FR2815970A1 - New polymorphisms in the human ABCA1 gene, useful for diagnosing predisposition to myocardial infarct and other cardiovascular diseases - Google Patents

Abstract

Nucleic acid (I) comprising, or derived from, any of 143 sequences reproduced (sequences (24)-(126), group A or sequences (137)-(158), group B) or their complements. Independent claims are also included for the following: (1) nucleic acid (Ia) containing at least 9 consecutive nucleotides (nt) from group A, or their complements, and containing any of about 70 specific polymorphisms; (2) nucleic acid (Ib) containing at least 9 nt from group B, or their complements, and containing, relative to the promoter of the ABCA1 gene, one of 23 specified polymorphisms; (3) nucleic acid (II) that hybridizes under highly stringent conditions to (I) or their complements; (4) nucleic acid (III) encoding any of 10 specified polypeptides, sequences (127)-(136); (5) nucleic acid (IV) comprising a group B sequences and a polynucleotide (IVa) encoding a polypeptide or nucleic acid of interest; (6) polymorphic ABCA1 polypeptides (V) comprising any of (127)-(136); (7) probes and primers specific for ABCA1 comprising (Ia), (Ib) or their complements; (8) genetic marker comprising (Ia), (Ib) or their complements; (9) method for detecting (I); (10) kit for detecting (I); (11) method for detecting a polymorphism in the ABCA1 gene; (12) kit for method (l); (13) recombinant cloning and expression vector containing (I), (Ia), (Ib), (II)-(IV); (14) host cell transformed with (I), (Ia), (Ib), (II)-(IV) or the vector of (n); (15) non-human transgenic animal in which the somatic and/or germ line cells have been transformed with (I), (Ia), (Ib), (II)-(IV) or the vector of (n); (16) antibodies (Ab) directed against (V); (17) method for detecting (V); and (18) kit for method (17).

Description

<Desc / Clms Page number 1>

The subject of the present invention is polymorphisms of the human ABCA1 gene and the novel polypeptide alleles encoded by the various sequences exhibiting allelic variations. The invention also relates to methods and kits for the analysis of allelic variations in the human ABCAI gene, and the use of ABCAI polymorphism for the diagnosis and treatment of cardiovascular conditions such as the risks of myocardial infarction. , atherosclerosis, and Anguish disease.

ABC 1 is a member of the superfamily of ABC transporter proteins (ATP Binding Cassette) that are involved in the transport of peptides, sugars, vitamins or steroid hormones. (Dean et al., Opin., Genet, 5 (1995) 779-785, Decocottignies et al Nat Genet Dev, 15 (1997) 137-145, Allikmets et al., Hum Mol. Genet., 5 (1996) 1649-1655).

The members of this transporter family which are, on the one hand, extremely conserved during evolution, from bacteria to humans, on the other hand have a common general structure characterized by two nucleotide binding folds (Nucleotide Binding Fold or NBF) with Walker A and B patterns as well as two transmembrane domains, each of the transmembrane domains consisting of several helices. The specificity of the ABC transporters for the different molecules transported appears to be determined by the structure of the transmembrane domains, whereas the energy required for the transport activity is provided by the degradation of the ATP at the level of the NBF refolding.

The transport of cholesterol from the liver to the tissues and vice versa is ensured by the two lipoprotein complexes that are LDLs (Low Density Lipoprotein) and

<Desc / Clms Page number 2>

 HDLs (High Density Lipoprotein). LDLs supply the tissues with cholesterol whereas, on the contrary, HDLs carry excess cholesterol formed in the tissues to the liver. During transport, cholesterol is acylated by transfer of fatty acids from lecithins by the action of the enzyme phosphatidyl-sterol-acyltransferase (LCAT).

 It is now clearly established in patients with low plasma HDL levels that elevated LDL levels lead to vessel-level cholesterol accumulation and a likelihood of developing coronary insufficiency (Castelli et al., Jama (1986) 256 (20), 2835-8). Indeed, a slower removal of excess cholesterol in the tissues promotes the formation of arterial plaques, and eventually the risk of heart attack, angina pectoris, or a peripheral arterial system disorder.

 These LDLs and HDLs lipoprotein complexes, which therefore intervene respectively in the mechanisms of influx and efflux of cholesterol, from the liver to the tissues or conversely, present a spherical structure of different density, which consists essentially of a nucleus of apolar lipids. consisting of triacylglycerols and cholesterol esters, and a ring consisting of apolipoproteins and amphiphilic lipids.

 It is generally accepted that efflux of cholesterol from tissues to the liver is achieved by two different routes. A first so-called passive pathway promotes the efflux of cholesterol from the plasma membrane to HDLs, while the second pathway is energy-dependent, and notably uses the apolipoprotein AI (Apo-AI) of incipient HDL, which is probably recognized and binds to cell membrane receptors to allow translocation of excess cholesterol to HDL particles (Rothblat et al., J. Lipid Res (1999) 40 (5) 781-96). He was recently

<Desc / Clms Page number 3>

démontré en particulier que les fibroblastes et les macrophages sont le siège d'une translocation active de cholestérol utilisant des apolipoprotéines pauvres en lipides telles que Apo-1, ApoA-II, et Apo-E (Yokoyama S., Biochim. Biophys. Acta (1998) 1392 (1), 1-15 ; Takahashi et al., PNAS (1999) 96 (20), 11358-63).

demonstrated in particular that fibroblasts and macrophages are the seat of active translocation of cholesterol using apolipoproteins low in lipids such as Apo-1, ApoA-II, and Apo-E (Yokoyama S., Biochim Biophys.Acta ( 1998) 1392 (1), 1-15, Takahashi et al., PNAS (1999) 96 (20), 11358-63).

maladie de Tangier et de la déficience familiale en HDL (FHD) (Remaley et al., Arterioscl. Thromb. Vase. Biol. (1997) 17 (9) 1813-21 ; Marcil et al., Arterioscl. Thromb. Vase. Biol (1999) 19 (1), 159-69 ; Francis et al. (1995) J Clin. Invest. 96 (1), 78-87). Various diseases related to HDL deficiency, including the active pathway of cholesterol translocation, have been described. These include the

Tangier disease and familial deficiency in HDL (FHD) (Remaley et al., Arterioscl, Thromb, Vase, Biol., (1997) 17 (9) 1813-21, Marcil et al., Arterioscl, Thromb, Vase, Biol. (1999) 19 (1), 159-69, Francis et al (1995) J Clin Invest 96 (1), 78-87).

 Indeed, Tangier's disease appears to be linked to a cellular deficit in the active pathway of cellular cholesterol translocation, which leads to HDL degradation and disruption of lipoprotein metabolism. Indeed, the particles not incorporating cholesterol from the peripheral cells and can not be metabolized correctly, are eliminated quickly from the body. The circulating plasma HDL concentration of these patients is therefore extremely reduced and the HDLs therefore no longer ensure the return of cholesterol to the liver. Excess cholesterol accumulated in peripheral cells and tissues causes characteristic clinical manifestations such as the formation of orange tonsils (Serfaty-Lacrosniere et al (1994), Athérosclerosis 107 (1) 85-98).

 Familial affections related to HDL metabolism are also characterized by a low concentration of HDL particles, and are most often detected in patients with coronary heart disease (Marcil et al., The Lancet (1999) 354 (9187), 1341 -6). This cardioprotective effect of HDL is explained

<Desc / Clms Page number 4>

probablement par son implication dans le transport du cholestérol des tissus périphériques vers le foie (Bruce et al. Annu. Rev. Nutr. (1998) 18, 297-3130).

probably by its involvement in the transport of cholesterol from peripheral tissues to the liver (Bruce et al., Annu Rev. Nutr. (1998) 18, 297-3130).

les patients atteints à la fois de la maladie de Tangier et de la déficience familiale en HDL (Lawn et al., J Clin. Invest. (1999) 104 (8) 125-31 ; Bodzioch et al., Nat. Genet. The product of the ABC 1 gene is likely to play a role in the regulation of cholesterol cell metabolism and in the reverse transport of cholesterol and phospholipids. In this regard, it has recently been demonstrated that the ABC 1 gene is a key gene in the active pathway of translocating cholesterol from cells to HDL. Indeed, it has been observed that the ABCAI transporter was mutated in patients affected in the reverse transport of cholesterol, and in particular in

patients with both Tangier's disease and familial HDL deficiency (Lawn et al., J Clin Invest (1999) 104 (8) 125-31, Bodzioch et al., Nat.

(1999) 22 (4), 347-51; Orso et al., Nat. Broom. (2000) 24 (2), 192-6).

Therefore, the presence of mutations or polymorphisms in the nucleotide sequence of ABCAI appears to be, in the same way as the plasma concentration of HDL, a good risk factor for detecting coronary artery disease.

 The high incidence of coronary heart disease, which is a leading cause of death in developed countries, clearly indicates the need for detection tools on the one hand of allelic polymorphisms of the ABC1 gene, as well as on compositions, processes and kits allowing to diagnose coronary risks or susceptibility to disease, particularly related to circulating HDL deficiency, which could lead to angina pectoris, myocardial infarction, atherosclerosis, or familial HDL deficiency such as Tangier, whose symptoms are described above.

<Desc / Clms Page number 5>

ABCA1 a permis d'identifier une boite TATA (TCTATAAAAG) 33 pb en amont du site d'initiation de la transcription, de nombreux sites de liaison de facteurs de transcription ubiquitaires tels que SPI, NF-kB, des protéines activatrices (AP-1,-2, et

-4), et trois motifs E-box (5'-CANNTG-3'), ainsi que plusieurs sites de fixation de facteur nucléaire hépatocytaire (HNF)-3 (3. The human ABCA1 gene has recently been cloned and characterized and is described in particular in applications PCT / FR00 / 01595, EP99402668, and by SantamarinaFojo et al., PNAS (2000) 97 (14), 7987-7992). It has a total size of 149 kb, and comprises a promoter sequence of 1.453 kb, coding and intron sequences of 146.581 kb, and a 3 'region of lkb. It consists of 50 exons and therefore 49 introns. Exon 1 codes for the 5 'untranslated end (5'UTR) is followed by a large intron 24,156 kb long, and exon 2 contains the remaining part of the 5'UTR end, and codes for the first 21 amino acids of the N-terminus of the ABC1 protein. The ABCA1 gene encodes the 2261 amino acid ABCA1 transporter protein. The analysis of the regulatory sequence upstream of the human gene

ABCA1 identified a 33-bp TATA (TCTATAAAAG) box upstream of the transcription initiation site, numerous ubiquitous transcription factor binding sites such as SPI, NF-kB, activating proteins (AP-1 , -2, and

-4), and three E-box (5'-CANNTG-3 ') motifs, as well as several Hepatocyte Nuclear Factor (HNF) -3 binding sites (3.

 Applicants surprisingly and unexpectedly discovered a number of polymorphisms in the human gene encoding the ABC1 transporter. The applicants have also discovered a statistically significant correlation between the presence of certain allelic polymorphisms of the ABCA1 gene and the predisposition of a subject to develop a coronary pathology, such as in particular a risk of myocardial infarction.

 The subject of the present invention is therefore isolated nucleic acids encoding polymorphic variants of the human ABCA1 transporter, capable of being linked with a coronary risk, such as a risk of myocardial infarction, cardiovascular disease or, more generally, any affection due to HDL deficiency.

<Desc / Clms Page number 6>

 The subject of the present invention is also the polymorphic polypeptide sequences of the human ABCA1 transporter produced by the allelic forms of ABCA1. In addition, the present invention relates to recombinant vectors comprising these nucleic acids, cells comprising the vectors, and methods for producing variant polypeptides obtained by culturing the cells under conditions permitting the expression of these polypeptides.

amplifier les régions contenant le gène ABCA1, (iii) déterminer la présence ou l'absence d'un ou plusieurs polymorphismes au niveau de la région d'ADN amplifiée. In another aspect, the present invention relates to appropriate detection means, probes or primers, specific for some of these polymorphisms in the human ABCA1 gene, which may be associated with coronary risks, such as, for example, a risk of myocardial infarction, or a particular pharmacologic response to a therapeutic molecule. The present invention also provides a method and kits for detecting a sequence of polymorphisms at the ABCA1 transporter sequence of a human subject, and includes (i) isolating a DNA sample from said subject, (ii)

amplify the regions containing the ABCA1 gene, (iii) determine the presence or absence of one or more polymorphisms at the amplified DNA region.

Such polymorphisms may be related to other polymorphisms in a polymorphic profile, which is associated with susceptibility to metabolic disease or disorder.

 In yet another aspect, the present invention relates to a method for diagnosing the risk of cardiovascular disease in a patient.

The method consists of comparing two polymorphic profiles. The first profile is that of the patient that is to be tested, and the second is a polymorphic reference profile that is derived from a population of control individuals having a predetermined cardiovascular or coronary risk such as, for example, a risk of infarction.

<Desc / Clms Page number 7>

du myocarde. La comparaison entre les séquences polymorphes test et témoin donne une bonne indication du facteur de risque du sujet présentant une séquence polymorphe ABCA 1.

myocardium. The comparison between the test and control polymorphic sequences gives a good indication of the risk factor of the subject having an ABCA 1 polymorphic sequence.

GENERAL DEFINITIONS
The terms nucleic acid or polynucleotide refer to polymers containing purine and pyrimidine bases. They are polyribonucleotides, polydeoxyribonucleotides, or polyribo-polydeoxyribonucleotide mixed polynucleotides. Nucleic acids include single- and double-stranded DNA-DNA, RNA-DNA, and RNA molecules, or protein nucleic acid (PNA) formed by conjugation of bases to an amino acid backbone. Nucleic acids also include molecules comprising modified bases and synthetic analogue phosphodiester bonds, such as phosphorothioates and thioesters. The term nucleic acid, in particular RNA DNA molecules, refers only to a primary or secondary structure of the molecule, and is not limited by a particular tertiary configuration. Therefore, the term includes double-stranded DNA, which is found among others in linear or circular DNA molecules (in restriction fragments), plasmids, and chromosomes. The structure of the double-stranded DNA molecules is described using the conventional direction, that is 5'-> 3 'of the non-transcribed strand of the DNA or sense strand (having a sequence homologous to the mRNA). A recombinant DNA molecule is a DNA molecule that has been subjected to molecular biology manipulations.

<Desc / Clms Page number 8>

On entend par acide nucléique ou un polypeptide isolé au sens de la présente invention, un acide nucléique ou un polypeptide qui a été soustrait à son environnement d'origine naturel. Un acide nucléique ou polypeptide isolé contient moins d'environ 50%, de préférence moins de 75%, et encore plus préférentiellement moins de 90% de composants cellulaires.

For the purposes of the present invention, the term "nucleic acid" or an isolated polypeptide is intended to mean a nucleic acid or a polypeptide which has been abstracted from its environment of natural origin. An isolated nucleic acid or polypeptide contains less than about 50%, preferably less than 75%, and even more preferably less than 90% of cellular components.

 A derived nucleic acid or polypeptide sequence corresponds to a region of a particular designated sequence, and includes for the nucleic acids sequences that are identical or complementary.

 For purposes of the present invention, the term nucleotide sequence may be used to denote either a polynucleotide or a nucleic acid, encompasses the genetic material itself, and is therefore not restricted to information containing its sequence.

 For the purposes of the present invention, the term "oligonucleotide" refers to a nucleic acid, generally comprising at least 10, preferably 15, and more preferably at least 20 nucleotides, which is capable of hybridizing to a genomic DNA molecule, to an mRNA molecule encoding a gene, to a cDNA, or any other molecule of interest. Oligonucleotides may be labeled, for example with 3 P nucleotides, or nucleotides to which a fluorescent label, or a label such as biotin, is covalently attached.

The oligonucleotide may be a probe capable of detecting the presence of a nucleic acid. Alternatively, the oligonucleotide may be a PCR primer, and may be used to clone the complete sequence or fragment of a gene of interest. The oligonucleotide may further form a triple helix with a double-stranded sequence of interest on a DNA molecule. Finally, an oligonucleotide library can be fixed on a solid support to detect different polymorphisms of interest.

<Desc / Clms Page number 9>

Généralement, les oligonucléotides sont synthétiques, et peuvent comprendre des liaisons phosphodiester ou des liaisons thioester.

Generally, the oligonucleotides are synthetic, and may include phosphodiester linkages or thioester linkages.

 A probe refers to a nucleic acid or oligonucleotide capable of hybridizing to a sequence on a target nucleic acid due to the complementarity of at least a portion of the probe with a sequence of the target nucleic acid. This probe is generally labeled in order to be detectable after hybridization.

 A nucleic acid molecule hybridizes to a nucleic acid molecule, such as cDNA, genomic DNA, or RNA, when the single-stranded form of the nucleic acid molecule can stabilize with another molecule single-stranded nucleic acid according to the appropriate temperature and ionic strength conditions of the hybridization solution (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New -York). The conditions of temperature and ionic strength determine the stringency of the hybridization.

 Homologous nucleic acids, low stringency conditions (temperature equal to 55 ° C, 5 × SSC at 0.1% SDS, 0.25% milk, without formamide, or 30% formamide, 5 × SSC at 0.5, are used for preliminary screening. % SDS).

