolism, an agonist, or an antagonist of an ABCl polypeptide, wherein the method comprises a) culturing a cell of a human monocytic line in an appropriate culture medium with a purified human albumin; b) incubating the cell of step a) simultaneously with a compound that stimulates the production of EL-1 beta and an agonist or antagonist candidate compound; c) incubating the cell obtained in step b) with an appropriate concentration of ATP; d) measuring EL-1 beta released by the cell obtained in step c) into the cell culture supernatant, and e) comparing the released EL-1 beta obtained in step d) with EL-1 beta released into a culture supernatant of a cell that has not been previously incubated with the agonist or antagonist candidate compound.
80. An implant comprising the recombinant host cell according to claim 32.
81. An implant comprising the recombinant host cell according to claim 34.
82. An implant comprising the recombinant host cell according to claim 36.
83. An isolated nucleic acid comprising any one of a) SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ID NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ID NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ID NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
84. An isolated nucleic acid comprising at least eight consecutive nucleotides of a nucleotide sequence of a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ Q) NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
85. An isolated nucleic acid comprising at least 80% nucleotide identity with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ U NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
86. The isolated nucleic acid according to claim 85, wherein the nucleic acid comprises an 85%, 90%, 95%, or 98% nucleotide identity with the nucleic acid comprising a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ID NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ID NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
87. An isolated nucleic acid that hybridizes under high stringency conditions with a nucleic acid comprising a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ID NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
88. An isolated nucleic acid comprising a nucleotide sequence as depicted in a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ Q) NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof..
89. A nucleotide probe or primer specific for an ABCl gene, wherein the nucleotide probe or primer comprises at least 15 consecutive nucleotides of a nucleotide sequence of a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ) NO: 69, f) nucleotides 1-223 of SEQ Q3 NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
90. The nucleotide probe or primer according to claim 89, wherein the nucleotide probe or primer comprises a marker compound.
91. A method of amplifying a region of the nucleic acid according to claim 83, wherein the method comprises: a) contacting the nucleic acid with two nucleotide primers, wherein the first nucleotide primer hybridizes at a position 5' of the region of the nucleic acid, and the second nucleotide primer hybridizes at a position 3' of the region of the nucleic acid, in the presence of reagents necessary for an amplification reaction; and b) detecting the amplified nucleic acid region.
92. A method of amplifying a region of the nucleic acid according to claim 91, wherein the two nucleotide primers are selected from the group consisting of a nucleotide primer comprising at least 15 consecutive nucleotides of a nucleotide sequence of a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
93. A kit for amplifying the nucleic acid according to claim 83, wherein the kit comprises: a) two nucleotide primers whose hybridization position is located respectively 5' and 3' of the region of the nucleic acid; and optionally, b) reagents necessary for an amplification reaction.
94. The kit according to claim 93, wherein the two nucleotide primers are selected from the group consisting of a nucleotide primer comprising at least 15 consecutive nucleotides of a nucleotide sequence of a) any one of SEQ U NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ Q) NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223 of SEQ ID NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ED NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ID NO: 17, or a complementary nucleotide sequence thereof.
95. A method of detecting a nucleic acid according to claim 83, wherein the method comprises:
A) contacting the nucleic acid with a nucleotide probe selected from the group consisting of a nucleotide probe comprising at least 15 consecutive nucleotides of a nucleotide sequence of a) any one of SEQ Q NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 11498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ID NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ ID NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ED NO: 17, or a complementary nucleotide sequence thereof, and
B) detecting a complex formed between the nucleic acid and the probe.
96. The method of detection according to claim 95, wherein the probe is immobilized on a support.
97. A kit for detecting the nucleic acid according to claim 83, wherein the kit comprises
A) a nucleotide probe selected from the group consisting of a nucleotide probe comprising at least 15 consecutive nucleotides of a nucleotide sequence of a) any one of SEQ ED NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) nucleotides 1 1498-11754 of SEQ ED NO: 1, or a complementary nucleotide sequence thereof, d) nucleotides 1-110 of SEQ ED NO: 69, or a complementary nucleotide sequence thereof, e) nucleotides 7971-9741 of SEQ ED NO: 69, f) nucleotides 1-223 of SEQ ID NO: 70, or a complementary nucleotide sequence thereof, g) nucleotides 8084-9854 of SEQ ED NO: 70, or a complementary nucleotide sequence thereof, h) nucleotides 696-951 of SEQ ED NO: 40, or a complementary nucleotide sequence thereof, i) nucleotides 296-2894 of SEQ Q_) NO: 36, or a complementary nucleotide sequence thereof, and j) nucleotides 490-5352 of SEQ ED NO: 17, or a complementary nucleotide sequence thereof, and optionally, B) reagents necessary for a hybridization reaction.
98. The kit according to claim 97, wherein the probe is immobilized on a support.
99. A recombinant vector comprising the nucleic acid according any one of claims 83 and 88.
100. The vector according to claim 99, wherein the vector is an adenovirus.
101. A recombinant host cell comprising the nucleic acid according to any one of claims 83 and 88.
102. A recombinant host cell comprising the recombinant vector according to claim 99.
103. An isolated nucleic acid of sequence chosen from SEQ ED NO: 69 or 70 encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 71.
104. A recombinant vector comprising the nucleic acid according to claim 103.
105. A recombinant host cell comprising the nucleic acid according to claim 103.
106. A recombinant host cell comprising the recombinant vector according to claim 104.
107. A pharmaceutical composition comprising the nucleic acid according to any one of claims 83, 88, and 103 and a physiologically compatible excipient.
108. A pharmaceutical composition comprising the recombinant vector according to claim 104 and a physiologically compatible excipient.
109. Use of the nucleic acid according to any one of claims 83, 88, and 103 for the manufacture of a medicament intended for the prevention of arteriosclerosis in various forms or more particularly for the treatment of a subject affected by a dysfunction in the reverse transport of cholesterol.
110. Use of a recombinant vector according to claim 104 for the manufacture of a medicament for the prevention of arteriosclerosis in various forms or more particularly for the treatment of subjects affected by a dysfunction in the reverse transport of cholesterol.
111. An implant comprising the recombinant host cell according to claim 106.
EP00975997A 1999-10-26 2000-10-26 Nucleic acids of the human abc1 gene and applications thereof Withdrawn EP1257651A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP00975997A EP1257651A2 (en) 1999-10-26 2000-10-26 Nucleic acids of the human abc1 gene and applications thereof