 For moderate hybridization conditions, a higher temperature is used, with 50% formamide, and 5X or 6XSSC. Although the hybridization reaction requires the complementarity of the nucleic acids, mismatches between the bases are acceptable. The stringency suitable for hybridization of a nucleic acid depends on the length of the nucleic acid and the degree of complementarity, which are well known variables in molecular biology. Plus the degree of similarity and

<Desc / Clms Page number 10>

d'homologie entre deux séquences nucléotidique est élevé, plus une température d'hybridation élevée peut être utilisée. Pour les hybrides ayant une taille supérieure à 100 nucléotides, le calcul de la température d'hybridation se fait par les équations décrites dans Sambrook et al. Pour l'hybridation d'acides nucléiques de taille inférieure, tels que les oligonucléotides, la position des mésappariements est importante, et la longueur de l'oligonucléotide détermine sa spécificité. Celui-ci a en général une longueur minimale de 10 nucléotides, de préférence au moins 15 nucléotides, et encore plus préférentiellement 20 nucléotides.

homology between two nucleotide sequences is high, plus a high hybridization temperature can be used. For hybrids having a size greater than 100 nucleotides, the calculation of the hybridization temperature is done by the equations described in Sambrook et al. For hybridization of smaller nucleic acids, such as oligonucleotides, the position of mismatches is important, and the length of the oligonucleotide determines its specificity. It generally has a minimum length of 10 nucleotides, preferably at least 15 nucleotides, and even more preferably 20 nucleotides.

+ 40 ul ADN placentaire humain (1 Omg/ml) - Dénaturer 5 mn à 96 C, puis plonger le mélange dans la glace. For high stringency hybridization conditions, the following conditions are used: 1-Competition membranes and PRE HYBRIDIZATION: - Mix: 40 l Salmon sperm DNA (10mglml)

+ 40 μl human placental DNA (1 μg / ml) - Denature for 5 minutes at 96 ° C, then immerse the mixture in ice.

 - Remove the 2X SSC buffer and pour 4 ml of formamide mix into the hybridization tube containing the membranes.

Add the mixture of the two denatured DNAs.

Incubation at 42 ° C. for 5 to 6 hours, with rotation.

 2-Competition of the labeled probe: - Add to the labeled and purified probe 10 to 50 gel Cot I DNA, according to the amount of non-specific hybridizations.

- Denature 7 to 10 minutes at 95 ° C.

- Incubate at 65 ° C for 2 to 5 hours.

<Desc / Clms Page number 11>

3-Hvbridation : - Oter le mix de pré hybridation.

3-Hybridization: - Remove the mix of pre hybridization.

- Mix 40 μl salmon sperm + 40 μl human placental DNA; denature 5 minutes at 96 C, then dive into the ice.

Add to the hybridization tube 4 ml of formamide mix, the mixture of the two DNAs and the denatured labeled probe / DNA Cot 1.

- Incubate 15 to 20 hours at 42 ° C, with rotation.

 4-Lavases: - A washing at room temperature in 2xSSC, to rinse.

- 2 times 5 minutes at room temperature 2xSSC and 0, 1% SDS - 2 times 15 minutes 0, 1xSSC and 0, 1% SDS at 65 C.

Wrap the membranes in Saran and expose.

 The hybridization conditions described above are suitable for hybridization under conditions of high stringency, of a nucleic acid molecule of varying length from 20 nucleotides to several hundred nucleotides.

Nucleic Acid hybridization, a practical approach, IRL Press, Oxford) ou encore dans l'ouvrage de AUSUBEL et al (Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N. Y). Suitable hybridization conditions may for example be adapted according to the teaching contained in the book by HAMES and HIGGINS (Eds., (1985)

Nucleic Acid Hybridization, a Practical Approach, IRL Press, Oxford) or in the work of AUSUBEL et al (Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N. Y).

 A gene refers to a nucleic acid sequence corresponding to a sequence present in the genome that comprises (i) the coding region, which includes exons, introns, and sequences at the junction between exons and introns, and (ii) 5 'and 3' regulatory sequences of the coding region.

<Desc / Clms Page number 12>

The ABCA1 transporter is understood to mean the ABCA1 transporter protein having the nucleotide sequence cDNA SEQ ID NO: 1 (FIG. 1), and the peptide sequence SEQ ID NO: 2 (FIG. 2). In addition, several partial genomic nucleotide sequences of the ABCA1 gene have been isolated and characterized, these genomic sequences comprising both exonic and intronic sequences. Some of these partial genomic sequences are shown in Table 1 below.

Table 1
Partial Genomic Sequences of the Human ABC1 Gene

<Tb>
<tb> SEQ <SEP> ID <SEP> NO <SEP> Designation
<tb> 3 <SEP> Promoter <SEP> (p), <SEP> exon <SEP> la, <SEP> intron <SEP> 1 <SEP> a <SEP> (p)
<tb> 4 <SEP> Intron <SEP><SEP> (p), <SEP> exon <SEP> lb, <SEP> intron <SEP> lb <SEP> (p)
<tb> 5 <SEP> Intron <SEP> Ib <SEP> (p), <SEP> exon <SEP> 2, <SEP> intron <SEP> 2, <SEP> exon <SEP> 3,
<tb> intron <SEP> 3, <SEP> exon <SEP> 4, <SEP> intron <SEP> 4 <SEP> (p)
<tb> 6 <SEP> Intron <SEP> 4 <SEP> (p), <SEP> exon <SEP> 5, <SEP> intron <SEP> 5 <SEP> (p)
<tb> 7 <SEP> Intron <SEP> 5 <SEP> (p), <SEP> exon <SEP> 6, <SEP> intron <SEP> 6 <SEP> (p)
<tb> 8 <SEP> Intron <SEP> 7 <SEP> (p), <SEP> exon <SEP> 8, <SEP> intron <SEP> 8 <SEP> (p)
<tb> 9 <SEP> Intron <SEP> 8 <SEP> (p), <SEP> exon <SEP> 9, <SEP> intron <SEP> 9, <SEP> exon <SEP> 10,
<tb> intron <SEP> 10 <SEP> (p)
<tb> 10 <SEP> Intron <SEP> 11 <SEP> (p), <SEP> exon <SEP> 12, <SEP> intron <SEP> 12, <SEP> exon <SEP> 13,
<tb> intron <SEP> 13, <SEP> exon <SEP> 14, <SEP> intron <SEP> 14, <SEP> exon <SEP> 15,
<tb> intron <SEP> 15, <SEP> exon <SEP> 16, <SEP> intron <SEP> 16, <SEP> exon <SEP> 17,
<tb> intron <SEP> 17 <SEP> (p)
<tb> 11 <SEP> Intron <SEP> 17 <SEP> (p), <SEP> exon <SEP> 18, <SEP> intron <SEP> 18 <SEP> (p)
<tb> 12 <SEP> Intron <SEP> 18 <SEP> (p), <SEP> exon <SEP> 19, <SEP> intron <SEP> 19 <SEP> (p)
<Tb>

<Desc / Clms Page number 13>

<Tb>
<tb> 13 <SEP> Intron <SEP> 19 <SEP> (p), <SEP> exon <SEP> 20, <SEP> intron <SEP> 20, <SEP> exon <SEP> 21,
<tb> intron <SEP> 21, <SEP> exon <SEP> 22, <SEP> intron <SEP> 22, <SEP> exon <SEP> 23,
<tb> intron <SEP> 23, <SEP> exon <SEP> 24, <SEP> intron <SEP> 24, <SEP> exon <SEP> 25,
<tb> intron <SEP> 25, <SEP> exon <SEP> 26, <SEP> intron <SEP> 26 <SEP> (p)
<tb> 14 <SEP> Intron <SEP> 26 <SEP> (p), <SEP> exon <SEP> 27, <SEP> intron <SEP> 27, <SEP> exon <SEP> 28,
<tb> intron <SEP> 28, <SEP> exon <SEP> 29, <SEP> intron <SEP> 29, <SEP> exon <SEP> 30,
<tb> intron <SEP> 30 <SEP> (p)
<tb> 15 <SEP> Intron <SEP> 30 <SEP> (p), <SEP> exon <SEP> 31, <SEP> intron <SEP> 31, <SEP> exon <SEP> 32,
<tb> intron <SEP> 32, <SEP> exon <SEP> 33, <SEP> intron <SEP> 33, <SEP> exon <SEP> 34,
<tb> intron <SEP> 34 <SEP> (p)
<tb> 16 <SEP> Intron <SEP> 35 <SEP> (p), <SEP> exon <SEP> 36, <SEP> intron <SEP> 36 <SEP> (p)
<tb> 17 <SEP> Intron <SEP> 36 <SEP> (p), <SEP> exon <SEP> 37, <SEP> intron <SEP> 37, <SEP> exon <SEP> 38,
<tb> intron <SEP> 38 <SEP> (p)
<tb> 18 <SEP> Intron <SEP> 38 <SEP> (p), <SEP> exon <SEP> 39, <SEP> Intron <SEP> 39 <SEP> (p)
<tb> 19 <SEP> Intron <SEP> 39 <SEP> (p), <SEP> exon <SEP> 40, <SEP> intron <SEP> 40, <SEP> exon <SEP> 41,
<tb> intron <SEP> 41 <SEP> (p)
<tb> 20 <SEP> Intron <SEP> 44 <SEP> (p), <SEP> exon <SEP> 45, <SEP> intron <SEP> 45 <SEP> (p)
<tb> 21 <SEP> Intron <SEP> 45 <SEP> (p), <SEP> exon <SEP> 46, <SEP> intron <SEP> 46, <SEP> exon <SEP> 47,
<tb> intron <SEP> 47 <SEP> (p)
<tb> 22 <SEP> Intron <SEP> 48 <SEP> (p), <SEP> exon <SEP> 49, <SEP> sequence <SEP> in <SEP>3'from
<tb> last <SEP> exon
<Tb>

By mononucleotide polymorphism or SNP is meant the substitution, insertion or deletion of a single nucleotide in the nucleotide sequence of a gene between several individuals. When the polymorphism is in the form of an insertion or a deletion, it can be an insertion or deletion of one or more nucleotides at a position of a gene. The different nucleotide sequences of the same gene due to a polymorphism, are alleles.

<Desc / Clms Page number 14>

A polymorphic position is a predetermined position in the sequence of a gene that includes an SNP. In some cases, genetic polymorphisms cause variation in the amino acid sequence, and thus a polymorphic position may result in a polymorphism in the amino acid sequence at a predetermined position of the polypeptide sequence. An individual homozygous for a particular polymorphism, deals with both copies of the same gene, the same polymorphic sequence at the same position. An individual heterozygous for a particular polymorphism relates to both copies of the gene, different sequences at the polymorphic position.

By polymorphic profile is meant one or more single nucleotide polymorphisms, which may be present on the sequence of a single gene or a plurality of genes. A simple polymorphic profile includes a single-position SNP of one or two alleles of an individual (allelic polymorphism). A test polymorphic profile corresponds to the characteristic polymorphism of an individual who is diagnosed, for example, with a predisposition to a disease associated with a deficiency of the ABC1 gene, such as an FHD-type metabolic deficiency or a condition cardiovascular disease, or a risk of myocardial infarction. The polymorphic reference or control profile was determined by statistically significant correlation of profiles in a population of individuals with coronary risk. POLYMORPHISMS OF THE ABCA1 GENE
The present invention is based on the discovery of 90 polymorphisms in the human ABCA1 gene sequence as shown in SEQ ID sequences

<Desc / Clms Page number 15>

NO : 3-22, dont 22 SNPs sont trouvés dans la séquence promotrice en amont du gène ABCA1 humain de SEQ ID NO : 23. Certains SNPs selon la présente invention conduisent à des altérations structurales dans la séquence polypeptidique de la

protéine transporteur ABCA1 humaine représentée à la SEQ ID NO : 2.

NO: 3-22, of which 22 SNPs are found in the promoter sequence upstream of the human ABCA1 gene of SEQ ID NO: 23. Certain SNPs according to the present invention lead to structural alterations in the polypeptide sequence of the present invention.

human ABCA1 transporter protein shown in SEQ ID NO: 2.

For the identification and characterization of polymorphic DNA of ABCA1, polymerase chain reaction (PCR) was performed to amplify ABCA1 sequences from human genomic DNA from three different ethnic groups, namely a population Caucasian, a Japanese population, and / or an African population. The PCR products are sequenced, and the sequences are compared with each other and with the reference sequences SEQ ID NO: 3-23.

sont dits silencieux (SIL), la séquence protéique ABCA1 restant inchangée. Enfin, lorsque le polymorphisme est localisé dans un intron ou dans un exon non codant, la séquence polymorphe est dite non codante (NCD). Les polymorphismes identifiés dans les différents exons et introns du gène ABCA1 sont décrits en détails ci-après. Table 2 shows the allelic polymorphisms in the exons and introns of the human ABCA1 gene according to the present invention. It indicates in particular the polymorphic position in each of the exons relative to the first nucleotide of the reference exon, and in each of the introns with respect to the 3 'end or upstream of the 5' end of the most exon. near, the 5 'and 3' sequences on either side of the polymorphic position, the frequency of appearance of polymorphism in the three populations tested, African, Caucasian and Japanese. In cases where these frequencies could not be determined, it is indicated nd. Some polymorphisms result in structural alterations in the peptide sequence of the human ABCA1 transporter protein, and more specifically by the substitution of one amino acid for another (MIS). Other polymorphisms in the exon sequences

are said to be silent (SIL), the protein sequence ABCA1 remaining unchanged. Finally, when the polymorphism is located in an intron or in a non-coding exon, the polymorphic sequence is called noncoding (NCD). The polymorphisms identified in the various exons and introns of the ABCA1 gene are described in detail hereinafter.

<Desc / Clms Page number 16>

Table 2 Allelic polymorphisms in the exons and introns of the human ABCA1 gene

<Tb>
<tb> Frequency <SEP> in <SEP> population
<tb> Name <SEP> Intron / Position <SEP> Sequence <SEP>5'Allele<SEP> Allele <SEP> Sequence <SEP>3'Type<SEP> Change <SEP> Codon <SEP> African <SEP> Caucasian <SEP> Japanese
<tb> Exon <SEP> 1 <SEP> 2 <SEP> Peptide
<tb> s-35ela <SEP> Exon <SEP><SEP> 35 <SEP> GGCCGGGACC <SEP> C <SEP> G <SEP> GCAGAGCCGA <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 4.84% <SEP> 0.00%
<tb> s-16elb <SEP> Exonlb <SEP> 16 <SEP> GACCAGCCACG <SEP> GGCGTCCCTG <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 10.94% <SEP> 27.42%
<tb> s-76elb <SEP> Exon <SEP> lb <SEP> 76 <SEP> ACACGCTGGG <SEP> G <SEP> C <SEP> GTGCTGGCTG <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 370.00% <SEP> 15.00%
<tb> s-m39i3 <SEP> Intron <SEP> 3 <SEP> -39 <SEP> GGCAGTTGGC <SEP> C <SEP> A <SEP> TAGCTAAAGC <SEP> NCD <SEP> 0 <SEP> 21, <SEP > 67% <SEP> 0.00% <SEP> 0.00%
<tb> s-25i4Intron <SEP> 425TCTCTGCATC <SEP> C <SEP> T <SEP> GTTGAGAATG <SEP> NCD <SEP> 0 <SEP> 6, <SEP> 90% <SEP> 0.00% <SEP> 0, <SEP> 00%
<tb> s-53e5Exon <SEP> 553CTGGGTTCCT <SEP> G <SEP> AT <SEP> TATCACAACC <SEP> SIL <SEP> 0 <SEP> 36, <SEP> 67% <SEP> 26.56% <SEP> 62.90%
<tb> s-108e6 <SEP> Exon <SEP> 6 <SEP> 108 <SEP> TTTGTGGCCT <SEP> A <SEP> G <SEP> CCAAGGGAGA <SEP> SIL <SEP> 217 <SEK> 3.45% <MS> 0.00% <SEP> 0.00%
<tb> s-113e6 <SEP> Exon <SEP> 6 <SEP> 113 <SEP> GGCCTACCAA <SEP> G <SEP> A <SEP> GGAGAAACTG <SEP> M <SEP> R <SEP>><SEP> K <SEP> 219 <SEP> 61.67% <SEP> 20.37% <SEP> 46.55%
<tb> s-ml4i7 <SEP> Intron <SEP> 7-14 <SEP> TTCTGTCCCC "A <SEP> ATCCCTGACG <SEP> NCD <SEP> 0 <SEP> 16, <SEP> 67% <SEP> 12.07 % <SEP> 63.33%
<tb> s-123e8Exon <SEP> 8123GCGGGCATCC <SEP> C <SEP> T <SEP> GAGGGAGGGG <SEP> SIL <SEP> 312 <SEP> 12.07% <SEP> 6.67% <SEQ> 10.34 %
<tb> s-135e8 <SEP> Exon <SEP> 8 <SEP> 135 <SEP> AGGGAGGGGG <SEP> G <SEP> AT <SEP> CTGAAGATCA <SEP> SIL <SEP> 316 <SEP> 32.76% <MS> 15.00% <SEP> 6.90%
<tb> s-m89i8 <SEP> Intron <SEP> 8-89 <SEP> TGGGGTTTCA <SEP> A <SEP> G <SEP> CTAAGAACTC <SEP> NCD <SEP> 0 <SEP> 23, <SEP> 33% <SEP> 0.00% <SEP> 0, <SEP> 00%
<Tb>

<Desc / Clms Page number 17>

Fréquence dans population Nom Intron/Position Séquence 5'Allèle Allèle Séquence 3'Type Changement Codon Africaine Caucasienne Japonaise Exon 1 2 peptidique s-ml04i9 Intron9-104 GAGGACTGGC A G CAGGGCTGCT NCD 0 n. d. 14, 81 % 28, 85% s-m61i9 Intron 9-61 AGGAGCCAAAG CGCTCATTGT NCD 0 n. d. 39, 58% 0, 00% s-m41 i9 Intron 9-41 GTCTGTGCTT CTC---CTCCTTTTTC NCD 0 n. d. 16, 00% 0, 00% s-ml3i9 Intron 9-13 CCTGGCTCCC C T ACCTGACTCC NCD 0 n. d. 8, 00% 42, 86% s-126el2 Exon 12 126 CTCCAGGCAG C T AATTGAGCTG SIL 545 9, 26% 0, 00% 0, 00% s-m29i 12 Intron 12-29 TTCTAAAGGA A G TGGTTGATTA NCD 0 6, 00% 0, 00% 0, 00% s-24i 13 Intron 13 24 AAGCCACTGT T A TTTAACCAGT NCD 0 5, 36% 26, 56% 12, 90% s-m59i 13 Intron 13-59 GGCCTTGGCC C T ATCACCCTGG NCD 0 0, 00% 7, 81% 34, 38% s-148el4 Exon 14 148 ACAACAGCAT C A CTCTGGTTTA SIL 680 50, 00% 13, 46% 71, 88% s-81i14 Intron 14 81 AAGAAGAAAA G A AAATCCAAGC NCD 0 0, 00% 0, 00% 32, 81% s-115il4Intron 141Ï5GGGGTCATAC C A TGTCATTTCC NCD 0 0, 00% 0, 00% 34, 38% s-196el5 Exon 15 196 GCAGGACTAC G A TGGGCTTCAC MIS V > M771 5, 36% 1, 72% 6, 67% s-136el6 Exon 16 136 CACCACTTCG G A TCTCCATGAT MIS V > I 825 0, 00% 6, 25% 37, 50% s-27el7Exon 1727CAGGCCCTGG T C ATTTTCCTTG MISY > P857 0, 00% 11, 11% 0, 00% o s-107el7 Exon 17 107 AGAAGAGAAT A G TCAGAAAGTA MISI > M883 45, 65% 12, 90% 71, 43% CD

Frequency in Population Name Intron / Position Sequence 5'Allele Allele Sequence 3'Type Change African African Caucasian Codon Exon 1 2 Peptide s-ml04i9 Intron9-104 GAGGACTGGC AG CAGGGCTCTCT NCD 0 nd 14, 81% 28, 85% s-m61i9 Intron 9 -61 AGGAGCCAAAG CGCTCATTGT NCD 0 nd 39, 58% 0, 00% s-m41 i9 Intron 9-41 GTCTGTGCTT CTC --- CTCCTTTTTC NCD 0 nd 16, 00% 0, 00% s-ml3i9 Intron 9-13 CCTGGCTCCC CT ACCTGACTCC NCD 0 nd 8, 00% 42, 86% s-126el2 Exon 12 126 CTCCAGGCAG CT AATTGAGCTG SIL 545 9, 26% 0, 00% 0, 00% s-m29i 12 Intron 12-29 TTCTAAAGGA AG TGGTTGATTA NCD 0 6, 00 % 0, 00% 0, 00% s-24i 13 Intron 13 24 AAGCCACTGT TA TTTAACCAGT NCD 0 5, 36% 26, 56% 12, 90% s-m59i 13 Intron 13-59 GGCCTTGGCC CT ATCACCCTGG NCD 0 0, 00% 7, 81% 34, 38% s-148el4 Exon 14 148 ACAACAGCAT CA CTCTGGTTTA SIL 680 50, 00% 13, 46% 71, 88% s-81i14 Intron 14 81 AAGAAGAAAA GA AAATCCAAGC NCD 0 0, 00% 0, 00% 32, 81% s-115il4Intron 141I5GGGGTCATAC CA TGTCATTTCC NCD 0 0, 00% 0, 00% 34, 38% s-196el5 Exon 15 196 GCAGGACTA C GA TGGGCTTCAC MIS V> M771 5, 36% 1, 72% 6, 67% s-136el6 Exon 16 136 CACCACTTCG GA TCTCCATGAT MIS V> I 825 0, 00% 6, 25% 37, 50% s-27el7Exon 1727CAGGCCCTGG TC ATTTTCCTTG MISY> P857 0, 00% 11, 11% 0, 00% o s-107el7 Exon 17 107 AGAAGAGAAT AG TCAGAAAGTA MISI> M883 45, 65% 12, 90% 71, 43% CD

<Desc / Clms Page number 18>

<Tb>
<tb> Frequency <SEP> in <SEP> population
<tb> Name <SEP> Intron <SEP> Position <SEP> Sequence <SEP>5'Allele<SEP> Allele <SEP> Sequence <SEP>3'Type<SEP> Change <SEP> African <SEP> Codon <SEP > Caucasian <SEP> Japanese
<tb> Exon <SEP> 1 <SEP> 2 <SEP> Peptide
<tb> s-60il7Intron <SEP> 1760CTGCTAACTG <SEP> T <SEP> C <SEP> TGGGGGCAAG <SEP> NCD <SEP> 0 <SEP> 10, <SEP> 87% <SEP> 0.00% <SEP> 0.00%
<tb> s-m68il7 <SEP> Intron <SEP> 17 <SEP> -68 <SEP> AGCGCAGTGC <SEP> C <SEP> G <SEP> CTGTGTCCTT <SEP> NCD <SEP> 0 <SEP> 0.00% <SEP> 8.33% <SEP> 32, <SEP> 81%
<tb> s-4e18 <SEP> Exon <SEP> 18 <SEP> 4 <SEP> GTCACAGTCT <SEP> G <SEP> T <SEP> CATGGAGGAG <SEP> MIS0F <SEP> 887 <SEP> 0.00% <MS> 0.00% <SEP> 3.13%
<tb> s-40e19 <SEP> Exon <SEP> 19 <SEP> 40 <SEP> CCTCGGGCAC <SEP> C <SEP> T <SEP> GCCTACATCC <SEP> SIL <SEP> 956 <SEP> 0.00% <MS> 0.00% <SEP> 4.35%
<tb> s-18i19 <SEP> Intron <SEP> 19 <SEP> 18 <SEP> CCAGCAGCAC <SEP> G <SEP> AT <SEP> TTAAGAATAG <SEP> NCD015, <SEP> 79% <SEP> 0.00 % <SEP> 0.00%
<tb> sm <SEP> 10119 <SEP> Intron <SEP> 19-T <SEP> ACCTGCCTCC <SEP> C <SEP> T <SEP> TGTCCCCAGG <SEP> NCD <SEP> 0 <SEP> 4, <SEP> 55% <SEP> 0.00% <SEP> 0.00%
<tb> s-123e22 <SEP> Exon <SEP> 22 <SEP> 123 <SEP> GAAGAACCAG <SEP> C <SEP> T <SEP> TGGGAACAGG <SEP> M <SEP> L <SEP>><SEP> C <SEP> 1122 <SEP> 29, <SEP> 31% <SEP> 0.00% <SEP> 0.00%
<tb> s-m65i22 <SEP> Intron <SEP> 22-65 <SEP> CCTCCCCGGC <SEP> G <SEP> A <SEP> AAGGTGCTGG <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 6.45% <SEP> n. <SEP> d.
<tb> s-54e23 <SEP> Exon <SEP> 23 <SEP> 54 <SEP> GCGACCATGA <SEP> G <SEP> C <SEP> AGTGACACGC <SEP> M <SEP> E <SEP>><SEP> D <SEP> 1172 <SEP> 7.14% <SEP> 4.84% <SEP> n. <SEP> d.
<tb> s-149i23 <SEP> Exon <SEP> 23 <SEP> 149 <SEP> GGTGTGGGAG <SEP> C <SEP> T <SEP> AGCTTGGTGG <SEP> NCD <SEP> 0 <SEP> 7, <SEP> 14% <SEP> 0.00% <SEP> n. <SEP> d.
<tb> s-m50i23 <SEP> Intron <SEP> 23 <SEP> -50 <SEP> GCCCTCACTC <SEP> C <SEP> T <SEP> GAAGCCCCTC <SEP> NCD <SEP> 0 <SEP> 3, <SEP > 45% <SEP> 0.00% <SEP> 0.00%
<tb> s-98e24 <SEP> Exon <SEP> 24 <SEP> 98 <SEP> TGCCATATGA <SEP> A <SEP> G <SEP> GCTGCTAAGG <SEP> SIL <SEP> 1211 <SEQ> 3.45% <MS> 0.00% <SEP> 0.00%
<tb> s-149e24 <SEP> Exon <SEP> 24 <SEP> 149 <SEP> TTGATGACCG <SEP> G <SEP> AT <SEP> CTCTCAGACC <SEP> SIL <SEP> 1228 <SEP> 18.97% <MS> 0.00% <SEP> 0.00%
<tb> s-44e27 <SEP> Exon <SEP> 27 <SEP> 44 <SEP> ATGGCAAAGG <SEP> G <SEP> AT <SEP> TCCTACCAGG <SEP> SIL <SEP> 1315 <SEP> 11, <SEP> 54% <SEP> 0, <SEP> 00% <SEP> n. <SEP> d.
<tb> s-7e30 <SEP> Exon <SEP> 30 <SEP> 7 <SEP> GCAGAGACAC <SEP> G <SEP><SEP> CCCTGCCAGG <SEP> SIL <SEP> 1427 <SEP> 3.45% <MS> 12.50% <SEP> 34, <SEP> 48%
<tb> @
<tb> c
<Tb>

<Desc / Clms Page number 19>

<Tb>
<tb> Frequency <SEP> in <SEP> population
<tb> Name <SEP> Intron / Position <SEP> Sequence <SEP>5'Allele<SEP> Allele <SEP> Sequence <SEP>3'Type<SEP> Change <SEP> Codon <SEP> African <SEP> Caucasian <SEP> Japanese
<tb> Exon <SEP> 1 <SEP> 2 <SEP> Peptide
<tb> s-166e30 <SEP> Exon <SEP> 30 <SEP> 166 <SEP> GTCCCCCAGG <SEP> G <SEP> T <SEP> GCAGGGGGGC <SEP> SIL <SEP> 1480 <SEP> 6.90% <MS> 0.00% <SEP> 0.00%
<tb> s-30i31 <SEP> Intron <SEP> 31 <SEP> 30 <SEP> GGCCCCTGCC <SEP> T <SEP> G <SEP> TATTATTACT <SEP> NCD <SEP> 0 <SEP> 13, <SEP> 79% <SEP> 12.50% <SEP> 0.00%
<tb> sm <SEP> 142132 <SEP> Intron <SEP> 32-142 <SEP> AGGAAGCTGA <SEP> C <SEP> T <SEP> GTGTAACTTC <SEP> NCD <SEP> 0 <SEP> 5, <SEP> 36% <SEP> 0.00% <SEP> 0.00%
<tb> s-m130i32 <SEP> Intron <SEP> 32-130 <SEP> TGTAACTTCT - CT <SEP> GAGGCAAAAT <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 26, 79% <SEP> 40.00%
<tb> s-m26i32 <SEP> Intron <SEP> 32-26 <SEP> CACTGTCTGG <SEP> G <SEP> C <SEP> TTTTAATGTC <SEP> NCD <SEP> 0 <SEP> 3, <SEP> 57% <SEP> 8.93% <SEP> 18.33%
<tb> s-m74i33 <SEP> Intron <SEP> 33-74 <SEP> CCTGTTGTCC <SEP> T <SEP> A <SEP> CAGGTTCCAG <SEP> NCD <SEP> 0 <SEP> 3, <SEP> 45% <SEP> 0.00% <SEP> 0.00%
<tb> s-62e34 <SEP> Exon <SEP> 34 <SEP> 62 <SEP> CTGGACACCA <SEP> G <SEP> AT <SEP> AAATAATGTC <SEP>MISR> K1587 <SEP> 93.10% <SEP> 26.67% <SEP> 57.14%
<tb> s-77e36Exon <SEP> 3677CAGCTTTGTC <SEP> G <SEP> AT <SEP> TATTCCTGAT <SEP> AT <SEP>V> I <SEP> 1674 <SEP> 0.00% <SEP> 0.00% <SEP> 3.33%
## EQU1 ## <SEP> 0.00%
<tb> s-64e38Exon <SEP> 3864GCACAGCCTA <SEP> T <SEP> C <SEP> GTGGTGCTCA <SEP> SIL <SEP> 1767 <SEP> 4.00% <SEP> 0.00% <SEP> n. <SEP> d.
<tb> s-251i39Intron <SEP> 39251GAAAATAGTG <SEP> T <SEP> G <SEP> TATTTGCTTG <SEP> NCD <SEP> 0 <SEP> n. <SEP> d. <SEP> 24, <SEP> 14% <SEP> 46.55%
<tb> s-252i39 <SEP> Intron <SEP> 39 <SEP> 252 <SEQ> AAAATAGTGT <SEP> T <SEP> C <SEP> ATTTGCTTGG <SEP> NCD <SEP> 0 <SEP> n. <SEP> d. <SEP> 24, <SEP> 14% <SEP> 44.83%
<tb> s-mll9i40 <SEP> Intron <SEP> 40-119 <SEP> ATCCCGCAGC <SEP> C <SEP> T <SEP> CCCTCCCTGC <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 0.00% <SEP> 25.00%
<tb> s-m69i44 <SEP> nd
<tb> s-114e45 <SEP> n / a
<Tb>

<Desc / Clms Page number 20>

<Tb>
<Tb>

Frequency <SEP> in <SEP> population
<tb> Name <SEP> Intron / Position <SEP> Sequence <SEP>5'Allele<SEP> Allele <SEP> Sequence <SEP>3'Type<SEP> Change <SEP> Codon <SEP> African <SEP> Caucasian <SEP> Japanese
<tb> Exon <SEP> 1 <SEP> 2 <SEP> Peptide
<tb> s-m34i45 <SEP> Intron <SEP> 45-34 <SEP> TTTTTTCCCC <SEP> C <SEP> T <SEP> CAGCAAATAA <SEP> NCD <SEP> 0 <SEP> n. <SEP> d. <SEP> 5, <SEP> 17% <SEP> 0.00%
<tb> s-13i47 <SEP> Intron <SEP> 47 <SEP> 13 <SEP> AATAAAGATA <SEP> A <SEP> G <SEP> TTTCTTTGGG <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 11, <SEP> 67% <SEP> 42.86%
<tb> s-86i47 <SEP> Intron <SEP> 47 <SEP> 86 <SEP> GTGCCTCTAA <SEP> A <SEP> C <SEP> ATAAAGGGAA <SEP> NCD <SEP> 0 <SEP> 1.72% <MS> 13.33% <SEP> 0.00%
<tb> s-377e49 <SEP> Exon <SEP> 49 <SEP> 377 <SEP> GACTTGAATT <SEP> T <SEP> C <SEP> AGTTTTTTAC <SEP> NCD <SEP> 0 <SEP> 3, <SEP> 33% <SEP> 0.00% <SEP> 0.00%
<tb> s-833e49 <SEP> Exon <SEP> 49 <SEP> 833 <SEP> TGGGTGTCTC <SEP> C <SEP> T <SEP> AGGCACGGGA <SEP> NCD <SEP> 0 <SEP> 54, <SEP> 55% <SEP> 35.00% <SEP> 18.97%
<tb> s-1580e49 <SEP> Exon <SEP> 49 <SEP> 1580 <SEP> TGTAACAATA <SEP> C <SEP> T <SEP> TGGGCAGCCT <SEP> NCD <SEP> 0 <SEP> 0, <SEP> 00% <SEP> 30, <SEP> 65% <SEP> 0.00%
<tb> s-1791e49 <SEP> Exon <SEP> 49 <SEP> 1791 <SEP> AGTCTCAAAT <SEP> A <SEP> T <SEP> TTTCATCTCT <SEP> NCD0 <SEP> 15, <SEP> 79% <SEP > 0.00% <SEP> 0.00%
<tb> s-2034e49 <SEP> Exon <SEP> 49 <SEP> 2034 <SEP> ACTTTTTCCA <SEP> A <SEP> G <SEP> AATTTGAATA <SEP> NCD <SEP> 0 <SEP> 3, <SEP> 33% <SEP> 12.90% <SEP> 22.22%
<tb> s-2049e49 <SEP> Exon <SEP> 49 <SEP> 2049 <SEP> TGAATATTAA <SEP> C <SEP> T <SEP> GCTAAAGGTG <SEP> NCD <SEP> 0 <SEP> 30, <SEP> 00% <SEP> 0.00% <SEP> 24.14%
<tb> s-2449e49 <SEP> Exon <SEP> 49 <SEP> 2449 <SEP> AAGAAAACAC <SEP> A <SEP> G <SEP> ACATTTTAAT <SEP> NCD <SEP> 0 <SEP> 16, <SEP> 67% <SEP> 20, <SEP> 00% <SEP> 23, <SEP> 33%
<tb> s-2843e49 <SEP> Exon <SEP> 49 <SEP> 2843 <SE>> TTCATTATCT <SEP> G <SEP> A <SEP> TACTGAAAGC <SEP> NCD <SEP> 0 <SEP> 7, <SEP> 69% <SEP> 0.00% <SEP> 0.00%
<Tb>

<Desc / Clms Page number 21>

nucléotidique SEQ ID NO : 24. L'ADNc portant le polymorphisme dans l'exon la du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 92. Mutation in the exon
The s-35ela mutation consists of the substitution of a cytosine (C) by a guanine (G) in position 35 of exon 1a, or at position 2928 with respect to the sequence SEQ ID NO: 3. The exon carrying this polymorphism to the sequence

nucleotide SEQ ID NO: 24. The cDNA carrying the polymorphism in exon la of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 92.

Mutation in exon 7b A first mutation is designated s-16elb and consists of the insertion of a guanine (G) at position 16 of exon lb, ie at position 115 with respect to the sequence SEQ ID NO: 4. Exon lb bearing this polymorphism has the nucleotide sequence SEQ ID NO: 25. The cDNA carrying the polymorphism in exon 1 b of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 93.