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
EP99402668 1999-10-26
EP99402668A EP1096012A1 (en) 1999-10-26 1999-10-26 Nucleics acids of the human ABC1 gene and their therapeutic and diagnostic application
US18626000P 2000-03-01 2000-03-01
US186260P 2000-03-01
PCT/EP2000/010886 WO2001030848A2 (en) 1999-10-26 2000-10-26 Nucleic acids of the human abc1 gene and applications thereof
EP00975997A EP1257651A2 (en) 1999-10-26 2000-10-26 Nucleic acids of the human abc1 gene and applications thereof

Publications (1)

Publication Number Publication Date
EP1257651A2 true EP1257651A2 (en) 2002-11-20

Family

ID=8242152

Family Applications (2)

Application Number Title Priority Date Filing Date
EP99402668A Withdrawn EP1096012A1 (en) 1999-10-26 1999-10-26 Nucleics acids of the human ABC1 gene and their therapeutic and diagnostic application
EP00975997A Withdrawn EP1257651A2 (en) 1999-10-26 2000-10-26 Nucleic acids of the human abc1 gene and applications thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP99402668A Withdrawn EP1096012A1 (en) 1999-10-26 1999-10-26 Nucleics acids of the human ABC1 gene and their therapeutic and diagnostic application

Country Status (8)