 A second mutation designated s-76elb consists of the substitution of a guanine (G) by a cytosine (C) at position 76 of exon lb, or at position 175 with respect to the sequence SEQ ID NO: 4. L exon Ib bearing this polymorphism to the nucleotide sequence SEQ ID NO: 26. The cDNA bearing the polymorphism in exon Ib of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 94.

adénine (A) position-39 de l'extrémité 3'de l'intron 3, soit à la position 10646 par rapport à la séquence SEQ ID NO : 5. La séquence nucléotidique de l'intron 3 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 27. Mutation in intron 3
The s-m39i3 mutation consists of the substitution of a cytosine (C) in one

adenine (A) position-39 of the 3 'end of intron 3, ie at position 10646 relative to the sequence SEQ ID NO: 5. The nucleotide sequence of intron 3 bearing this polymorphism is represented in FIG. sequence SEQ ID NO: 27.

<Desc / Clms Page number 22>

Mutation dans l'intron 4

La mutation s-25i4 consiste en la substitution d'une cytosine (C) en une thymidine (T) position 25 de l'extrémité 5'de l'intron 4, soit à la position 10828 par rapport à la séquence SEQ ID NO : 5. La séquence nucléotidique partielle de l'intron 4 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 28.

Mutation in intron 4

The s-25i4 mutation consists of the substitution of a cytosine (C) for a thymidine (T) at the 5 'end of intron 4, at position 10828 with respect to the sequence SEQ ID NO: 5. The partial nucleotide sequence of intron 4 bearing this polymorphism is represented in the sequence SEQ ID NO: 28.

Mutation in exon 5
The s-53e5 mutation consists of the substitution of a guanine (G) for an adenine (A) position 53 of exon 5, ie at position 306 with respect to the sequence SEQ ID NO: 6. Exon 5 carrying this polymorphism at the nucleotide sequence SEQ ID NO: 29. The cDNA carrying the polymorphism in exon 5 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 95.

gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 96. Mutation in exon 6
The mutation designated s-108e6 consists of the substitution of an adenine (A) for a guanine (G) at position 108 of exon 6, ie at position 268 with respect to the sequence SEQ ID NO: 7. exon 6 bearing this polymorphism to the nucleotide sequence SEQ ID NO: 30. The cDNA carrying the polymorphism in exon 6 of the

ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 96.

 The s-113e6 mutation consists of the substitution of a guanine (G) for an adenine (A) at position 113 of exon 6, ie at position 273 with respect to the sequence SEQ ID NO: 7. exon 6 of the ABCA1 gene bearing this polymorphism is the polynucleotide of sequence SEQ ID NO: 31. The mutated cDNA carrying the polymorphism in exon 6 is represented in the nucleotide sequence

<Desc / Clms Page number 23>

SEQ ID NO : 97, code pour un polypeptide ABCA1 variant d'une longueur de 2261 acides aminés, de séquence SEQ ID NO : 127.

SEQ ID NO: 97, encodes an ABCA1 polypeptide varying in length of 2261 amino acids, of sequence SEQ ID NO: 127.

séquence SEQ ID NO : 8. La séquence nucléotidique partielle de l'intron 7 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 32. Mutation in the intron 7
The s-ml4i7 mutation consists of the insertion of an adenine (A) at position-14 upstream of the 3 'end of intron 7, or at position 589 relative to the

sequence SEQ ID NO: 8. The partial nucleotide sequence of intron 7 bearing this polymorphism is represented in the sequence SEQ ID NO: 32.

séquence SEQ ID NO : 8. L'exon 8 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 33. L'ADNc portant le polymorphisme dans l'exon 8 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 98. Mutation in exon 8
The s-123e8 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 123 of exon 8, at position 726 with respect to

SEQ ID NO: 8. Exon 8 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 33. The cDNA carrying the polymorphism in exon 8 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 98.

 The s-135e8 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 135 of exon 8, ie at position 738 with respect to the sequence SEQ ID NO: 8. The exon 8 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 34. The cDNA carrying the polymorphism in exon 8 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 99.

guanine (G) en position-89 en amont de l'extrémité 3'de l'intron 8, soit à la position 525 par rapport à la séquence SEQ ID NO : 9. La séquence nucléotidique partielle de Mutation in the intron 8
The s-m89i8 mutation consists of the substitution of an adenine (A) by a

guanine (G) at position-89 upstream of the 3 'end of intron 8, or at position 525 with respect to the sequence SEQ ID NO: 9. The partial nucleotide sequence of

<Desc / Clms Page number 24>

l'intron 8 portant ce polymorphisme est représentée à la séquence nucléotidique SEQ ID NO : 35.

intron 8 bearing this polymorphism is represented in the nucleotide sequence SEQ ID NO: 35.

position 981 par rapport à la séquence SEQ ID NO : 9. La séquence nucléotidique partielle de l'intron 9 portant ce polymorphisme est représentée à la séquence nucléotidique SEQ ID NO : 36. Mutation in the intron 9
Mutation sm 104 i9 consists of the substitution of an adenine (A) by a guanine (G) at position-104 upstream of the 3 'end of intron 9, ie at the

position 981 with respect to the sequence SEQ ID NO: 9. The partial nucleotide sequence of intron 9 carrying this polymorphism is represented in the nucleotide sequence SEQ ID NO: 36.

séquence SEQ ID NO : 9. La séquence nucléotidique partielle de l'intron 9 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 37. The s-m6li9 mutation consists of an insertion of a guanine (G) at position-61 upstream of the 3 'end of intron 9, ie at position 1023 with respect to the

SEQ ID NO: 9 sequence. The partial nucleotide sequence of intron 9 bearing this polymorphism is represented in the sequence SEQ ID NO: 37.

SEQ ID NO : 9. La séquence nucléotidique partielle de l'intron 9 portant ce polymorphisme est représentée à la séquence nucléotidique SEQ ID NO : 38. The s-m41i9 mutation consists of a deletion of a three nucleotide CTC nucleotide fragment at position-41 to nucleotide-43 upstream of the 3 'end of intron 9, at position 1042-4044 relative to to the sequence

SEQ ID NO: 9. The partial nucleotide sequence of intron 9 carrying this polymorphism is represented in the nucleotide sequence SEQ ID NO: 38.

The s-ml3i9 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position-13 upstream of the 3 'end of intron 9, or at position 1072 with respect to the sequence SEQ ID NO: 9. The partial nucleotide sequence of intron 9 bearing this polymorphism is represented in the nucleotide sequence SEQ ID NO: 39.

<Desc / Clms Page number 25>

Mutation dans l'exon 12

La mutation s-126el2 consiste en la substitution d'une cytosine (C) en une thymine (T) en position 126 de l'exon 12, soit à la position 765 par rapport à la séquence SEQ ID NO : 10. L'exon 12 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 40. L'ADNc portant le polymorphisme dans l'exon 12 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 100.

Mutation in exon 12

The s-126el2 mutation consists of the substitution of a cytosine (C) for a thymine (T) at position 126 of exon 12, or at position 765 with respect to the sequence SEQ ID NO: 10. The exon 12 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 40. The cDNA carrying the polymorphism in exon 12 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 100.

guanine (G) en position-29 en amont de l'extrémité 3'de l'intron 12, soit à la position 1337 par rapport à la séquence SEQ ID NO : 10. La séquence nucléotidique de l'intron 12 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 41. Mutation in the intron 12
The s-m29il2 mutation consists of the substitution of an adenine (A) by a

guanine (G) at the 29-position upstream of the 3 'end of intron 12, ie at position 1337 with respect to the sequence SEQ ID NO: 10. The nucleotide sequence of intron 12 bearing this polymorphism is represented in the sequence SEQ ID NO: 41.

Mutations in the intron 13 The s-24il3 mutation consists of the substitution of a thymine (T) by an adenine (A) at position 24 of the 5 'end of intron 13, ie at position 1566 relative to SEQ ID NO: 10. The nucleotide sequence of intron 13 carrying this polymorphism is represented in the nucleotide sequence SEQ ID NO: 42.

 The s-m59il3 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position-59 upstream of the 3 'end of intron 13, or at position 3270 with respect to the sequence SEQ ID NO: 10. The nucleotide sequence of intron 13 bearing this polymorphism has the sequence SEQ ID NO: 43.

Mutation in exon 14

<Desc / Clms Page number 26>

La mutation s-148e14 consiste en la substitution d'une cytosine (C) par une adénine (A) en position 148 de l'exon 14, soit à la position 3476 par rapport à la séquence SEQ ID NO : 10. L'exon 14 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 44. L'ADNc portant le polymorphisme dans l'exon 14 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 101.

The s-148e14 mutation consists of the substitution of a cytosine (C) by an adenine (A) at position 148 of exon 14, or at position 3476 with respect to the sequence SEQ ID NO: 10. The exon 14 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 44. The cDNA carrying the polymorphism in exon 14 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 101.

rapport à la séquence SEQ ID NO : 10. La séquence nucléotidique de l'intron 14 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 45. Mutation in the intron 14
The s-81il4 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 81 of the 5 'end of intron 14, or at position 3632 with

compared to the sequence SEQ ID NO: 10. The nucleotide sequence of intron 14 carrying this polymorphism is represented in the sequence SEQ ID NO: 45.

The s-115i14 mutation consists of the substitution of a cytosine (C) by an adenine (A) at the 115 position of the 5 'end of the intron 14, or at the position 3666 with respect to the sequence SEQ ID NO 10. Intron 14 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 46.

séquence SEQ ID NO : 10. L'exon 15 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 47. L'ADNc portant le polymorphisme dans l'exon 15 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 102, et code pour une protéine ABCA1 mutée SEQ ID NO : 128 dans laquelle une valine (V) est substituée par une méthionine (M) en position 771. Mutation in exon 15
The s-196el5 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 196 of exon 15, or at position 5492 with respect to the

SEQ ID NO: 10 sequence. Exon 15 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 47. The cDNA carrying the polymorphism in exon 15 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 102, and encodes a mutated ABCA1 protein SEQ ID NO: 128 in which a valine (V) is substituted with a methionine (M) at position 771.

Mutation in exon 16

<Desc / Clms Page number 27>

séquence SEQ ID NO : 10. L'exon 16 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 48. L'ADNc portant le polymorphisme dans l'exon 16 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 103, et code pour une protéine ABCA1 mutée de séquence SEQ ID NO : 129, qui comprend la substitution d'une valine (V) en isoleucine (I) en position 825. The s-136el6 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 136 of exon 16, or at position 6714 with respect to the

SEQ ID NO: 10 sequence. Exon 16 carrying this polymorphism has the nucleotide sequence SEQ ID NO: 48. The cDNA carrying the polymorphism in exon 16 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 103, and encodes a mutated ABCA1 protein of sequence SEQ ID NO: 129, which comprises substituting a valine (V) for isoleucine (I) at position 825.

gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 104, et code pour une protéine ABCA1 mutée SEQ ID NO : 130 dans laquelle une tyrosine (Y) est substituée par une proline (P) en position 857. Mutations in exon 17
The s-27el7 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position 27 of exon 17, or at position 7914 with respect to the sequence SEQ ID NO: 10. The exon 17 carrying this polymorphism at the nucleotide sequence SEQ ID NO: 49. The cDNA carrying the polymorphism in exon 17 of the

ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 104, and encodes a mutated ABCA1 protein SEQ ID NO: 130 in which a tyrosine (Y) is substituted by a proline (P) at position 857.

séquence SEQ ID NO : 10. L'exon 17 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 50. L'ADNc portant le polymorphisme dans l'exon 17 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 105, et code pour une protéine ABCA1 mutée SEQ ID NO : 131 dans laquelle une isoleucine (I) est substituée par une méthionine (M) en position 883. The s-107e17 mutation consists of the substitution of an adenine (A) with a guanine (G) at position 107 of exon 17, or at position 7994 with respect to

SEQ ID NO: 10 sequence. Exon 17 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 50. The cDNA carrying the polymorphism in exon 17 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 105, and encodes a mutated ABCA1 protein SEQ ID NO: 131 in which an isoleucine (I) is substituted with a methionine (M) at position 883.

<Desc / Clms Page number 28>

Mutation dans l'intron 17

La mutation s-60il7 consiste en la substitution d'une thymine (T) par une cytosine (C) en position 60 de l'extrémité 5'de l'intron 17, soit à la position 8061 par rapport à la séquence SEQ ID NO : 10. La séquence nucléotidique partielle de l'intron 17 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 51.

Mutation in the intron 17

The s-60il7 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position 60 of the 5 'end of intron 17, ie at position 8061 with respect to the sequence SEQ ID NO The partial nucleotide sequence of intron 17 bearing this polymorphism is represented in the sequence SEQ ID NO: 51.

The s-m68il7 mutation consists of the substitution of a cytosine (C) by a guanine (G) at position-68 upstream of the 3 'end of intron 17, or at position 319 with respect to the sequence SEQ ID NO: 11. The partial nucleotide sequence of intron 17 carrying this polymorphism is represented in the sequence SEQ ID NO: 52.

est représenté par la séquence nucléotidique SEQ ID NO : 106, et code pour une protéine ABCA1 mutée SEQ ID NO : 132 dans laquelle une cystéine (C) est substituée par une phénylalanine (F) en position 887. Mutation in exon 18
The s-4el8 mutation consists of the substitution of a guanine (G) by a thymine (T) at position 4 of exon 18, ie at position 390 with respect to the sequence SEQ ID NO: 11. The exon 18 carrying this polymorphism at the nucleotide sequence SEQ ID NO: 53. The cDNA carrying the polymorphism in exon 18 of the ABCA1 gene

is represented by the nucleotide sequence SEQ ID NO: 106, and encodes a mutated ABCA1 protein SEQ ID NO: 132 in which a cysteine (C) is substituted with a phenylalanine (F) at position 887.

 The s-40el9 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 40 of exon 19, or at position 943 with respect to the sequence SEQ ID NO: 12. The exon 19 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 54. The cDNA carrying the polymorphism in exon 19 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 107.

<Desc / Clms Page number 29>

Mutation dans l'intron 19

La mutation s-18il9 consiste en la substitution d'une guanine (G) par une adénine (A) en position 18 de l'extrémité 5'de l'intron 19, soit à la position 1053 par rapport à la séquence SEQ ID NO : 12. La séquence nucléotidique partielle de l'intron 19 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 55.

Mutation in the intron 19

The s-18il9 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 18 of the 5 'end of intron 19, ie at position 1053 with respect to the sequence SEQ ID NO The partial nucleotide sequence of intron 19 carrying this polymorphism is represented in the sequence SEQ ID NO: 55.

Mutation sm 10 19 consists in the substitution of a cytosine (C) by a thymine (T) at the 10-position upstream of the 3 'end of intron 19, or at position 274 with respect to the SEQ sequence ID NO: 13. The partial nucleotide sequence of intron 19 bearing this polymorphism is represented in sequence SEQ ID NO: 56.

Mutation in exon 22
The s-123e22 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 123 of exon 22, or at position 1592 with respect to the sequence SEQ ID NO: 13. The exon 22 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 57. The cDNA carrying the polymorphism in exon 22 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 108, and codes for a mutated ABCA1 protein SEQ ID NO Wherein leucine (L) is substituted with cysteine (C) at position 1122.

La mutation s-m65i22 consiste en la substitution d'une guanine (G) par une adénine (A) en position-65 en amont de l'extrémité 3'de l'intron 22, soit à la position 2884 par rapport à la séquence SEQ ID NO : 13. La séquence nucléotidique Mutation in the intron 22

The s-m65i22 mutation consists of the substitution of a guanine (G) with an adenine (A) at position-65 upstream of the 3 'end of intron 22, or at position 2884 with respect to the sequence SEQ ID NO: 13. The nucleotide sequence

<Desc / Clms Page number 30>

de l'intron 22 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 58.

intron 22 carrying this polymorphism is represented in the sequence SEQ ID NO: 58.

cytosine (C) en position 54 de l'exon 23, soit à la position 3002 par rapport à la séquence SEQ ID NO : 13. L'exon 23 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 59. L'ADNc portant le polymorphisme dans l'exon 23 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 109, et code pour une protéine ABCA1 mutée SEQ ID NO : 134 dans laquelle un acide glutamique (E) est substitué par un acide aspartique (D) en position 1172. Mutation in exon 23
The s-54e23 mutation consists of the substitution of a guanine (G) by a

cytosine (C) at position 54 of exon 23, that is to position 3002 with respect to the sequence SEQ ID NO: 13. Exon 23 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 59. The cDNA carrying the polymorphism in exon 23 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 109, and codes for a mutated ABCA1 protein SEQ ID NO: 134 in which a glutamic acid (E) is substituted with an aspartic acid (D ) in position 1172.

Mutation in the intron 23
The s-149i23 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 149 of the 5 'end of intron 23, or at position 3170 with respect to the sequence SEQ ID NO The nucleotide sequence of intron 23 carrying this polymorphism is represented in the sequence SEQ ID NO: 60.

thymine (T) en position-50 en amont de l'extrémité 3'de l'intron 23, soit à la position 3958 par rapport à la séquence SEQ ID NO : 13. La séquence de l'intron 23 portant ce polymorphisme est représentée à la séquence nucléotidique SEQ ID NO : 61. The s-m50i23 mutation consists of the substitution of a cytosine (C) by a

thymine (T) at the 50-position upstream of the 3 'end of intron 23, ie at position 3958 with respect to the sequence SEQ ID NO: 13. The sequence of intron 23 carrying this polymorphism is represented to the nucleotide sequence SEQ ID NO: 61.

Mutations in exon 24
The s-98e24 mutation consists of the substitution of an adenine (A) by a guanine (G) at position 98 of exon 24, ie at position 4105 with respect to the

<Desc / Clms Page number 31>

séquence SEQ ID NO : 13. L'exon 24 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 62. L'ADNc correspondant à la mutation dans l'exon 24 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 110.

SEQ ID NO: 13 sequence. Exon 24 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 62. The cDNA corresponding to the mutation in exon 24 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 110 .

séquence SEQ ID NO : 13. L'exon 24 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 63. L'ADNc portant le polymorphisme dans l'exon 24 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 111. The s-149e24 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 149 of exon 24, or at position 4156 with respect to

SEQ ID NO: 13 sequence. Exon 24 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 63. The cDNA carrying the polymorphism in exon 24 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 111.

gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 112. Mutation in exon 27
The s-44e27 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 44 of exon 27, or at position 604 with respect to the sequence SEQ ID NO: 14. The exon 27 carrying this polymorphism at the nucleotide sequence SEQ ID NO: 64. The cDNA carrying the polymorphism in exon 27 of the

ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 112.

Mutations in exon The s-7e30 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 7 of exon 30, ie at position 6854 with respect to the sequence SEQ ID NO The exon 30 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 65. The cDNA carrying the polymorphism in exon 30 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 113.

 The s-166e30 mutation consists of the substitution of a guanine (G) by a thymine (T) at position 166 of exon 30, or at position 7013 with respect to the sequence SEQ ID NO: 14. The exon 30 carrying this polymorphism to the sequence

<Desc / Clms Page number 32>

nucléotidique SEQ ID NO : 66. L'ADNc correspondant à la mutation dans l'exon 30 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 114.

nucleotide SEQ ID NO: 66. The cDNA corresponding to the mutation in exon 30 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 114.

Mutation in the intron 31 The s-30i31 mutation consists of the substitution of a thymine (T) by a guanine (G) in position 30 of the 5 'end of the intron 31, ie at the position 1307 relative to SEQ ID NO: 15. The nucleotide sequence of intron 31 bearing this polymorphism is represented in the sequence SEQ ID NO: 67.

Mutation in the intron 32 The mutation s-ml42i32 consists of the substitution of a cytosine (C) by a thymine (T) at position-142 upstream of the end 3 'of the intron 32, ie at the position 3600 compared to the sequence SEQ ID NO: 15. The nucleotide sequence of the intron 32 bearing this polymorphism is represented in the sequence SEQ ID NO: 68.

The mutation s-ml30i32 consists of an insertion of two nucleotides at position-130 upstream of the 3 'end of intron 32, ie at position 3611 with respect to the sequence SEQ ID NO: 15. The nucleotide sequence of the intron 32 bearing this polymorphism is represented in the nucleotide sequence SEQ ID NO: 69.

The s-m26i32 mutation consists of the substitution of a guanine (G) by a cytosine (C) at position-26 upstream of the 3 'end of the intron 32, or at position 3716 with respect to the sequence SEQ ID NO: 15. The nucleotide sequence of intron 32 bearing this polymorphism is represented in the nucleotide sequence SEQ ID NO: 70.

<Desc / Clms Page number 33>

Mutation dans l'intron 33

La mutation s-m74i33 consiste en la substitution d'une thymine (T) par une adénine (A) en position-74 en amont de l'extrémité 3'de l'intron 33, soit à la position 5247 par rapport à la séquence SEQ ID NO : 15. La séquence nucléotidique de l'intron 33 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 71.

Mutation in the intron 33

The s-m74i33 mutation consists of the substitution of a thymine (T) by an adenine (A) at position-74 upstream of the 3 'end of intron 33, or at position 5247 with respect to the sequence SEQ ID NO: 15. The nucleotide sequence of intron 33 bearing this polymorphism is represented in the sequence SEQ ID NO: 71.

Mutation in. exon 34 The s-62e34 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 62 of exon 34, ie at position 5382 with respect to the sequence SEQ ID NO: 15 Exon 34 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 72. The cDNA carrying the polymorphism in exon 34 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 115, and encodes an ABCA1 protein. mutant of SEQ ID NO: 135, wherein an arginine (R) was replaced by a lysine (K) at position 1587.

 The analysis of this polymorphism in an ECTIM population (a pioneering study of myocardial infarction), which includes a study of patients having survived myocardial infarction and Caucasian-type controls (Parra et al., Arteriosclerosis and Thrombosis). , (1992) 12 (6), 701-707), shows that this polymorphism is significantly associated with a high risk of myocardial infarction (F = 18, 6 p <0, 0001).

 This polymorphism also seems to be associated with lower average levels of HDL cholesterol, apolipoprotein A-I and A-II. In particular, the presence of the s-62e34 allele A is associated with a decrease of apolipoprotein A-I by about 5 mg / dl.

<Desc / Clms Page number 34>

The s-62e34 polymorphism according to the invention, which results in the replacement of an arginine (R) by a lysine (K) at position 1587 of the ABC1 protein, constitutes a functional mutation which affects the levels of HDL cholesterol, apolipoprotein AI and apolipoprotein A-II and predisposes to cardiovascular risk.

pour une protéine ABCA1 mutée de SEQ ID NO 136, dans laquelle une valine (V) est substituée par une isoleucine (I) en position 1674. Mutation in exon 36
The s-77e36 mutation consists of the substitution of a guanine (G) for an adenine (A) at position 77 of exon 36, ie at position 1064 with respect to the sequence SEQ ID NO: 16. The exon 36 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 73. The cDNA carrying the polymorphism in exon 36 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 116, and codes

for a mutated ABCA1 protein of SEQ ID NO 136, wherein a valine (V) is substituted with an isoleucine (I) at position 1674.

rapport à la séquence SEQ ID NO : 16. L'intron 36 portant ce polymorphisme a la séquence nucléotidique partielle SEQ ID NO : 74. Mutation in the intron 36
The s-55i36 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position 55 of the 5 'end of intron 36, or at position 1220 by

compared to the sequence SEQ ID NO: 16. The intron 36 bearing this polymorphism has the partial nucleotide sequence SEQ ID NO: 74.

Mutation in exon 38
The s-64e38 mutation consists of the substitution of a thymine (T) for a cytosine (C) at position 64 of exon 38, or at position 835 with respect to the sequence SEQ ID NO: 17. The exon 38 carrying this polymorphism to the sequence

<Desc / Clms Page number 35>

nucléotidique SEQ ID NO : 75. L'ADNc portant le polymorphisme dans l'exon 38 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 117.

nucleotide SEQ ID NO: 75. The cDNA carrying the polymorphism in exon 38 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 117.

rapport à la séquence SEQ ID NO : 18. La séquence nucléotidique partielle de l'intron 39 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 76. Mutations in the intron 39
The mutation S-251i39 consists of the substitution of a thymine (T) by a guanine (G) at position 251 of the 5 'end of intron 39, or at position 375 by

related to the sequence SEQ ID NO: 18. The partial nucleotide sequence of the intron 39 bearing this polymorphism is represented in the sequence SEQ ID NO: 76.

rapport à la séquence SEQ ID NO : 18. La séquence nucléotidique partielle de l'intron 39 portant ce polymorphisme est représentée à la séquence SEQ ID NO : 77. The s-252i39 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position 252 of the 5 'end of intron 39, or at position 376 by

compared to the sequence SEQ ID NO: 18. The partial nucleotide sequence of the intron 39 carrying this polymorphism is represented in the sequence SEQ ID NO: 77.

Mutation in the intron 40 The mutation s-ml l9i40 consists of the substitution of a cytosine (C) for a thymine (T) at position-119 upstream of the 3 'end of the intron 40, ie at the position 710 with respect to the sequence SEQ ID NO: 19. The nucleotide sequence of the intron 40 bearing this polymorphism is represented in the sequence SEQ ID NO: 78.

Mutation in the intron 44
The s-m69i44 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position-69 upstream of the 3 'end of intron 44, or at position 108 with respect to the sequence SEQ ID NO: 20. The partial nucleotide sequence of intron 44 bearing this polymorphism is represented in the nucleotide sequence SEQ ID NO: 79.

<Desc / Clms Page number 36>

Mutation dans l'exon 45

La mutation s-114e45 consiste en la substitution d'une cytosine (C) par une thymine (T) en position 114 de l'exon 45, soit à la position 290 par rapport à la séquence SEQ ID NO : 20. L'exon 45 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 80. L'ADNc portant le polymorphisme dans l'exon 45 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 118.

Mutation in exon 45

The s-114e45 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 114 of exon 45, or at position 290 with respect to the sequence SEQ ID NO: 20. The exon 45 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 80. The cDNA carrying the polymorphism in exon 45 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 118.

Mutation in the intron 45 The s-m34i45 mutation consists of the substitution of a cytosine (C) by a thymine (T) at the 34-position upstream of the 3 'end of the intron 45, ie at the position 343 with respect to the sequence SEQ ID NO: 21. The partial nucleotide sequence of intron 45 bearing this polymorphism is represented in the sequence SEQ ID NO: 81.

Mutations in the intron 47 The s-13i47 mutation consists of the substitution of an adenine (A) by a guanine (G) at position 13 of the 5 'end of intron 47, ie at position 1068 relative to to the sequence SEQ ID NO: 21. The partial nucleotide sequence of intron 47 bearing this polymorphism is represented in the sequence SEQ ID NO: 82.

The s-86i47 mutation consists of the substitution of an adenine (A) by a cytosine (C) at position 86 of the 5 'end of intron 47, or at position 1141 with respect to the sequence SEQ ID NO The partial nucleotide sequence of intron 47 carrying this polymorphism is represented in the sequence SEQ ID NO: 83.

<Desc / Clms Page number 37>

Mutations dans l'exon 49

La mutation s-377e49 consiste en la substitution d'une thymine (T) par une cytosine (C) en position 377 de l'exon 49, soit à la position 571 par rapport à la séquence SEQ ID NO : 22. L'exon 49 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 84. L'ADNc portant le polymorphisme dans l'exon 49 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 119.

Mutations in exon 49

The s-377e49 mutation consists of the substitution of a thymine (T) by a cytosine (C) at position 377 of exon 49, or at position 571 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 84. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 119.

gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 120. The s-833e49 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 833 of exon 49, that is at position 1027 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 85. The cDNA carrying the polymorphism in exon 49 of the

ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 120.

 The s-1580e49 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 1580 of exon 49, or at position 1773 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 86. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 121.

gène ABC 1 est représenté par la séquence nucléotidique SEQ ID NO : 122. The s-1791e49 mutation consists of the substitution of an adenine (A) by a thymine (T) at position 1791 of exon 49, that is to position 1985 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 87. The cDNA carrying the polymorphism in exon 49 of the

ABC gene 1 is represented by the nucleotide sequence SEQ ID NO: 122.

 The s-2034e49 mutation consists of the substitution of an adenine (A) with a guanine (G) at position 2034 of exon 49, that is at position 2228 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the sequence

<Desc / Clms Page number 38>

nucléotidique SEQ ID NO : 88. L'ADNc portant le polymorphisme dans l'exon 49 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 123.

nucleotide SEQ ID NO: 88. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 123.

 The s-2049e49 mutation consists of the substitution of a cytosine (C) by a thymine (T) at position 2049 of exon 49, that is to position 2243 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 89. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 124.

 The s-2449e49 mutation consists of the substitution of an adenine (A) by a guanine (G) at position 2449 of exon 49, that is to position 2643 with respect to the sequence SEQ ID NO: 22. The exon 49 carrying this polymorphism to the nucleotide sequence SEQ ID NO: 90. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 125.

séquence SEQ ID NO : 22. L'exon 49 portant ce polymorphisme a la séquence nucléotidique SEQ ID NO : 91. L'ADNc portant le polymorphisme dans l'exon 49 du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 126. The s-2843e49 mutation consists of the substitution of a guanine (G) with an adenine (A) at position 2843 of exon 49, or at position 3037 with respect to

SEQ ID NO: 22. Exon 49 bearing this polymorphism has the nucleotide sequence SEQ ID NO: 91. The cDNA carrying the polymorphism in exon 49 of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 126.

 Some polymorphisms found within the coding regions, which essentially correspond to substitutions of a single nucleotide located on the third base of the codons of the ABCA1 open reading frame, do not cause any changes in the nature of the amino acid. encoded, given the rules of genetic degeneration in humans, well known to those skilled in the art. Polymorphisms that do not alter the amino acid sequence can, however, have a significant biological function, which may have an effect on the concentration of amino acid.

<Desc / Clms Page number 39>

 Circulating HDL, and therefore apolipoprotein A-I or A-II. Such polymorphisms may for example affect the regulation of transcription or translation, for example by acting on mRNA stability, splicing, transcription rate, translation and translation fidelity.

OTHER POLYMORPHISMS
According to the invention, other polymorphisms have been discovered in the promoter region upstream of the human ABCA1 gene. The polymorphic positions are represented in FIG. 3 by nucleotides marked in bold (and underlined when it comes to the bases flanking an insertion) on the promoter sequence of the wild-type human ABC 1 gene of sequence SEQ ID NO: 23.

 Table 3 also shows the allelic polymorphisms in the promoter sequence of the human ABCA1 gene according to the present invention. The name, wild and mutant alleles, polymorphic positions, and frequency of occurrence of allelic polymorphisms in two population groups, the Caucasian population and the Japanese population are indicated.

<Desc / Clms Page number 40>

Table 3 Allelic polymorphisms in the human ABCA1 gene promoter

<Tb>
<tb> Frequency <SEP> in
<tb> population
<tb> Name <SEP> Location <SEP> Position <SEP> Sequence <SEP>5'Allele<SEP> 1 <SEP> Allele <SEP> 2 <SEP> Sequence <SEP>3'Caucasian<SEP> Japanese
<tb> s-2389p <SEP> Promoter-2389 <SEP> AAAAAAATAC <SEP> G <SEP> A <SEP> AAAATTAGAT <SEP> 29, <SEP> 60% <SEP> 33, <SEP> 30%
<tb> sins-2176-2177p <SEP> Promoter-2176 <SEP> TGAGGGGAGG <SEP> GGAGGGGAGG <SEP> AGGGAGGGGG <SEP> 33.30% <SEP> 33.30%
<tb> s-1814pPromotor-1814 <SEP> CAGCCTCCTG <SEP> A <SEP> G <SEP> GATAACAGGC <SEP> 38.70% <SEP> 21.00%
<tb> s-1801p <SEP> Promoter <SEP> -1801 <SEP> TAACAGGCGC <SEP> C <SEP> T <SEP> CGCCACCACA <SEP> 41.90% <SEP> 66.10%
<tb> s-1652p <SEP> Promoter <SEP> -1652 <SEP> CACTGCGCCC <SEP> A <SEP> G <SEP> GCTCAGATCC <SEP> 38.70% <SEP> 21.00%
<tb> s-1506p <SEP> Promoter <SEP> -1506 <SEP> CTCTTCTATG <SEP> G <SEP> C <SEP> GTCTGTCCTG <SEP> 17.70% <SEP> 17.70%
<tb> s-1395p <SEP> Promoter <SEP> -1395 <SEP> TGAATGTCTG <SEP> C <SEP> T <SEP> ATGCAGGTGG <SEP> n. <SEP> d. <SEP> 46.80%
<tb> s-1252p <SEP> Promoter <SEP> -1252 <SEP> TGCCCTTCAA <SEP> G <SEP> A <SEP> GTGGCTACAA <SEP> 27.30% <SEP> n. <SEP> d.
<tb> s-1217pPromotor-1217 <SEP> AGGTAGGAGA <SEP> C <SEP> T <SEP> CTTGTGGCCT <SEP> 6.80% <SEP> 31.30%
<tb> s-1099p <SEP> Promoter <SEP> -1099 <SEP> AGTTTGACCT <SEP> G <SEP> T <SEP> AGTTTTGGCC <SEP> 9, <SEP> 10% <SEP> n. <SEP> d.
<tb> s-1034-1035p <SEP> Promoter-1034 <SEP> ATATTTAGAC <SEP> AT <SEP> ATGGTGTGTA <SEP> 25.00% <SEP> 19.40%
<tb> s-940pPromotor-940 <SEP> GGCAAACAGA <SEP> T <SEP> G <SEP> AAGTTGGAGG <SEP> 45.00% <SEP> 51.60%
<tb> s-803pPromotor-805 <SEP> AAATTAAAAG <SEP> G <SEP> A <SEP> GGGCTGGTCC <SEP> 14.60% <SEP> 51.90%
<tb> sA-777-774p <SEP> Promoter-777 <SEP> GTTCTGTGTT <SEP> TTTG-TTTGTTTGTT <SEP> 11, <SEP> 50% <SEP> 5.00%
<tb> sA-773-765p <SEP> Promoter-773 <SEP> TGTGTTTTTG <SEA> TTTGTTTGT <SEP> TTTGTTTGTT <SEP> 23.10% <SEP> 16.70%
<tb> s-564p <SEP> Promoter <SEP> -564 <SEP> GAGGACTGTC <SEP> C <SEP> T <SEP> GCCTTCCCCT <SEP> 21.40% <SEP> 32.80%
<Tb>

<Desc / Clms Page number 41>

<Tb>
<tb> Frequency <SEP> in
<tb> population
<tb> Name <SEP> Location <SEP> Position <SEP> Sequence <SEP>5'Allele<SEP> 1 <SEP> Allele <SEP> 2 <SEP> Sequence <SEP>3'Caucasian<SEP> Japanese
<tb> s-407p <SEP> Promoter-407 <SEP> GCGGAAAGCA <SEP> G <SEP> C <SEP> GATTTAGAGG <SEP> 26.60% <SEP> 18.30%
<tb> s-302p <SEP> Promoter-302 <SEP> CGTCTTAGGC <SEP> C <SEP> T <SEP> GGCGGGCCCG <SEP> 10, <SEP> 90% <SEP> 13.30%
<tb> s-278p <SEP> Promoter <SEP> -278 <SEP> GGGGGAAGGG <SEP> G <SEP> C <SEP> ACGCAGACCG <SEP> 34.40% <SEP> 33, <SEP> 30%
<tb> sA-223-219p <SEP> Promoter-223 <SEP> CACCCCACCC <SEP> CACCC <SEP> ACCTCCCCCC <SEP> 10.90% <SEP> 13.30%
<tb> s-99pPromotor-99 <SEP> AGGCCGGGAA <SEP> G <SEP> C <SEP> GGGGCGGGGA <SEP> 41.70% <SEP> 35.00%
<tb> s-14p <SEP> promoter <SEP> -14 <SEP> GGAACTAGTC <SEP> C <SEP> T <SEP> CGGCAAAAAC <SEP> 20, <SEP> 00% <SEP> 4.20%
<Tb>

<Desc / Clms Page number 42>

Le polymorphisme S-2389p consiste en la substitution d'une guanine (G) par une adénine (A) en position 505 du premier nucléotide de la séquence SEQ ID NO : 23, ou en position-2389 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme S-2389p dans la séquence régulatrice du gène ABC 1 est représenté par la séquence nucléotidique SEQ ID NO : 137.