Country Link
EP (2) EP1096012A1 (en)
JP (1) JP2003523177A (en)
AU (1) AU1391901A (en)
BR (1) BR0014998A (en)
CA (1) CA2388950A1 (en)
HU (1) HUP0400492A3 (en)
WO (1) WO2001030848A2 (en)
ZA (1) ZA200203269B (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6821774B1 (en) 1999-06-18 2004-11-23 Cv Therapeutics, Inc. Compositions and methods for increasing cholesterol efflux and raising HDL using ATP binding cassette transporter ABC1
US6835563B1 (en) 1999-06-18 2004-12-28 Cv Therapeutics Compositions and methods for increasing cholesterol efflux and raising HDL ATP binding cassette transporter protein ABC1
WO2001070810A2 (en) * 2000-03-20 2001-09-27 Bayer Aktiengesellschaft Atp binding cassette transporter 1 (abc1) gene polymorphisms and uses thereof for the diagnosis and treatment of lipid disorders, cardiovascular diseases and inflammatory diseases
FR2815970A1 (en) * 2000-10-31 2002-05-03 Aventis Pharma Sa New polymorphisms in the human ABCA1 gene, useful for diagnosing predisposition to myocardial infarct and other cardiovascular diseases
WO2002036770A2 (en) * 2000-10-31 2002-05-10 Aventis Pharma S.A. Polymorphic sequences of the human abca1 gene, their uses, detection methods and kits
WO2005116057A1 (en) * 2004-05-27 2005-12-08 Baker Medical Research Institute Monoclonal antibody against abca1
US20090280500A1 (en) * 2004-12-11 2009-11-12 Science And Technology Facilities Council Assay for generation of a lipid profile using fluorescence measurement
EP2037740A4 (en) * 2006-06-07 2011-12-28 Reddys Lab Ltd Dr Compositions and methods to enhance reverse cholesterol transport
WO2021099573A1 (en) * 2019-11-21 2021-05-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for diagnosing and treating chronic myelomonocytic leukemia (cmml)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0130848A2 *

Also Published As

Publication number Publication date
JP2003523177A (en) 2003-08-05
HUP0400492A2 (en) 2004-05-28
BR0014998A (en) 2003-06-17
HUP0400492A3 (en) 2006-01-30
EP1096012A1 (en) 2001-05-02
WO2001030848A2 (en) 2001-05-03
WO2001030848A3 (en) 2002-09-12
AU1391901A (en) 2001-05-08
ZA200203269B (en) 2003-07-24
CA2388950A1 (en) 2001-05-03

Similar Documents

Publication Publication Date Title
EP1100895B1 (en) Abc1 polypeptide and methods and reagents for modulating cholesterol levels
EP1096012A1 (en) Nucleics acids of the human ABC1 gene and their therapeutic and diagnostic application
EP1213352A1 (en) Nucleic acids of the human abca5, abca6, abca9, and abca10 genes, vectors containing such nucleic acids and uses thereof
CZ299055B6 (en) Isolated polypeptide encoded by a lipase like gene, composition having phospholipase activity, pharmaceutical composition, isolated immunizing peptide and nucleic acid, biologically compatible solution, vector, recombinant cell, formulation useable f
WO2002064827A2 (en) Nucleic acids of the human abca12 gene, vectors containing such nucleic acids, and uses thereof
US6893841B2 (en) Nucleic acids of the human ABCC11 gene, vectors containing such nucleic acids and uses thereof
AU5540800A (en) Nucleic and proteinic acids corresponding to human gene abc1
KR20020059645A (en) Nucleic acids of the human abc1 gene and their therapeutic and diagnostic application
EP1854880A1 (en) Methods and reagents for modulating cholesterol levels
US20060063166A1 (en) Nucleic acids of the human ABCC12 gene, vectors containing such nucleic acids and uses thereof
WO2002085943A2 (en) Nucleic acids of the human abcc12 gene, vectors containing such nucleic acids and uses thereof
US20030077605A1 (en) Nucleic acids of the human ABCC12 gene, vectors containing such nucleic acids, and uses thereof
US20050136421A1 (en) Methods and reagents for modulating cholesterol levels
WO1999045112A2 (en) Chromosome 11-linked coronary heart disease susceptibility gene chd1

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17P Request for examination filed

Effective date: 20030312

17Q First examination report despatched

Effective date: 20040603

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20041023