The S-2389p polymorphism consists of the substitution of a guanine (G) with an adenine (A) at position 505 of the first nucleotide of the sequence SEQ ID NO: 23, or at position-2389 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-2389p polymorphism in the regulatory sequence of the ABC 1 gene is represented by the nucleotide sequence SEQ ID NO: 137.

The Sins-2176-2177p polymorphism consists of an insertion of the GGAGGGGAGG sequence at 717 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-2176 with respect to the transcription initiation site. The nucleic acid comprising the Sins-2176-2177p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 138.

The S-1814p polymorphism consists of the substitution of an adenine (A) with a guanine (G) at position 1080 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-1814 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-1814p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 139.

The S-1801p polymorphism consists of the substitution of a cytosine (C) by a thymine (T) at position 1093 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-1801 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-1801p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 140.

The S-1652p polymorphism consists of the substitution of an adenine (A) with a guanine (G) at position 1242 of the first nucleotide of the sequence SEQ ID NO: 23 or at position 1652 with respect to the site of initiation of the transcription +1. The acid

<Desc / Clms Page number 43>

nucléique comprenant le polymorphisme S-1652p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 141.

Nucleic acid comprising the S-1652p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 141.

 The S-1506p polymorphism consists of the substitution of a guanine (G) by a cytosine (C) at position 1388 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-1506 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-1506p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 142.

une thymine (T) en position 1499 du premier nucléotide de la séquence SEQ ID NO : 23 ou en position-1395 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme S-1395p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 143. The S-1395p polymorphism consists of the substitution of a cytosine (C) for

a thymine (T) at position 1499 of the first nucleotide of sequence SEQ ID NO: 23 or at position-1395 relative to the site of initiation of transcription +1. The nucleic acid comprising the S-1395p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 143.

une adénine (A) en position 1642 du premier nucléotide de la séquence SEQ ID NO : 23 ou en position-1252 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme S-1252p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 144.

The S-1252p polymorphism consists of the substitution of a guanine (G) for

an adenine (A) at position 1642 of the first nucleotide of sequence SEQ ID NO: 23 or at position-1252 with respect to the site of initiation of transcription +1. The nucleic acid comprising the S-1252p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 144.

gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 145. The S-1217p polymorphism consists of the substitution of a cytosine (C) by a thymine (T) at position 1677 of the first nucleotide of the sequence SEQ ID NO: 23 or at position -1217 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-1217p polymorphism in the regulatory sequence of

ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 145.

The S-1099p polymorphism consists of the substitution of a guanine (G) by a thymine (T) at the 1795 position of the first nucleotide of the sequence SEQ ID NO:

<Desc / Clms Page number 44>

23 ou en position-1099 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme S-1099p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 146.

23 or position-1099 relative to the transcription initiation site +1. The nucleic acid comprising the S-1099p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 146.

 The Sins-1034-1035p polymorphism consists of an insertion of an adenine and a thymine (AT) at position 1859 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-1034 with respect to the initiation site of the transcription +1. The nucleic acid comprising the Sins-1034-1035p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 147.

 The S-940p polymorphism consists in the substitution of a thymine (T) for a guanine (G) in position 1954 of the first nucleotide of the sequence SEQ ID NO: 23 or in position-940 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-940p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 148.

 The S-803p polymorphism consists of the substitution of a guanine (G) by an adenine (A) at position 2091 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-803 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-803p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 149.

 The SA-777-774p polymorphism consists of a deletion of a fragment of four TTTG nucleotides at position 2117 of the first nucleotide of sequence SEQ ID NO: 23 or at position-774 relative to the transcription initiation site +1 .

The nucleic acid comprising the SA-777-774p polymorphism in the sequence

<Desc / Clms Page number 45>

régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 150.

The ABCA1 gene regulator is represented by the nucleotide sequence SEQ ID NO: 150.

séquence SEQ ID NO : 23 ou en position-765 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme SA-773-765p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 151. The polymorphism SA-773-765p consists of a deletion of a fragment of nine nucleotides TTTGTTTGT at position 2121 of the first nucleotide of the

sequence SEQ ID NO: 23 or at position 765 with respect to the transcription initiation site +1. The nucleic acid comprising the SA-773-765p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 151.

The S-564p polymorphism consists of the substitution of a cytosine (C) by a thymine (T) at position 2330 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-564 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-564p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 152.

une cytosine (C) en position 2487 du premier nucléotide de la séquence SEQ ID NO : 23 ou en position-407 par rapport au site d'initiation de la transcription +1. L'acide nucléique comprenant le polymorphisme S-407p dans la séquence régulatrice du gène ABCA1 est représenté par la séquence nucléotidique SEQ ID NO : 153. The S-407p polymorphism consists of the substitution of a guanine (G) for

a cytosine (C) at position 2487 of the first nucleotide of sequence SEQ ID NO: 23 or at position-407 relative to the transcription initiation site +1. The nucleic acid comprising the S-407p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 153.

 The S-302p polymorphism consists of the substitution of a cytosine (C) by a thymine (T) at position 2592 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-302 with respect to the site of initiation of the transcription +1. The nucleic acid comprising the S-302p polymorphism in the regulatory sequence of the ABC 1 gene is represented by the nucleotide sequence SEQ ID NO: 154.

<Desc / Clms Page number 46>

The S-278p polymorphism consists of the substitution of a guanine (G) by a cytosine (C) at position 2616 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-278 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-278p polymorphism in the regulatory sequence of the ABC 1 gene is represented by the nucleotide sequence SEQ ID NO: 155.

The SA-223-219p polymorphism consists of a deletion of a five-nucleotide CACCC fragment at position 2671 from the first nucleotide of SEQ ID NO: 23 or at position-219 relative to the transcription initiation site +1. .

The nucleic acid comprising the SA-223-219p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 156.

The S-99p polymorphism consists of the substitution of a guanine (G) by a cytosine (C) at position 2795 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-99 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-99p polymorphism in the regulatory sequence of the ABCA1 gene is represented by the nucleotide sequence SEQ ID NO: 157.

The S-14p polymorphism consists of the substitution of a cytosine (C) by a thymine (T) at position 2880 of the first nucleotide of the sequence SEQ ID NO: 23 or at position-14 with respect to the initiation site of the transcription +1. The nucleic acid comprising the S-14p polymorphism in the regulatory sequence of the ABC 1 gene is represented by the nucleotide sequence SEQ ID NO: 158.

According to a first aspect, the invention also relates to the nucleotide sequences of the ABCA1 gene comprising at least one biallelic polymorphism as described above.

<Desc / Clms Page number 47>

Ainsi, l'invention a pour objet un acide nucléique comprenant un polynucléotide choisi dans le groupe constitué des séquences nucléotidiques SEQ ID NO : 24-126 et 137-158 ou un acide nucléique de séquence complémentaire.

Thus, the subject of the invention is a nucleic acid comprising a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NO: 24-126 and 137-158 or a nucleic acid of complementary sequence.

 The invention also relates to a nucleic acid hybridizing under conditions of high stringency with a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 24-126 and 137-158 or a nucleic acid of complementary sequence.

 The invention also relates to a nucleic acid having at least 9 consecutive nucleotides of a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID No. 24-126 and 137-158, and comprising the polymorphic base or a sequence nucleic acid. complementary.

 The invention also relates to a nucleic acid having at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID No. 24-126 and 137-158, and comprising the polymorphic base or a sequence nucleic acid. complementary.

 The invention also relates to a nucleic acid having at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 24-126 and 137-158, the polymorphic base being located in the center of the nucleotide fragment. from 21 bases.

 The invention further relates to a nucleic acid derived from a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 24-126 and 137-158 comprising the polymorphic sequence, and at least two nucleotides located on either side polymorphic position or nucleic acid of complementary sequence.

<Desc / Clms Page number 48>

Un autre objet de l'invention concerne un acide nucléique codant pour un polypeptide choisi dans le groupe constitué de séquences d'acides aminés SEQ ID NO : 127-136.

Another subject of the invention relates to a nucleic acid encoding a polypeptide selected from the group consisting of amino acid sequences SEQ ID NO: 127-136.

d'acide aminé choisie dans le groupe constitué des séquences SEQ ID NO : 127-136. The invention also relates to a polypeptide comprising a

amino acid selected from the group consisting of SEQ ID NO: 127-136.

It also relates to an antibody directed against a polymorphic ABCA1 polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 127-136 sequences, or a peptide fragment thereof. Preferably, the antibody according to the present invention comprises a detectable compound.

 The invention also relates to a nucleic acid containing a polynucleotide encoding a polypeptide or a nucleic acid of interest operably linked to a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 137-158.

 The present invention relates to a recombinant cloning and / or expression vector which carries a nucleic acid comprising a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NO: 24-126 and 137-158, and at least one of the polymorphisms as previously described. It also relates to a host cell transformed with a nucleic acid comprising a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NOs: 24-126 and 137-158, and at least one of the polymorphisms as previously described or by the recombinant vector described. above. It further relates to a non-human transgenic mammal whose somatic cells and / or germ cells have been transformed with a nucleic acid comprising a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 24-126 and 137-158, and at least one of the polymorphisms as described above or with a recombinant vector as described above.

<Desc / Clms Page number 49>

According to a second aspect, the subject of the invention is probes or nucleotide primers capable of hybridizing to the nucleic acids of SEQ ID NO: 24-126 and 137-158 sequences and comprising at least one polymorphic position or nucleic acid nucleic acid. complementary sequence.

 Probes and nucleotide primers comprise a polynucleotide of nucleotide sequence selected from the group consisting of SEQ ID NO: 24-126 and 137-158 sequences, or a complementary sequence containing one of the polymorphic bases according to the invention.

 Preferably, a nucleotide probe according to the invention has a length of 15,16,19 to 25,35, 40,50, 70,80, 100,200, 500,1000, 1,500 consecutive nucleotides of a polynucleotide of nucleotide sequence chosen from the group consisting of SEQ ID NOs 24-126 and 137-158, and comprising at least one polymorphic base, or a complementary sequence nucleic acid.

 Even more preferably, the nucleotide probes consist of a nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NO: 24-126 and 137-158. Preferably, the polymorphic base is located in the center of the nucleotide fragment of 21 bases.

 Preferably, a nucleotide primer according to the invention has a length of 8.9, 10.11, 12.13, 14.15, 16.17, 18.19, 20.21, 22.23, 24.25 to 40 consecutive nucleotides of a polynucleotide of nucleotide sequence selected from the group consisting of SEQ ID NO 24-126 and 137-158, and comprising at least one polymorphic base, or a nucleic acid of complementary sequence.

<Desc / Clms Page number 50>

Preferably, the base of the 3 'end of these primers is complementary to a nucleotide located at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides or more on the 3 'side of the position of the polymorphism according to the invention, present in one of the sequences SEQ ID No. 24-126 and 137-158 and / or their complementary sequences .

 The definition of a probe and a nucleotide primer according to the invention therefore encompasses oligonucleotides which hybridize, under the high stringency hybridization conditions defined above, with a nucleic acid chosen from the sequences SEQ ID NO: 24 -126 and 137-158, comprising at least one of the polymorphisms defined above, or with a complementary sequence thereof.

 Examples of primers and primer pairs for amplifying different regions of the ABCA1 gene are shown below.

séquence SEQ ID NO : 159 (ACCGAAGTAAGGAGTTGCTC) et l'amorce de séquence SEQ IN NU : 160 (ACTGTTTCACTAATACTTACTG). This is for example the pair of primers represented by the primer of

sequence SEQ ID NO: 159 (ACCGAAGTAAGGAGTTGCTC) and sequence primer SEQ IN NU: 160 (ACTGTTTCACTAATACTTACTG).

 A primer or a nucleotide probe according to the invention may be prepared by any suitable method well known to those skilled in the art, including by cloning and the action of restriction enzymes or by direct chemical synthesis according to techniques such as the method with the phosphodiester of Narang et al. (Methods Enzymol (1979) 68, 90-98) or Brown et al. (Methods Enzymol (1979) 68, 109- 151), the diethylphosphoramidite method of Beaucage et al. (Tetrahedron Lett. (1981) 22, 1859-1862), or the solid support technique described in US Pat. No. EP 0 707 592.

<Desc / Clms Page number 51>

By way of illustration, appropriate nucleotide primers according to the present invention are, for example, primers whose base at the end hybridizes with the base located immediately on the 3 'side of the polymorphic base of the fragment comprising the polymorphism. After a step of specific hybridization of the primer, an elongation step with a mixture of two complementary dideoxynucleotides of the polymorphic base of said polymorphism, for example labeled with two distinct fluorophores, then a fluorescence signal detection step obtained allows to determine which of the two differently labeled fluorescent dideoxynucleotides has been incorporated, and to deduce the nature of the polymorphic base.

 Each of the nucleic acids according to the invention, including the oligonucleotide probes and primers described above, can be labeled, if desired, by incorporating a detectable label by spectroscopic, photochemical, biochemical, immunochemical or chemical means.

 For example, such labels may consist of radioactive isotopes (32P, 33P, 3H, 35S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or ligands such as biotin.

 The labeling of the probes is preferably carried out by incorporation of labeled molecules into the polynucleotides by primer extension, or by addition to the 5 'or 3' ends.

 Examples of non-radioactive labeling of nucleic acid fragments are described in particular in French Patent No. FR 78 109 75 or in the articles of Urdea et al. (Nucl Ac, Res (1988) 11, 497-4957) or Sanchez-pescador et al. (J. Clin Microbiol (1988) 26 (10), 1934-1938).

<Desc / Clms Page number 52>

D'autres approches peuvent être utilisées pour le marquage et la détection des didéoxynucléotides. Une méthode en phase homogène basée sur le FRET (Fluorescence Resonance Energy Transfer) a été décrite entre autres par Chen et Kwok (Nucl Ac Res, 25 (1997) 347-353). Selon cette méthode, des fragments amplifiés d'ADN génomique susceptibles de contenir des polymorphismes sont incubés avec une amorce marquée à la fluorescéine à l'extrémité 5', en présence de didéoxynucléotides triphosphate fluorescents et d'une polymérase Taq modifiée.

Other approaches can be used for the labeling and detection of dideoxynucleotides. A homogeneous phase method based on FRET (Fluorescence Resonance Energy Transfer) has been described inter alia by Chen and Kwok (Nucl Ac Res, 25 (1997) 347-353). According to this method, amplified fragments of genomic DNA capable of containing polymorphisms are incubated with a fluorescein-labeled primer at the 5 'end, in the presence of fluorescent dideoxynucleotide triphosphates and a modified Taq polymerase.

The labeled primer is extended one base by incorporation of the labeled dideoxynucleotide specific for the allele present in the complementary genomic DNA sequence. At the end of this elongation reaction, the fluorescence intensities for the two labeled dideoxynucleotide labeling compounds are analyzed directly without separation or purification. The ratio for these two fluorescences makes it possible to determine the nucleotide used by the polymerase during elongation, and to deduce the nature of the polymorphic base. All of these steps can be carried out in the same tube and the fluorescence modifications followed by real time.

masse ajoutée à l'amorce de microséquençage. (Haff et al., Gen Res, 7 (1997) 378- 388). Alternatively, the extension primer can be analyzed by MALDI-TOF mass spectrometry. The base located in the polymorphic position is identified by measuring the

mass added to the microsequencing primer. (Haff et al., Gen Res, 7 (1997) 378-388).

 Advantageously, the probes according to the invention allow amplification of the signal, such as the probes described by Urdea et al. (Nucl Acid SympSer (1991) 24, 197-200) or in European Patent No. EP-0 225 807 (CHIRON).

<Desc / Clms Page number 53>

The oligonucleotide probes according to the invention can be used in particular in Southem hybridizations to genomic or Northern DNA to RNA.

The structural characteristics making it possible to differentiate the normal sequences from the mutated sequences of ABCAI (genomics, messenger RNAs, cDNA) are thus put to good use in order to produce means for detecting mutated ABCA1 sequences in a sample, in particular in the form of probes specifically hybridizing with mutated sequences of ABCA1 or pairs of primers for selectively amplifying the ABCA1 gene regions carrying the polymorphisms described above. The detection of the presence of these mutations may notably be carried out by discrimination of the length of the amplified nucleic acid fragments, by hybridization of the amplified fragments using the specific probes described above or by direct sequencing of these amplified fragments. .

Such nucleotide primers may for example be immobilized on a support. In addition, it is possible to immobilize on a support, for example in an orderly manner, multiple specific primers as described above, each of these primers being adapted to the detection of one of the polymorphisms of the ABCA1 gene according to US Pat. 'invention.

According to a third aspect of the present invention, the polymorphisms of the ABCA1 gene according to the invention are useful in particular as genetic markers in association studies between the presence of a given allele in a subject and the predisposition of this subject to a pathology. given and / or to a given response to a therapeutic molecule in the context of pharmacogenetic studies.

<Desc / Clms Page number 54>

 The subject of the present invention is therefore genetic markers comprising all or part of a nucleic acid chosen from the group consisting of the nucleotide sequences SEQ ID NO: 24-126 and 137-158 or a nucleic acid of complementary sequence, and comprising one of polymorphisms according to the invention.

 The genetic markers of the invention are advantageously used for the association studies of a given allele of the polymorphisms according to the invention, with the levels of HDL cholesterol, apolipoprotein AI and apolipoprotein A-II plasma in patients .

113e6, s-123e8, s-153e8, s-126el2, s-148el4, s-196el5, s-136el6, s27el7, sl07el7, s-4el8, s-40el9, s-123e22, s-54e23, s-98e24, s-149e24, s-44e27, s-7e30, s-166e30, s- 62e34, s-77e36, s-64e38, s-114e45, s-377e49, s-833e49, s-1580e49, s-1791e49, s- 2034e49, s-2049e49, s-2449e49, et s-2843e49 avec les taux d'HDL cholestérol, d'apolipoprotéine A-I et d'apolipoprotéine A-II plasmatiques chez les patients. Preferably, the genetic markers are used for the association studies of polymorphisms s-35ela, s-16elb, s-76elb, s-53e5, s-108e6, s-

113e6, s-123e8, s-153e8, s-126el2, s-148el4, s-196el5, s-136el6, s27el7, sl07el7, s-4el8, s-40el9, s-123e22, s-54e23, s-98e24, s-149e24, s-44e27, s-7e30, s-166e30, s-62e34, s-77e36, s-64e38, s-114e45, s-377e49, s-833e49, s-1580e49, s-1791e49, s- 2034e49, s-2049e49, s-2449e49, and s-2843e49 with plasma levels of HDL cholesterol, apolipoprotein AI and apolipoprotein A-II in patients.

 Even more preferably, genetic markers are used for the association studies of s-113e6, s-196el5, s-136el6, s27el7, s107el7, s-4el8, s-123e22, s-54e23, s-62e34 polymorphisms. , and s-77e36 with plasma levels of HDL cholesterol, apolipoprotein AI and apolipoprotein A-II in patients.

 In particular, the present invention relates to genetic markers comprising all or part of a nucleic acid selected from the group consisting of the nucleotide sequences SEQ ID NOs: 24-126 and 137-158 or a nucleic acid of complementary sequence, for the studies of association of polymorphisms such as

<Desc / Clms Page number 55>

décrits précédemment avec un risque cardiovasculaire chez les patients et plus particulièrement un risque d'infarctus du myocarde.

previously described with cardiovascular risk in patients and more particularly a risk of myocardial infarction.

Methods for the genetic analysis of complex traits (phenotypes) are of different types (Lander et al., Science, 265 (1994) 2037-2048). In general, the biallelic polymorphisms according to the invention are useful in any of the methods described in the state of the art intended to demonstrate a statistically significant correlation between a genotype and a phenotype. Biallelic polymorphisms can be used in linkage analysis and allele sharing methods. Preferably, the biallelic polymorphisms according to the invention are used to identify genes associated with detectable characters (phenotypes) using association studies, an approach that does not require the use of families affected by the trait, and which also allows the identification of genes associated with complex and sporadic characters.

Other statistical methods implementing biallelic polymorphisms according to the invention are for example those described by Forsell et al. (Biol Psychiatry 42 (1997) 898-903) Xiong et al. (Ann J Hum Genet 64 (1999) 629-640), Horvath et al. (Am J Hum Genet 63 (1998) 1886-1897), Sham et al. (Ann Hum Genet 59 (1995) 323-336) or Nickerson et al. (Genomics, 12 (1992) 377-387). Preferably, biallelic polymorphisms are used to identify genes associated with a phenotype.

 According to a fourth aspect, the present invention relates to a method for detecting one of the polymorphisms described above in the nucleotide sequence of the ABCA1 gene of a subject.

<Desc / Clms Page number 56>

The method according to the invention consists in determining the nucleotide sequence of all or part of the ABCA1 gene in said subject at one of the polymorphic positions of the invention, and identifying the presence or absence of the SNP (single nucleotide polymorphism) at the position analyzed.

 Preferably, the detection method according to the invention consists in determining the presence of a G or an A at the polymorphic position 113 of exon 6, the presence of a G or an A at the position polymorph 196 of exon 15, the presence of a G or an A at the polymorphic position 136 of exon 16, the presence of an A or G at the polymorphic position 107 of exon 17 , the presence of a T or a C at the polymorphic position 27 of exon 17, the presence of a G or a T at the polymorphic position 4 of exon 18, the presence of a C or a T at the polymorphic position 123 of exon 22, the presence of a G or a C at the polymorphic position 54 of exon 23, the presence of a C or a T at the polymorphic position 62 of exon 34, the presence of a G or A at the polymorphic position 77 of exon 36.

 Even more preferably, the detection method according to the present invention consists in determining the nucleotide sequence of the ABCA1 gene at position 62 of exon 34 and the SNP corresponding to the presence of a C or a T.

 According to a first embodiment of the method of the invention, the presence of at least one of the previously described SNPs is identified by sequencing all or part of the ABCA1 gene of the subject at the polymorphic positions.

 Amplification and sequencing primers may be constructed to hybridize with a specific region of a sequence selected from the sequence group consisting of SEQ ID NO: 24-126 and SEQ ID NO: 137-158,

<Desc / Clms Page number 57>

ou de séquence complémentaire, et comprenant au moins une position polymorphe. De telles amorces de séquençage sont construites préférentiellement de manière à amplifier des fragments d'environ 250 à environ 500 nucléotides, comprenant au moins une des positions polymorphes selon l'invention.

or of complementary sequence, and comprising at least one polymorphic position. Such sequencing primers are preferably constructed so as to amplify fragments of about 250 to about 500 nucleotides, comprising at least one of the polymorphic positions according to the invention.

 The amplified fragments, for example by the PCR method, are then sequenced and the sequence obtained is compared with the reference sequences SEQ ID NO: 24-91 and 137 to 158 in order to determine if one or more deletions, additions or substitutions of nucleotides are found in the amplified sequence from the DNA contained in the biological sample from the tested subject.

 The method of the invention allows the amplification of a nucleic acid containing at least one of the polymorphisms of the invention, and comprising the steps of: a) contacting a sample, wherein the presence of the nucleic acid ABCA1 is suspected, with a pair of nucleotide primers whose hybridization position is located respectively on the 5 'side on one strand and the 3' side on the complementary strand of the region of the target nucleic acid whose amplification is sought, in the presence of the reagents necessary for the amplification reaction; and b) detecting the amplified nucleic acids.

 To implement the amplification method as defined above, it will be advantageous to use any of the nucleotide primers defined according to the criteria mentioned above.

<Desc / Clms Page number 58>

The invention thus relates, according to this first embodiment, to a method for detecting one of the polymorphisms according to the invention in the ABCA1 gene in a subject, comprising the following steps: a) sequencing, using biological material from the subject to be tested, of a nucleic acid fragment using at least one nucleotide primer hybridizing with the sequence chosen from the sequences SEQ ID NO: 24-91 or the sequences SEQ ID NO: 137-158 according to US Pat. invention; b) aligning the sequence obtained in a) with the sequence corresponding to the amplified sequence chosen from the sequences SEQ ID NO: 24-91 or the sequences SEQ ID NO: 137-158; c) determining the presence of a polymorphism in the sequence of the nucleic acid fragment relative to SEQ ID NO: 24-91 or SEQ ID NO: 137-158 reference sequences.

The method for detecting the presence of a polymorphism of the ABCA1 gene in a subject, also comprises the steps of: a) sequencing, from a biological material from the test subject, all or part of the ABCA1 gene, using a nucleotide primer hybridizing with the sequence chosen from SEQ ID NO: 24-91 or SEQ ID NO: 137-158; b) aligning the nucleotide sequence obtained in a) with a sequence selected from the group consisting of SEQ ID? 1 and 3-23; c) determining the nucleotide differences between the sequenced polynucleotide from the biological material of the test subject and the sequences SEQ ID NO: 1 and 3-23 reference.

<Desc / Clms Page number 59>

According to a second embodiment of the method according to the present invention, it uses the oligonucleotide probes as described above, which are capable of specifically hybridizing with a corresponding region of one of the sequences SEQ ID NO: 24-91 or with a corresponding region of one of the sequences SEQ ID NOS 137-158, and comprising at least one of the polymorphic bases according to the invention as described above, for the purpose of detecting the presence of one or more of the polymorphisms according to the invention in a sample from a subject.

 Preferably, the nucleotide probes consist of a nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NO: 24-126 and 137-158, the polymorphic base being located at center of the nucleotide fragment of 21 bases.

 Preferably the nucleotide probes according to this embodiment of the invention are immobilized on a solid support. Such solid supports are well known to those skilled in the art and include surfaces of microtitration plate wells covered with polystyrene beds, magnetic beds, nitrocellulose strips, or even microparticles such as latex particles.

Accordingly, the present invention also relates to a method for detecting the presence of a nucleic acid as described above in a sample, said method comprising the steps of:
1) contacting one or more nucleotide probes according to the invention with the sample to be tested;

<Desc / Clms Page number 60>

2) détecter le complexe éventuellement formé entre la ou les sondes et l'acide nucléique présent dans l'échantillon.

2) detecting the complex possibly formed between the probe or probes and the nucleic acid present in the sample.

 Preferably, the oligonucleotide probe (s) are immobilized on a support, and even more preferentially, the oligonucleotide probes comprise a detectable marker.

 According to a fifth aspect of the present invention, the methods for detecting polymorphisms described above are used to diagnose in a subject a predisposition to develop a certain pathology, after a combination study, or to predict the pharmacological response of a patient to a given molecule, after a pharmacogenetic study.

 More particularly, the methods make it possible to diagnose in a subject who has been detected as carrying a given allele at least one of the polymorphisms according to the invention, a pathological risk related to a deficiency of the ABCA1 transporter, or a null or unwanted response to a given therapeutic molecule.

 The methods of the invention are particularly useful for diagnosing the predisposition of an individual to present a coronary or cardiovascular risk, such as a risk of myocardial infarction, or atherosclerosis.

 The method according to the invention makes it possible to determine whether a subject presents a risk for the development of a pathology related to a deficit in the metabolism of cholesterol, especially in the reverse transport of cholesterol, a risk of developing a familial HDL deficiency. such as Tangier's disease or more generally cardiovascular disease or coronary heart disease, such as a risk of myocardial infarction or atherosclerosis.

<Desc / Clms Page number 61>

Such methods include detecting, in cells of a biological sample from the test subject, the presence or absence of a given allele of one of the polymorphisms according to the invention as described in Table 2. , in the sequence of the human ABCA1 gene of sequence SEQ ID NO: 3-22.

dans le tableau 3, dans la séquence régulatrice SEQ ID NO : 23 en amont du gène ABCA1 caractérisée par une altération dans l'expression d'un gène dont l'expression est régulée par le promoteur de ABCA1. The methods according to the invention also make it possible to detect in cells of a biological sample from the test subject, the presence or absence of a given allele of one of the polymorphisms according to the invention as described.

in Table 3, in the regulatory sequence SEQ ID NO: 23 upstream of the ABCA1 gene characterized by an alteration in the expression of a gene whose expression is regulated by the ABCA1 promoter.

The subject of the present invention is the method for diagnosing a pathology related to a deficiency of the ABCA1 transporter which consists in detecting in a subject the presence of a given allele of one of the polymorphisms of the invention according to one of the methods of previously described.

 Preferably, the method of the invention makes it possible to diagnose the predisposition of a subject to develop a cardiovascular disease such as a myocardial infarction.

 Even more preferably, the present invention relates to a method and a kit for diagnosing a risk of myocardial infarction or a risk of cardiovascular disease in a subject, comprising detecting in said subject, the presence a nucleic acid comprising a polynucleotide of sequence SEQ ID NO: 72 or 115, and comprising a polymorphic base A at position 62 of exon 34, or at position 5382 with respect to sequence SEQ ID NO: 15.

<Desc / Clms Page number 62>

The subject of the present invention is the method for diagnosing a pharmacological response linked to a variation of the ABCA1 transporter or its regulation which consists in detecting in a subject the presence of a given allele of at least one of the polymorphisms of the subject. invention according to one of the detection methods described above.

la séquence régulatrice en amont du gène ABCA1 de séquence SEQ ID NO : 23, de l'addition d'un ou plusieurs nucléotides ou encore de la délétion d'un ou plusieurs nucléotides dans lesdites séquences SEQ ID Nu 3-22 ou SEQ ID Nu 23. By way of illustration, such SNP polymorphisms may be detected in order to determine the existence of a substitution of a nucleotide in the sequence of a nucleic acid corresponding to the ABCA1 gene of sequence SEQ ID NO: 3-22 and / or in

the regulatory sequence upstream of the ABCA1 gene of sequence SEQ ID NO: 23, the addition of one or more nucleotides or the deletion of one or more nucleotides in said SEQ ID Nu 3-22 or SEQ ID NU sequences 23.

des séquences SEQ ID NO : 24-126 ou avec une région correspondante d'une des séquences SEQ ID N 137-158, comprenant au moins une des bases polymorphes selon l'invention telles que décrites précédemment, en vue de diagnostiquer chez un sujet une prédisposition au développement d'une pathologie liée à une déficience dans le transport inverse du cholestérol, tel que l'infarctus du myocarde, l'athérosclérose ou encore la maladie de Tangier, ou plus généralement une affection cardiovasculaire, ou de prédire la réponse pharmacologique d'un sujet à une molécule thérapeutique donnée. The present invention further relates to the use of oligonucleotide probes specifically hybridizing with a corresponding region of a

sequences SEQ ID NO: 24-126 or with a corresponding region of one of the sequences SEQ ID N 137-158, comprising at least one of the polymorphic bases according to the invention as described above, for the purpose of diagnosing in a subject a predisposition to the development of a pathology related to a deficiency in the reverse transport of cholesterol, such as myocardial infarction, atherosclerosis or Tangier's disease, or more generally a cardiovascular disease, or to predict the pharmacological response of a subject to a given therapeutic molecule.

 Diagnostic methods according to the present invention can advantageously be used to evaluate the efficacy of therapeutic products in the treatment of conditions related to an ABCA1 transporter deficiency.

<Desc / Clms Page number 63>

Subjects carrying an allelic polymorphism of the ABCA1 gene may present, for example, differences in the concentration of the various lipid variables that are commonly measured, such as the levels of HDL cholesterol, triglycerides, apolipoproteins AI and A-II, lipoprotein particles. AI and A-II, or differences in the regulation of the biosynthesis of the protein.

The differences observed due to the presence of an allelic variant in a subject may be modified when a particular therapeutic agent is administered to said subject. The methods according to the present invention may therefore be useful for determining the clinical effect of a therapeutic substance and determining the therapeutic doses to be administered.

 According to a last aspect, the subject of the present invention is a kit or kit for detecting the presence of one of the polymorphisms as described above, in the ABCA1 gene in a subject, said kit comprising: a) one or more hybridizing primers; with a region selected from SEQ ID NO: 24-126 or SEQ ID NO: 137-158; b) if necessary, the means necessary for carrying out an amplification reaction of at least one polymorphic position of the present invention.

 The subject of the invention is also a kit or kit for the detection of one of the polymorphisms of the present invention in the ABC1 gene, in a subject, comprising: a) one or more oligonucleotide probes as defined above;

<Desc / Clms Page number 64>

b) le cas échéant, les réactifs nécessaires à la réalisation d'une réaction d'hybridation.

b) where appropriate, the reagents necessary for carrying out a hybridization reaction.

 The nucleic acid fragments derived from any of the nucleotide sequences SEQ ID No. 24-126 comprising one of the polymorphisms of the invention are therefore useful for detecting the presence of at least one polymorphic allele of the ABCA1 gene in a sample.

 The probes according to the invention can also be used for the detection of PCR amplification products or for the detection of mismatches.

 Preferably, the kit or detection kit is characterized in that the probe or probes are immobilized on a support.

 According to a second embodiment, the kit or detection kit is characterized in that the oligonucleotide probes comprise a detectable marker.

 According to a particular embodiment of the detection kit described above, such a kit will comprise a plurality of oligonucleotide probes according to the invention that may be used to detect target sequences of interest or alternatively detect mutations in the coding regions. or the non-coding regions of the nucleic acids according to the invention, more particularly nucleic acids of SEQ ID NO 1 and 3-23 sequences or nucleic acids of complementary sequence.

 Thus, the probes according to the invention immobilized on a support can be ordered in matrices such as "DNA chips". Such ordered matrices

<Desc / Clms Page number 65>

ont été en particulier décrites dans le brevet US Nu 5, 143, 854, dans les demandes WO 90/15070 et WO 92/10092.

have been described in particular in US Pat. No. 5,143,854, in WO 90/15070 and WO 92/10092.

 Support matrices on which oligonucleotide probes have been immobilized at a high density are for example described in US Pat. Nos. 5,412,087 and PCT Application No. WO 95/11995. The nucleotide primers according to the invention may be used to amplify any of the nucleic acids according to the invention, and more particularly all or part of a nucleic acid of sequences SEQ ID Nos. 24-126 and 137-158.

d'un acide nucléique selon l'invention, et plus particulièrement tout ou partie d'un acide nucléique de séquences SEQ ID NO 1, et 3-23 ledit nécessaire ou. kit comprenant a) un couple d'amorces nucléotidiques conformes à l'invention, dont la position d'hybridation est localisée respectivement du côté 5'et du côté 3'de l'acide nucléique cible dont l'amplification est recherchée ; b) le cas échéant, les réactifs nécessaires à la réaction d'amplification. Un tel nécessaire ou kit d'amplification comprendra avantageusement au moins une paire d'amorces nucléotidiques telles que décrites ci-dessus. The invention further relates to a kit or kit for amplification

a nucleic acid according to the invention, and more particularly all or part of a nucleic acid of sequences SEQ ID NO 1, and 3-23 said necessary or. kit comprising a) a pair of nucleotide primers according to the invention, whose hybridization position is located respectively on the 5'and the 3'-side of the target nucleic acid whose amplification is sought; (b) where appropriate, the reagents necessary for the amplification reaction. Such a kit or amplification kit will advantageously comprise at least one pair of nucleotide primers as described above.

 The invention furthermore relates to a method for detecting the presence of a polymorphic ABCA1 protein in a sample, comprising the steps of a) contacting the sample with an antibody as previously described; and b) detecting the antigen / antibody complex formed.

 The present invention also relates to a diagnostic kit for detecting the presence of a polymorphic ABCA1 polypeptide in a sample, said kit comprising: a) an antibody as previously described; and b) a reagent for detecting the antigen / antibody complexes formed.

 The invention is further illustrated, without being limited, by the figures and examples below.

<Desc / Clms Page number 66>

FIG. 1 illustrates the sequence SEQ ID NO: 1 corresponding to the nucleotide sequence of the transcript of the human ABC 1 gene; Figure 2 illustrates the amino acid sequence SEQ ID NO: 2 corresponding to the peptide sequence of the transporter protein ABCA1; Figure 3 illustrates the regulatory sequence SEQ ID NO: 23 upstream of the human ABCA1 gene; the position of the different polymorphisms is indicated in bold.

EXAMPLE 1: IDENTIFICATION OF ABCA1 POLYMORPHISMS The detection of polymorphisms in the transcript sequences or in the genomic sequences of the ABCA1 gene can be carried out according to different protocols.

The method of choice is direct sequencing.

In the case of a transcript where the structure of the corresponding gene is unknown or partially known, it is necessary to precisely determine its intronexon structure as well as the genomic sequence of the corresponding gene. It is therefore firstly necessary to isolate the BAC clone (s) of genomic DNA corresponding to the transcript studied, to sequence the insert of the corresponding clone (s) and to determine the intron-exon structure by comparing the sequence of the cDNA to that of the genomic DNA obtained.

The direct sequencing polymorphism detection technique consists in comparing the genomic sequences of the ABCA1 gene obtained from at least 32 individuals from each tested population, Caucasian, African and Japanese. The sequence divergences are polymorphisms. All those modifying the amino acid sequence of the wild-type protein are mutations capable of affecting the function of said protein which is of interest to consider more particularly in the case / control association studies described in Example 2.

Primers for DNA amplification of individuals were designed from the non-repetitive sequences of intron DNA of the ABC1 gene, so that amplification of intron-exon junctions as well as essential bases for the

<Desc / Clms Page number 67>

 formation of the secondary structure during the RNA splicing step is included in the amplified fragments.

The genomic DNA of the individuals was amplified using the primers described above using the kit Qiagen's Star Taq &commat; (Qiagen, Valencia, CA) or the Supertaq kit) (Ambion, Austin, TX) using the hybridization conditions and amplification cycle conditions recommended by the manufacturer.

The amplified PCR products were purified using a kit marketed by Qiagen and sequenced by the Big Dye Terminator method on an ABI 3700 sequencer (Apllied Biosystems, Foster City, CA).

EXAMPLE 2: ANALYSIS OF ABCAI GENE POLYMORPHISMS The Myocardial Infarction Case-Control Study (ECTIM) is a study of patients suffering from myocardial infarction and control subjects from Northern Ireland, England and from France (all of the Caucasian type).

The study was carried out to identify a possible association of exon polymorphisms such as for example s-16elb, s-113e6, s-135e8, s-148el4, s-136el6, s-101el7, s-54e23, s- 7e30, s-62e34, s-833e49 and s-2034e49, with plasma levels of HDL cholesterol, Apo-1 and ApoA-II in controls and patients.

The genomic DNA of the individuals was amplified using the primers described above to specifically amplify the exon of interest and the corresponding intronexon junctions using, for example, the Qiagen's Star Taq kit (Qiagen, Valencia, CA). or the Supertaq kit (S) (Ambion, Austin, TX) under the hybridization conditions and the amplification cycle conditions recommended by the manufacturer. On these amplifiers, mini-sequencing reactions were performed for each of the selected polymorphisms. The genotype of each of the controls and patients could thus be determined for each of the polymorphisms.

testé par un test de X2 avec 1 df Les fréquences génotypiques et alléliques ont été comparées entre les groupes par tests de y, 2. Les différents paramètres phénotypiques ont été comparé entre les génotypes par analyse de variance ANOVA.This data was analyzed with the SAS software. The Hardy-Weinberg balance has been

tested by X2 test with 1 df Genotypic and allelic frequencies were compared between groups by tests of y, 2. The different phenotypic parameters were compared between genotypes by ANOVA analysis of variance.

Claims (38)

A nucleic acid comprising a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NOS 24-126 and 137-158, or a nucleic acid of complementary sequence.  2. Nucleic acid derived from a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID Nu 24-126 and 137-158, or a nucleic acid of complementary sequence.  A nucleic acid comprising at least 9 consecutive nucleotides of a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID Nu 24-126, or a nucleic acid of complementary sequence, and comprising a polymorphism selected from the group consisting of i) a A named s-m39i3, s-53e5,

 s-113e6, s-135e8, s-24il3, s-148el4, s-81il4, s-115i14, s-196el5, s-136el6, s-18il9, s-m65i22, s-149e24, s-44e27, s- 7e30, s-62e34, s-m74i34, s-77e36, s-2843e49, ii) a T named s-254, s-123e8, s-ml3i9, s-126el2, s-m59il3, s-4el8, s-40el9 , s-mlOil9, s-123e22, s-149i23, s-m50i23, s-166e30, s-ml42i32, s-m119i40, s-114e45, s-m34i45, s-833e49, s-1580e49, s-1791e49, s Embedded image, and s-2034e49, s-2449e49, iv) a C named s-76elb, s-27el7, s-60il7, s-54e23, sm26i32, s-55i36, s-64e38, s-252i39, s-m69i44, s-86i47 , s-377e49, v) a deletion named s-m41i9, and vi) an insertion named s-16elb, s-ml417, s-m61i9, s-ml30i32.  4. Nucleic acid comprising at least 9 consecutive nucleotides of a polynucleotide selected from the group consisting of SEQ ID nucleotide sequences

 NO: 137-158, or a nucleic acid of complementary sequence, and comprising, with respect to the promoter sequence of the ABCA1 gene SEQ ID NO: 23, a <Desc / Clms Page number 69>  polymorphism selected from the group consisting of i) A at positions 505, 1642, 2091, ii) T at positions 1093, 1499, 1677, 1795, 2330, 2592, 2880, iii) G in positions 1080, 1242, 1954 iv) a C at positions 1388.2487, 2616.2795, v) an insertion of GGAGGGGAGG at position 717, an AT insertion at position 1859, and vi) a deletion of TTTG at position 2117, a deletion of TTTGTTTGT at position 2121 , and a deletion of CACCC in position 2671.

 5. Nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of SEQ ID nucleotide sequences

 NO: 24-126 or a nucleic acid of complementary sequence, and comprising a polymorphism selected from the group consisting of i) an A named s-m39i3, s-53e5, s-113e6, s-135e8, s-24il3, s- 148el4, s-81il4, s-11514, s-196el5, s-136el6, s-18il9, s-m65i22, s-149e24, s-44e27, s-7e30, s-62e34, s-m74i34, s-77e36, s-2843e49, ii) a T designated s-254, s-123e8, s-ml3i9, s-126el2, s-m59il3, s-4el8, s-40el9, s-ml109, s-123e22, s-149i23, s -m50i23, s-166e30, s-ml42i32, s-ml 19i40, s-114e45, s-m34i45, s-833e49, s-1580e49, s-1791e49, s-2049e49, iii) a G-appointed s-35ela, s -108e6, sm89i8, s-ml04i9, s-m29il2, s-107el7, s-m68il7, s-98e24, s-30i31, s-251i39, s-13i47, s-2034e49, s-2449e49, iv) a named C s-76elb, s-27el7, s-60il7, s-54e23, ss26i32, s-55i36, s-64e38, s-252i39, s-m69i44, s-86i47, s-377e49, v) a deletion named s-m41i9 and vi) an insertion named s-16elb, s-ml417, s-m61i9, s-ml30i32.  6. Nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of SEQ ID nucleotide sequences

 NO: 137-158 or a nucleic acid of complementary sequence and comprising, with respect to the promoter sequence of the ABCA1 gene SEQ ID NO: 23, a polymorphism selected from the group consisting of i) an A at positions 505, 1642, 2091, ii) T in positions 1093, 1499, 1677, 1795, 2330, 2592, 2880, iii) a G in <Desc / Clms Page number 70>  positions 1080, 1242, 1954, iv) a C at positions 1388, 2487, 2616, 2795, v) an insertion of GGAGGGGAGG at position 717, an AT insertion at position 1859, and vi) a deletion of TTTG at position 2117, a deletion of TTTGTTTGT at position 2121, a deletion of CACCC at position 2671.

 7. A nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 24-126 or a nucleic acid of complementary sequence, and comprising a polymorphic base located at the center of the fragment of 21 nucleotides. and chosen in

 group consisting of i) an A named s-m39i3, s-53e5, s-113e6, s-135e8, s-24il3, s-148el4, s-81il4, s-115il4, s-196el5, s-136el6, s- 18il9, s-m65i22, s-149e24, s-44e27, s-7e30, s-62e34, s-m74i34, s-77e36, s-2843e49, ii) a T named s-25i4, s-123e8, s-ml3i9 , s-126el2, s-m59il3, s-4el8, s-40el9, s-m10119, s-123e22, s-149i23, s-m50123, s-166e30, s-ml42i32, s-ml 19i40, s-114e45, m-3445, s-833e49, s-1580e49, s-1791e49, s-2049e49, iii) a G-named s-35ela, s-108e6, s-m89i8, sml04i9, s-m29il2, s-107el7, s-m68il7 , s-98e24, s-1031, s-251i39, s-13i47, s-2034e49, s-2449e49, iv) a C named s-76elb, s-27el7, s-60il7, s-54e23, s-m26i32, (v) a deletion named sm41i9, and (vi) an insertion named s-16elb, s-ml147, s-m61i9, s -ml30i32.  8. Nucleic acid comprising at least 21 consecutive nucleotides of a polynucleotide selected from the group consisting of the nucleotide sequences SEQ ID NO: 137-158 or a nucleic acid of complementary sequence, and comprising a polymorphic base located at the center of said 21 nucleotide fragment and selected from the group consisting of i) an A at positions 505, 1642, 2091, ii) a T at positions 1093, 1499, 1677, 1795, 2330, 2592, 2880, iii) a G at positions 1080, 1242, 1954, iv) a C at positions 1388.2487, 2616.2795, v) an insertion of GGAGGGGAGG at position 717, an AT insertion at position 1859, vi) a deletion of TTTG in <Desc / Clms Page number 71> 9. Nucleic acid hybridizing under conditions of high stringency, with a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID No. 24-126 and 137-158, or a nucleic acid of complementary sequence.  position 2117, a deletion of TTTGTTTGT at position 2121, and a deletion of CACCC at position 2671, relative to the promoter sequence of ABCA1 gene SEQ ID NO: 23

 10. Nucleic acid encoding a polypeptide selected from the group consisting of peptide sequences SEQ ID NO: 127-136.  A nucleic acid comprising: a) a nucleic acid comprising a polynucleotide selected from the group consisting of nucleotide sequences SEQ ID NO: 137-158; and b) a polynucleotide encoding a polypeptide or nucleic acid of interest.  12. A polymorphic ABCA1 polypeptide, characterized in that it comprises a polypeptide chosen from the group of polypeptides of amino acid sequence SEQ ID NO: 127-136.  13. Probe or nucleotide primer specific for the ABCA1 gene comprising a nucleic acid according to any one of claims 3 to 9, or a nucleic acid of complementary sequence.  14. Probe or primer according to claim 13, useful for the detection of a polymorphism in the ABCA1 gene, of a length of at least 15 nucleotides.  Primer or primer nucleotide primer according to claim 13, useful for the detection of a polymorphism in the ABCA1 gene, of a length of at least 21 nucleotides. <Desc / Clms Page number 72>

 16. Nucleotide probe according to any one of claims 13 to 15, characterized in that it comprises a marker compound whose presence is detectable.  17. Nucleotide primer according to one of claims 13 to 15, the base of the 3 'end of said primer being complementary to the nucleotide immediately located on the 3' side of the polymorphic base of one of the sequences SEQ ID NO 24 -126 and 137-158 or their complementary sequences.  18. Nucleotide primer according to claim 17, the base of the 3 'end of said primer being complementary to a nucleotide located at 2.3, 4.5, 6.7, 8.9, 10, 11.12 , 13, 14, 15, 16, 17, 18, 19, 20 nucleotides or more on the 3 'side of the position of the polymorphism of one of the sequences SEQ ID Nos. 24-126 and 137-158 or their complementary sequences.  19. A genetic marker comprising a nucleic acid according to any one of claims 3 to 9, or a nucleic acid of complementary sequence.  The method for detecting a nucleic acid according to claim 1 or 2 in a sample, said method comprising the steps of: a) contacting the sample in which the presence of the target nucleic acid is suspected with a pair of nucleotide primers whose hybridization position is located respectively on the 5 'and on the 3' side of the target polymorphic position to be amplified of the nucleic acid according to claim 1 or 2 in the presence of the reagents necessary for the reaction amplification; and b) detecting the amplified nucleic acids.  21. The detection method according to claim 20, characterized in that the nucleotide primers are chosen from the primers according to one of claims 13 to 15, 17 or 18. <Desc / Clms Page number 73>

 22. Necessary for the detection of a nucleic acid according to claim 1 or 2 comprising: a) a pair of nucleotide primers whose hybridization position is located respectively on the 5 'and on the 3' side of the target polymorphic position to amplify nucleic acid claim 1 or 2; (b) where appropriate, the reagents necessary for the amplification reaction.  23. Necessary for the amplification of a nucleic acid according to claim 22, characterized in that the nucleotide primers are chosen from the group consisting of the primers according to one of claims 13 to 15, 17 or 18.  24. A method for detecting the presence of a polymorphism of the ABCA1 gene in a subject, said method comprising the steps of: a) sequencing, from a biological material from the test subject, any

 or part of the ABCA1 gene, using a nucleotide primer according to one of claims 13 to 15, 17 or 18; b) aligning the nucleotide sequence obtained in a) with a sequence selected from the group consisting of SEQ ID? 1 and 3-23; c) determining the nucleotide differences between the sequenced polynucleotide from the biological material of the test subject and the sequences SEQ ID NO: 1 and 3-23 reference.  Kit or kit for detecting the presence of a polymorphism of the ABCA1 gene in a subject, comprising a) one or more primers hybridizing with a region selected from the group consisting of

 SEQ ID NO: 24-126 sequences or SEQ ID NO: 137-158 sequences; and b) the means necessary for the sequencing of all or part of the nucleic acid corresponding to the ABCA1 gene at the polymorphic positions of the nucleic acid according to claim 1 or 2. <Desc / Clms Page number 74>  26. A method for detecting the presence of a polymorphism of the ABCA1 gene in a subject, said method comprising the steps of: a) contacting one or more nucleic probes according to one of claims 13 to 16 with the sample from the subject to be tested; b) detecting any complex formed between the probe (s) and the nucleic acid present in the sample.

 27. The detection method according to claim 26, characterized in that the probe or probes are immobilized on a support.  28. A kit for detecting the presence of a nucleic acid according to claim 1 or 2 in a sample, said kit comprising: a) one or more nucleotide probes according to any one of claims 13 to 16; b) if necessary, the reagents necessary for the hybridization reaction.  29. Detection kit according to claim 28, characterized in that the probe or probes are immobilized on a support.  30. A method of diagnosing a risk of myocardial infarction in a subject, comprising detecting by a method according to one of claims 24, 26 or 27, the presence in said subject of a nucleic acid comprising a polynucleotide of

 sequence SEQ ID NO: 72 or 115, and comprising a polymorphic base A at position 5382 with respect to the sequence SEQ ID NO: 15.  31. A method for diagnosing a risk of cardiovascular disease in a subject, comprising detecting by a method according to one of claims 24, 26 or 27, the presence in said subject of a nucleic acid comprising a sequence polynucleotide. SEQ ID NO: 72 or 115, and comprising a polymorphic base A at position 5382 with respect to the sequence SEQ ID NO: 15. <Desc / Clms Page number 75>

32. A cloning and / or recombinant expression vector comprising a nucleic acid according to one of claims 1 to 11.  33. The nucleic acid transformed host cell according to one of claims 1 to 11 or a recombinant vector according to claim 32.  34. Transgenic non-human mammal whose somatic cells and / or germinal cells have been transformed with a nucleic acid according to claim 1 to 11 or with a recombinant vector according to claim 32.  An antibody directed against a polymorphic ABCA1 polypeptide according to claim 12, or a peptide fragment thereof.  36. An antibody according to claim 35, characterized in that it comprises a detectable compound.  37. A method for detecting the presence of a polymorphic ABCA1 protein according to claim 12 in a sample, comprising the steps of: a) contacting the sample with an antibody according to one of claims 35 or 36; b) detection of the antigen / antibody complex formed.  A diagnostic kit for detecting the presence of a polypeptide according to claim 12 in a sample, said kit comprising: a) an antibody according to one of claims 35 or 36; b) a reagent for detecting the antigen / antibody complexes formed.